Bone 44 (2009) 102–112

Contents lists available at ScienceDirect

Bone

j ourna l homepage: www.e lsev ie r.com/ locate /bone

Potential use of an estrogen–glucocorticoid receptor chimera as a drug screen fortissue selective estrogenic activity

Benit S. Maru a, Jonathan H. Tobias b,⁎, Caroline Rivers a, Christopher J. Caunt a,Michael R. Norman a, Craig A. McArdle a

a Laboratory for Integrated Neurosciences and Endocrinology, University of Bristol, UKb Academic Rheumatology, University of Bristol, Avon Orthopaedic Centre, Southmead Hospital, Bristol BS10 5NB, UK

⁎ Corresponding author. Fax: +44 117 959 5936.E-mail address: Jon.Tobias@bristol.ac.uk (J.H. Tobias)

8756-3282/$ – see front matter © 2008 Elsevier Inc. Aldoi:10.1016/j.bone.2008.09.016

a b s t r a c t

a r t i c l e i n f o

Article history:

SERMs act as ER agonists in Received 9 July 2008Revised 24 September 2008Accepted 29 September 2008Available online 11 October 2008

Edited by: J. Aubin

Keywords:SERMsEstrogen receptor alphaOsteoblastsEstradiolReporter assay

bone despite their antagonistic properties in other tissues. As well as inhibitingbone remodelling, this effect may involve stimulation of osteoblast activity, in light of evidence from recentin vivo studies. However, progress in exploring this action has been hampered by a lack of accurate in vitromodels. For example, ER antagonists are reported to stimulate reporter assays based on estrogen target genesin osteoblasts, contrary to their inhibitory effects in vivo. We examined whether evaluating global aspects ofER function provides a more accurate reflection of ER activation in osteoblasts, based on the use ofmorphological and/or transcriptional read-outs with green fluorescent protein (GFP)-receptor chimeras.Osteoblast-like (ROS and U2OS) and breast cancer (MCF7) cells were transfected with a human ERα–GFPfusion protein, and treated with ER agonists (17β-estradiol, and dienestrol), antagonists (ICI 182,780 and ZK164015) and SERMs (tamoxifen, raloxifene, 4-hydroxytamoxifen (4-HT) and hexestrol). We investigatedcellular compartmentalisation of these constructs by fluorescence microscopy, nuclear mobility byfluorescence recovery after photobleaching (FRAP), and global activation of estrogenic transcription usinga ERE-luc reporter. SERMs caused a modest increase in ERE-luc activity in osteoblast-like cells (but not inbreast cells), and a reduction in nuclear mobility in breast (but not osteoblast-like) cells. These studies werethen repeated using a GFP chimera where the human GR ligand binding domain (LBD) was replaced by thehuman ERα LBD (ERGR–GFP), combined with a GRE-luc reporter. Interestingly, SERMs increased bothcytoplasmic to nuclear translocation of ERGR–GFP, and GRE-luc reporter activity, in osteoblast-like (but notbreast) cells. Indeed, transcriptional responses to SERMs in osteoblast-like cells were considerably greaterwith the ERGR/GRE-luc than the ERα/ERE-luc system, 4-HT inducing 300 and 25% increases in reporteractivity respectively. ER antagonists were entirely without effect. We conclude that evaluation of globalestrogenic activity, as opposed to activation of a specific target gene, provides a more accurate read-out forosteoblast stimulation. In particular, ERGR-mediated GRE-luc activity provides a high signal response toestrogen agonists and SERMs, in a cell context dependent manner closely resembling that observed in vivo.Further studies utilising this system are justified to explore the mechanistic basis for estrogenic stimulationof osteoblast activity, and to identify newer SERMs capable of targeting this activity.

© 2008 Elsevier Inc. All rights reserved.

Introduction

As well as suppression of osteoclastic bone resorption, in vitro and invivo studies suggest beneficial effects of SERMs on bone involvestimulation of osteoblastic bone formation [1–3]. Although clinicalevidence for a positive effect of SERMs on bone formation is currentlylacking, such a mode of action seems likely given that several clinicalstudies suggest that estrogen directly stimulates osteoblast activity inhumans [4]. To provide a basis for exploring the mechanism of action ofSERM-dependent stimulation in osteoblasts, and for screening newermore effective compounds, we previously examined whether reporters

.

l rights reserved.

based on osteoblast-regulatory genes such as bone morphogeneticprotein (BMP)-6 can beused to evaluate preferential responses to SERMsin osteoblasts. We found that SERMs, but not 17β-estradiol (E2),stimulated BMP-6 reporter activity in ROS (osteosarcoma) cellstransiently transfected with ERα, whereas no stimulationwas observedinMCF7 (breast cancer) cells [5]. Similar findings have been reported forother putative osteoblast target genes such as BMP-4, TGFβ3 and Cbfa1[5–8]. However, the physiological relevance of these reporters can bebrought into question, as they also appear to be activated by anti-estrogens such as ICI 182,780 [5–8], which we previously foundproduces a pronounced inhibitory effect on bone formation in vivo [9].

It has been suggested that binding of SERMs to ERs induces (orstabilises) receptor conformations that differ from those induced bynative ligands such as E2, facilitating interactions with different co-

103B.S. Maru et al. / Bone 44 (2009) 102–112

regulatory proteins [10]. Hence, variation between cells in the relativeexpression of different steroid co-activators and co-repressors maycontribute to the cell context-dependent activity of SERMs [11]. Thishypothesis implies that in cells such as osteoblasts where SERMs act asER agonists, this activity profile applies to all ER target genes, ratherthan a specific subset. Therefore, a global read-out of ER activationmay prove more accurate in analysing SERM-dependent activation ofosteoblasts, as compared with reporter assays based on specific targetgenes. For example, our study described above suggests that tissuedifferences in cellular compartmentalisation may also contribute tothe tissue selectivity of SERM action in osteoblasts, since an ERα–GFPchimeric receptor appeared to be expressed at higher levels in thecytoplasm of un-stimulated ROS compared with MCF7 cells [5].Alternatively, SERM-dependent osteoblast stimulation may involveeffects on ERα nuclear mobility. For example, both E2 and tamoxifenwere found to re-distribute a ERα–GFP chimeric protein within thenucleus of HeLa cells, leading to a more punctate distribution, and toreduce mobility within the nucleus as assessed by fluorescencerecovery after photobleaching (FRAP) [12].

