Physiologia Plantarum 144: 210–224. 2012 Copyright © Physiologia Plantarum 2011, ISSN 0031-9317

Molecular characterization of novel TaNAC genes in wheatand overexpression of TaNAC2a confers drought tolerancein tobaccoYiMiao Tanga,†, MeiYing Liua,b,†, ShiQing Gaoa,†, Zhao Zhanga,b, Xin Zhaoa, ChangPing Zhaoa,∗,FengTing Zhanga and XuePing Chenb,∗

aBeijing Engineering and Technique Research Center of Hybrid Wheat, Beijing Academy of Agricultural and Forestry Science, Beijing 100097,People’s Republic of ChinabDepartment of Chemistry, University of Science and Technology of China, Hefei 230026, People’s Republic of China

Correspondence*Corresponding authors,e-mail: cp_zhao@vip.sohu.com,chenxp08@ustc.edu.cn

Received 29 July 2011;revised 21 August 2011

doi:10.1111/j.1399-3054.2011.01539.x

Plant-specific NAC (NAM/ATAF/CUC) transcription factors (TFs) have beenreported to play a role in diverse stress responses and developmentalprocesses. We show here that six new genes encoding NAC TFs in wheat(Triticum aestivum) were identified (named as TaNAC2a, TaNAC4a, TaNAC6,TaNAC7, TaNAC13 and TaNTL5, respectively), and we classified them intothree groups: stress-related NACs, development-related NACs and NTLs(membrane-associated TFs belonging to NAC) by phylogenetic analysis.All TaNACs were induced by one or several kinds of stress treatmentsincluding dehydration, salinity and low temperature, whereas different genesshowed different expression levels. All these TaNACs, except TaNAC7, wereproven to have transcriptional activation activity in the yeast strain AH109by transactivation analysis. Furthermore, subcellular localization analysisrevealed that four TaNAC:GFP (green fluorescent protein) fusion proteins werelocalized in the nucleus, TaNAC2a:GFP mainly located in the nucleus and theplasma membrane, TaNTL5:GFP was associated with the membrane, whiletruncated TaNTL5(�TM):GFP (lacking the transmembrane motif) was detectedexclusively in the nucleus. Semi-quantitative reverse transcription polymerasechain reaction analysis demonstrated that five genes exhibited organ-specificexpression. Transgenic tobacco plants overexpressing TaNAC2a showedhigher fresh weight and dry weight than non-transgenic plants underdrought condition, which indicated that the transgene improved tobaccotolerance to drought treatment. Together, these results provided a preliminarycharacterization of six TaNACs, which possessed a potential role in improvingstress tolerance and the regulation of development in wheat, and suggestedthat TaNAC2a was potentially useful for engineering drought tolerant plants.

Abbreviations – ABA, abscisic acid; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFP, green fluorescent protein;MTFs, membrane-associated transcription factors; NAC, NAM/ATAF/CUC; NAM, NO APICAL MERISTEM; NTL, membrane-associated transcription factor belonging to NAC; ORF, open reading frame; RT-PCR, reverse transcription polymerase chainreaction; TF, transcription factor; TM, transmembrane motif; WT, wild-type.

†These authors contributed equally to the article.

210 Physiol. Plant. 144, 2012

Introduction

In plants, more than 50 families of different tran-scription factors (TFs) have been identified based onsequence analysis in model species such as Arabidop-sis and rice (Riechmann et al. 2000, Xiong et al. 2005,Riano-Pachon et al. 2007). Numerous reports demon-strate that TFs are necessary for plant development andcrucial in the conversion of stress signal perception tostress-responsive gene expression (Shinozaki et al. 2003,Kacperska 2004). Among these TFs, NAM/ATAF/CUC(NAC) comprise one of the largest TFs families (Ernstet al. 2004), containing 106 and 149 predicted membersin Arabidopsis and rice genomes, respectively (Gonget al. 2004, Xiong et al. 2005). Members of this familyhave a highly conserved N-terminal NAC domain anda variable C-terminal transcriptional regulation domain(Ernst et al. 2004, Olsen et al. 2005).

The NAC domain originally derives from the NAM(NO APICAL MERISTEM) gene in petunia, and theATAF1, ATAF2, CUC2 genes in Arabidopsis (Souer et al.1996, Aida et al. 1997, 1999). NAC family genes areinvolved in the development and morphogenesis of var-ious plant systems that early mutations in NAM geneslead to failing to form shoot apical meristems which indi-cates that NAM participates in determining the positionof the shoot apical meristem and primordia in Petunia(Souer et al. 1996).

NAC proteins appear to be widespread in land plantsbut no homolog has been identified thus far in othereukaryotes (Riechmann et al. 2000). In addition, NACproteins have been reported to contribute to patternformation in embryos and seed quality (Sperotto et al.2009), senescence (John et al. 1997, Guo and Gan 2006,Balazadeh et al. 2008, Kim et al. 2009) and flower devel-opment (Sablowski and Meyerowitz 1998, Kim et al.2007a). NAC proteins are also thought to participate inplant’s responses to pathogens, viral infections and envi-ronmental stimuli (Xie et al. 1999, Collinge and Boller2001, Kim et al. 2007b). Moreover, ATAF, a subfamilyof NAC TFs, are important regulators of plants responsestoward pathogen attack and wounding (Collinge andBoller 2001, Hegedus et al. 2003, Delessert et al. 2005,Ohnishi et al. 2005, Selth et al. 2005, Wang et al. 2009).Recently, some NAC TFs were revealed to have veryimportant functions in secondary wall formation (Kuboet al. 2005, Zhong et al. 2006, Mitsuda et al. 2007,Yamaguchi et al. 2011).

In Arabidopsis, overexpression of ANAC019,ANAC055 or ANAC072 alters the expression of manystress-inducible genes in transgenic plants and con-fers a constitutive increase in drought tolerance (Tranet al. 2004). Transgenic rice with SNAC1 overexpression

exhibits 22–34% higher seed setting than the negativecontrol population in the field when severe droughtstress was imposed during the reproductive stage (Huet al. 2006). As a transcriptional activator in responseto abiotic and biotic stresses, transgenic rice plants ofOsNAC6 have improved drought tolerance (Nakashimaet al. 2007). Furthermore, CUC1/CUC2 from Arabidop-sis plays roles in controlling the formation of boundarycells in meristems (Aida et al. 1997); AtNAC1 mediatesauxin signaling to promote lateral root development (Xieet al. 2000).

Recently, it was found that at least 18 members aremembrane-associated TFs (MTFs) in Arabidopsis, andfive in rice (Kim et al. 2006, 2008, 2010). Virtually all ofthe reported plant MTFs are closely relevant to the plantresponse to various abiotic stresses (Seo et al. 2008).NTL8 is affected by abiotic stresses, particularly highsalt, and it may be involved in root development (Kimet al. 2008). OsNTL genes are induced by diverse abi-otic stress conditions: OsNTL2, OsNTL3, OsNTL4 andOsNTL5 genes are induced by high salinity and man-nitol; OsNTL3 and OsNTL4 genes are induced by coldand heat (Kim et al. 2010).

