d n a r e p a i r 5 ( 2 0 0 6 ) 904–913

avai lab le at www.sc iencedi rec t .com

journa l homepage: www.e lsev ier .com/ locate /dnarepai r

Impaired elimination of DNA double-strandbreak-containing lymphocytes in ataxiatelangiectasia and Nijmegen breakage syndrome

Paola Porceddaa,1, Valentina Turinettoa,1, Erica Lantelmea, Enrico Fontanellab,Krystyna Chrzanowskac, Riccardo Ragonad, Mario De Marchia,Domenico Deliab, Claudia Giachinoa,∗

a Department of Clinical and Biological Sciences, University of Turin, Regione Gonzole 10, 10043 Orbassano, Italyb Department of Experimental Oncology, Istituto Nazionale Tumori, Via Venezian 1, 20133 Milan, Italyc Department of Medical Genetics, Children’s Memorial Health Institute, 20 Dzieci Polskich St., 04-730 Warsaw, Polandd Department of Medical and Surgical Disciplines, Corso Dogliotti 14, University of Turin, 10126 Turin, Italy

a r t i c l e i n f o

Article history:

Received 28 April 2006

Accepted 9 May 2006

Published on line 12 June 2006

Keywords:

DNA damage

Apoptosis

Lymphocyte

Human

a b s t r a c t

The repair of DNA double-strand breaks is critical for genome integrity and tumor suppres-

sion. Here we show that following treatment with the DNA-intercalating agent actinomycin

D (ActD), normal quiescent T cells accumulate double-strand breaks and die, whereas T cells

from ataxia telangiectasia (AT) and Nijmegen breakage syndrome (NBS) patients are resis-

tant to this death pathway despite a comparable amount of DNA damage. We demonstrate

that the ActD-induced death pathway in quiescent T lymphocytes follows DNA damage

and H2AX phosphorylation, is ATM- and NBS1-dependent and due to p53-mediated cellular

apoptosis. In response to genotoxic 2-Gy �-irradiation, on the other hand, quiescent T cells

from normal donors survive following complete resolution of the damage thus induced. T

cells from AT and NBS patients also survive, but retain foci of phosphorylated H2AX due to a

subtle double-strand break (DSB) repair defect. A common consequence of these two genetic

defects in the DSB response is the apparent tolerance of cells containing DNA breaks. We

suggest that this tolerance makes a major contribution to the oncogenic risk of patients

tability syndromes.

compiled as complete V(D)J coding exons by nonhomologous

with chromosome ins

1. Introduction

DSB repair is critical for genome integrity and tumor sup-pression. DSBs are produced either by exogenous agents or

by endogenous events, such as collapsed replication forksand gene rearrangements during lymphocyte development.Antigen receptor gene recombination is initiated by the

∗ Corresponding author. Tel.: +39 011 6705425; fax: +39 011 9038639.E-mail address: claudia.giachino@unito.it (C. Giachino).

1 These authors contributed equally to this work.1568-7864/$ – see front matter © 2006 Elsevier B.V. All rights reserved.doi:10.1016/j.dnarep.2006.05.002

© 2006 Elsevier B.V. All rights reserved.

recombinase-activating gene 1/2 (RAG1/2) endonuclease dur-ing the G0/G1 phase of the cell cycle [1]. This generates DSBsadjacent to the V, D and J segments [2] that are subsequently

end joining [3].V(D)J recombination is now known to be active in precur-

sor bone marrow and thymic cells, and in a fraction of mature

( 2 0 0

Bep[tmb(iVtsmgDarwAi

TActscaIaNf

pp

2

2d

PNAggdiGmsdasCa1du

d n a r e p a i r 5

and T cells that undergo receptor revision in the periph-ry [4,5]. We and others have observed functional RAG generoducts in mature T cells featuring defective TCR expression

6,7]. The frequency of this T cell subset is increased morehan 10-fold in patients with AT and NBS [8,9], two autoso-

al recessive genomic instability syndromes characterizedy immunodeficiency, hypersensitivity to ionizing radiationIR) and DSB-inducing agents, defective DNA repair, and anncreased risk of lymphoid malignancies [10–13]. The role of(D)J recombination in the onset of tumorigenic transloca-

ions is well established [14–17], and a similar role has beenuggested for secondary V(D)J rearrangements [18]. Severalechanisms have evolved in normal cells to counter the dan-

ers of V(D)J recombination, i.e. the specific targeting of DNASBs to the intended sites, their efficient rejoining and thectivation by unresolved DSBs of a general DNA damage-esponse [19]. Alterations of any of these processes, togetherith increased RAG activity, in lymphocytes defective for theTM or NBS1 proteins would provide an explanation of their

ncreased risk of leukemia/lymphoma [20].We here assessed the response of normal, AT and NBS

cells kept in the G0/G1 phase to two genotoxic agents:ctD and IR. ActD is an anti-tumor antibiotic used in manyhemotherapeutical protocols that intercalates into DNA andhus inhibits transcription and induces damage [21,22]. Wehow that ActD produces DSBs in normal quiescent T lympho-ytes and targets them to apoptosis, whereas T cells from ATnd NBS patients resist this apoptosis and survive. FollowingR (2-Gy) quiescent T cells from normal donors resolve virtu-lly all damage within 72 h and survive. T cells from AT andBS patients also survive, despite the maintenance of �H2AX

oci.Inefficient elimination of DSB-containing cells may be sup-

osed to make a major contribution to the oncogenic risk ofatients with chromosome instability syndromes.

. Materials and methods

.1. Cell isolation, cell culture and induction of DNAamage

eripheral blood from four healthy donors, six AT and fourBS patients was collected after signed informed consent.T patients were either homozygous or compound heterozy-ous for truncating mutations; NBS patients were homozy-ous for the common 657del5 mutation. PBMC were isolated asescribed [7] and either used within 2 days or frozen and used

mmediately after thawing. In all cases, >95% of cells were in0/G1. T cell lines were generated as described [7]. All experi-ents were conducted on resting T cells (>95% in G0/G1). ActD

upplied by Sigma–Aldrich Co. (St. Luis, MO, USA) was used atoses ranging from 0.05 to 10 �g/ml (0.04–8 �M). ZVAD-FMKnd ZFA-FMK peptides were obtained from Promega (Madi-on, WI, USA) and added at 100 �M. Caffeine (Sigma–Aldricho.) was used at the final concentration of 10 mM for PBMC

nd 3 mM for cultured T cells, and added to the mediumh before ActD. The transcription inhibitor 5,6-dichloro-1-�--ribofuranosylbenzimidazole (DRB) (Sigma–Aldrich Co.) wassed at 20 �M.

