Blackwell Publishing LtdORIGINAL ARTICLECytokine expression in O. viverrini infectionCytokine expression in hamsters experimentally infected with

Opisthorchis viverrini

J. JITTIMANEE,1 R. W. SERMSWAN,1 A. PUAPAIROJ,2 W. MALEEWONG3 & S. WONGRATANACHEEWIN4

1Department of Biochemistry, 2Department of Pathology, 3Department of Parasitology, and 4Department of Microbiology, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand

SUMMARY

The cytokine mRNA expression of IL-12, IFN-γ, TGF-β, IL-4, and IL-10 were investigated in spleen, liver and mesentericlymph nodes (MLN) in hamsters experimentally infectedwith Opisthorchis viverrini. Animals were infected with 5, 25or 100 metacercariae (Mc) and examined by RT-PCR andreal-time PCR at 2 weeks, 2 and 6 months after infection. Thecytokine expression was compared using HPRT. The IL-12was significantly expressed at 2 weeks in the liver of the 5- and25-Mc-infected groups. It is correlated with the inflammationintensity found in the liver at the same time. The production ofIFN-γ was not increased. The significant increase in expressionof IL-10 was observed in the 6-month group in the spleen,which may suppress the Th1 and lead to a Th2 response.The IL-4 and TGF-β expressions in MLN were significantlyincreased, and correlated with the dose of infection, especiallyin the 6-month groups. The TGF-β level in MLN was 15-foldhigher than in the uninfected control, compared to a twofoldincrease in spleen and liver. Because this parasite resides in thebile duct, the regulatory cytokine levels of mucosal immunitywere enhanced more than those in systemic immunity. Theseresults indicate the predominance of Th2 responses in chronicO. viverrini infection, and the high level of TGF-β may inhibitthe immune functions, which allows the parasites to evade hostimmune response.

Keywords cytokines, hamster, immunopathology, Opisthorchisviverrini

INTRODUCTION

Opisthorchiasis caused by Opisthorchis viverrini infection isendemic along the Mekong River Basin, notably in LaosPDR and Thailand. It has been estimated that the numberof infections caused by the parasite is in the order of 9 × 106

(1). It has been shown that O. viverrini infections are presentin 15% of the Thai population (2), of which 18·5% live in thenorth-east region (1,3). People acquire liver flukes throughconsumption of raw or undercooked Cyprinoid fishharbouring infective metacercariae. The disease tends tobecome chronic and persists for many years, leading tohepatobiliary disease and cholangiocarcinoma (4–7). Lesssevere manifestations include cholangitis, chronic cholecys-titis and cholelithiasis (8). The hamster was demonstrated tobe an appropriate host for studying the immunology,pathology and cholangiocarcinogenesis related to infectionby this parasite (9,10). Opisthorchis viverrini infection inhamsters was found to induce hyperplasia and adenomatousformations of the bile duct epithelium, immunopathologyand cholangiocarcinoma (9–11). Cellular and humoral immuneresponses to O. viverrini in hamsters and humans were reported(12–14). Knowledge of the mechanisms and roles of immuneresponse in either immunoprotection or immunopathology,however, is still limited, and most of the reports were focusedon antibody responses (12–16). The marked elevation of theIgG antibody level in opisthorchiasis suggests an involvementof an immunopathological mechanism in this trematodeinfection (16). Moreover, some evidence suggested that immuno-depression may also have occurred (12,17).

Studies in animal models in various parasitic infectionshave revealed that T lymphocytes and the cytokines play acrucial role in determining the outcome of parasitic infec-tions, in terms of both protective immunity and immunopa-thology. Of particular interest is the evidence that differentparasitic infections in the context of different host geneticbackgrounds can trigger polarized CD4+ T cell subsetresponses (18). The set of cytokines produced by Th1 or Th2helper cell response, in turn, can have opposing effects on the

Correspondence: Dr Surasakdi Wongratanacheewin, Department of Microbiology, Faculty of Medicine, Khon Kaen University, Khon Kaen, 40002. Thailand (e-mail: sura_wng@kku.ac.th).Received: 30 October 2005 Accepted for publication: 24 October 2006

parasite, resulting in either control of the infection or pro-motion of the disease. The establishment of this state of cross-regulation between Th1 and Th2 cells may be important forparasite survival (18). Research on T lymphocyte–parasiteinteractions is crucial for the design of effective vaccines andimmunotherapies, and thus has broad practical as well astheoretical ramifications (18).