Ideally, a cell-based bioassay for SERMs would provide a rapid,reproducible and robust read-out that mimics effects seen in vivo,namely stimulation by ERα agonists and no stimulation by pureantagonists in any cell type, as well as stimulation by known SERMs inbone cells but not in breast cells. However, we know of no publishedmodel that meets these criteria. Here, we evaluated a variety ofresponses to SERMs, ER agonists and antagonists in different celltypes, in order to identify a SERM response which reproduced that toestrogen in bone but not breast-derived cells. In particular, as well asusing standard approaches in which reporter constructs were used toevaluate activation of gene transcription, we examined whetherquantification of ER intracellular compartmentalisation or nuclearmobility using ERα–GFP chimeras as described above can provide amore accurate read-out of cell-context-dependent SERM effects.

To overcome the limitation that ER is primarily nuclear even in un-stimulated cells, we also tested for possible effects of ER agonists,antagonists and SERMs on cellular compartmentalisation of afluorescently tagged chimera between the glucocorticoid receptor(GR) and ER. Except that both ER and GR sequences were derived fromhuman cDNA, the construct utilised in the present studywas similar tothat described byMartinez et al. [14], which consisted of a rat GR withthe ligand binding domain (LBD) replaced by the equivalent human ERsequence. The chimera retains helix 1 of the GR LBD, and is known tobind HSP90 which is important for retention of the un-stimulated GRin the cytoplasm [13]. Hence, unlike the constitutively nuclear ER, theERGR chimera is cytoplasmic when expressed (in NIH/3T3-derivedcells) in the absence of hormone, but translocates to the nucleus inresponse to E2 [13].

Materials and methods

Chemicals

E2, dienestrol, hexestrol, tamoxifen, 4-hydroxytamoxifen (4-HT),Dexamethasone (Dex) epidermal growth factor (EGF) and phorbol12,13-dibutyrate (PDBu) were purchased from Sigma (Poole, Dorset,UK), ICI 182,780 (ICI) and ZK-164015 from Tocris (Bristol, Avon, UK)and raloxifene from Eli Lilly (Basingstoke, Hampshire, UK).

Cell culture

Human breast cancer cells (MCF7) and human osteosarcoma(U2OS) derived cells were obtained from the European Collection ofCell Cultures (Salisbury, UK). Rat osteosarcoma 17/2.8 (ROS) cells werekindly provided by L Lanyon, Royal Veterinary College, London. Cellswere maintained in DMEM supplemented with 10% foetal calf serum,L-Glutamine (2 mM), penicillin (50 IU/ml) and streptomycin (50 mg/

ml) under a humidified atmosphere of 5% CO2 in air at 37 °C, asdescribed previously [5]. The cells were subcultured twice weekly byremoving the conditioned medium, washing with 2 ml TE (0.25%trypsin, 0.03% EDTA in phosphate-buffered saline, PBS), and incuba-ting for 5 min with a further 2 ml TE, until the cells detached. 3 mlfresh culture medium was then added and pipetted up and down tobreak any clumps. This was then dispensed into a new T75 tissueculture flask at of ratio of 1:5–1:10, depending on cell type. Cellscultured for experiments were maintained in phenol red-free andserum-free medium (SFM) with BSA (100 μg/ml) and apo-transferrin(10 μg/ml).

Generation of ERGR–GFP

We generated a fluorescently tagged chimera between the GR andER as a reporter to be used in cell imaging. The pcDNA3 ERαGR-GFPvector encodes a receptor containing the N-terminus, DNA bindingdomain and hinge regions of the hGR upstream of a hybrid LBD. Thishybrid LBD is made of the hGR helix 1 and partial loop 1–3 sequenceslinked (via tcacgaggt) to the hERα LBD sequences, which start with theC-terminus loop 1–3. This construct retains helix 1 of the GR LBD(which binds HSP90 and is important for retention of the un-stimulated GR in the cytoplasm) and is similar to that previouslydescribed [14] except that we have used the human ERα LBD. Thegeneration of the pcDNA3EGFP-ERαGR commenced with the poly-merase chain reaction (PCR) of primers (5′) gcatcatcgataaaattcgaag (3′)(primer 1), which includes a Cla 1 site and (5′) ggctc-acctcgtga-aacagagctatcatatcctg (3′) (primer 2). Primer 2 contained the linker sitetoo, which was to aid with the annealing of the sequence during thefinal PCR [14]. The template for this PCR was the pcDNA3-EGFP-GRαplasmid, creating PCR product 1 (PCR1). The template contains theregion of the DNA sequence to be amplified and the primersdetermined the beginning of and the end of the sequence to beamplified. The second PCR was for primers (5′) tct-tcacgaggt-gagccccccatactctattccg (3′) (primer 3) and (5′) catgca-ctcgag-tca-gaccgtggcagggaaac (3′) (primer 4) which included an Xho 1 site tail.Primer 3 contained the linker sequence, allowing for the annealing ofthe hERα sequence to the hGR sequence. The template for the secondPCR was the EGFP-ERα plasmid creating PCR product 2 (PCR2)

Following the initial two PCRs the first two products were thenpurified using the QIAquick PCR purification kit (Qiagen). The final PCRused primer 1 and 4 and PCR1 and PCR2 were used as the templates.The final product, which was 1117 bp, was then purified using theQIAquick PCR purification kit (Qiagen). The PCR products and thepcDNA3-EGFP-GRα were then digested with Cla 1 and Xho 1. Cla 1(AT/CGAT) restricts the pcDNA3 EGFP vector at 3029 bp and Xho 1(C/TCGAG) restricts the vector at 3970 bp. The size of the restricted PCRproduct was 1103 bp and the cut vector was 7504 bp (having had941 bp restricted). The restricted PCR product and vector were thenrun on a gel and the bands purified using QiaQuick Gel extraction kit(Qiagen). The Cla 1 and Xho 1 fragment from the PCR product was thensubcloned in frame downstream of the CMV promoter into thecorresponding digest of the pcDNA3-EGFP-GR (Invitrogen).

One Shot® TOP10 Chemically Competent E. coli cells (InvitrogenLife Technologies) were transformed by adding 1.5 μl plasmid DNA to15 μl of chemically competent cells. Clones were selected by plating20 μl of the cell suspension on LB agar plates containing 50 μg/mlampicillin. Discrete colonies were selected and used to inoculate 5 mlLB broth containing ampicillin at 37 °C overnight in an orbitalincubator. Plasmid DNAwas isolated using a QIAprep SpinMinprep Kitfollowing manufacturer's instructions (Qiagen). The DNA concentra-tion was determined by measuring the absorbance, of 1/100 dilution(in TE), at 260 nm in a Gene Quant II RNA/DNA calculator (PharmaciaBiotech) using TE as a blank. Large-scale plasmid DNA cultures wereextracted using the Qiagen HiSpeed Plasmid Maxi Kit, according tomanufacturer's instructions (Qiagen).