6 ) 904–913 905

Cultured T cells were �-irradiated (2 Gy or, for some exper-iments, 0.5 Gy) using a 6 MV accelerator (Elekta) at a dose of2 Gy/min. Cells were kept on ice for 1 h (the time needed toreach the laboratories), then returned to the incubator andharvested at different times.

2.2. Flow cytometry

The viability of resting cells was determined by propidiumiodide (PI) staining. To assess viability of proliferating T cellsfollowing �-irradiation, resting cultured T cells were inducedto proliferate with 0.75 �g/ml PHA (Gibco-Invitrogen) added atthe time of irradiation, harvested at 7 days and analyzed by PIstaining.

Apoptosis was defined through double staining with anti-annexin V-FITC (BD PharMingen, San Diego, CA, USA) andPI, in accordance with the manufacturer’s instructions. Cas-pase activation was analyzed with anti-Active Caspase-3(BD PharMingen, San Diego, CA, USA) as primary antibodyand a PE-conjugated goat anti-rabbit (BD PharMingen, SanDiego, CA, USA) as secondary antibody. Cell cycle analy-sis was based on DNA content. Briefly, ethanol-fixed cellswere treated with 1 �g/ml RNase A (Sigma–Aldrich Co.) andstained with 50 �g/ml PI. Stained cells were analyzed on aFACScan (Becton Dickinson & Co., San Jose, CA, USA) usingthe CellQuest software. Cell survival was expressed afternormalization to medium alone or supplemented with thedrug’s solvent (“medium” in the graphs). Statistical analysiswas performed with the test of independence or Student’st-test.

2.3. Immunofluorescence

Approximately 400,000 T cells for each condition were col-lected, fixed with 4% paraformaldehyde, permeabilized with0.5% Triton X-100, and blocked with 6% BSA and 2.5% nor-mal goat serum. Cells were stained with the anti-�-H2AXmAb (Upstate Biotechnology, NY, USA), and with Alexa 546-conjugated goat anti-mouse as secondary Ab (MolecularProbes, Inc., Eugene, OR, USA). Stained cells were trans-ferred to poly-l-lysine-coated coverslips and slides weremounted with Mowiol (Calbiochem, San Diego, CA). Fluo-rescence images were obtained with a 510 Carl Zeiss con-focal laser microscope using a 63× objective. Optical sec-tions through the nuclei were captured at 0.5 �m inter-vals, and images were obtained by projection of the indi-vidual sections. For quantitative analysis, foci were countedby eye until at least 40 cells and 40 foci were recordedper sample. Fluorescence images were elaborated as arbi-trary units/pixel using a LSM Image examiner software fromZeiss.

2.4. Single-cell gel electrophoresis

DNA damage was evaluated using a modification of the single-cell gel electrophoresis comet assay with increased sensitivity

[23] on T cells either incubated with 100 �M ZVAD-FMK peptideor in medium with ActD and ZVAD-FMK. PicoGreen-stained(Molecular Probes, Inc., Eugene, OR) gels were analyzed usinga 510 Carl Zeiss microscope and the Comet Score parameter

5 ( 2

906 d n a r e p a i r

calculator software (TM) (freely available from TriTek Corp.).DNA damage was expressed as olive tail moment (OTM).

2.5. Reverse transcription PCR

Total RNA was extracted from 2 × 106 T cells usingTRIZOL®Reagent (InvitrogenTM, Carlsbad, CA, USA), followingthe manufacturer’s instructions. First-strand cDNA was syn-thesized using oligo d(T) and Moloney murine leukemia virusReverse Transcriptase MMLV-RT (InvitrogenTM) in 20 �l finalvolume, and 2 �l were used in each PCR reaction. The primerswere as follows: GAPDH forward, ACCACAGTCCATGCCATCAC;GAPDH reverse, TCCACCACCCTGTTGCTGTA; GATA-3 forward,

TGTCTGCAGCCAGGAGAGC; GATA-3 reverse, ATGCATCAAA-CAACTGTGGCCA. Both primer pairs spanned at least oneintron. The PCR profiles were: 3 min at 94 ◦C, 22 cycles at 94 ◦Cfor 30 s, 60 ◦C for 30 s, 72 ◦C for 30 s, for GAPDH; and 3 min at

0 0 6 ) 904–913

94 ◦C, 27 cycles at 94 ◦C for 30 s, 64 ◦C for 30 s, 72 ◦C for 30 s, forGATA-3.

2.6. Immunoblot analysis

Western blots were performed as described [24]. Membraneswere incubated with either an anti-Chk2 antibody madeby us (clone 44D4/21) or Chk2-pThr68 (Cell Signaling, Bev-erly, MA, USA), p53 (clone DO7 YLEM, Avezzano, Italy), p53-pSer15 (Cell Signaling), Atm (a kind gift from J. Shiloh), Atm-pSer1981 (Rockland Immunochemicals, Gilbertsville, PA, USA),vinculin and �-actin (both from Sigma–Aldrich Co.), and sub-sequently with a peroxidase-conjugated secondary antibody.

The immunoreactive bands were visualized by ECL SuperSignal (Pierce, Rockford, IL, USA) on autoradiographic films,scanned and quantitated by ImageQuant software (MolecularDynamics, Sunnyvale, CA, USA).

Fig. 1 – Selective resistance to ActD-induced apoptoticdeath of lymphocytes derived from AT and NBS patients. (a)Circulating lymphocytes from three AT (©), three NBS (�)and four healthy donors (�) were maintained in mediumalone or in medium containing 0.5 �g/ml of ActD, harvestedat 24, 48 and 72 h and analyzed by flow cytometry afterstaining with PI. Lymphocytes were gated based on the SSCand FSC parameters. Cultured T cells from two AT patients(©), three NBS patients (�) and two controls (�) were kept inmedium alone or in medium containing 0.05 �g/ml of ActD,harvested at 24, 48 and 72 h and similarly analyzed.Survival of lymphocytes cultured in ActD is shownnormalized to survival in medium alone. Viability is shownas mean ± S.D. of three independent experiments. (b)ActD-induced death requires activation of caspases. NormalPBMC were cultured for 24 h in medium (white bar), with0.5 �g/ml ActD, with the caspase inhibitor ZVAD (100 �M)and ActD, or with the control peptide ZFA (100 �M) andActD (all black bars). Survival of gated lymphocytes isshown normalized to survival in medium alone(mean ± S.D. of three independent experiments). Cultured Tcells from three normal donors were kept for 24 h inmedium (white bar), with 10 �g/ml ActD, with the caspaseinhibitor ZVAD (100 �M) in the presence of ActD, or with thecontrol ZFA (100 �M) in the presence of ActD (black bars). (c)ActD treatment of circulating lymphocytes induces caspaseactivation. Control PBMC were cultured 24 h in mediumalone or with 0.5 �g/ml ActD, then harvested and stainedwith anti-active caspase-3 antibody. Lymphocytes weregated based on the SSC and FSC parameters. Cultured Tcells were kept for 24 h in medium alone or with 0.05 �g/mlActD, then harvested and stained with anti-activecaspase-3 antibody. Percentages of active caspase-3+ cellsare indicated. (d) ActD treatment of circulating lymphocytesinduces translocation of phosphatidylserine to the externalleaflet of the cell membrane. PBMC were cultured 24 h inmedium alone or with 0.5 �g/ml ActD, then harvested andstained with anti-annexin V and PI. Lymphocytes weregated based on the SSC and FSC parameters. Cultured Tcells were kept for 24 h in medium alone or with 0.05 �g/mlActD, then harvested and stained with anti-annexin V andPI. Percentages of PI- annexin V+ cells are indicated.