Recent studies have shown that helminth parasites, suchas Schistosoma mansoni, induce Th2 responses (19,20).Several studies have observed a marked eosinophilia inboth peripheral blood and bone marrow cells of Fasciolahepatica-infected mice, rats and sheep (21–24). However,information regarding the immune responses generatedduring liver fluke infections is limited. Because the hamsterhas been widely used as an experimental model for thestudy of pathology and immunology in opisthorchiasis(9,10), we investigated the T cell responses of acute andchronic O. viverrini infection in hamsters at different timeintervals. The T cell responses were evaluated by theinduction of cytokine expression of both the Th1 and Th2types. The results of this study will lead to some under-standing of Th1 and Th2 roles in both immunopathologyand immunoprotection.

MATERIALS AND METHODS

Experimental design

Golden Syrian hamsters aged approximately 4–6 weeks wereused. Twelve groups, designated groups 1–12, each con-tained 10 hamsters. Groups 1, 5 and 9 were orally infectedwith five metacercariae (Mc), whereas groups 2, 6, 10 and 3,7, 11 were infected with 5, 25 and 100 Mc, respectively.Other groups (4, 8, 12) were left as the uninfected controls.Each group was later killed by ether inhalation at a differenttime after infection (2 weeks for groups 1–4, 2 months forgroups 5–8 and 6 months for 9–12). All experimental proce-dures with animals were in accordance with the Thailandnational guidelines for the care and use of laboratory animals.The protocol used was approved by the Khon Kaen UniversityAnimal Ethics Committee.

In vitro stimulation of hamster splenic cells by Concanavalin A

Spleen cells from normal hamsters at a concentrationof 1 × 106 cells/mL were stimulated with 10 µg/mL of Con-canavalin A (Con A) (Sigma, St. Louis, MO, USA) in RPMIcontaining penicillin (100 U/mL) and streptomycin (100 µg/mL).After 24 h of stimulation, the cell suspension was harvestedand washed in phosphate buffer saline (and then subjectedto total RNA extraction by using Trizol reagent (Invitrogen

Life Technologies, Carlsbad, CA, USA). The RNAs wereused for RT-PCR positive control of either cytokines orHPRT (hypoxanthine phosphoribosyl transferase) and forgeneration of a cRNA standard curve in real-time PCR.

Isolation and purification of total RNA

Liver, mesenteric lymph nodes (MLN) and spleens wereremoved from each hamster and immediately frozen in dryice. RNAs were extracted with the Trizol reagent accordingto the manufacturer’s recommendations. In brief, each tissuewas homogenized in Trizol reagent and incubated for 5 minat 30°C to permit the complete dissociation of nucleoproteincomplexes. The homogenized sample was centrifuged at10 000 g for 10 min at 4°C and the supernatant was removedto a new tube. Chloroform was added at 0·2 mL per mL ofTrizol. The tubes were shaken vigorously by hand for 15 sand incubated at 30°C for 3 min. The samples were cen-trifuged at 10 000 g for 15 min at 4°C and the aqueous phasewas transferred to new tubes. The RNA in the aqueous phasewas precipitated by a half volume of isopropyl alcohol. TheRNA pellets were washed once with 1 mL of 75% ethanol. Thequality of RNA was assessed by agarose gel electrophoresis.The contaminated DNA was digested with RNase-free DNases(Promega, Madison, WI, USA) at 37°C for 30 min. Theenzyme activities were destroyed by heating at 65°C. Theamount of RNA was measured by optical density at 260 nmand the RNA was used for RT-PCR amplification.

Primers

Oligonucleotide primers were chosen on the basis of hamsternucleotide sequences in the GenBank database, and accord-ing to previously published sequences (25). The size andsequence of each primer and the number of cycles used aregiven in Table 1.