Fig. 1. Effects of ligands on ERE-Luc activity in MCF7 and ROS cells. MCF7 (A) and ROS (B) cells were cultured in serum-free and phenol red-free DMEM and co-transfected withpCDNA3.1 encoding the ERE-Luc (500 ng/well) and β-Gal (200 ng/well) reporters. The cells were then incubated for 48 hwith the indicated ligands at 10−8 M (left panels), or with theindicated concentrations of E2, 4-HT and ICI (right panels), before processing for measurement of luciferase and β-Gal activity. The data shown are luciferase activity normalised toβ-Gal activity and are the mean±SEM from 6 independent experiments, each with quadruplicate observations (n=6). EC50 (or IC50) values were 1.6×10−10 M, 4.3×10−10 M and5.1×10−11M for E2, 4-HTand ICI (respectively) inMCF7 cells (C), and 1.6×10−10M, 4.5×10−11M,1.9×10−11M for E2, 4-HTand ICI (respectively) in ROS cells (D). OnewayANOVA revealedthe treatments were statistically significant (Pb0.05) and post hoc (Dunnett's) tests revealed statistically significant differences to control values at ⁎Pb0.05, ⁎⁎Pb0.01, ⁎⁎⁎Pb0.001.

104 B.S. Maru et al. / Bone 44 (2009) 102–112

Plasmid DNA was digested in reaction mixtures containing 2.5 μlDNA, 0.25 μl restriction enzymes (BamH1 and Xba 1), 2 μl of theappropriate buffer and distilled water in a final volume of 20 μl. Thedigest was allowed to proceed for 2–3 h at 37 °C before addition of 4 μlDNA loading buffer. Samples were loaded onto a 1% agarose gelcontaining a 1:20,000 dilution of ethidium bromide, which was thensubjected to electrophoresis in 1× TAE buffer. The DNA was viewedunder ultraviolet light using a High Performance UV Transilluminatorand images were captured using LabWorks™ Image Acquisition andAnalysis Software (both from BioImaging Systems, Ultra-Violet Pro-ducts Ltd., Cambridge, UK). BamH1 restricts the vector to givefragments at 723 and 7875 bp; and Xba 1 restricts the vector to givefragments at 667 and 7931 bp. After restriction analysis the vector wassequenced and the sequencewas checkedusingChromas 2.31 software.

Reporter activity assessment

Cells were plated in 96 well plates (5×103 cells/well) and allowedto attach for 24 h before transfectionwith Superfect. The cells were co-transfected with vectors encoding ERE-Luc (500 ng/1well) hERα(500 ng/well) and β-gal (200 ng/well) or were transfected with500 ng/well GRE-luc, 500 ng/well ERGR–GFP and 200 ng/well β-gal.This was added to serum free DMEM making up a total of 30 μl. Thiswas thenmixed with 2.5 μl Superfect and allowed to complex for 10 to15 min. After this 150 μl of serumwith mediumwas added and 150 μlof this mix was then added to each well. After 2–3 h the wells wereaspirated andwashedwith PBS. 200 μl serum free and phenol red-free

DMEM, supplemented with BSA (100 μg/ml) and apo-transferrin(10 μg/ml), (serum-free medium, SFM) was added and left to incubatefor 48 h at 37 °C with 5% CO2 in air. The cells were then stimulated for24 or 48 h with test compounds as described in the figure legendsbefore being washed in PBS and lysed by freezing and thawing inreporter assay lysis buffer. 50 μl cell lysate from each well wastransferred to a 96-well luminometer plate (Thermo Labsystems,Altrincham, Cheshire, UK). Luciferase activity was assessed by additionof 100 μl/well luciferin substrate mixture and measurement ofluminescence using an MLX Microtitre Plate Luminometer (DYNEXTechnologies, Chantilly, VA, USA). β-Gal activity was assessed bytransferring 30 μl cell lysate to a 96-well clear flat-bottomedmicrotitreplate (Nalge Nunc International, Rochester, NY) and adding 170 μlchlorophenol red-β-D-galactopyranoside substrate mixture. Plateswere incubated at 37 °C to allow a colour change of the substratefrom yellow to orange. Optical density was then assessed using a96-well microtitre plate reader with a 575 nm filter.

Confocal fluorescence microscopy

Cells were plated (7×104 cell/well) on glass coverslips in 12 wellplates (Linbro, OH, USA) and transfected with 2 μg/well ERGR–GFP orERα–GFP which was added to serum free (non-supplemented serumfree DMEM) DMEM making up a total of 50 μl. This was then mixedwith 7.5 μl Superfect and allowed to complex for 10 to 15 min. Afterthis 400 μl of serum with media was added to each well. After 2–3 hthe wells were aspirated and washed with phosphate-buffered saline.

Fig. 2. ERα–GFP mobility in ROS and MCF-7 cells. MCF7 (A) and ROS (B) cells were cultured in serum-free and phenol red-free DMEM and transfected with pCDNA3.1 encodingERα–GFP (2 μg/well). The cells were then incubated for 48 h with the indicated ligands at 10−8 M, before FRAP. The data shown are mean fluorescence intensity measured in a regionof interest within the nucleus immediately before and for 85 s after photobleaching. Fluorescence in this region was normalised, setting the intensity before bleaching at 100% andimmediately after photobleaching at 0%. The data shown are mean±SEM from 6–9 independent experiments each with at least quadruplicate observations (n=6–9). For the MCF7data two way ANOVAs revealed each of the treatment effects to be statistically significant (Pb0.01) and post hoc (Bonferroni) tests revealed significant differences betweencontrol and treatment values. For the ROS data, two way ANOVAs and post hoc tests revealed statistically significant effects (Pb0.05) only for the ICI treatment. The images show theERα–GFP immediately after bleaching (top panels) and following 85-second recovery (lower panels) and the scale bars are approximately 10 μm.

105B.S. Maru et al. / Bone 44 (2009) 102–112

500 μl SFM was added and the cells were left to incubate for 48 h at37 °C with 5% CO2 in air before treatment with test compounds.Following the treatments noted in figure legends images of cells wereacquired for calculating cytoplasmic localisation or for fluorescencerecovery after photobleaching. Cells were observed using a confocallaser-scanning microscope (Leica, Milton Keynes, Bucks, UK) with a543 nm filter (Green HeNe laser) and 488 nm filter (65 mW Ar laser)with a ×63 oil immersion lens. Analysis of the ERα–GFP localisationwas performed using Leica Confocal software to calculate integratedfluorescence intensities which enabled the calculation of the amountof ERα–GFP in the cytoplasm, as a % of the amount in the whole cell(cytoplasmic fluorescence %). FRAP was performed by selecting aregion of interest (ROI) within the nucleus and bleaching the ROI for30 s by increasing the 488 and 476 nm lasers to 100% and subsequentrecovery of fluorescence (as GFP-ERα migrated into the ROI) wasquantified over 85 s.