( 2 0 0 6 ) 904–913 907

3

3a

TpwepvtivirNps

aAlweftiaettpb

3N

ADupRdgp

wceHDaDwU�

f(

Fig. 2 – Mechanisms of ActD-induced death: transcriptionalinhibition is not sufficient to induce lymphocyte death. (a)DRB treatment does not induce lymphocyte death. Cellswere cultured for 72 h in medium alone (white bars), ActD(0.5 �g/ml for circulating lymphocytes and 0.05 �g/ml forcultured T cells), or 20 �M of the transcriptional inhibitorDRB (black bars) and analyzed by flow cytometry afterstaining with PI. Cell survival is shown normalized tosurvival in medium alone (mean ± S.D. of threeindependent experiments). (b) DRB treatment inhibitstranscription of GATA-3 and GAPDH genes. Cells werecultured for 72 h in medium alone or with 20 �M DRB, theRNA was extracted and the cDNA used for RT-PCR withGATA-3- and GAPDH-specific oligonucleotides. Onerepresentative experiment out of four is shown.

d n a r e p a i r 5

. Results

.1. Resting T lymphocytes from AT and NBS patientsre resistant to ActD-induced apoptosis

o define the sensitivity to ActD of quiescent circulating lym-hocytes, freshly separated PBMC from four healthy donorsere treated with 0.5 �g/ml ActD and analyzed by flow cytom-

try with propidium iodide (PI) staining (Fig. 1a). Mature lym-hocytes were susceptible to ActD-induced death (mean 19%iable cells at 72 h). In contrast, mature lymphocytes fromhree AT and three NBS patients were resistant. Their viabil-ty at 72 h exceeded 60%: AT versus control, p = 0.0003; NBSersus control, p = 0.0001 with the test of independence. Sim-lar results were obtained with 0.05 �g/ml ActD in cultured,esting T cells from two healthy donors, two AT and threeBS patients: AT versus control, p = 0.0057; NBS versus control,= 0.0038. More than 95% of cells remained in G0/G1 (data nothown).

To determine whether ActD induced apoptosis, wessessed its sensitivity to the caspase inhibitor ZVAD-FMK.s shown in Fig. 1b, addition of ZVAD-FMK to normal, circu-

ating lymphocytes partially prevented ActD-induced death,hereas addition of the control peptide ZFA-FMK had no

ffect. Comparable results were obtained with cultured T cellsrom two healthy controls. This death mechanism was fur-her explored by active caspase-3 and annexin V/PI stain-ngs. After 24 h ActD, there was an evident increase in bothctive caspase-3-positivity (Fig. 1c) and annexin V+PI−, i.e.arly apoptotic cells, among circulating lymphocytes and cul-ured T cells (Fig. 1d). ActD thus induces an apoptotic pathwayhat involves caspase activation and translocation of phos-hatidylserine from the inner to the outer leaflet of the mem-rane before its integrity is lost.

.2. ActD-induced apoptosis follows an ATM- andBS1-dependent response to DSBs

ctD intercalates into DNA, inhibits transcription and inducesNA damage [21,22]. To determine whether such inhibitionnderlies ActD-induced apoptosis, we assessed the apoptoticotential of DRB, a transcriptional inhibitor that directly blocksNA polymerase II [25] without intercalating into DNA. At aose that inhibited transcription of the GATA-3 and GAPDHenes, DRB was unable to induce the death of mature lym-hocytes (Fig. 2).

To demonstrate ActD-induced damage and determinehether it includes DSBs, we used a modified version of the

omet assay with increased sensitivity at low damage lev-ls [23] and assessed phosphorylation of the histone variant2AX on serine 139 (�-H2AX), an early and specific indicator ofSBs [26–28], by immunostaining and confocal microscopy. Aspoptosis itself results in oligonucleosomal fragmentation ofNA [29] and H2AX phosphorylation [30], these experimentsere done in the presence of the caspase inhibitor ZVAD-FMK.

ntreated T cell lines displayed virtually no DNA damage nor-H2AX foci (Fig. 3a and b). After treatment with 10 �g/ml ActDor 1 h, all normal, AT and NBS nuclei were comet shapednot shown) and extensive DNA damage was evident (Fig. 3a),

together with many �-H2AX foci in all the normal cells (Fig. 3b).AT and NBS cells were also more than 90% positive, thoughtheir mean fluorescence intensity was 51% and 65% that ofthe normal cells (Fig. 3b). Similar results were obtained after0.05 �g/ml ActD treatment for 6 h (Fig. 3c and d). The �-H2AXfoci were counted to determine the average number of DSBsproduced in normal cells: 0.05 and 10 �g/ml produced 7 and12 DSBs/cell, respectively (data not shown). Transcriptionalinhibition thus seems irrelevant to the death pathway andDSBs are produced by ActD with the employed conditions inquiescent mature T cells.