RT-PCR

RT-PCR was performed by using a one-step RT-PCR system(Superscript®, Invitrogen Life Technologies). Briefly, 1 µgof total RNA was mixed with 10 µ forward and reverseprimers, 2 µL of SuperScript® RT/Platinum Taq Mix (M-MLV-RT/Taq polymerase) and 1× buffer containing 0·2 m ofeach dNTP and 1·6 m Mg2SO4, to a final volume of 50 µL. Themixture was then submitted to the thermal cycler (GeneAmpPCR System 2400, Applied Biosystem, Foster, CA, USA) usingthe following steps of cDNA synthesis: one cycle at 45°C for30 min and preamplification for one cycle at 94°C for 2 min,and PCR amplification for 40 cycles, as also described inTable 1. The final extension was one cycle at 72°C for 4 min.The amplification products were analysed by 1·5% agarose

gel electrophoresis. The relative RT-PCR was interpreted asthe density ratio of each amplification product to that of theHPRT housekeeping gene. The RT-PCR of each cytokinewas performed individually in each hamster and comparedwithin the group. If little variation was observed, an equalamount of mRNA from each hamster in the same groupwas pooled for the final amplification result. The standardPCR, using the purified RNAs, was also performed toensure the absence of any contaminating DNA. The RT-PCR products were sequenced and confirmed by comparingthe DNA sequences with cytokines of hamsters in theGenBank.

cRNA construction for real-time PCR

Primers for cRNA construction and real-time PCR were thesame as those in RT-PCR, except that the IL-12p40 was 5′-GGTTTGCTGTGGTTCTGCT-3′ for the forward primerand 5′-CTTGGATGGTCAGGGTTTTC-3′ for the reverse.The cRNA construction was carried out by converting thetotal RNA to single-stranded cDNA, then adding the T7promoter sequence (TAATACGACTCACTATAGGGA) tothe 5′ end of the forward primer and Oligo-d (T)15 to the 5′end of the reverse primer by PCR amplification and gener-ated cRNA for each cytokine. The PCR reaction contained50–100 ng of cDNA, 10× PCR buffer, 1 unit of Taq DNApolymerase, 0·2 m dNTP, 1·5 m MgCl2, and RNase–DNase-free water to a final volume of 25 µL. The amplifi-cation conditions included preamplification for one cycleat 94°C/2 min; amplification for 35 cycles of denaturingat 94°C/15 s; and extension at 72°C/60 s. The annealingconditions were varied for each cytokine (64°C/30 s forHPRT and TGF-β 60°C/30 s for IL-4; 65°C/30 s for IL-10and 66°C/30 s for IL-12p40). The final extension was carried

out at 72°C for 4 min for one cycle. For cRNA construction,the purified PCR products containing the T7 promoter wereused as templates for in vitro transcription with MEGA-script® (Ambion Inc., Austin, TX, USA). The DNase I enzyme(Ambion Inc.) was added to remove the template DNA.The concentration of cRNA was determined by using thespectrophotometer at 260 nm and the copy number of cRNAwas calculated from the equation as described in (26).

Real-time PCR

To generate the standard curve for real-time PCR, thestandard cRNA (obtained from Con A stimulation) of eachcytokine was serially diluted 10-fold to obtain 101−108

copies and reverse transcribed to cDNA by using M-MLVreverse transcriptase (Invitrogen). The cDNA was generatedfrom each dilution of cRNA (or 2 µg of total RNA samples)according to the manufacturer’s recommendations. Thetotal RNA from samples was obtained parallel with thestandard. All cDNAs were kept at −20°C for real-time PCR.

The real-time PCR was performed by using a Light-Cycler® machine (Roche Applied Science, Indianapolis, IN,USA). The optimal condition for real time of each cytokineand HPRT was determined. Ten µL of 2× Platinum® SYBR®Green qPCR superMix-UDG (Invitrogen) was mixed with1 µL of bovine serum albumin (1 mg/mL), 10 µ of eachforward and reverse primer, 2 µL of either cDNA from thesample or cDNA generated from cRNA and nuclease-freewater to a final volume of 20 µL. The conditions for the 45 cyclesof quantitative amplification were 94°C/10 s for denaturation,50°C/30 s (for IL-4) or 60°C/30 s (for other cytokines andHPRT) for annealing and 72°C/30 s for extension. The meltingcurve analyses were performed for one cycle at 95°C/0 s,55°C/15 s and 95°C/0 s (slope = 0·1°C/s) for denaturation,

Table 1 Sequences of the forward and reverse primers and PCR conditions used for RT-PCR

GenBankaccessionnumbers

Gene to be amplified Primers

PCR conditions (Temperature/Time)Size (bp) cDNADenature Anneal Extend

AF 047041 HPRT Forward 5′-GCGATGTCATGGTAGAGA-3′ 94°C/15 s 48°C/30 s 72°C/60 s 128Reverse 5′-GGGAGTGGATCTATCACA-3′