Semi-automated wide-field fluorescence microscopy and image analysis

Cells were transfected with 500 ng/well ERGR–GFP and plated asdescribed above on Costar plain black-wall 96 well plates (Corning,Arlington, UK) prior to treatment as noted in figure legends. Cells werethen washed in ice cold PBS before fixation in 4% paraformaldehyde/PBS and permeabilisation in −20 °C methanol. Nuclei were stainedusing a 10 μg/ml solution of 4′6-diamidino-2-phenylindole (DAPI,Sigma). Image acquisition in each well was performed on an In CellAnalyser 1000 (GE Healthcare) microscope, using a ×10 objective and

360 nm (DAPI) and 475 nm (GFP) excitation filters, and monitoredthrough 460 nm and 535 nm emission filters, respectively, with a61002 trichroic mirror (GE Healthcare). Analysis of ERGR–GFPlocalisation was performed using the Dual Area Objective Analysisalgorithm in the In Cell Analyser Workstation (GE Healthcare) withimages collected from the 460 nm and 535 nm emission filters todefine nuclear and cytoplasmic regions respectively. Non-transfectedcells were excluded by applying a filter to exclude cells inwhichwholecell GFP fluorescence was b10% above background. Imaging data arereported as a ratio of nuclear to cytoplasmic stain intensity (N/C ratio).

Statistical analysis

The figures show means and SEMs of data pooled from at least 3separate experiments. Statistical analysis was by one or two wayANOVA and post hoc (Dunnett's) tests accepting Pb0.05 as statisticallysignificant. EC50 and IC50 values were calculated by fitting data tosigmoid curves using Graphpad Prism (Graphpad Software Inc., LaJolla, CA).

Results

ERE reporter studies

To compare general activation of estrogenic response pathways bySERMs, ER agonists and antagonists in different cell types, first, weevaluated transcriptional activity of a classical estrogen-response

Fig. 3. Effects of ligands on ERα–GFP mobility and distribution. MCF7 (A and C) and ROS (B and D) cells were cultured in serum-free and phenol red-free DMEM, transfected withpCDNA3.1 encoding ERα–GFP (2 μg/well) and then incubated for 48 h with the indicated ligands at 10−8 M. Live cell imaging was then used to determine ERα–GFPmobility (A and B)and localisation (C and D). Mobility was assessed by FRAP (as described under Fig. 2). 85-second recovery profiles were fitted to a one-phase exponential association curve in order tocalculate the Ymax (maximal fluorescence after recovery, as a proportion of fluorescence before bleaching). These values were then used as measures of the proportion of ERα–GFPthat is mobile and this is shown as ERα–GFP mobility (%). To determine ERα–GFP compartmentalisation, integrated fluorescence intensities were used to calculate the amount ofERα–GFP in the cytoplasm, as a % of the amount in the whole cell. The data shown are mean±SEM from 6–9 independent experiments each with at least quadruplicate observations(n=6–9). One way ANOVA revealed the treatments were statistically significant (Pb0.05) and post hoc (Dunnett's) tests revealed statistically significant differences to control valuesat ⁎Pb0.05, ⁎⁎Pb0.01, ⁎⁎⁎Pb0.001.

106 B.S. Maru et al. / Bone 44 (2009) 102–112

element-luciferase reporter (ERE-luc, containing 3 adjacent consensusEREs). As expected, in MCF7 human breast cancer cell lines transientlytransfected with human ERα, ER agonists (E2 and dienestrol)stimulated reporter activity, whereas activity was suppressed bothby SERMs (hexestrol, 4-HT, raloxifene and tamoxifen) and ERantagonists (ICI 182,780 and ZK-164015) (Fig. 1A). ER agonists andantagonists exerted similar effects in ROS cells transiently transfectedwith ERα to those seen in MCF7 cells, whereas inhibition bySERMs was replaced by minor stimulation in ROS cells (Fig. 1B).Dose–response curves revealed similar potencies of E2, 4-HT and ICI182,780 in MCF7 and ROS cells (Figs. 1C and 1D). In the absence ofexogenous ERα, E2 and ICI 182,780 respectively stimulated andinhibited ERE-luc activity in both cell lines, but the response wasconsiderably smaller (results not shown).

ERα–GFP chimera studies

An ERα–GFP chimerawas then generated and used in FRAP studiesto compare effects of SERMs, ER agonists and antagonists on receptormobility in MCF7 and ROS cells (Fig. 2). As expected, when a region ofthe nucleus was exposed to the full power of the confocal laser beamthe GFP within the excited region was rapidly bleached (fluorescence

reduced by N90%within 30 ss). This was followed by a recovery periodin which fluorescence (within the bleached region) increased asERα–GFP migrated into the bleached region. In control MCF7 and ROScells, the fluorescence increased (half-time of approximately 20 s),attaining 30–40% of the pre-bleach value within 85 s, providing ameasure of the proportion of receptors that are mobile in the absenceof exogenous ligand. In MCF7 cells, pre-treatment for 48 h with ICI182,780 almost completely prevented fluorescence recovery and theSERM 4-HT reduced recovery to 12±0.2% whereas E2 increasedrecovery to 41.2±0.5% (from 32.8±0.5% in control cells) (mean±SEM).In contrast, E2 and 4-HT had no measurable effect on recovery in ROScells and although ICI 182,780 reduced recovery (from 38.3±0.4% to20.0±0.5%) it did not cause the pronounced reduction inmobility seenin MCF7 cells.