Since caffeine inhibits the kinase activity of ATM [31], weinvestigated its effect on the response to ActD-induced DSBsin normal lymphocytes. Caffeine also inhibits the related ATRprotein kinase [32], yet ATR is not expressed in the noncy-cling lymphocytes we used, due to post-transcriptional con-trol mechanisms [33]. Preincubation of freshly separated lym-

phocytes with caffeine conferred partial resistance to ActD-induced death, an effect that mimics our findings in AT cells(Fig. 4a). Analogous results were obtained with cultured con-trol T cells, while preincubation of cultured T cells from AT and

908 d n a r e p a i r 5 ( 2

Fig. 3 – Mechanisms of ActD-induced death: ActD inducesDNA damage and DSBs in T lymphocytes. (a) Analysis ofDNA damage by the comet assay. Cultured T cells weretreated for 1 h in medium with 100 �M ZVAD alone or with10 �g/ml ActD. The DNA damage is expressed in olive tailmoment (OTM) units. The values are medians and standarddeviations of at least 40 cells/slide. (b) �-H2AX analysis after10 �g/ml ActD treatment. T lymphocytes were treated for1 h in medium with 100 �M ZVAD alone or with 10 �g/mlActD, harvested and stained with anti-�-H2AX mAb asprimary antibody and with Alexa 546-conjugated goatanti-mouse as secondary Ab. Cells were treated with ZVADto avoid any DNA fragmentation and H2AXphosphorylation due to apoptotic mechanisms. (c) Analysisof DNA damage by the comet assay. Cultured T cells weretreated for 6 h in medium with 100 �M ZVAD alone or with0.05 �g/ml ActD. The DNA damage is expressed in olive tailmoment (OTM) units. The values are medians and standarddeviations of at least 40 cells/slide. (d) �-H2AX analysis after0.05 �g/ml ActD treatment. T lymphocytes were treated for6 h in medium with 100 �M ZVAD alone or with 0.05 �g/mlActD, harvested and stained with anti-�-H2AX mAb. Cellswere treated with ZVAD to avoid any DNA fragmentationand H2AX phosphorylation due to apoptotic mechanisms.

0 0 6 ) 904–913

NBS patients resulted in a survival curve comparable with thatof ActD alone (Fig. 4b).

3.3. Following 2 Gy IR, resting T lymphocytes from ATand NBS patients survive despite the presence ofunresolved DSBs

Following 2 Gy IR, PI staining was used to assess the viabil-ity of cultured, resting T cells from four healthy donors, sixAT and one NBS patients. Virtually all cells survived for 72 h(Fig. 5a). This ability to survive was dependant on their beingin G0/G1. Upon addition of PHA at IR, in fact, there were sub-stantial percentages of normal cell deaths. AT lymphocyteswere typically radiosensitive, whereas NBS lymphocytes wereintermediately susceptible (Fig. 5b).

Many �-H2AX foci were detectable in virtually all T cellsfrom healthy donors and from AT and NBS patients 1 h afterIR (Fig. 5c), though the mean fluorescence intensity of AT andNBS cells was 46% and 65% of that of normal cells. Exact deter-mination of the maximum number of DSBs by counting the�-H2AX foci was prevented by the small average size of the Tcell nuclei. No more than 30 foci could be distinctly counted.This figure, however, was reached and apparently surpassedby about 80% of the cells examined 1 h after irradiation. It maythus be concluded that the number of DSBs produced by 2 GyIR exceeds 30 per cell. Previous estimates for fibroblasts are40–60 per cell [34,35].

A �-H2AX focus is an early response to a DSB and its kineticsof disappearance closely parallels the rate of DSB repair [36,37].This kinetics, however, was defective in AT cells: >4 foci/cellwere still present after 72 h versus 0.5 for normal donor cells(Fig. 5d). The number of persisting foci appeared to be inter-mediate in NBS cell: 2 foci/cell at 72 h (Fig. 5d).

3.4. The opposite cellular outcome following ActDversus IR reflects differences in the nature of the DSBsproduced and the molecular pathway induced

To discover why an opposite response is induced in normalquiescent T cells treated with the two genotoxic compounds(i.e. repair and survival after IR versus apoptosis after ActD),we first looked to see whether induction of DSBs concomi-tantly with transcriptional inhibition (both features of ActD)results in cell death and then whether repair of ActD-inducedDSBs occurs in normal T cells when their apoptosis is blocked.DSBs were induced with both 0.5 Gy IR, a dose producing8 foci/cell like 0.05 �g/ml ActD, and the standard 2 Gy dose.DSBs induction and transcriptional inhibition only modestlysynergized and resulted in weak death induction (Fig. 6a), andthe repair of ActD-induced DSBs was greatly impaired com-pared with that of IR-induced DSBs (72–100% residual dam-age at 24 h after ActD versus 9–20% after IR) (Fig. 6b and c).Lastly, we analyzed the molecular pathways activated by thetwo compounds. Exposure of cells to radiation triggers thekinase activity of ATM and enables it to phosphorylate severalsubstrates involved in multiple damage response pathways

[10]. To determine whether the same molecular pathway isinduced by ActD, we analyzed the autophosphorylation ofATM-Ser1981, an event reflecting activation of ATM by DNAdamage [38]. As an indication of ATM activity, we assessed

d n a r e p a i r 5 ( 2 0 0 6 ) 904–913 909

Fig. 4 – Effect of the ATM-inhibitor caffeine on the ActD-induced apoptosis. (a) Circulating lymphocytes from three healthydonors were treated with 10 mM caffeine alone or in conjunction with 0.05 �g/ml ActD and analyzed at 72 h by PI staining.Data are normalized to survival in medium alone (bars, mean ± S.D.). (b) Cultured T cells from three healthy donors, two ATand three NBS patients were treated with 3 mM caffeine alone or in conjunction with 0.05 �g/ml ActD and analyzed after48 h by staining with PI. Data are normalized to survival in medium alone (bars, mean ± S.D.).

Fig. 5 – Survival and DNA repair in irradiated, resting lymphocytes from AT and NBS patients. (a) Resting cultured T cellsfrom six AT patients, one NBS and four healthy donors were �-irradiated (2 Gy), harvested at 72 h and analyzed by flowcytometry after PI staining. Survival of irradiated lymphocytes was normalized to survival of unirradiated cells (bars,mean ± S.D.). (b) Resting cultured T cells from one AT patient, one NBS and one normal donor were �-irradiated (2 Gy),induced to proliferate with PHA, harvested at 7 days and analyzed by flow cytometry after PI staining. Survival of irradiatedlymphocytes was normalized to survival of unirradiated cells (bars, mean ± S.D. of 10 replicates in a single experiment). (c)�-H2AX analysis after 2 Gy �-IR. Resting cultured T lymphocytes were irradiated, harvested after 1 h and stained withanti-�-H2AX mAb as primary antibody and with Alexa 546-conjugated goat anti-mouse as secondary Ab. (d) DSB repairafter 2 Gy �-IR. Resting cultured T lymphocytes from two AT patients, two NBS and two normal donors were irradiated,harvested at 24, 48 and 72 h and stained with anti-�-H2AX mAb as primary antibody and with Alexa 546-conjugated goatanti-mouse as secondary Ab. The background number of foci in unirradiated cells was subtracted from the number of focii tha