AF 034482 IFN-γ Forward 5′-TCCTATCGCGTTGGCCTA-3′ 94°C/15 s 50°C/30 s 72°C/60 s 515Reverse 5′-TCCACCCCCAAAACAGCA-3′

AF 046214 TGF-β Forward 5′-TGGGCTGGAAGTGGAT-3′ 94°C/15 s 48°C/30 s 72°C/60 s 128Reverse 5′-CGGGTTGTGTTGGTTGTA-3′

AF 046211 IL-12p40 Forward 5′-CTCTGAGCCACTCACGA-3′ 94°C/50 s 55°C/120 s 70°C/50 s 167Reverse 5′-GTCAGTGCTGATTGCA-3′

AF 046213 IL-4 Forward 5′-TGAACCAGGTCACAGA-3′ 94°C/15 s 54°C/30 s 72°C/60 s 251Reverse 5′-CGTGGACTCATTCACA-3′

AF 046210 IL-10 Forward 5′-CATGCTCCGAGAGCTGA-3′ 94°C/15 s 54°C/30 s 72°C/60 s 256Reverse 5′-CTGCAGTTGCCTCCTGA-3′

annealing and melting, respectively. The levels of cytokineand HPRT were quantified from the standard curve. Theresults were expressed as the ratio of copy number of cytokinegenes to HPRT.

ELISA for determination of TGF-ββββ

Because of the great similarity of the amino acid sequencesbetween mouse TGF-β1 and partial hamster TGF-β (100%identities; data not shown), the DuoSet® ELISA of mouse TGF-β1 (R & D Systems Inc., Minneapolis, MN, USA) was used todetect the TGF-β level in sera of hamsters. The procedure wasperformed according to the manufacturer’s recommendations.

Pathological studies

The liver tissue from control and infected hamsters wasremoved and fixed in 10% formalin, dehydrated and paraffin-

embedded. The tissue slides were stained with haematoxylinand eosin for histopathology investigation.

Statistical analysis

An independent sample T-test ( program) was used toanalyse real-time PCR and ELISA data. An asterisk indicatesa statistical difference (P < 0·05) between uninfected controland infected groups.

RESULTS

Histopathology

In O. viverrini-infected hamsters, inflammatory cell infiltrationwas found in the mucosa and submucosa of bile ducts andportal areas (Figure 1m). These cells were mainly lym-phocytes and eosinophils, whereas bridging inflammation

Figure 1 Haematoxylin and eosin-stained liver tissues from uninfected (control) hamsters and hamsters infected with 5, 25 and 100 metacercariae (Mc) of Opisthorchis viverrini for 2 weeks, 2 and 6 months (left panel, a to l) (100×). Selected pictures of pathology in the liver (right panel, m to p). Flukes, F, were found inside bile ducts. The pathology caused by the infection is clearly shown by the hyperplastic change of the infected bile duct epithelium (b), periductal fibrosis (f, h, j, k, arrows), bridging inflammation (o, arrow), bile duct obstruction (h, l) and granulomatous formation, G (g, p).

(Figure 1o) was frequently seen in infected hamsters thatwere sacrificed at later times. Periductal fibrosis of some bileducts appeared in all infected hamsters, especially in the2- and 6-month groups (Figure 1f,h,j,k, arrows). Hyper-plastic changes (Figure 1b) and mild dysplasia (Figure 1n)of bile duct epithelium showed in all infected hamsters.Opisthorchis viverrini eggs were found in periductal lumens,causing chronic granulomatous inflammation (Figure 1g,p).The growth of adult worms (Figure 1h,l), hyperplasiaand granulomatous inflammation resulted in the bileduct obstruction. The inflammation is clearly observed inthe liver after 2 weeks of infection and regressed after 2and 6 months. The pathology was not different when theintensity of infection was increased, but the lesions weremore frequent.