Wheat is a major crop, which provides calories andnutrients in the diets for the population worldwide.Extensive work about NAM genes has been carriedout, which may facilitate the functional elucidation ofthis large family (Uauy et al. 2006, Waters et al. 2009)to characterize more NAC TFs from wheat (Triticumaestivum). In recent years, NAC research in wheat, par-ticularly related to abiotic and biotic stresses genes,was studied. Xia et al (2010a) found a novel NAC TFgene TaNAC8 in wheat, which responded to stripe rustpathogen infection and abiotic stresses. Xia et al (2010b)also identified TaNAC4 TF gene involved in defenseresponse against stripe rust pathogen infection and abi-otic stresses. TaNAC69 from the NAC superfamily of TFswas upregulated by abiotic stresses in wheat and rec-ognized two consensus DNA-binding sequences (Xueet al. 2006). Transgenic bread wheat overexpression ofTaNAC69 enhanced transcript levels of stress upregu-lated genes and dehydration tolerance (Xue et al. 2011).

In this study, we describe the characterization ofsix new NAC genes (TaNACs, named as TaNAC2a,TaNAC4a, TaNAC6, TaNAC7, TaNAC13 and TaNTL5)in wheat and investigate the expression profiles undervarious stress treatments, the tissue-specific expressionand the localization of the constructed TaNAC:GFP(green fluorescent protein) fusion proteins. Besides, wehave proved that five out of six TaNAC proteins demon-strated transcriptional activation activities in yeast. Andoverexpression of TaNAC2a could significantly enhancedrought tolerance in tobacco. These results provide

Physiol. Plant. 144, 2012 211

useful information for further investigation of TaNACs’functions in growth, development and response to stresstreatments.

Materials and methods

Isolation and cloning of TaNAC genes

To identify NAC family genes in wheat, the amino acidsequences of OsNACs from rice were used as querysequences to search the database of UniGene/Triticum_aestivum (ftp://ftp.ncbi.nih.gov/repository/UniGene/Triticum_aestivum/), using the TBLASTN program with ane-value of 1e–3 to obtain adequate hits. DifferentOsNACs were used to interrogate the database, andthe returned results were compared to each other.The CAP3 Sequence Assembly Program (http://pbil.univ-lyon1.fr/cap3.php) was then used to assemble thesearched TaNAC genes (Huang and Mahan 1999). Openreading frames (ORFs) were detected with the ORF FINDER

at NCBI. We then conducted reverse transcription poly-merase chain reaction (RT-PCR) to confirm these results.Gene-specific primers listed in Table S1 were designedto obtain full-length cDNA.

Sequence alignment and phylogenetic analysis

A multiple sequence alignment was performed usingCLUSTALX 1.81 with default settings (Thompson et al.1997). These amino acid sequences of the fol-lowing known NAC proteins: SNAC1, OsNAC4,OsNAC6, ONAC300, CUC1, Petunia NAM, OsNTL5and OsNTL6 were used besides the six newly clonedTaNACs. Motif detection was performed with TMHMM

SERVER V.2.0 (http://www.cbs.dtu.dk/services/TMHMM/).For phylogenetic analysis, NAC domain sequences wereextracted from their protein sequences with SCANPROSITE

(http://www.expasy.ch/tools/scanprosite/). An unrootedphylogenetic tree was generated by the Neighbor-joiningmethod using MEGA 4.0 software (Tamura et al. 2007).

Plant materials and stress treatments

To study the tissue-specific expression of TaNAC genes,wheat (T. aestivum) ‘Jingdong 17’ seedlings generallygrown in the field were used. At the four-leaf stage, theroots, leaves and stems were collected, and the senes-cent leaves and immature seeds were harvested at thegrain filling stage. To study the expression of TaNACgenes under different stress treatments, ‘Jingdong17’ wastreated as follows: for the dehydration treatment, 2-week-old plants after germination were carefully pulledout and washed gently with water to remove soil and

then transferred onto filter paper for rapid dehydration;for the salt stress and abscisic acid (ABA) treatments, 13-day-old seedlings were transferred to either 200 mMNaCl or 100 μM ABA for different periods of time.Low-temperature treatment was conducted by transfer-ring seedlings to water that was maintained at 4◦C. Afterexposure to treatments for indicated durations, the wheatplants were immediately frozen in liquid nitrogen andkept at −80◦C for further analysis.

RNA extraction and semi-quantitative RT-PCR

Total RNA was extracted from treated materials withTrizol (Tiangen Biotech., Beijing, China) according tothe manufacturer’s instructions. First-strand cDNA syn-thesis was performed using TaKaRa cDNA synthesis kit(TaKaRa, Dalian, China). For semi-quantitative RT-PCR,wheat GAPDH (cytosolic glyceraldehyde-3-phosphatedehydrogenase, AF251217) was used as an internal con-trol for organ-specific and stress-responsive expressionstudies. The PCR parameters used for GAPDH wereas follows: 94◦C for 5 min, 28 cycles of 94◦C for 30 s,58◦C for 40 s and 72◦C for 1 min. The analysis of TaNACgenes expression was carried out with the same PCR pro-cedure as that of GAPDH or with an adjusted annealingtemperature. Primers for each TaNAC and GAPDH weredesigned using PRIMER PREMIER 5.0 and are shown inTable S2.

Subcellular localization analysis

The ORFs of TaNAC cDNAs were ligated into thepCaMV35S-GFP vector, resulting in an in-frame fusionprotein of GFP gene and the TaNAC ORFs. Theconstruct (p35S:GFP-TaNAC) and the control vector(pCaMV35S-GFP) were transformed into onion epider-mal cells by particle bombardment using a BiolisticPDS-1000/He gene gun system (BIO-RAD, Hercules,CA, USA). After 24 h at 25◦C incubation of transformedonion epidermal cells, GFP signal was detected by aconfocal fluorescence microscope (LSM510 Meta; Zeiss,Jena, Germany). The primers flanked with restriction sitesfor subcloning are listed in Table S3.

Transcriptional activation analysis in yeast

To investigate the transcriptional activation activity,the TaNAC ORFs were fused in-frame with GAL4DNA-binding domain in pGBKT7 to construct vectors.The pGBKT7 was used as a negative control. Thesedifferent constructs were transformed into yeast strainAH109. The transformants were streaked on the SD/Trp-and SD/Trp-/His-/Ade- medium. After incubation at 28◦C

212 Physiol. Plant. 144, 2012

for 3 days, the growth status of the transformants wasevaluated. The β-galactosidase filter assay was carriedout according to the manufacturer’s instructions. Primersfor PCR amplification are provided in Table S4.

Construction of plant expression vectorsand tobacco transformation

The full-length cDNA of TaNAC2a was cloned intothe plant expression vector pBI121 under the con-trol of the cauliflower mosaic virus 35S promoter. Theresultant construct, pBI121-TaNAC2a, was transformedinto tobacco (Nicotiana tabacum) by Agrobacterium-mediated transformation method to generate transgenictobacco plants (Voelker et al. 1987). The trans-genic plants were confirmed by PCR with primers(F: CTACGACGACATCCAGAGCAT; R: TCTCAGACACGACGACGCAT).