tps3apP(ptwtpD

n the irradiated samples. Without irradiation, cells had less

he phosphorylation of its target residues Chk2-Thr68 and53-Ser15 [10]. Time-dependent analysis after 2 Gy IR (Fig. 6d)howed an ATM-pSer1981 signal increase that was 13-fold ath in normal T cells. Chk2-pThr68 increased 5-fold 30 minfter IR and an electroforetic shift corresponding to the hyper-hosphorylated form of Chk2 was clearly visible at 3 h (Fig. 6d).hosphorylation of p53-Ser15 increased substantially at 3 hFig. 6e). In the same cells, 0.05 �g/ml ActD induced autophos-horylation of ATM-Ser1981, though the increase was lesshan after IR (6-fold at 9 h) (Fig. 6d). Chk2-pThr68 increase

as also slightly reduced compared with IR (3-fold at 9 h) and

he lack of the electroforetic shift corresponding to the hyper-hosphorylated form of Chk2 indicated that the number ofSBs produced by this dose is not sufficient to induce full

n 0.5 foci/cell.

activation of Chk2 as in our previous study [39] (Fig. 6d). Inter-estingly, phosphorylation of p53-Ser15 rose substantially and,more important, the level of p53 accumulation was three timesthat induced by IR (Fig. 6e).

4. Discussion

Here we show that quiescent AT and NBS T lymphocytes areresistant to an apoptotic death pathway induced in normal

T cells by ActD and display a subtle, but defined DSB repairdefect following IR. A common consequence of these two dif-ferent alterations in the DSB response is apparent tolerance ofcells containing DSB.

910 d n a r e p a i r 5 ( 2 0 0 6 ) 904–913

Fig. 6 – The nature of the DSBs produced and the molecular pathway induced by ActD and IR. (a) Circulating lymphocytesand cultured T cells from three healthy donors were maintained in medium alone (×), in medium containing 20 �M of DRB(+), in medium containing ActD (0.5 �g/ml for circulating lymphocytes and 0.05 �g/ml for cultured T cells, ), in mediumalone following 0.5 Gy �-IR (♦), in medium alone following 2 Gy �-IR (�), in medium containing 20 �M of DRB following 0.5 Gy�-IR (�), or in medium containing 20 �M of DRB following 2 Gy �-IR (�). Cells were harvested at 24, 48 and 72 h and analyzedby flow cytometry after staining with PI. Cell survivals are normalized to survival in medium alone. One representativeexperiment out of three is shown. (b) DSB repair after �-IR and ActD treatment. Resting cultured T lymphocytes from onenormal donor were either irradiated (2 and 0.5 Gy �-IR) or treated with ActD (10 and 0.05 �g/ml) in the presence of thecaspase inhibitor ZVAD (100 �M). Cells were harvested at various times and stained with anti-�-H2AX mAb. As with the0.05 �g/ml ActD dose a longer time is required to produce the DSBs (6 h), the repair kinetics started from 9 h. Thebackground number of foci in untreated cells was subtracted from the number of foci in the treated samples. (c) Assessmentof the residual damage. Residual damage after �-IR and ActD treatments was expressed as the percentage of �-H2AX focistill present at 24 h on the maximum number of foci produced. In the case of 2 Gy �-IR this maximum was taken as30 foci/cell, though this is an underestimation. (d) Time course analysis of ATM-Ser1981 and Chk2-Thr68 phosphorylationfollowing �-IR and ActD. Western blot analysis was performed on resting normal T cells harvested before or at varioustimes after either 2 Gy �-IR or 0.05 �g/ml ActD treatment. Probing for vinculin checked lanes for protein content. (e) Timecourse analysis of p53 accumulation and p53-Ser15 phosphorylation following IR and ActD. Western blot analysis of restingnormal T cells harvested before or at various times after either 2 Gy �-IR or 0.05 �g/ml ActD treatment. Probing for �-actin

al is

checked lanes for protein content. Quantification of p53 sign

The ability of AT and NBS T cells to survive DNA dam-age induced by intercalating agents is only shared withimmature thymocytes [40 and our unpublished results],where it reflects a necessary tolerance to the DNA breaksthat normally occur during TCR rearrangements. However,

while resistance to DNA DSB-induced death correspondsto a physiological requirement in developing lymphocytes,it may become of pathological significance later as inef-ficient elimination of mature cells containing unresolved

shown normalized for the �-actin content.

DSBs would constitute a major contribution to an oncogenicrisk.

Our findings of caspase activation and phosphatidylserinetranslocation before the loss of membrane integrity representdirect evidence that ActD induces apoptosis. Our demonstra-

tion of the important role of ATM in this apoptotic path-way is consistent with the finding that mature T cells fromATM-deficient murine strains resist ActD doses that result inthe death of most cells from wild-type mice [40]. However,

( 2 0

opiitioiagmthctgaet

lsiaata[

atAtrAmAstnm[

fpdrdsbiNriodhDrh

d n a r e p a i r 5

ne notable difference between those previous data and ourresent work is that ActD death pathway seems to be p53-

ndependent in the mouse while it is clearly p53-dependentn humans (see below). Further support for the role of ATM inhis death pathway is the resistance to apoptosis we elicitedn normal lymphocytes with caffeine, a widely used inhibitorf ATM. Other cell types undergo ATM-dependent apoptosis:

n ATM knockout mice, developing neurons failed to undergopoptosis following treatment with either IR [41] or variousenotoxic compounds [42,43] and immature CD4+CD8+ thy-ocytes were resistant to the apoptosis normally occurring at

his developmental stage [44,45]. Lastly, normal murine anduman proliferating myoblasts, but not their differentiatedounterparts, the myotubes, undergo an ATM-mediated apop-otic pathway following irradiation [46]. In some cell types androwth phases, therefore, the requirement for ATM to medi-te apoptosis seems to override its role in DNA repair, andxplains the apparent tolerance to DNA damage observed inhe absence of ATM.

Our finding that the NBS1 protein is also necessary to directymphocytes to ActD-induced death is completely new. Thetrikingly similar resistance of AT and NBS cells to ActD-nduced death and our epistatic analysis on NBS cells withn inhibitor of ATM activity suggest that ATM and NBS1re regulators of the same apoptotic pathway, and highlighthe recently described NBS1 roles in both the control of thepoptotic pathway [24,47–50] and the activation of ATM itself51–53].