The same protocol was employed to compare effects of otherligands on nuclear receptor mobility. In these experiments therecovery data were fitted to one-phase exponential association curvesin order to estimate the plateau value (Ymax, maximal fluorescenceafter recover, as a % of fluorescence before bleaching) as a measure ofthe proportion of ERα–GFP that is mobile. In MCF7 cells, ERα–GFPmobility was increased by E2, reduced by SERMs and further reducedby ER antagonists (Fig. 3A). In contrast, agonists and SERMs had no

Fig. 4. Cellular localisation of ERGR–GFP Figs. A–H show representative confocal microscopy images of live MCF7 and ROS cells that had been cultured on glass coverslips, transfectedwith pcDNA3 ERGR–GFP (2 μg/well) and incubated for 48 hwith the indicated ligands at 10−8 M (scale bars 10 μm). Panels I–L illustrate the quantification of ERGR–GFP localisation inlarger cell numbers by means of semi-automated wide-field fluorescence microscopy and image analysis in 96 well culture plates. For most experiments 3 fields of view were takenwith treatments in quadruplicate wells. In this way for each cell and treatment type, images were captured for a total growth area of over 5 mm2 and this typically contained over1000 cells in each experiment. Panels I and J show DAPI and ERGR–GFP images respectively (for approximately 50% of a single representative field of view). The Dual Area ObjectiveAnalysis algorithm in the In Cell Analyser Workstation (GE Healthcare) was then used to segment the images (e.g. to define the nuclear perimeter from the DAPI stain and the cellperimeter from the GFP fluorescence). Panel K illustrates the segmentation with nuclei shown by light blue or mauve lines, and cell perimeters shown by red or green lines. It alsoshows the filtering process, with ERGR–GFP expressing cells having green perimeters and ERGR–GFP negative cells having red perimeters. Transfection efficiency was typically5–20%. Figure L shows a greater magnification of the area in the box of panel K and illustrates the fact that, in these E2-treated cells the ERGR–GFP reporter is clearly concentrated inthe nucleus.

107B.S. Maru et al. / Bone 44 (2009) 102–112

measurable effect on ERα–GFP mobility in ROS cells and although ERantagonists reduced receptor mobility, their effects were less markedthan in MCF7 cells (Fig. 3B). Thus, there is a clear distinction betweeneffects of SERMs on ERα–GFP mobility (reduction in MCF7 cells andlack of effect in ROS cells, Fig. 3), just as in their effect ontranscriptional activity (inhibition in MCF7 cells and mild stimulationin ROS cells, Fig. 1).

To quantify possible effects of different ER ligands on intracellularcompartmentalisation, cytoplasmic fluorescence as a proportion oftotal cytoplasmic and nuclear fluorescencewas calculated. None of thetreatments measurably altered whole cell ERα–GFP levels in eithercell type (not shown). The ER agonists both reduced the proportion ofERα–GFP in the cytoplasm in both cell types, and this was alsoreduced by all SERMs in ROS cells and by raloxifene in MCF7 cells. Incontrast the proportion of ERα–GFP in the cytoplasmwas increased byboth antagonists in ROS cells and by ZK-164015 in MCF7 cells (Figs. 3Cand 3D).

ERGR–GFP chimera studies

Using our ERα–GFP chimera, little difference was observed ineffects of SERMs on nuclear compartmentalisation in MCF7 and ROScells and this may reflect the fact that ER is largely confined to thenucleus in both cell types, even in the absence of ligand. To overcomethis limitation, we generated an ERGR–GFP chimera in which thehuman GR ligand binding domain was replaced with equivalentsequences from human ERα. Confocal microscopy confirmedthat ERGR–GFP was distributed throughout the cytoplasm of un-stimulated MCF7 and ROS cells, while exposure to E2 increasedthe proportion in the nucleus, whereas Dex had no such effect(Figs. 4A–H). In addition, 4-HT increased nuclear ERGR–GFP in ROS butnot MCF7 cells. In order to quantify these effects in larger cellnumbers, we used a wide-field microscope based system for semi-automated image acquisition and analysis (In Cell 1000). Automatedimage segmentation was used to define nuclear and cytoplasmic

Fig. 5. Effects of ligands on cellular localisation of ERGR–GFP in MCF7, ROS and U2OScells. MCF7 (A), ROS (B) and U2OS (C) cells were cultured in serum-free and phenol red-free DMEM and transfected with pCDNA3.1 encoding ERGR–GFP (500 ng/well). Theywere then incubated for 16 h in control serum-free media or in serum-free media withindicated ligand (10−8 M). Semi-automated wide field fluorescence microscopy andimaging were then used to quantify integrated fluorescence values of ERGR–GFP withinthe nucleus and cytoplasm (as above) and these values were used to calculate thenucler:cytoplasmic (N/C) ERGR–GFP ratio. The data shown are the mean±SEM from 5independent experiments showing the N/C ratio normalised to the values in controlcells (n=5). One way ANOVA revealed the treatments were statistically significant(Pb0.05) and post hoc (Dunnett's) tests revealed statistically significant differences tocontrol values at ⁎Pb0.05, ⁎⁎Pb0.01, ⁎⁎⁎Pb0.001.

108 B.S. Maru et al. / Bone 44 (2009) 102–112

regions and to determine the ratio of nuclear to cytoplasmic ERGR–GFP fluorescence (Figs. 4I–L).

In subsequent studies using a range of ligands with the In Cell 1000analysis system, ER agonists were found to increase the nuclear:cytoplasmic ratio of ERGR–GFP in MCF7 and ROS cells, whereasDex and ER antagonists had no measurable effect (Figs. 5A and B).

Interestingly, SERMs increased the nuclear:cytoplasmic ratio of ERGR–GFP in ROS cells but had no effect in MCF7 cells. Since thesedifferences might reflect those in species (rather than the tissue) fromwhich cell lines were derived, we performed similar experiments witha human osteosarcoma cell line (U2OS). As shown, results obtained inU2OS cells were similar to those in ROS cells (Fig. 5C). In both cases,the nuclear:cytoplasmic ratio of ERGR–GFP was increased by E2 andeach SERM, but not ICI 182,780.

A similar rat ERGR–GFP chimera has been shown to stimulate GRE-luc reporter activity following activation by ER agonists in several celltypes [13] so we examined whether SERMs also preferentiallystimulate GRE-luc reporter activity, in ROS cells co-transfected withour human ERGR–GFP construct. As expected, ER agonists caused apronounced increase in GRE-luc activity, whereas ER antagonists werewithout effect, in MCF7, ROS and U2OS cells (Figs. 6A–C). Dex failed toincrease GRE-luc activity in these cells, demonstrating that the ERGR–GFP construct is not activated by dex and that the cells express too fewendogenous GR for measurable GRE-luc activation. Interestingly, allfour SERMs had little or no effect on GRE-luc activity in MCF7 cells butcaused pronounced activation in ROS and U2OS cells. Subsequentdose–response studies confirmed that whereas E2 caused similardose-dependent increases in GRE-luc activity in MCF7 and ROS cellsco-transfected with ERGR–GFP, there was a striking discrepancy intheir response to 4-HT (Figs. 6D and E).