The cytokine expression profiles from spleen, liver and mesenteric lymph nodes

The cytokine expression profiles in O. viverrini-infectedhamsters were analysed by RT-PCR. The relative RT-PCRwas performed individually in each hamster, comparedwithin the group and interpreted as the density ratio of eachamplification product to the product of the HPRT house-keeping gene (data not shown). The level of cytokineexpression was then confirmed by using quantitativereal-time PCR. The RT-PCR products and real-time PCRresults are shown in Figures 2,3. The PCR product from thepooled mRNA of each group is shown in each lane(Figure 2). There was a significant increase of IL-12 (Th1-inducing cytokine) expression in the spleen of all infectedhamsters at 2 weeks (Figure 3). The IL-12 profile in the liverwas expressed at a high level in the 5-Mc groups at 2 weeksafter infection (Figures 2b and 3). The IFN-γ expressionwas not increased in the spleen of the 2-weeks group and notfound in other organs (Figure 2). However, among the reg-ulatory cytokines, TGF-β was significantly increased in thespleen of the 2- and 6-months groups in the 25- and 100-Mcgroups (Figure 3). The TGF-β protein level in the sera ofinfected hamsters was analysed by ELISA and the result isshown in Figure 4. The ELISA data confirmed our RNAexpression profile, which showed that TGF-β was increasedin heavily infected groups. The IL-10 expression was verylow or not detectable in the liver (Figure 2b), whereas in thespleen its profile was increased significantly, especially in the6-month-infected groups (Figure 3). IL-4 expression in liverand spleen was low.

The expression of Th1 (IFN-γ) or Th1-inducing cytokines(IL-12) in MLN of all groups was undetectable (Figure 2).In contrast, the Th2 cytokine (IL-4) in MLN was highlyexpressed and statistically significant at 6 months in thegroups that were infected with 100 Mc (Figure 3). The

Figure 2 Ethidium bromide-stained 1·5% agarose gels containing RT-PCR products of cytokine expression profiles in the spleen (a), liver (b) and mesenteric lymph node (MLN) (c) of hamsters experimentally infected with 5, 25 and 100 O. viverrini Mc for 2 weeks, 2 and 6 months. The cytokine-positive control, P, shows the RT-PCR products of each cytokine mRNA obtained from normal hamster spleen cells stimulated by Con A. The HPRT gene was used as an internal control. Each lane represents each animal group tested.

regulatory cytokine (TGF-β) expression was also very highin MLN and found to be 3–15-fold that of uninfectedcontrols at 6 months of infection (Figure 3).

DISCUSSION

It is well accepted that CD4+ T cells can be separated intotwo major subsets, Th1 and Th2, on the basis of theircytokine secretion patterns and functions (27,28). Th1 cellsproduce IFN-γ, IL-2 and TNF-β they promote the activa-tion of macrophages and the production of opsonizingantibodies; and they mediate delayed-type hypersensitivityreactions and inflammatory responses. In contrast, Th2cells produce IL-4, IL-5, IL-6 and IL-10, and promoteimmediate-type hypersensitivity reactions, involving IgE,eosinophils and mast cells. The cytokine levels of each Tcell subtype mutually inhibit the differentiation and effecterfunctions of the reciprocal subset, resulting in the polari-zation of the immune response to either type 1 or type 2. The

cross-regulation of cytokines produced by these differentT helper responses, in turn, can have opposing effects onthe parasite, resulting in either the control of infection orpromotion of the disease (18). Research on T lymphocyte–parasite interactions is crucial for the design of effectivevaccines and immunotherapies, and thus has broad practicalas well as theoretical ramifications (18).

Little is known about the host immune response inopisthorchiasis. The antibody response was characterizedmainly for diagnostic purposes (29). Because monoclonalantibodies to hamster cytokines are not available, we usedRT-PCR and real-time PCR for detection of cytokineexpression profiles that may not correlate directly with thelevel of the cytokine itself. However, because the TGF-β-active form requires post-translational modifications, theprotein product in the serum was confirmed by using mouseTGF-β1 ELISA.

Our results demonstrate that at the early stage of infection(2 weeks), while the juvenile worm hatches and moves to

Figure 3 Reverse transcriptase real-time PCR in spleen, liver and MLN of control and infected hamsters. TGF-β, IL-10, IL-12 and IL-4 expression in control (0 Mc) hamsters and hamsters infected with 5, 25 and 100 O. viverrini metacercariae for 2 weeks (�), 2 ( ) and 6 months (�) were measured quantitatively by real-time PCR and the result was expressed as cytokine/HPRT ratio. Asterisks indicate statisticaldifferences (P < 0·05) between uninfected control and infected groups. The data are representative of two independent experiments.