The finding of massive DNA damage with the comet assaynd early �-H2AX foci in ActD-treated cells indicates induc-ion of DNA DSBs. These DSBs may be the outcome of differentctD effects: they could be directly caused by ActD intercala-

ion into the DNA at transcriptionally active sites or be indi-ectly produced through the action of topoisomerases, sincectD is a topoisomerases poison [21,22]. However, the mini-al difference in the number of DSBs produced by doses ofctD differing by as much as 200-fold (7 with 0.05 �g/ml ver-us 12 with 10 �g/ml) is not easily explained and would suggesthat ActD-mediated induction of DSBs is a rate-limiting phe-omenon. Alternatively, DSBs accompanying ActD treatmentay stem from preapoptotic chromatin condensation (PACC)

54], a process induced by ActD and other agents.Defective DNA repair follows 2 Gy IR in quiescent T cells

rom AT and NBS patients. Elevated levels of �-H2AX fociersisted in T cells from AT donors, indicating a subtle yetefined DSB repair defect. This resembles in many respects theepair defect recently described in resting ATM- and Artemis-eficient fibroblasts, which proved incapable of rejoining amall fraction of IR-induced DSBs, the so called ‘dirty’ endreaks [35]. In that pathway, the nuclease activity of Artemis

s required for the processing of hairpin-like DSBs prior toHEJ [55,56]. This is similar to what happens during V(D)J

ecombination, where coding sequence ends generate hairpinntermediates whose resolution requires the nuclease activityf Artemis. DNA-PK is responsible for the phosphorylation-ependent activation of Artemis in V(D)J recombination. ATM,

owever, is required to hyperphosphorylate Artemis duringSB repair. NBS cells were here analyzed for the first time in

elation to this DSB repair pathway and were also shown toave a defect, albeit less prominent than that of AT lympho-

0 6 ) 904–913 911

cytes. This finding is consistent with the demonstration thatNBS1 is a component of this DSB rejoining pathway [35]. Theslightness of the defect might reflect the fact that NBS patientscarry hypomorphic mutations in Nbs1 gene that may conferresidual protein activity.

We observed that fluorescence intensity of �-H2AX foci waslower in AT and, to a lesser extent, in NBS cells than in normalcontrols, despite their comparable DNA damage. This suggeststhat at least in quiescent T lymphocytes ATM has a major rolein H2AX phosphorylation following DNA damage. This closedependence of H2AX phosphorylation on ATM kinase activityhad already been observed following �-irradiation in growth-saturated AT lymphoblastoid cells [57,58], while the redundantuse of multiple kinases has been demonstrated in activelyproliferating, irradiated cells [58,59]. Thus, there appear to begrowth conditions where ATM predominates in phosphorylat-ing this histone variant.

The reason why normal resting T cells repair DNA dam-age and survive after IR, but undergo apoptosis after ActD,may lie in differences in the nature of the DSBs induced orthe concomitant contribution of other ActD effects, includ-ing transcriptional inhibition. Our first set of experimentsto elucidate this matter demonstrated a highly compro-mised repair of ActD-induced DSBs and a weak synergisticeffect between transcriptional inhibition and DSBs in deathinduction and seem to point toward a peculiar nature ofActD-induced DSBs. From a molecular point of view, strongupregulation of p53 following ActD appears to be the driv-ing force that leads to apoptosis: p53 accumulation follow-ing ActD may cross a threshold beyond which apoptosis isinitiated [60].

In conclusion, we suggest that inefficient elimination ofmature, DSB-containing lymphocytes may make a substantialcontribution to the oncogenic risk of AT and NBS patients. Thisrisk might be particularly evident in quiescent lymphocytesof patients where the reduced elimination is associated withan increased rate of secondary V(D)J rearrangements [7,8], aknown source of DSBs. An interesting possibility is that T cellsperceive DSBs accompanying secondary V(D)J rearrangementsas DNA damage rather than as a physiologic event and henceactivate the ATM/Artemis damage response pathway we haveshown to be defective in AT and NBS T cells.

Acknowledgements

We thank Drs. G. Forni, University of Turin, Italy, and G. DelSal, University of Trieste, Italy, for their critical reading ofthe MS and comments. We gratefully acknowledge the con-tribution of Drs. A. Brusco, University of Turin, Italy, and A.Marchi, University of Pavia, Italy, for providing biological sam-ples from AT patients. We thank Dr. A. Lanzavecchia, IRB,Bellinzona, Switzerland for the rIL2-producing myeloma sys-tem and Dr. M. Moretti, University of Perugia, Italy for helpwith the comet assay. This work was partially supported bygrants from ‘Ministero dell’Istruzione, dell’Universita e della

Ricerca (MIUR-FIRB 2001), from ‘Regione Piemonte’ (RicercaScientifica Applicata 2003 and Ricerca Sanitaria Finalizzata2004), and from ‘Fondazione Enrico, Umberto e Livia Benassi’,Turin, Italy.

5 ( 2

r

912 d n a r e p a i r

e f e r e n c e s

[1] S. Desiderio, W.C. Lin, Z. Li, The cell cycle and V(D)Jrecombination, Curr. Top. Microbiol. Immunol. 217 (1996)45–59.

[2] S.D. Fugmann, I.J. Villey, L.M. Ptaszek, D.G. Schatz, TheRAG proteins and V(D)J recombination: complexes, ends,and transposition, Annu. Rev. Immunol. 18 (2000) 495–527.

[3] C.H. Bassing, K.F. Chua, J. Sekiguchi, H. Suh, S.R. Whitlow,J.C. Fleming, B.C. Monroe, D.N. Ciccone, C. Yan, K.Vlasakova, D.M. Livingston, D.O. Ferguson, R. Scully, F.W.Alt, Increased ionizing radiation sensitivity and genomicinstability in the absence of histone H2AX, Proc. Natl.Acad. Sci. U.S.A. 99 (2002) 8173–8178.

[4] G. Kelsoe, V(D)J hypermutation and receptor revision:coloring outside the lines, Curr. Opin. Immunol. 11 (1999)70–75.

[5] R. Mostoslavsky, F.W. Alt, Receptor revision in T cells: anopen question? Trends Immunol. 25 (2004) 276–279.

[6] C.J. McMahan, P.J. Fink, RAG reexpression and DNArecombination at T cell receptor loci in peripheral CD4+ Tcells, Immunity 9 (1998) 637–647.

[7] E. Lantelme, B. Palermo, L. Granziero, S. Mantovani, R.Campanelli, V. Monafo, A. Lanzavecchia, C. Giachino,Cutting edge: recombinase-activating gene expression andV(D)J recombination in CD4+CD3low mature Tlymphocytes, J. Immunol. 164 (2000) 3455–3459.