Ligand responses for ERα-mediated activation of ERE-luc (Fig. 1)were smaller than those observed for ERGR-mediated activation ofGRE-luc (Fig. 6), which may have reflected differences in the extent ofligand-independent activation: serum growth factors are expected toactivate signalling pathways leading to phosphorylationwithin the N-terminal A/B domain of the ERα; absence of this ER sequence(replaced by the corresponding region from the hGR) within theERGR/GFP construct would preclude such ligand independent activa-tion, resulting in greater sensitivity to ligand. To test this, we assessedeffects of EGF and a protein kinase C (PKC) activating phorbol ester(PDBu) on transcriptional responses to ERα/GFP and ERGR/GFPconstructs. As expected, E2 caused a dose-dependent stimulation ofERE-luc in ERα expressing MCF7 and ROS cells. EGF and PDBu alsocaused dose-dependent increases in ERE-luc activity and synergisti-cally increased E2 effects in MCF7 (Figs. 7A and B) and ROS (Figs. 7Dand E) cells transfected with ERα/GFP. In contrast, when MCF7 andROS cells were transfected with the ERGR/GFP and GRE-luc constructs,EGF and PDBu failed to increase luc activity or to synergise with E2 ineither cell type (Figs. 7C and F), suggesting that unlike ERα/GFP, ERGR/GFP is resistant to activation by ligand-independent pathways.

Discussion

In recent years fusion proteins of receptors with GFP have beenincreasingly used as biosensors for receptor activation and severalgroups have reported agonist effects on distribution and/ormobility ofERα–GFP chimeras within the nucleus [12,14]. However, to ourknowledge, no previous studies have used this approach to examineERα nuclear mobility in osteoblasts. In MCF7 cells, broadly similareffects of ligand exposure on ERα nuclear mobility were observed tothose previously reported in HeLa cells, with SERMs causing partialslowing of recovery and antagonists a more complete immobilisation[12,14]. However, whereas E2 was also found to slow recovery in HeLacells, though to a lesser extent than that observed with tamoxifen or4-HT, it appeared to enhance recovery in MCF7 cells. In contrast, inROS cells, neither E2 nor SERMs affected recovery, and whereas pureantagonists delayed recovery, immobilisation to the extent seen inHeLa or MCF7 cells did not occur. In terms of the functionalimplications of these observations, mobility of ERα within thenucleus, as detected by FRAP, has been found to be a proteasome-dependent process [14]. Proteasome-function is in turn dependent ontranscriptional activity, such that reduced hERα-mediated

Fig. 6. Regulation of GRE-luc activity in cells co-transfected with ERGR–GFP. MCF7 (A), ROS (B) and U2OS (C) cells were cultured in serum-free and phenol red-free DMEM and co-transfected with pCDNA3.1 encoding ERGR–GFP (500 ng/well), GRE-Luc (500 ng/well) and β-Gal (200 ng/well) reporters. Cells were then incubated for 24 h with the indicatedligands at 10-8 M before processing formeasurement of luciferase and β-Gal activity. In dose–response studies, MCF7 (D) and ROS (E) cells were exposed to concentrations of E2, 4-HTand ICI as shown. The data shown are luciferase activity normalised to β-Gal activity and are the mean±SEM from 6 independent experiments, each with quadruplicate observations(n=6). EC50 values were 1.4×10−10 M for E2 in MCF7 cells, and 8.3×10−11 M, 7.5×10−10 M, for E2 and 4-HT (respectively) in ROS cells. One way ANOVA revealed the treatments werestatistically significant (Pb0.05) and post hoc (Dunnett's) tests revealed statistically significant differences to control values at ⁎Pb0.05, ⁎⁎Pb0.01, ⁎⁎⁎Pb0.001.

109B.S. Maru et al. / Bone 44 (2009) 102–112

transactivation impairs proteasome-mediated degradation and recep-tor turnover [15]. Consequently, the tendency for SERMs to delayrecovery in MCF7 and HeLa cells but not ROS cells is consistent withthe view that SERMs act as global ER antagonists in MCF7 and HeLacells but as agonists in ROS cells.

Recently, Martinez et al. developed a biosensor consisting of theGR in tandem with GFP and with its LBD replaced with that from therat ERα [13]. This is primarily cytoplasmic but translocates to thenucleus when activated by ER agonists, providing a more robust

morphological read-out. Hence, we examined whether this systemmight provide a more suitable in vitro assay for tissue-selectiveestrogenic activation of osteoblasts by SERMs. As expected, thehuman ERGR/GFP fusion protein which we generated for thispurpose, like the previously described rat ERGR/GFP construct [13],was primarily cytoplasmic but translocated to the nucleus onstimulation with E2 but not in response to the GR agonist, Dex.Interestingly, we saw no ERGR/GFP translocation in breast or bonecells stimulated with either of the pure antagonists, but whereas the

Fig. 7. Functional interaction between E2 and PDBu or E2 and EGF in ERα-dependent ERE-luc activation but not ERGR-dependent GRE-luc activation. MCF7 (A–C) and ROS (D–F) cellswere cultured in serum-free and phenol red-free DMEM and co-transfected with pCDNA3.1 encoding ERα and ERE-luc (A–E) or with ERGR–GFP and GRE-Luc (C and F) (each at500 ng/well) and β-Gal (200 ng/well) reporters. The cells were then incubated for 24 h with the indicated concentration of E2 either alone or in the presence of EGF (10−11, 10−9 or10−7 M) or PDBu (10−8, 10−7 or 10−6 M) as indicated, before processing for measurement of luciferase and β-Gal activity. The data shown are luciferase activity normalised to β-Galactivity and are the mean±SEM from 3–5 independent experiments, each with quadruplicate observations (n=3–5). Twoway ANOVAs (performed for each panel) revealed E2 to be asignificant variable (Pb0.001) for each cell/reporter combination. EGF and PDBu were also significant sources of variation in each of the experiments with cells expressing ERα andERE-luc (upper and middle panels, Pb0.001) but not in the experiments with cells expressing ERGR–sGFP and GRE-luc (lower panels, PN0.05).

110 B.S. Maru et al. / Bone 44 (2009) 102–112

four SERMs likewise had no effect on nuclear translocation in breastcells, they all stimulated nuclear translocation of ERGR/GFP in bonecells (ROS and U2OS).

Based on previous evidence that a similar rat ERGR–GFP chimerastimulates GRE-luc reporter activity following activation by ERagonists in several cell types [13], we applied this method to examinepossible cell context-dependent effects of SERMs. The SERMs and ERantagonists had either weak or no measurable effects on GRE-lucreporter activity in the presence of ERGR/GFP in MCF7 cells whereasall four SERMs caused marked stimulation of GRE-luc transcription inthe two bone cell lines. Tamoxifen 10−5 M was previously found tostimulate GRE-luc activity in a NIH/3T3 murine fibroblast-derived cellline stably transfected with ERGR [13], which is considerably higherthan the concentration of 10−8 M used here, whereas lower doseswere without effect. Several lines of evidence support the fact that

these findings represent an important feature of SERM-dependentstimulation of estrogenic pathways in osteoblasts. For example, bothhuman and rat-derived osteoblast-like cell lines showed similarresponses, all four SERMs tested showed equivalent effects, asubstantial response was observed to SERMs which was similar inmagnitude to that after ERα agonists, and the response to E2 and 4-HToccurred over an equivalent dose range. However, further studies arerequired to confirm that similar responses occur in other osteoblast-like cells, including primary cultures.