Drought tolerance assay

To obtain full-grown tobacco plants, seeds were sown inpots containing vermiculite soaked with half-strengthHoagland nutrient solution. After 1 month, some ofthe transgenic and wild-type (WT) tobacco seedlingswere collected to analyze the expression level ofTaNAC2a gene using RT-PCR method, and others weretransferred into big pots (30-cm diameter upper part,20-cm diameter lower part, with a height of 50 cm)and grown in a greenhouse (16 h light 27◦C/8 h dark23◦C cycles) for 3 months. The plants were subjectedto drought stress with no water for 45 days and thenre-watered for 7 days for restored growth to detect theperformance of the transgenic plants. The plants wereharvested and then the fresh weight and dry weight weredetermined.

Results

The identification and analysis of TaNAC genes

A total of 52 putative NAC family genes were obtainedusing the CAP3 Sequence Assembly Program and theORF FINDER program, and the full-length cDNAs of 17novel NAC family genes were identified by RT-PCR(Yi-miao, unpublished data). The NAC genes describedin this paper were named as TaNAC2a, TaNAC4a,TaNAC6, TaNAC7, TaNAC13 and TaNTL5, accordingto the NCBI protein BLAST results and phylogenetic ana-lysis. All of the TaNAC genes were new members ofthe NAC family in wheat except TaNAC2a, which hada high degree of similarity at the amino acid level com-paring with previously cloned TaNAC2 (identity 96%,AY625683, Xue 2005). The wheat TaNAC sequences

identified in this work have been submitted to GenBankunder the following accession numbers: HM027571-HM027574, HM027576 and HM027577.

The protein sequence alignment is shown in Fig. 1A.The TaNAC TFs shared a highly conserved N-terminalDNA-binding domain that consists of five consensussubdomains (a–e) and a highly variable C-terminaltranscriptional regulation domain. NTLs (membrane-associated transcription factor belonging to NAC) pos-sessed a NAC domain in their N-terminal regions anda transmembrane motif (TM) in their far C-terminalregions. In view of the analysis of other proteins withknown functions, our newly identified TaNACs wereprovisionally and putatively divided into three groupsaccording to their relatives’ function and the phylo-genetic tree (Fig. 1B): stress-related NACs (group I),including TaNAC2a, TaNAC4a, TaNAC6; development-related NAM/CUCs (group II), including TaNAC7 andTaNAC13; and NTLs (group III) including TaNTL5.Membrane-associated NAC was designated NTL forthe NTM1-like (NAC with transmembrane motif 1-like)domain. NTL4, NTL7, NTL11 and OsNTL4, OsNTL5,OsNTL6 in group III are NTLs from the Arabidopsis andrice genomes respectively (Kim et al. 2010). TaNTL5was the first membrane-associated NAC TFs from wheatwhich had a large similarity (identity 73%) to OsNTL5.

Expression profiles of TaNAC genes underdifferent stresses

The expression patterns of TaNAC genes in the wholeseedlings under various stress treatment were inves-tigated. As shown in Fig. 2A, for dehydration, theexpression levels of TaNAC2a increased gradually andreached its maximum at 5 h, then remained at this level.TaNAC4a transcript levels were slightly higher at 1 hthan at 0 h, then declined to the lowest level at 2 h, aftermaintaining this level for at least 10 h, the expressionlevel recovered by 24 h. Notably, TaNTL5 transcriptlevels were dramatically downregulated by dehydration,while the expression levels of TaNAC6 were slightlyincreased and maintained steadily after a 5-h exposureto dehydration.

With salt treatment, the expression levels of TaNAC2adecreased to a low level and then gradually accumu-lated, with a higher expression level at 24 h whencompared to the untreated control. For TaNAC4a,the expression reached a maximum at 1 h and thendecreased to a very low level at 24 h. TaNAC6 reachedmaximum expression at 5 h and maintained at a steadylevel through the following durations. TaNTL5 tran-script levels declined to the lowest level at 2 h afterthe treatment and then increased gradually, but got to

Physiol. Plant. 144, 2012 213

(a)

(b)

(c)

A B

(e)

(d)

(c)

Fig. 1. Multiple sequence alignment and phylogenetic analysis of TaNAC. (A) Comparison of the amino acid sequences of TaNAC and relatedproteins (by CLUSTALX program). The boxes labeled (a–e) indicate subdomains of the NAC domains already known. The putative nuclear localizationsignal sequences are underlined. TMs of NTLs (OsNTL5, TaNTL5 and OsNTL6) are shown by box in their far C-terminal regions. Part of the amino acidsequences in the C-terminal was deleted due to lack of space. (B) Phylogenetic analysis of the TaNAC TFs and other known NAC proteins. The aminoacid sequences of the NAC domain proteins were aligned by CLUSTALX, the phylogenetic tree was constructed using MEGA 4.0 and the neighbor-joiningmethod with the following parameters: poisson correction, pairwise deletion and bootstrap (replicates 1000; random seed 64238). The numbers atthe nodes indicate the bootstrap values. The bar at the bottom indicates the relative divergence of the sequences examined. GenBank accessionnumbers for the genes that were listed as gene names in the analysis were as follows: ATAF2: CAA52772.1; OsNAC6: BAA89800.1; TaNAC6:HM027571; ATAF1: CAA52771.1; OsNAC3: BAA89797.1; GRAB1: CAA09371.1; TaNAC4: GQ985329; TaNAC4a: HM027576; SNAC1: AEG21060.1;TaNAC2: AEI00650.1; TaNAC2a: HM027577; NTL11: NM_120523; NTL4: NM_111885; OsNTL6: NM_001055094; OsNTL5: NM_001069053; TaNTL5:HM027574; OsNTL4: NM_001070082; NTL7: NM_103142; OsNAC7: BAA89801.1; TaNAC7: HM027572; CUC2: BK007973.1; NAM: ADE34618.1;CUC1: ACB31158.1; ONAC300: AB182278; TaNAC13: HM027573; GRAB2: AJ010830.

214 Physiol. Plant. 144, 2012

(A)

(B)

(C)

(D)

Fig. 2. The expression profiles of TaNAC genes in the whole seedlings under various treatments (A–C) and in different organs at four-leaf stage (D).(A) The expression profiles of stress-related TaNAC and TaNTL genes under various treatments. Total RNA was isolated from 2-week-old seedlingsthat were exposed to dehydration, NaCl and cold for the indicated times. Wheat GAPDH was amplified as an internal control. (B) The expressionpatterns of development-related TaNAC7 and TaNAC13 under various treatments. (C) Comparison of the expression patterns of stress-related TaNACand TaNTL5 under dehydration and ABA. (D) The expression of TaNAC genes in different organs at four-leaf stage. Transcript levels of six TaNACgenes were examined in five types of tissues: leaves (L); stems (S); roots (R) at the four-leaf stage, senescence leaves (SL) and immature seeds (IS) atthe grain filling stage.

a lower level at 24 h when compared to the untreatedcontrol. With cold treatment, TaNAC2a and TaNTL5transcript levels were not affected; however, TaNAC4awas strongly induced by cold stress and demonstratedstable elevated expression. TaNAC6 was also responsiveto cold stress and was induced to a steady high level.