[8] E. Lantelme, S. Mantovani, B. Palermo, R. Campanelli, L.Granziero, V. Monafo, C. Giachino, Increased frequency ofRAG-expressing, CD4(+)CD3(low) peripheral T lymphocytesin patients with defective responses to DNA damage, Eur.J. Immunol. 30 (2000) 1520–1525.

[9] E. Lantelme, V. Turinetto, S. Mantovani, A. Marchi, S.Regazzoni, P. Porcedda, M. De Marchi, C. Giachino,Analysis of secondary V(D)J rearrangements in mature,peripheral T cells of ataxia-telangiectasia heterozygotes,Lab. Invest. 83 (2003) 1467–1475.

[10] Y. Shiloh, ATM and related protein kinases: safeguardinggenome integrity, Nat. Rev. Cancer 3 (2003) 155–168.

[11] S.G. Becker-Catania, R.A. Gatti, Ataxia-telangiectasia, Adv.Exp. Med. Biol. 495 (2001) 191–198.

[12] Y. Shiloh, Ataxia-telangiectasia and the Nijmegenbreakage syndrome: related disorders but genes apart,Annu. Rev. Genet. 1 (1997) 635–662.

[13] M. Digweed, K. Sperling, Nijmegen breakage syndrome:clinical manifestation of defective response to DNAdouble-strand breaks, DNA Repair 3 (2004) 1207–1217.

[14] F.G. Haluska, S. Finver, Y. Tsujimoto, C.M. Croce, The t(8;14) chromosomal translocation occurring in B-cellmalignancies results from mistakes in V–D–J joining,Nature 324 (1986) 158–161.

[15] T.H. Rabbitts, Chromosomal translocations in humancancer, Nature 372 (1994) 143–149.

[16] A. Agrawal, Q.M. Eastman, D.G. Schatz, Transpositionmediated by RAG1 and RAG2 and its implications for theevolution of the immune system, Nature 394 (1998)744–751.

[17] K. Hiom, M. Melek, M. Gellert, DNA transposition by theRAG1 and RAG2 proteins: a possible source of oncogenictranslocations, Cell 94 (1998) 463–470.

[18] M. Davila, S. Foster, G. Kelsoe, K. Yang, A role for

secondary V(D)J recombination in oncogenic chromosomaltranslocations? Adv. Cancer Res. 81 (2001) 61–92.

[19] G.J. Vanasse, P. Concannon, D.M. Willerford, Regulatedgenomic instability and neoplasia in the lymphoid lineage,Blood 94 (1999) 3997–4010.

0 0 6 ) 904–913

[20] M.J. Liao, T. Van Dyke, Critical role for Atm in suppressingV(D)J recombination-driven thymic lymphoma, Genes Dev.13 (1999) 1246–1250.

[21] K.M. Tewey, T.C. Rowe, L. Yang, B.D. Halligan, L.F. Liu,Adriamycin-induced DNA damage mediated bymammalian DNA topoisomerase II, Science 226 (1984)466–468.

[22] D.K. Trask, M.T. Muller, Stabilization of type Itopoisomerase-DNA covalent complexes by actinomycin D,Proc. Natl. Acad. Sci. U.S.A. 85 (1988) 1417–1421.

[23] W.U. Muller, J. Ciborovius, T. Bauch, C. Johannes, C.Schunck, U. Mallek, W. Bocker, G. Obe, C. Streffer, Analysisof the action of the restriction endonuclease AluI usingthree different comet assay protocols, Strahlenther Onkol.180 (2004) 655–664.

[24] G. Buscemi, C. Savio, L. Zannini, F. Micciche, D. Masnada,M. Nakanishi, H. Tauchi, K. Komatsu, S. Mizutani, K.Khanna, P. Chen, P. Concannon, L. Chessa, D. Delia, Chk2activation dependence on Nbs1 after DNA damage, Mol.Cell. Biol. 21 (2001) 5214–5222.

[25] R. Zandomeni, B. Mittleman, D. Bunick, S. Ackerman, R.Weinmann, Mechanism of action ofdichloro-beta-d-ribofuranosylbenzimidazole: effect on invitro transcription, Proc. Natl. Acad. Sci. U.S.A. 79 (1982)3167–3170.

[26] E.P. Rogakou, D.R. Pilch, A.H. Orr, V.S. Ivanova, W.M.Bonner, DNA double-stranded breaks induce histone H2AXphosphorylation on serine 139, J. Biol. Chem. 273 (1998)5858–5868.

[27] H.T. Chen, A. Bhandoola, M.J. Difilippantonio, J. Zhu, M.J.Brown, X. Tai, E.P. Rogakou, T.M. Brotz, W.M. Bonner, T.Ried, A. Nussenzweig, Response to RAG-mediated VDJcleavage by NBS1 and gamma-H2AX, Science 290 (2000)1962–1965.

[28] S. Burma, B.P. Chen, M. Murphy, A. Kurimasa, D.J. Chen,ATM phosphorylates histone H2AX in response to DNAdouble-strand breaks, J. Biol. Chem. 276 (2001)42462–42467.

[29] J.J. Cohen, Apoptosis, Immunol. Today 14 (1993) 126–130.[30] E.P. Rogakou, W. Nieves-Neira, C. Boon, Y. Pommier, W.M.

Bonner, Initiation of DNA fragmentation during apoptosisinduces phosphorylation of H2AX histone at serine 139, J.Biol. Chem. 275 (2000) 9390–9395.

[31] A. Blasina, B.D. Price, G.A. Turenne, C.H. McGowan,Caffeine inhibits the checkpoint kinase ATM, Curr. Biol. 9(1999) 1135–1138.

[32] P. Nghiem, P.K. Park, Y. Kim, C. Vaziri, S.L. Schreiber, ATRinhibition selectively sensitizes G1 checkpoint-deficientcells to lethal premature chromatin condensation, Proc.Natl. Acad. Sci. U.S.A. 98 (2001) 9092–9097.

[33] G.G. Jones, P.M. Reaper, A.R. Pettitt, P.D. Sherrington, TheATR-p53 pathway is suppressed in noncycling normal andmalignant lymphocytes, Oncogene 23 (2004) 1911–1921.

[34] E.P. Rogakou, C. Boon, C. Redon, W.M. Bonner, Megabasechromatin domains involved in DNA double-strand breaksin vivo, J. Cell Biol. 146 (1999) 905–916.