It was noteworthy that the ERGR/GRE-luc system could mimictissue-selective activation by SERMs in osteoblasts, in spite of the factthat this appeared to be resistant to activation by protein kinases, asreflected by the fact that PDBu and EGF failed to increase GRE-lucactivity in breast or bone cells expressing ERGR/GFP, whereas bothcaused pronounced stimulation (and synergy with E2) in cells

111B.S. Maru et al. / Bone 44 (2009) 102–112

expressing ERα and ERE-luc. The lack of activation of ERGR by proteinkinases, which play an important role in augmenting ER signalling[16], presumably reflects the fact that the ERGR/GFP constructgenerated herein contains only the LBD of the ER and lacks theS102/4, S118, S167, S236 and S305 sites phosphorylated by ERK, RSK,AKT and PKA to mediate ligand-independent (i.e. E2-independent butprotein kinase-dependent) activation [17]. Although serine residues inthe N-terminal domain (NTD) of the GR are also subject tophosphorylation, modulation of functions such as ligand binding orco-factor recruitment are likely to involve interactions between theNTD and the LBD domains that we predict would be compromised bythe heterologous nature of these domains in the ERGR chimera.

It is well established that many stimuli acting via tyrosine kinasereceptors (TKRs) and G-protein coupled receptors (GPCRs) canstimulate ER and alter the balance of agonist/antagonist effectscaused by SERMs [17–19]. However, although some studies suggestthat tissue-selective activation of osteoblasts involves the targeting ofthese extra-nuclear pathways [20], the present observations implythat protein kinase-dependent activation is not necessary for cellcontext dependency of SERM action. The lack of competing ligandindependent activation of ERGR may also provide an explanation forthe greater fold increase in reporter activity induced by SERMs inosteoblasts transfected with ERGR as opposed to ERα. However,against this suggestion, our studies were performed in serum-freeconditions which are likely to have minimised the level of ligandindependent stimulation. Moreover, if ligand independent stimulationcontributed significantly to ERE-luc but not GRE-luc activity, this mayhave been expected to lead to higher baseline levels of reporteractivity in the former, which was not found to be the case.

These experimental observations also provide some interestinginsights into themolecularmechanismswhich underlie the cell contextdependency of SERM effects on osteoblasts. In view of the link betweennuclear mobility and transactivation as discussed above [14], thedifferences in nuclear mobility of the ERα/GFP construct betweenbone and breast cancer cells following treatmentwith SERMswhichweobserved is consistent with the view that distinct repertoires of nuclearco-regulatory proteins between cell types underlies the cell context-dependent activity of SERMs [11]. However, this would not explaindifferences in cytoplasmic to nuclear translocation of the ERGR/GFPconstruct between breast and bone cells in response to SERMs whichwere also seen, pointing to the role of other mechanisms which operateoutside the nucleus. The lattermight include chaperoneproteins such asheat shock proteins 70 and 90, which regulate trafficking of glucocorti-coid receptors both into and within the nucleus [21]. For example, HSP-90 has been found to regulate GR nuclear mobility as assessed by FRAP[22]. Moreover, HSP-70 has also been implicated in transcriptionalrepression of un-liganded estrogen receptor [23].

A potential limitation of these findings with respect to the mode ofaction of SERMs in bone is that, althoughwehave focussed on estrogeniceffects on osteoblasts, it is clear that direct effects on osteoclasts also playan important role,whichwerenot addressedhere, including the recentlydescribed up-regulation of Fas ligand by estrogen in osteoclasts [24].Moreover, although we have included studies of ERα, we have yet toextend our analyses to ERβ-dependent effects. In light of evidence thatloss of function ERα mutations cause bone loss in humans [25], anddeficiency of ERα but not ERβ prevents estrogen-induced boneformation in mice [26,27], it may be that estrogen-dependent effectson osteoblasts are predominantly mediated via ERα. Nonetheless, it isrecognised that ERβ is also expressed at relatively high levels inosteoblasts [28–30], and there is some evidence to suggest that ERβ isinvolved inmediatingSERMeffects onosteoblasts through the formationof ERαERβ heterodimers [31]. In addition, it is possible that estrogeniceffects on osteoblasts involve a distinct extra-nuclear receptor, GPR30[32], which we are keen to study in future investigations.

In conclusion, we found that ERGR-mediated GRE-luc activityresponds to estrogen agonists and SERMs in a cell context dependent

manner closely resembling that seen in vivo. In addition, the responsemagnitude using this systemwas considerably enhanced, resulting in amuch stronger signal to noise ratio, comparedwith alternativemethodsbased on osteoblast-like cells transfected with ERα. Moreover, ERGR-mediated GRE-luc activity appeared to be resistant to growth factor orprotein kinasemodification, rendering it a reliable and sensitive tool forSERM screening. Further studies utilising this system are justified toexplore the mechanistic basis for estrogenic stimulation of osteoblastactivity, and to identify newer SERMs capable of targeting this activity.

Acknowledgments

This work was supported by project grants from Procter andGamble, the Research Foundation of the Charitable Trust for theUnited Bristol Hospitals (Project 285) and by an Equipment Grant fromthe Wellcome Trust (078407).

References

[1] Perry MJ, Gujral S, Whitworth T, Tobias JH. Tamoxifen stimulates cancellous boneformation in long bones of female mice. Endocrinology 2005;146:1060–5.

[2] Qu Q, Harkonen PL, Vaananen HK. Comparative effects of estrogen andantiestrogens on differentiation of osteoblasts in mouse bone marrow culture. JCell Biochem 1999;73(4):500–7.

[3] Taranta A, Brama M, Teti A, De luca V, Scandurra R, Spera G, et al. The selectiveestrogen receptormodulator raloxifene regulates osteoclast and osteoblast activityin vitro. Bone 2002;30(2):368–76.

[4] Tobias JH, Compston JE. Does estrogen stimulate osteoblast function inpostmenopausal women? Bone 1999;24:121–4.

[5] Ong DB, Colley SM, Norman MR, Kitazawa S, Tobias JH. Transcriptional regulationof a BMP-6 reporter by estrogen receptor alpha. J Bone Miner Res 2004;19:447–54.