the liver (Figure 1b,c,d), its antigens may stimulate theexpression of Th1-inducing cytokine (IL-12) in the liver(Figure 3), which correlated with the inflammatory cellsinfiltrated into the liver (Figure 1m). Sripa and Kaewkes(14) reported that acute inflammatory reactions, includingcongestion, neutrophil and eosinophil infiltration, occurredin the gall bladder on day 14 of infection. The IL-12 expres-sion in the spleen at this stage was also high and tended tobe lower when its antigens were reported to diffuse into thebiliary epithelium; such diffusion was associated withheavy mononuclear cell infiltration (Figure 3). This phe-nomenon was also demonstrated in other trematodes, suchas Fasciola hepatica (30,31), Schistosoma mansoni (32) andClonorchis sinensis (33). In S. mansoni, the Th1 reactivity ininfected mice was triggered primarily by larval antigens,whereas the Th2 response was shown to be induced byschistosome eggs and directed largely against egg antigens(32). The role of the IL-12 response in protective immunityagainst O. viverrini needs further investigation. If IL-12 doeshave a protective function, the modulation of the hostimmune response to up-regulate the Th1-inducing cytokinesmay help the immune system to eliminate the parasite. Ourresults showed that spleen IL-10 was produced significantlyin the 6-month groups (Figure 3), and this production maybe related to the suppression of Th1, leading to a Th2response. The IL-10 was found to be produced at significantlevels in S. mansoni egg-positive rather than egg-negativepatients (20). It is therefore postulated to be an importantcytokine controller of the shift from Th1 to Th2 production

in chronic schistosomiasis. The systemic cytokine responsesdid not show any correlation with the intensity of infection.This may be caused by the non-invasive property of theparasites.

Because O. viverrini resides in the lumen of the bile ductand, during its life cycle in humans, it does not invadesurrounding tissue or come into intimate contact with thelymphoid tissue, except in severe infection, cytokine analysisof the mucosal immune system may be important. Thecytokine responses in the mucosal immune system may bedifferent from the systemic immune responses. We thereforestudied cytokine expression in the MLN. We previouslyshowed that the profile of antibody responses in the bileof infected patients was different from that in the blood,especially of IgA and IgE (13). In this work, the cytokineresponse of the mucosal immunity (MLN) was different fromthe spleen, as shown by the concentration of Th2 cytokines(IL-4), which increased to three times that in the spleen andliver. The concentration of the regulatory cytokine (TGF-β)increased twofold in the spleen compared to 15-fold inMLN of 100 Mc-6 months-infected groups. The high IL-4expression in the MLN may explain the high titre of IgEand IgA in the bile of infected patients (13). Nevertheless,the parasite still survives despite the high level of IL-4. Thisobservation was also demonstrated in FVB mice infectedwith C. sinensis (33). The IL-4 cytokine response was foundto be predominant in susceptible FVB mice when comparedto resistant BALB/c mice (33). This study suggested thatthe susceptibility or resistance to C. sinensis infection wasassociated with Th2 cytokine production. The Th2 cytokinesinduced by chronic O. viverrini infection that were demon-strated in this study were also demonstrated in F. hepatica(34), C. sinensis (33) and other helminthic infections (35,36).The high level of TGF-β expression, especially in chronicinfection, may inhibit the immune functions, causingimmunosuppression of the host. Our findings confirmedour previous study that the parasite suppressed the hostimmune system (17). Our preliminary result found that theexcretory and secretory antigens of the parasite stimulatedTGF-β expression in primary hamster spleen cells in vitro(unpublished data). Whether this TGF-β plays a role in theevasion mechanism and survival of the parasite remains tobe investigated.

This is the first report to demonstrate the correlationbetween cytokine responses and pathology in hamsteropisthorchiasis. The O. viverrini-infected hamsters expressedearly IL-12 in the liver in response to the parasite antigens,which caused immune cell infiltration and immunopa-thology. The regulatory cytokine (TGF-β) expressionincreased significantly later in the 6-month group in spleenand liver. Both IL-4 and TGF-β were found mainly in theMLN, and that may explain the high levels of IgE and IgA.

Figure 4 TGF-β level in sera of control and infected hamsters. The TGF-β1 level was determined in the sera from uninfected control (0 Mc) hamsters and hamsters infected with 5, 25 and 100 O. viverrini metacercariae for 2 weeks (�), 2 ( ) and 6 months (�)by ELISA, using a mouse TGF-β1 kit. Asterisks indicate statistical differences (P < 0·05) between uninfected control and infected groups.