The expression profiles of TaNAC7 and TaNAC13,which were classified as development-related NAM/CUCs, are listed separately (Fig. 2B). The transcript levelsof these two genes were both regulated by dehydration,salt and cold stress. For each of the two genes, threekinds of stress induced similar expression patterns. Asfor TaNAC7, the transcript levels were maintained stablyafter 24 h treatment, while for TaNAC13, the transcriptlevels remained invariant after being subjected to the

treatment for 2 or 5 h; however, both genes showedhigher expression levels compared to the untreated con-trols.

It is known that NAC TFs could regulate droughtstress response through both ABA-dependent andABA-independent pathways (Fujita et al. 2004, Tranet al. 2004). Thus, in our assays, we compared theexpression profiles induced by dehydration and ABA,and wanted to know whether there was a correlationbetween these two conditions. As shown in Fig. 2C, theexpression patterns of TaNAC4a induced by dehydrationand ABA were similar, and the same circumstance wasobserved for TaNAC6. As stress-related genes, TaNAC4aand TaNAC6 expression may be associated with thedehydration response in an ABA-dependent pathway

Physiol. Plant. 144, 2012 215

due to the same expression response in these twokinds of stress. The transcript levels of TaNTL5 underABA treatment were the same as the control, but weredownregulated by dehydration. TaNAC2a displayed anopposite expression tendency when subjected to dehy-dration and ABA.

Expression of TaNAC genes in plant organs

To reveal the expression patterns of the TaNAC genesin different organs, semi-quantitative RT-PCR was per-formed using cDNA from leaves, stems, roots (at four-leafstage), senescent leaves and immature seeds (at grain fill-ing stage). The results (Fig. 2D) showed that five TaNACgenes exhibited organ-specific expression (excludingTaNAC7). TaNTL5 was highly expressed in leaves (boththe same in young leaves and senescent leaves) compar-ing with other organs. TaNAC2a showed much higherexpression level in leaves (both the same in youngleaves and senescent leaves) than in stems as well asroots, and no expression was detected in seeds. TaNAC6and TaNAC13 were expressed exclusively in leaves, andthe expression level was higher in senescent leaves thanin young leaves. TaNAC4a expression was detectedin four-leaf stage seedlings, with higher expression inleaves than stems and roots, and no expression wasobserved in senescent leaves or immature seeds. Thetissue-specific expression of TaNAC genes suggestedthat they were involved in diverse roles during wheatgrowth and development.

Subcellcular localization analysis of TaNAC proteins

To investigate the subcellular localization of TaNACproteins, the ORFs of TaNAC genes were fused in-framewith GFP to their C-terminus. The constructs were tran-siently expressed in onion epidermal cells. As shown inFig. 3A, the GFP signals of four TaNAC fusion proteinswere located exclusively within the nucleus, exceptfor TaNAC2a, signals of which were detected in thenucleus as well as in the plasma membrane. In contrast,cells transformed with GFP alone displayed fluorescencesignals both in the cytoplasm and nucleus.

To examine the membrane association of TaNTL5,the GFP coding sequence was fused in-frame to the 5′

end of the full-length TaNTL5 gene [TaNTL5(full):GFP]or of a truncated form devoid of the sequence encod-ing the TM [TaNTL5(�TM):GFP]. The fusion constructswere transiently expressed in onion epidermal cells. Asshown in Fig. 3B, for TaNTL5(full):GFP, the GFP signalswere detected in the plasma membrane as well as inthe nucleus. In contrast, TaNTL5(�TM):GFP (containingamino acid residues 1–320 and lacking the TM) was

detected exclusively in the nucleus. These resultssuggested that TaNTL5 was a bona fide membrane-associated protein.

Transactivation activity of TaNAC TFs

Most of the characterized NAC TFs had been reportedto have a C-terminal transactivation region (Robertson2004, Fujita et al. 2006). Both the full-length amino acidsequence and the C-terminal domain alone had tran-scription activation activity (Jensen et al. 2007, Lu et al.2007). The transcriptional activation assay was investi-gated using the yeast one-hybrid system. As shown inFig. 4, all of the yeast transformants, including thosecontaining only the vector control pGBKT7, grew wellon the SD medium lacking tryptophan (Trp−) that wasused for the selection of transformants (normal growthcontrol). On the other hand, when the same transfor-mants were streaked on SD medium lacking tryptophan,histidine and adenine (Trp−/His−/Ade−), yeast transfor-mants carrying the fusion plasmids were able to growwell, whereas transformant-containing pGBKT7 couldnot. The only exception was TaNAC7, which behavedthe same as empty pGBKT7 vector alone. TaNAC7 couldnot activate HIS3 and ADE2 reporter genes in yeast.Additionally, in the presence of 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal), the yeast cellsgrown on the SD (Trp−/His−/Ade−) turned blue, indicat-ing that the other reporter gene, LacZ, was also activated.Our work indicated that all of the TaNAC TFs investi-gated in this study could function as transcriptionalactivators except TaNAC7.

Overexpression of TaNAC2a in transgenic tobaccoimproved drought tolerance

In order to test the in vivo function of TaNAC2a, trans-genic tobacco plants overexpressing this gene weregenerated. The T2 generations of four homozygoustransgenic lines, overexpression line 1 (OE1), overex-pression line 2 (OE2), overexpression line 3 (OE3) andoverexpression line 4 (OE4), were used for drought tol-erance assay. The expression of TaNAC2a in transgenictobacco plants was confirmed by RT-PCR and no bandwas detected in WT (Fig. 5). In normal conditions, after2 months the transgenic plants grow normally comparedto WT plants (Fig. 6A). As shown in Fig. 6B, after re-watering 7 days for restored growth followed by 45 daysof drought stress, the lower half leaves of the transgenicplants had withered, but the upper half leaves remainedvigorous; while the WT plants could not survive, sug-gesting that overexpression of TaNAC2 could improvedrought tolerance in transgenic tobacco plants. The fresh

216 Physiol. Plant. 144, 2012

(A) (B)

Fig. 3. The subcellular localization of TaNAC proteins. (A) The nuclear localization of TaNAC proteins. The TaNAC:GFP fusion proteins, driven by the35S promoter, were transiently expressed in onion epidermal cells and analyzed by fluorescence microscopy. GFP alone was used as a negative control.The left column shows cells viewed in the dark field, with green fluorescence excited by blue light. The micrograph obtained under bright light andthe merged images are shown in middle and right columns, respectively. (B) The subcellular localization of TaNTL5(full):GFP and TaNTL5�TM:GFP.Fusion constructs were transiently expressed in onion epidermal cells and analyzed by fluorescence microscopy.

weight of the transgenic plants was higher than that ofwide-type, and the difference was significant betweenOE1, OE2, OE4 and WT (Fig. 7). As for the dry weight,OE1- and OE2-transgenic lines were significantly higherthan WT. The dry weight of OE3- and OE4-transgenicline was also higher than that of WT, but the differ-ence was not significant. The results suggested that theTaNAC2a-transgenic tobacco plants could accumulatemore biomass than wide-type under drought stress.