[6] Tou L, Quibria N, Alexander JM. Regulation of human cbfa1 gene transcription inosteoblasts by selective estrogen receptor modulators (SERMs). Mol CellEndocrinol 2001;183:71–9.

[7] van den Wijngaard A, Mulder WR, Dijkema R, Boersma CJ, Mosselman S, vanZoelen EJ, et al. Antiestrogens specifically up-regulate bone morphogeneticprotein-4 promoter activity in human osteoblastic cells. Mol Endocrinol 2000;14(5):623–33.

[8] Yang NN, Venugopalan M, Hardikar S, Glasebrook A. Identification of an estrogenresponse element activated by metabolites of 17beta-estradiol and raloxifene.Science 1996;273(5279):1222–5.

[9] Gallagher A, Chambers TJ, Tobias JH. The estrogen antagonist ICI 182,780 reducescancellous bone volume in female rats. Endocrinology 1993;133:2787–91.

[10] Paige LA, Christensen DJ, Gron H, Norris JD, Gottlin EB, Padilla KM, et al. Estrogenreceptor (ER) modulators each induce distinct conformational changes in ER alphaand ER beta. Proc Natl Acad Sci U S A 1999;96:3999–4004.

[11] Smith CL, O'Malley BW. Coregulator function: a key to understanding tissuespecificity of selective receptor modulators. Endocr Rev 2004;25(1):45–71.

[12] Maruvada P, Baumann CT, Hager GL, Yen PM. Dynamic shuttling and intranuclearmobility of nuclear hormone receptors. J Biol Chem 2003;278(14):12425–32.

[13] Martinez ED, Rayasam GV, Dull AB, Walker DA, Hager GL. An estrogen receptorchimera senses ligands by nuclear translocation. J Steroid Biochem Mol Biol2005;97(4):307–21.

[14] Stenoien DL, Patel K, Mancini MG, Dutertre M, Smith CL, O'Malley BW, et al. FRAPreveals that mobility of oestrogen receptor-alpha is ligand- and proteasome-dependent. Nat Cell Biol 2001;3(1):15–23.

[15] Reid G, Hubner MR, Metivier R, Brand H, Denger S, Manu D, et al. Cyclic,proteasome-mediated turnover of unliganded and liganded ERalpha on responsivepromoters is an integral feature of estrogen signaling.Mol Cell 2003;11(3):695–707.

[16] Driggers PH, Segars JH. Estrogen action and cytoplasmic signaling pathways. PartII: the role of growth factors and phosphorylation in estrogen signaling. TrendsEndocrinol Metab 2002;13(10):422–7.

[17] Katzenellenbogen BS, Choi I, Delage-Mourroux R, Ediger TR, Martini PG, MontanoM, et al. Molecular mechanisms of estrogen action: selective ligands and receptorpharmacology. J Steroid Biochem Mol Biol 2000;74(5):279–85.

[18] Likhite VS, Stossi F, Kim K, Katzenellenbogen BS, Katzenellenbogen JA. Kinase-specific phosphorylation of the estrogen receptor changes receptor interactionswith ligand, deoxyribonucleic acid, and coregulators associated with alterations inestrogen and tamoxifen activity. Mol Endocrinol 2006;20(12):3120–32.

[19] Michalides R, Griekspoor A, Balkenende A, Verwoerd D, Janssen L, Jalink K, et al.Tamoxifen resistance by a conformational arrest of the estrogen receptor alphaafter PKA activation in breast cancer. Cancer Cell 2004;5(6):597–605.

[20] Kousteni S, Almeida M, Han L, Bellido T, Jilka RL, Manolagas SC. Induction ofosteoblast differentiation by selective activation of kinase-mediated actions of theestrogen receptor. Mol Cell Biol 2007;27(4):1516–30.

[21] Pratt WB, Morishima Y, Murphy M, Harrell M. Chaperoning of glucocorticoidreceptors. Handb Exp Pharmacol 2006(172):111–38.

[22] Elbi C, Walker DA, Romero G, Sullivan WP, Toft DO, Hager GL, et al. Molecularchaperones function as steroid receptor nuclear mobility factors. Proc Natl AcadSci U S A 2004;101(9):2876–81.

112 B.S. Maru et al. / Bone 44 (2009) 102–112

[23] Ogawa S, Oishi H, Mezaki Y, Kouzu-Fujita M, Matsuyama R, Nakagomi M, et al.Repressive domain of unliganded human estrogen receptor alpha associates withHsc70. Genes Cells 2005;10(12):1095–102.

[24] Nakamura T, Imai Y, Matsumoto T, Sato S, Takeuchi K, Igarashi K, et al. Estrogenprevents bone loss via estrogen receptor alpha and induction of Fas ligand inosteoclasts. Cell 2007;130(5):811–23.

[25] Smith EC, Boyd J, Frank GR, Takahashi H, Cohen RM, Specker B, et al. Estrogenresistance caused by a mutation in the estrogen-receptor gene in a man. N EnglJ Med 1994;331:1056–61.

[26] McDougall KE, Perry MJ, Gibson R, Bright J, Colley S, Hodgin JB, et al. Estrogen-induced osteogenesis in intact female mice lacking ERbeta. Am J Physiol 2002;283:E817–23.

[27] McDougall KE, Perry MJ, Gibson RL, Colley SM, Korach KS, Tobias JH. Estrogenreceptor-alpha dependency of estrogen's stimulatory action on cancellous boneformation in male mice. Endocrinology 2003;144(5):1994–9.

[28] Arts J, Kuiper GGJM, Janssen JMMF, Gustafsson JA, Lowik CWGM, Pols HAP, et al.Differential expression of estrogen receptors alpha and beta mRNA duringdifferentiation of human osteoblast SV-HFO cells. Endocrinology 1997;138:5067–70.

[29] Bord S, Horner A, Beavan S, Compston J. Estrogen receptor alpha and beta aredifferentially expressed in developing human bone. J Clin Endocrinol Metab2001;86:2309–14.

[30] Onoe Y, Miyaura C, Ohta H, Nozawa S, Suda T. Expression of estrogen receptor betain rat bone. Endocrinology 1997;138:4509–12.

[31] Monroe DG, Secreto FJ, Subramaniam M, Getz BJ, Khosla S, Spelsberg TC.Estrogen receptor alpha and beta heterodimers exert unique effects on estrogen-and tamoxifen-dependent gene expression in human U2OS osteosarcoma cells2005.

[32] Prossnitz ER, Arterburn JB, Sklar LA. GPR30: a G protein-coupled receptor forestrogen. Mol Cell Endocrinol 2007;265–266:138–42.