The Th2 predominance and decreased Th1 response maylead to the survival of the parasite. This preliminary resultwill help us to understand the kinetics of Th1 and Th2responses in opisthorchiasis.

ACKNOWLEDGEMENTS

We would like to thank Emeritus Prof James A Will,Department of Animal Health and Biomedical Sciences,Madison, WI, for his kind help editing the English in thismanuscript. This project was supported by the ThailandTropical Diseases Research Programme (T2) (Grant No.ID02-2-HEL-005-009) and by the Thailand ResearchFund through the Royal Golden Jubilee Ph.D. Programme(Grant No. PHD/0212/2543) to Ms. Jutharat Jittimanee andS. Wongratanacheewin.

REFERENCES

1 World Health Organization. Control of foodborne trematodeinfections: Report of WHO Study Group. World Health OrganTech Rep Series 1995; 849: 1–157.

2 Jongsuksuntigul P, Chacychomsri W, Techamontrikul P, JeraditP & Suratavanit P. Studies on prevalence and intensity ofintestinal helminthiasis and opisthorchiasis in Thailand in 1991.J Trop Med Parasitol 1992; 15: 80–95.

3 Jongsuksuntigul P, Imsomboon T, Teerarat S, SuruthanavarihP & Kongpradit S. Consequences of opisthorchiasis-controlprogramme in northeastern Thailand. J Trop Med Parasitol1996; 19: 24–39.

4 Pungpak S, Chalermrut K, Harinasuta T, et al. Opisthorchisviverrini infection in Thailand: symptoms and signs of infection– a population-based study. Trans R Soc Trop Med Hyg 1994;88: 561–564.

5 Riganti M, Pungpak S, Sachakul V, Bunnag D & Harinasuta T.Opisthorchis viverrini eggs and adult flukes as nidus andcomposition of gallstones. Southeast Asian J Trop Public Health1998; 19: 633–636.

6 Schwartz DA. Helminths in the induction of cancer: Opisthorchisviverrini, Clonorchis sinensis and cholangiocarcinoma. Trop GeogMed 1980; 32: 95–100.

7 Schwartz DA. Cholangiocarcinoma associated with liver flukeinfection: a preventable source of morbidity in Asian immi-grants. Am J Gastroenterol 1986; 81: 76–79.

8 Harinasuta T, Riganti M & Bunnag D. Opisthorchis viverriniinfection: pathogenesis and clinical features. Arzneimittel-Forschung 1984; 34: 1167–1169.

9 Thamavit W, Bhamarapravati N, Sahaphong S, Vajrasthira S &Angsubhakorn S. Effects of dimethylnitrosamine on inductionof cholangiocarcinoma in Opisthorchis viverrini-infected Syriangolden hamsters. Cancer Res 1978; 38: 4634–4639.

10 Bhamarapravati N, Thamavit W & Vajrasthira S. Liver changesin hamsters infected with a liver fluke of man, Opisthorchis viver-rini. Am J Trop Med Hyg 1978; 27: 787–794.

11 Thamavit W, Pairojkul C, Tiwawech D, Itoh M, Shirai T & ItoN. Promotion of cholangiocarcinogenesis in the hamster liverby bile duct ligation after dimethylnitrosamine initiation.Carcinogenesis 1993; 14: 2415–2417.

12 Sirisinha S, Tuti S, Vichasri S & Tawatsin A. Humoral immuneresponses in hamsters infected with Opisthorchis viverrini.Southeast Asian J Trop Med Public Health 1983; 14: 243–251.

13 Wongratanacheewin S, Bunnag D, Vaeusorn N & Sirisinha S.Characterization of humoral immune response in the serum andbile of patients with opisthorchiasis and its application in immu-nodiagnosis. Am J Trop Med Hyg 1988; 38: 356–362.

14 Sripa B & Kaewkes S. Localisation of parasite antigens andinflammatory responses in experimental opisthorchiasis. Int JParasitol 2000; 30: 735–740.

15 Sirisinha S. Some immunological aspects of opisthorchiasis.Arzneimittel-Forschung 1984; 34: 1170–1172.

16 Haswell-Elkins MR, Sithithaworn P, Mairiang E, et al. Immuneresponsiveness and parasite-specific antibody levels in humanhepatobiliary disease associated with Opisthorchis viverriniinfection. Clin Exp Immunol 1991; 84: 213–218.