Discussion

Systematical analysis of NAC TFs have been performedin Arabidopsis, rice and soybean (Ooka et al. 2003,

Fang et al. 2008, Tran et al. 2009). However, relativelyfew wheat NAC genes were studied up to now. In thisarticle, we isolated six NAC genes in wheat. Structuralanalysis of the TaNAC proteins indicated that they pos-sessed the highly conserved N-terminal DNA-bindingdomain containing five typical motifs (Fig. 1A), whichwas consistent with previous report (Ooka et al. 2003).Further analysis of the a–e subdomain indicated thateach group of the proteins contained unique amino acidsequences. For instance, in subdomain c, for all of theNTLs (18 from Arabidopsis, 5 from rice and 1 fromwheat; Fig. 1A showed only three of them in the multi-ple alignment; Kim et al. 2010), there were two aminoacid residues before the conserved ‘WYF’ that had not

Physiol. Plant. 144, 2012 217

Fig. 4. Analysis of transcriptional activation activity of six TaNAC TFs. Fusion proteins containing the GAL4 DNA-binding domain and TaNAC wereexpressed on SD (Trp−/His−/Ade−) medium in the yeast strain AH109, and the vector pGBKT7 was expressed as negative control on the right side ofthe medium (the left column). All yeast transformants were streaked on SD (Trp−) as the normal growth control (including the PGBKT7 vector only,the middle column). Plates were incubated for 3 days and subjected to the β-galactosidase assay (the right column). All results were repeated forthree times and representative results are shown here.

218 Physiol. Plant. 144, 2012

Fig. 5. Detection of TaNAC2a expression level in transgenic plants byRT-PCR method. One-month-old tobacco seedlings were used to detectthe TaNAC2a expression level. There was no expression detected in WT.

(a)

(b)

Fig. 6. Drought tolerance assays of WT and TaNAC2a-overexpressingtransgenic tobacco plants. In normal conditions, after 2 monthsthe transgenic plants grow normally compared to WT plants.(B) Performance of WT control and TaNAC2a-overexpression tobaccoplants after 45 days drought stress and 7 days recovery. The transgenicplants were still alive while the WT plants could not survive.

been found in other NAC TFs thus far. In addition, stress-related NAC TFs might contain one conserved ‘P’ andone conserved ‘A’ in subdomain c and d, respectively,although more sequences needed to be included in thealignment. The detailed roles of the specific amino acidresidues in the NAC domain are awaiting for furtherstudy.

Fig. 7. Effect of drought stress on the fresh weight (FW) and dry weight(DW) of WT and transgenic lines. The data shown are means ± SD

from three independent experiments, each with five plants per line perexperiment. Asterisk indicates value for transgenic plants significantlydifferent from that for the WT at P < 0.05 by the t-test.

As the three groups we classified and described above,in the group I genes, SNAC1 was induced predominantlyin guard cells by drought and encoded a NAC TF (Huet al. 2006); the expression of OsNAC6 was induced byabiotic stresses, including cold, drought and high salinity(Nakashima et al. 2007); systematic sequence analysisof NAC TFs in rice indicated that OsNAC3, OsNAC4,OsNAC5 belonged to stress-related NACs. Our clas-sification of rice genes in group I and group II wasgenerally consistent with the comprehensive analysisand the categories of NAC TFs in rice (Fang et al. 2008).Therefore, our preliminary results demonstrated thatTaNAC2a, TaNAC4a and TaNAC6 were stress-relatedgenes.

Group II was named based on the conserved domainNAM and CUC, and the various functions in plantdevelopment. Previous reports demonstrated that CUC1,CUC2, CUP and NAM were expressed at organ bound-aries, such as the place between the SAM and newlydeveloped leaves, suggesting that these genes wereinvolved in organ separation during development (Soueret al. 1996, Aida et al. 1997, Sablowski and Meyerowitz1998, Ishida et al. 2000, Takada et al. 2001, Aida et al.2002, Weir et al. 2004). ONAC300, a novel member ofthe NAC family in rice, was expressed at very early devel-opmental stages in multi-organs (Kusano et al. 2005).GRAB proteins from wheat might play important rolesin geminivirus DNA replication in connection to plantgrowth, development and senescence pathways (Xieet al. 1999). TaNAC7 and TaNAC13 were placed intothis group according to classification, so their functionsin wheat development might be similar to NAM, CUC1/2

Physiol. Plant. 144, 2012 219

or ONAC300 that participated in delimiting organs dur-ing early development and morphogenesis; however,this hypothesis requires further investigation.

As observed above that TaNAC7 did not exhibit a tran-scription activation activity, one possible cause might beour detection method for transcription activation wasnot sensitive enough; there might be another cause thatTaNAC7 might function as transcriptional suppressor,or had generic specificity in transcription activity (Tranet al. 2004).

Recently, NAC proteins were found to be involvedin plant responses to pathogen and environmental stim-uli. It was noteworthy that potential NAC candidategenes improved stress resistance in Arabidopsis, rice,soybean and other plants. Several ANAC genes (Tranet al. 2004, He et al. 2005, Lu et al. 2007) and ONACgenes including SNAC1 (Hu et al. 2006) and OsNAC6(Nakashima et al. 2007) had been shown to be stressresponsive. We found that each TaNAC gene wasinduced simultaneously by two or three stress treatments,which was consistent with the results of NACs in Ara-bidopsis, rice and soybean (Fujita et al. 2004, Hu et al.2006, Nakashima et al. 2007, Hu et al. 2008, Tran et al.2009). We also noted that the expression of TaNAC7and TaNAC13 showed similar patterns under differentstresses, while the others showed different expressionpatterns under different treatments, such as TaNAC2aunder dehydration and salt treatments, TaNAC4a andTaNTL5 under dehydration and cold treatments. Thesewere very different from previous reports that transcriptsof many dehydration-inducible NAC genes showed sig-nificant increase under high salinity (Zhou et al. 2008,Tran et al. 2009).

We observed that dehydration and ABA treatmentsinduced the same expression response profiles for bothTaNAC4a and TaNAC6, which might indicate that thesetwo kinds of stress may be insidiously related to eachother. Although further research was required to clar-ify this problem, it might be supportive for the latentlinkage that NAC TFs could regulate drought stressresponse through ABA-dependent pathway (Fujita et al.2004, Tran et al. 2004). The expression of TaNTL5was downregulated by dehydration, while the tran-script levels were the same as the control under ABAtreatment. This suggested that TaNTL5 might regulatedownstream genes independently of ABA. TaNAC2a,showing an opposite expression tendency under dehy-dration and ABA treatment, also waited for furtherinvestigation.