[35] E. Riballo, M. Kuhne, N. Rief, A. Doherty, G.C. Smith, M.J.Recio, C. Reis, K. Dahm, A. Fricke, A. Krempler, A.R. Parker,S.P. Jackson, A. Gennery, P.A. Jeggo, M. Lobrich, A pathwayof double-strand break rejoining dependent upon ATM,Artemis, and proteins locating to gamma-H2AX foci, Mol.Cell. 16 (2004) 715–724.

[36] K. Rothkamm, M. Lobrich, Evidence for a lack of DNAdouble-strand break repair in human cells exposed to very

low X-ray doses, Proc. Natl. Acad. Sci. U.S.A. 100 (2003)5057–5062.

[37] M. Lobrich, N. Rief, M. Kuhne, M. Heckmann, J.Fleckenstein, C. Rube, M. Uder, In vivo formation and

( 2 0

d n a r e p a i r 5

repair of DNA double-strand breaks after computedtomography examinations, Proc. Natl. Acad. Sci. U.S.A. 102(2005) 8984–8989.

[38] C.J. Bakkenist, M.B. Kastan, DNA damage activates ATMthrough intermolecular autophosphorylation and dimerdissociation, Nature 421 (2003) 499–506.

[39] G. Buscemi, P. Perego, N. Carenini, M. Nakanishi, L.Chessa, J. Chen, K. Khanna, D. Delia, Activation of ATMand Chk2 kinases in relation to the amount of DNA strandbreaks, Oncogene 23 (2004) 7691–7700.

[40] A. Bhandoola, B. Dolnick, N. Fayad, A. Nussenzweig, A.Singer, Immature thymocytes undergoing receptorrearrangements are resistant to an Atm-dependent deathpathway activated in mature T cells by double-strandedDNA breaks, J. Exp. Med. 192 (2000) 891–897.

[41] K.H. Herzog, M.J. Chong, M. Kapsetaki, J.I. Morgan, P.J.McKinnon, Requirement for Atm in ionizingradiation-induced cell death in the developing centralnervous system, Science 280 (1998) 1089–1091.

[42] M.R. Macleod, L. Ramage, A. McGregor, J.R. Seckl, ReducedNMDA-induced apoptosis in neurons lacking ataxiatelangiectasia mutated protein, Neuroreport 14 (2003)215–217.

[43] I.I. Kruman, R.P. Wersto, F. Cardozo-Pelaez, L. Smilenov,S.L. Chan, F.J. Chrest, R. Emokpae Jr., M. Gorospe, M.P.Mattson, Cell cycle activation linked to neuronal cell deathinitiated by DNA damage, Neuron 41 (2004) 549–561.

[44] C. Barlow, S. Hirotsune, R. Paylor, M. Liyanage, M. Eckhaus,F. Collins, Y. Shiloh, J.N. Crawley, T. Ried, D. Tagle, A.Wynshaw-Boris, Atm-deficient mice: a paradigm of ataxiatelangiectasia, Cell 86 (1996) 159–171.

[45] Y. Xu, D. Baltimore, Dual roles of ATM in the cellularresponse to radiation and in cell growth control, GenesDev. 10 (1996) 2401–2410.

[46] L. Latella, J. Lukas, C. Simone, P.L. Puri, J. Bartek,Differentiation-induced radioresistance in muscle cells,Mol. Cell. Biol. 24 (2004) 6350–6361.

[47] K.M. Cerosaletti, P. Concannon, Nibrin forkhead-associateddomain and breast cancer C-terminal domain are bothrequired for nuclear focus formation and phosphorylation,

J. Biol. Chem. 278 (2003) 21944–21951.

[48] J. Falck, J.H. Petrini, B.R. Williams, J. Lukas, J. Bartek, TheDNA damage-dependent intra-S phase checkpoint isregulated by parallel pathways, Nat. Genet. 30 (2002)290–294.

0 6 ) 904–913 913

[49] J.H. Lee, B. Xu, C.H. Lee, J.Y. Ahn, M.S. Song, H. Lee, C.E.Canman, J.S. Lee, M.B. Kastan, D.S. Lim, Distinct functionsof Nijmegen breakage syndrome in ataxia telangiectasiamutated-dependent responses to DNA damage, Mol.Cancer Res. 1 (2003) 674–681.

[50] C. Lukas, J. Falck, J. Bartkova, J. Bartek, J. Lukas, Distinctspatiotemporal dynamics of mammalian checkpointregulators induced by DNA damage, Nat. Cell Biol. 5 (2003)255–260.

[51] J.H. Lee, T.T. Paull, Direct activation of the ATM proteinkinase by the Mre11/Rad50/Nbs1 complex, Science 304(2004) 93–96.

[52] Z. Horejsi, J. Falck, C.J. Bakkenist, M.B. Kastan, J. Lukas, J.Bartek, Distinct functional domains of Nbs1 modulate thetiming and magnitude of ATM activation after low dosesof ionizing radiation, Oncogene 23 (2004) 3122–3127.

[53] J.H. Lee, T.T. Paull, ATM activation by DNA double-strandbreaks through the Mre11–Rad50–Nbs1 complex, Science308 (2005) 551–554 (Erratum in: Science 308 (2005)1870).

[54] K. Andreau, M. Castedo, J.L. Perfettini, T. Roumier, E.Pichart, S. Souquere, S. Vivet, N. Larochette, G. Kroemer,Preapoptotic chromatin condensation upstream of themitochondrial checkpoint, J. Biol. Chem. 279 (2004)55937–55945.

[55] P.A. Jeggo, M. Lobrich, Artemis links ATM to double strandbreak rejoining, Cell Cycle 4 (2005) 359–362.

[56] M. Lobrich, P.A. Jeggo, Harmonising the response to DSBs:a new string in the ATM bow, DNA Repair 4 (2005) 749–759(Review).

[57] P.M. Girard, E. Riballo, A.C. Begg, A. Waugh, P.A. Jeggo,Nbs1 promotes ATM dependent phosphorylation eventsincluding those required for G1/S arrest, Oncogene 21(2002) 4191–4199.

[58] T. Stiff, M. O’Driscoll, N. Rief, K. Iwabuchi, M. Lobrich, P.A.Jeggo, ATM and DNA-PK function redundantly tophosphorylate H2AX after exposure to ionizing radiation,Cancer Res. 64 (2004) 2390–2396.

[59] H. Wang, M. Wang, H. Wang, W. Bocker, G. Iliakis,Complex H2AX phosphorylation patterns by multiple

kinases including ATM and DNA-PK in human cellsexposed to ionizing radiation and treated with kinaseinhibitors, J. Cell. Physiol. 202 (2005) 492–502.

[60] D.W. Meek, The p53 response to DNA damage, DNA Repair3 (2004) 1049–1056 (Review).