17 Wongratanacheewin S, Rattanasiriwilai W, Priwan R & Siris-inha S. Immunodepression in hamsters experimentally infectedwith Opisthorchis viverrini. J Helminthol 1987; 61: 151–156.

18 Sher A & Coffman RL. Regulation of immunity to parasites byT cells and T cell-derived cytokines. Ann Rev Immunol 1992; 10:385–409.

19 Jenkins SJ & Mountford AP. Dendritic cells activated withproducts released by schistosome larvae drive Th2-type immuneresponses, which can be inhibited by manipulation of CD40costimulation. Infect Immun 2005; 73: 395–402.

20 Silveira AM, Gazzinelli G, Alves-Oliveira LF, et al. Humanschistosomiasis mansoni: intensity of infection differentiallyaffects the production of interleukin-10, interferon-gamma andinterleukin-13 by soluble egg antigen or adult worm antigenstimulated cultures. Trans R Soc Trop Med Hyg 2004; 98:514–519.

21 Doy TG, Hughes DL & Harness E. Resistance of the rat toreinfection with Fasciola hepatica and the possible involvementof intestinal eosinophil leucocytes. Res Vet Sci 1978; 25: 41–44.

22 Milbourne EA & Howell MJ. Eosinophil responses to Fasciolahepatica in rodents. Int J Parasitol 1990; 20: 705–708.

23 Keegan PS & Trudgett A. Fasciola hepatica in the rat: immuneresponses associated with the development of resistance toinfection. Parasite Immunol 1992; 14: 657–669.

24 Chauvin A, Bouvet G & Boulard C. Humoral and cellularimmune responses to Fasciola hepatica experimental primaryand secondary infection in sheep. Int J Parasitol 1995; 25:1227–1241.

25 Melby PC, Tryon VV, Chandrasekar B & Freeman GL. Cloningof Syrian hamster (Mesocricetus auratus) cytokine cDNAs andanalysis of cytokine mRNA expression in experimental visceralleishmaniasis. Infect Immun 1998; 66: 2135–2142.

26 Fronhoffs S, Totzke G, Stier S, et al. A method for the rapidconstruction of cRNA standard curves in quantitative real-timereverse transcription polymerase chain reaction. Mol Cell Probes2002; 16: 99–110.

27 Mosmann TR, Cherwinski H, Bond MW, Giedlin MA & CoffmanRL. Two types of murine helper T cell clone. I. Definitionaccording to profiles of lymphokine activities and secretedproteins. J Immunol 1986; 136: 2348–2357.

28 Mosmann TR & Coffman RL. Heterogeneity of cytokinesecretion patterns and functions of helper T cells. Adv Immunol1989; 46: 111–147.

29 Wongratanacheewin S, Sermswan RW & Sirisinha S. Immunol-ogy and molecular biology of Opisthorchis viverrini infection.Acta Trop 2003; 88: 195–207.

30 Clery D, Torgerson P & Mulcahy G. Immune responses ofchronically infected adult cattle to Fasciola hepatica. Vet Parasitol1996; 62: 71–82.

31 Clery DG & Mulcahy G. Lymphocyte and cytokine responsesof young cattle during primary infection with Fasciola hepatica.Res Vet Sci 1998; 65: 169–171.

32 Pearce EJ, Caspar P, Grzych JM, Lewis FA & Sher A. Down-regulation of Th1 cytokine production accompanies inductionof Th2 responses by a parasitic helminth, Schistosoma mansoni.J Exp Med 1991; 173: 159–166.

33 Choi YK, Yoon BI, Won YS, et al. Cytokine responses in miceinfected with Clonorchis sinensis. Parasitol Res 2003; 91: 87–93.

34 O’Neill SM, Brady MT, Callanan JJ, et al. Fasciola hepaticainfection downregulates Th1 responses in mice. Parasite Immunol2000; 22: 147–155.

35 Pearce EJ, La Flamme A, Sabin E & Brunet LR. The initiationand function of Th2 responses during infection with Schisto-soma mansoni. Adv Exp Med Biol 1998; 452: 67–73.

36 Thomas PG, Harn DA, Jr. Immune biasing by helminth glycans.Cell Microbiol 2004; 6: 13–22.