Numerous evidences had proved that tissue specifi-cally expressed TFs played critical roles in plant growthand development (He et al. 2005, Mitsuda et al. 2007,Yoo et al. 2007). However, the studies of tissue-specific

NAC TFs were still few in wheat. Our results bysemi-quantitative RT-PCR indicated that TaNAC genesshowed tissue-specific expression in different wheatorgans. Stress-responsive TaNAC2a and TaNAC4a wereexpressed in leaves at much higher levels when com-pared to other vegetative tissues, and this might suggestthat these two genes resisted stress similarly to SNAC1,which could be induced by drought predominantly inguard cells (Hu et al. 2006). The expression of TaNAC6and TaNAC13 were higher in senescent leaves than inyoung leaves, suggesting that their functions might beassociated with leaf senescence. Whether senescenceprogress was age dependent (non-stressful) or affectedby stress conditions required further investigation (Guoand Gan 2006). Members of the NAM subfamily hadbeen detected specifically at organ boundaries, such asthat between the SAM and newly developed leaf pri-mordial (Souer et al. 1996, Aida et al. 1997, Ishida et al.2000, Weir et al. 2004, Kusano et al. 2005). TaNAC7and TaNAC13 belong to the NAM subfamily and deservefurther research so that we can clarify their functionsbetter. Our research also showed that some TaNACgenes were both developmental and stress regulated. Forexample, TaNAC6 was induced by salinity and had ahigher expression level in senescent leaves. In addition,TaNAC4a was expressed in young leaves rather thansenescent leaves, and displayed high-expression lev-els under cold treatment. Development-related TaNAC7and TaNAC13 were both induced by dehydration, salin-ity and cold. Therefore, extensive studies of every TaNACare urgent.

MTFs, in many cases, were stored in their dormantforms in the cytoplasm, and they could be activatedand localized to the nucleus upon stimulation (Kimet al. 2008). In this article, the subcellular localization ofTaNTL5 result was consistent with previous observationfor OsNTL2 (Kim et al. 2010), but different from NTL8,as the signals of NTL8 truncation form 8-C (devoidof the TM-coding region) were mainly located in thenucleus, but they could also be detected in the plasmamembrane (Kim et al. 2007a, 2007b). It was interestingthat TaNTL5(�TM):GFP and GFP:OsNTL2�C contained1–320 amino acids (aa) and 1–350 aa of the full-lengthprotein (truncating C-terminal of 326 aa and 379 aaincluding the TM-coding region) respectively, whereas8-C was only devoid of 26 aa (mainly including theTM-coding region with a length of 22 aa). Therefore, wepresumed that there were some other specific sequencesor motifs that also function in NTL localization and thesesequences lay between the conserved NAC domain andthe TM motif. Also putatively, TaNTL5 was a membrane-associated protein with a soluble particle form whichmight be released from membrane. TaNTL5 functioned

220 Physiol. Plant. 144, 2012

as a transcriptional activator, and more importantly,the expression patterns of TaNTL5 were strongly sup-pressed by dehydration and high salinity. Taken together,our results supported that the controlled regulation ofthe MTF provided an efficient way of gene regulationand was considered to be an adaptive strategy, whichensures prompt responses to environmental changes inplants (Brown et al. 2000, Hoppe et al. 2001, Kim et al.2007a, 2007b).

We generated TaNAC2a overexpression lines toinvestigate TaNAC2a involvement in tobacco droughtstress tolerance. The TaNAC2a gene expression levelswere determined in the transgenic tobacco plants andthere was no expression in WT. When challenged withdrought, overexpression lines exhibited greater tolerancecompared to WT with more green leaves and higher freshweight and dry weight than non-transgenic plants. Theresults confirmed that TaNAC2a could confer droughttolerance to transgenic plants and might play a role indrought stress response, and further proposed its use indrought stress engineering.

Overall, we characterized six TaNAC genes relatedto stress and development in wheat. Overexpressionof TaNAC2a could significantly enhance drought tol-erance in tobacco, making it a potential candidatefor engineering stress tolerant plants. We are cur-rently overexpressing these stress and developmental-responsive TaNAC genes in wheat plants to furtherinvestigate their functions. Together, our work pro-vided useful information toward the study of these genesinvolved in the regulation of growth and development inwheat.

Acknowledgements – This work was supported by theGenetically Modified Organisms Breeding Major Projects(2008ZX08002-002, 2008ZX08002-003, 2008ZX08002-004), the Beijing Technical Nova Project (2007B056,2008B035), the Excellence Scholar Fostered Program ofBeijing Government (20081D0200500050), the BeijingNatural Science Foundation of China (5102016) andthe Young Foundation Project of Beijing Academy ofAgriculture and Forestry Scientific Research.

References

Aida M, Ishida T, Fukaki H, Fujisawa H, Tasaka M (1997)Genes involved in organ separation in Arabidopsis: ananalysis of the cup-shaped cotyledon mutant. Plant Cell9: 841–857

Aida M, Ishida T, Tasaka M (1999) Shoot apical meristemand cotyledon formation during Arabidopsisembryogenesis: interaction among the CUP-SHAPEDCOTYLEDON and SHOOT MERISTEMLESS genes.Development 126: 1563–1570

Aida M, Vernoux T, Furutani M, Traas J, Tasaka M (2002)Roles of PIN-FORMED1 and MONOPTEROS in patternformation of the apical region of the Arabidopsisembryo. Development 129: 3965–3974

Balazadeh S, Riano-Pachon DM, Mueller-Roeber B (2008)Transcription factors regulating leaf senescence inArabidopsis thaliana. Plant Biol 1: 63–75

Brown MS, Ye J, Rawson RB, Goldstein JL (2000)Regulated intramembrane proteolysis: a controlmechanism conserved from bacteria to humans. Cell100: 391–398

Collinge M, Boller T (2001) Differential induction of twopotato genes, Stprx2 and StNAC, in response to infectionby Phytophthora infestans and to wounding. Plant MolBiol 46: 521–529

Delessert C, Kazan K, Wilson IW, Van Der Straeten D,Manners J, Dennis ES, Dolferus R (2005) Thetranscription factor ATAF2 represses the expression ofpathogenesis-related genes in Arabidopsis. Plant J 43:745–757

Ernst HA, Olsen AN, Larsen S, Lo Leggio L (2004)Structure of the conserved domain of ANAC, a memberof the NAC family of transcription factors. EMBO Rep 5:297–303

Fang Y, You J, Xie K, Xie W, Xiong L (2008) Systematicsequence analysis and identification of tissue-specific orstress-responsive genes of NAC transcription factorfamily in rice. Mol Genet Genomics 280: 547–563

Fujita M, Fujita Y, Maruyama K, Seki M, Hiratsu K,Ohme-Takagi M, Tran LS, Yamaguchi-Shinozaki K,Shinozaki K (2004) A dehydration-induced NACprotein, RD26, is involved in a novel ABA-dependentstress-signaling pathway. Plant J 39: 863–876

Fujita M, Fujita Y, Noutoshi Y, Takahashi F, Narusaka Y,Yamaguchi-Shinozaki K, Shinozaki K (2006) Crosstalkbetween abiotic and biotic stress responses: a currentview from the points of convergence in the stresssignaling networks. Curr Opin Plant Biol 9: 436–442

Gong W, Shen YP, Ma LG, Pan Y, Du YL, Wang DH,Yang JY, Hu LD, Liu XF, Dong CX, Ma L, Chen YH,Yang XY, Gao Y, Zhu D, Tan X, Mu JY, Zhang DB,Liu YL, Dinesh-Kumar SP, Li Y, Wang XP, Gu HY,Qu LJ, Bai SN, Lu YT, Li JY, Zhao JD, Zuo J, Huang H,Deng XW, Zhu YX (2004) Genome-wide ORFeomecloning and analysis of Arabidopsis transcription factorgenes. Plant Physiol 135: 773–782

Guo Y, Gan S (2006) AtNAP, a NAC family transcriptionfactor, has an important role in leaf senescence. Plant J46: 601–612

Hegedus D, Yu M, Baldwin D, Gruber M, Sharpe A,Parkin I, Whitwill S, Lydiate D (2003) Molecularcharacterization of Brassica napus NAC domaintranscriptional activators induced in response to bioticand abiotic stress. Plant Mol Biol 53: 383–397

Physiol. Plant. 144, 2012 221

He XJ, Mu RL, Cao WH, Zhang ZG, Zhang JS, Chen SY(2005) AtNAC2, a transcription factor downstream ofethylene and auxin signaling pathways, is involved insalt stress response and lateral root development. Plant J44: 903–916

Hoppe T, Rape M, Jentsch S (2001) Membrane-boundtranscription factors: regulated release by RIP or RUP.Curr Opin Cell Biol 13: 344–348

Hu H, Dai M, Yao J, Xiao B, Li X, Zhang Q, Xiong L (2006)Overexpressing a NAM, ATAF, and CUC (NAC)transcription factor enhances drought resistance and salttolerance in rice. Proc Natl Acad Sci USA 103:12987–12992

Hu H, You J, Fang Y, Zhu X, Qi Z, Xiong L (2008)Characterization of transcription factor gene SNAC2conferring cold and salt tolerance in rice. Plant Mol Biol67: 169–181

Huang X, Madan A (1999) CAP3: a DNA sequenceassembly program. Genome Res 9: 868–877

Ishida T, Aida M, Takada S, Tasaka M (2000) Involvementof CUP-SHAPED COTYLEDON genes in gynoeciumand ovule development in Arabidopsis thaliana. PlantCell Physiol 41: 60–67

Jensen MK, Rung JH, Gregersen PL, Gjetting T,Fuglsang AT, Hansen M, Joehnk N, Lyngkjaer MF,Collinge DB (2007) The HvNAC6 transcription factor: apositive regulator of penetration resistance in barley andArabidopsis. Plant Mol Biol 65: 137–150

John I, Hackett R, Cooper W, Drake R, Farrell A,Grierson D (1997) Cloning and characterization oftomato leaf senescence-related cDNAs. Plant Mol Biol33: 641–651

Kacperska A (2004) Sensor types in signal transductionpathways in plant cells responding to abiotic stressors:do they depend on stress intensity? Physiol Plant 122:159–168

Kim YS, Kim SG, Park JE, Park HY, Lim MH, Chua NH,Park CM (2006) A membrane-bound NAC transcriptionfactor regulates cell division in Arabidopsis. Plant Cell18: 3132–3144

Kim SG, Kim SY, Park CM (2007a) A membrane-associated NAC transcription factor regulatessalt-responsive flowering via FLOWERING LOCUS T inArabidopsis. Planta 226: 647–654

Kim SY, Kim SG, Kim YS, Seo PJ, Bae M, Yoon HK,Park CM (2007b) Exploring membrane-associated NACtranscription factors in Arabidopsis: implications formembrane biology in genome regulation. Nucleic AcidsRes 35: 203–213

Kim SG, Lee AK, Yoon HK, Park CM (2008) Amembrane-bound NAC transcription factor NTL8regulates gibberellic acid-mediated salt signaling inArabidopsis seed germination. Plant J 55: 77–88

Kim JH, Woo HR, Kim J, Lim PO, Lee IC, Choi SH,Hwang D, Nam HG (2009) Trifurcate feed-forward

regulation of age-dependent cell death involvingmiR164 in Arabidopsis. Science 323: 1053–1057

Kim SG, Lee S, Seo PJ, Kim SK, Kim JK, Park CM (2010)Genome-scale screening and molecular characterizationof membrane-bound transcription factors in Arabidopsisand rice. Genomics 95: 56–65

Kubo M, Udagawa M, Nishikubo N, Horiguchi G,Yamaguchi M, Ito J, Mimura T, Fukuda H, Demura T(2005) Transcription switches for protoxylem andmetaxylem vessel formation. Genes Dev 19: 1855–1860

Kusano H, Asano T, Shimada H, Kadowaki K (2005)Molecular characterization of ONAC300, a novel NACgene specifically expressed at early stages in variousdeveloping tissues of rice. Mol Genet Genomics 272:616–626

Lu PL, Chen NZ, An R, Su Z, Qi BS, Ren F, Chen J,Wang XC (2007) A novel drought-inducible gene,ATAF1, encodes a NAC family protein that negativelyregulates the expression of stress-responsive genes inArabidopsis. Plant Mol Biol 63: 289–305

Mitsuda N, Iwase A, Yamamoto H, Yoshida M, Seki M,Shinozaki K, Ohme-Takagi M (2007) NAC transcriptionfactors, NST1 and NST3 are key regulators of theformation of secondary walls in woody tissues ofArabidopsis. Plant Cell 19: 270–280

Nakashima K, Tran L-SP, Nguyen VD, Fujita M,Maruyama K, Todaka D, Ito Y, Hayashi N, Shinozaki K,Yamaguchi-Shinozaki K (2007) Functional analysis of aNAC-type transcription factor OsNAC6 involved inabiotic and biotic stress-responsive gene expression inrice. Plant J 51: 617–630

Ohnishi T, Sugahara S, Yamada T, Kikuchi K, Yoshiba Y,Hirano HY, Tsutsumi N (2005) OsNAC6, a member ofthe NAC gene family, is induced by various stresses inrice. Genes Genet Syst 80: 135–139

Olsen AN, Ernst HA, Leggio LL, Skriver K (2005) NACtranscription factors: structurally distinct, functionallydiverse. Trends Plant Sci 10: 79–87

Ooka H, Satoh K, Doi K, Nagata T, Otomo Y,Murakami K, Matsubara K, Osato N, Kawai J,Carninci P, Hayashizaki Y, Suzuki K, Kojima K,Takahara Y, Yamamoto K, Kikuchi S (2003)Comprehensive analysis of NAC family genes in Oryzasativa and Arabidopsis thaliana. DNA Res 10: 239–247

Riano-Pachon DM, Ruzicic S, Dreyer I, Mueller-Roeber B(2007) PlnTFDB: an integrative plant transcription factordatabase. BMC Bioinformatics 8: 42

Riechmann JL, Heard J, Martin G, Reuber L, Jiang C,Keddie J, Adam L, Pineda O, Ratcliffe OJ, Samaha RR,Creelman R, Pilgrim M, Broun P, Zhang JZ,Ghandehari D, Sherman BK, Yu G (2000) Arabidopsistranscription factors: genome-wide comparative analysisamong eukaryotes. Science 290: 2105–2110

Robertson M (2004) Two transcription factors are negativeregulators of gibberellin response in the

222 Physiol. Plant. 144, 2012

HvSPY-signaling pathway in barley aleurone. PlantPhysiol 136: 2747–2761

Sablowski RW, Meyerowitz EM (1998) A homolog of NOAPICAL MERISTEM is an immediate target of the floralhomeotic genes APETALA3/PISTILLATA. Cell 92:93–103

Selth LA, Dogra SC, Rasheed MS, Healy H, Randles JW,Rezaian MA (2005) A NAC domain protein interactswith tomato leaf curl virus replication accessory proteinand enhances viral replication. Plant Cell 17: 311–325

Seo PJ, Kim SG, Park CM (2008) Membrane-boundtranscription factors in plants. Trends Plant Sci 13:550–556

Shinozaki K, Yamaguchi-Shinozaki K, Seki M (2003)Regulatory network of gene expression in the droughtand cold stress responses. Curr Opin Plant Biol 6:410–417

Souer E, van Houwelingen A, Kloos D, Mol J, Koes R(1996) The no apical meristem gene of Petunia isrequired for pattern formation in embryos and flowersand is expressed at meristem and primordia boundaries.Cell 85: 159–170

Sperotto RA, Ricachenevsky FK, Duarte GL, Boff T,Lopes KL, Sperb ER, Grusak MA, Fett JP (2009)Identification of up-regulated genes in flag leaves duringrice grain filling and characterization of OsNAC5, a newABA-dependent transcription factor. Planta 230:985–1002

Takada S, Hibara K, Ishida T, Tasaka M (2001) TheCUPSHAPED COTYLEDON1 gene of Arabidopsisregulates shoot apical meristem formation.Development 128: 1127–1135

Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4:molecular evolutionary genetics analysis (MEGA)software version 4.0. Mol Biol Evol 24: 1596–1599

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F,Higgins DG (1997) The CLUSTAL_X windows interface:flexible strategies for multiple sequence alignment aidedby quality analysis tools. Nucl Acids Res 25: 4876–4882

Tran L-SP, Nakashima K, Sakuma Y, Simpson SD, Fujita Y,Maruyama K, Fujita M, Seki M, Shinozaki K,Yamaguchi-Shinozaki K (2004) Isolation and functionalanalysis of Arabidopsis stress inducible NACtranscription factors that bind to a drought responsivecis-element in the early responsive to dehydration stress1 promoter. Plant Cell 16: 2481–2498

Tran LS, Quach TN, Guttikonda SK, Aldrich DL, Kumar R,Neelakandan A, Valliyodan B, Nguyen HT (2009)Molecular characterization of stress-inducible GmNACgenes in soybean. Mol Genet Genomics 281: 647–664

Uauy C, Distelfeld A, Fahima T, Blechl A, Dubcovsky J(2006) A NAC gene regulating senescence improvesgrain protein, zinc, and iron content in wheat. Science314: 1298–1301

Voelker T, Sturm A, Chrispeels MJ (1987) Differences inexpression between two seed lectin alleles obtainedfrom normal and lectin-deficient beans are maintainedin transgenic tobacco. EMBO J 6: 3571–3577

Wang X, Goregaoker SP, Culver JN (2009) Interaction ofthe Tobacco mosaic virus replicase protein with a NACdomain transcription factor is associated with thesuppression of systemic host defenses. J Virol 83:9720–9730

Waters BM, Uauy C, Dubcovsky J, Grusak MA (2009)Wheat (Triticum aestivum) NAM proteins regulate thetranslocation of iron, zinc, and nitrogen compoundsfrom vegetative tissues to grain. J Exp Bot 60:4263–4274

Weir I, Lu J, Cook H, Causier B, Schwarz-Sommer Z,Davies B (2004) CUPULIFORMIS establishes lateralorgan boundaries in Antirrhinum. Development 131:915–922

Xia N, Zhang G, Sun YF, Zhu L, Xu LS, Chen XM, Liu B,Yu YT, Wang XJ, Huang LL, Kang ZS (2010a) TaNAC8, anovel NAC transcription factor gene in wheat, respondsto stripe rust pathogen infection and abiotic stresses.Physiol Mol Plant Pathol 74: 394–402

Xia N, Zhang G, liu XY, Cai GL, Zhang Y, Wang XJ,Zhao J, Huang LL, Kang ZS (2010b) Characterization ofa novel wheat NAC transcription factor gene involved indefense response against stripe rust pathogen infectionand abiotic stresses. Mol Biol Rep 37: 3703–3712

Xie Q, Sanz-Burgos AP, Guo H, Garcıa JA, Gutierrez C(1999) GRAB proteins, novel members of the NACdomain family, isolated by their interaction with aGemini virus protein. Plant Mol Biol 39: 647–656

Xie Q, Frugis G, Colgan D, Chua NH (2000) ArabidopsisNAC1 transduces auxin signal downstream of TIR1 topromote lateral root development. Genes Dev 14:3024–3036

Xiong Y, Liu T, Tian C, Sun S, Li J, Chen M (2005)Transcription factors in rice: a genome-widecomparative analysis between monocots and eudicots.Plant Mol Biol 59: 191–203

Xue GP (2005) A CELD-fusion method for rapiddetermination of the DNA-binding sequence specificityof novel plant DNA-binding proteins. Plant J 41:638–649

Xue GP, Bower NI, McIntyre CL, Riding GA, Kazan K,Shorter R (2006) TaNAC69 from the NAC superfamily oftranscription factors is up-regulated by abiotic stresses inwheat and recognises two consensus DNA-bindingsequences. Func Plant Biol 33: 43–57

Xue GP, Way HM, Richardson T, Drenth J, Joyce PA,McIntyre CL (2011) Overexpression of TaNAC69 leadsto enhanced transcript levels of stress up-regulatedgenes and dehydration tolerance in bread wheat. MolPlant 4: 697–712

Physiol. Plant. 144, 2012 223

Yamaguchi M, Mitsuda N, Ohtani M, Ohme-Takagi M,Kato K, Demura T (2011) Vascular-relatedNAC-DOMAIN7 directly regulates expression of a broadrange of genes for xylem vessel formation. Plant J 66:579–590

Yoo YS, Kim Y, Kim YS, Lee JS, Ahn HJ (2007) Control offlowering time and cold response by a NAC-domainprotein in Arabidopsis. PLoS One 2: e642

Zhong R, Demura T, Ye ZH (2006) SND1, a NAC domaintranscription factor, is a key regulator of secondary wallsynthesis in fibers of Arabidopsis. Plant Cell 18:3158–3170

Zhou QY, Tian AG, Zou HF, Xie ZM, Lei G, Huang J,Wang CM, Wang HW, Zhang JS, Chen SY (2008)Soybean WRKY-type transcription factor genes,GmWRKY13, GmWRKY21, and GmWRKY54, conferdifferential tolerance to abiotic stresses in transgenicArabidopsis plants. Plant Biotechnol J 6:486–503

Supporting Information

Additional Supporting Information may be found in theonline version of this article:

Table S1. Gene-specific primers designed to obtain full-length TaNAC cDNAs.

Table S2. Primers for semi-quantitative RT-PCR.

Table S3. Primers for subcellular localization analysis.

Table S4. Primers for transcriptional activation analysisin yeast.

Please note: Wiley-Blackwell are not responsible forthe content or functionality of any supporting materialssupplied by the authors. Any queries (other than missingmaterial) should be directed to the corresponding authorfor the article.

Edited by M. Uemura

224 Physiol. Plant. 144, 2012