Comparative study of the physiological roles of three peroxidases (NADH peroxidase, Alkyl...

Comparative study of the physiological roles of threeperoxidases (NADH peroxidase, Alkyl hydroperoxidereductase and Thiol peroxidase) in oxidative stressresponse, survival inside macrophages and virulenceof Enterococcus faecalis

Stephanie La Carbona,1† Nicolas Sauvageot,1†

Jean-Christophe Giard,1 Abdellah Benachour,1

Brunella Posteraro,2 Yanick Auffray,1

Maurizio Sanguinetti2† and Axel Hartke1*1Laboratoire de Microbiologie de l’Université de Caen,EA956 USC INRA2017, 14032 CAEN cedex, France.2Institute of Microbiology, Catholic University of SacredHeart, L. go F. Vito 1, 00168 Rome, Italy.

Summary

The opportunistic pathogen Enterococcus faecalis iswell equipped with peroxidatic activities. It harboursthree loci encoding a NADH peroxidase, an alkylhydroperoxide reductase and a protein (EF2932)belonging to the AhpC/TSA family. We present resultsdemonstrating that ef2932 does encode a thiol per-oxidase (Tpx) and show that it is part of the regulon ofthe hydrogen peroxide regulator HypR. Characteriza-tion of unmarked deletion mutants showed that allthree peroxidases are important for the defenceagainst externally provided H2O2. Exposure to internalgenerated H2O2 by aerobic growth on glycerol,lactose, galactose or ribose showed that Npr wasabsolutely required for aerobic growth on glyceroland optimal growth on the other substrates. Growthon glycerol was also dependent on Ahp. Addition ofcatalase restored growth of the mutants, and there-fore, extracellular H2O2 concentrations have beendetermined. This showed that the time point of growtharrest of the Dnpr mutant correlated with the highestH2O2 concentration measured. Analysis of the sur-vival of the different strains inside peritoneal macro-phages revealed that Tpx was the most importantantioxidant activity for protecting the cells against thehostile phagocyte environment. Finally, the Dtpx andthe triple mutant showed attenuated virulence in amouse peritonitis model.

Introduction

Enterococcus faecalis is a Gram-positive bacterium and anatural member of the digestive microflora in humans andmany other animals. Although harmless in healthy indi-viduals, some strains become pathogen mainly in hospi-talized patients under prolonged antibiotic treatments, inpatients with severe underlying diseases, and in patientswith an impaired immune system (Gilmore et al., 2002).E. faecalis has been identified as a leading cause ofsurgical site, bloodstream, urinary and persistent toothroot canal infections (Richards et al., 2000; Stuart et al.,2006). It is assumed that many enterococcal bloodstreaminfections are endogenous, originating from the gas-trointestinal tract, and macrophages may serve as avehicle facilitating invasion (Wells et al., 1990). The oxi-dative burst is one of the major mechanisms by which thehost’s phagocytes kill pathogenic bacteria. Therefore, anefficient oxidative stress response aiming to increase thecell’s antioxidant defence may be crucial, at least in theearly stages, for successful infection. In silico analysis ofthe genome sequence of E. faecalis strain V583 revealedthat this opportunistic pathogenic bacterium is wellequipped with antioxidant enzyme systems (Ribouletet al., 2007). It contains a single MnSOD, and a sodA-deletion mutant has recently been characterized (Verneuilet al., 2006). This showed that MnSOD plays a centralrole in the oxidative stress response not only towardssuperoxide but also towards hydrogen peroxide, and thatthe survival of the mutant inside macrophages wasseverely affected.

Enterococcus faecalis has historically been consideredto be catalase-negative, but a gene coding for a catalaseis present in the genome sequence of strain V583.E. faecalis cannot synthesize haem, but when cultured inthe presence of hemin, catalase activity was indeeddetected and overproduction of the enzyme providedextensive protection against H2O2 in E. faecalis V583(Frankenberg et al., 2002). Furthermore, enzyme charac-teristics showed that it belongs to the family of monofunc-tional catalases.

Three genes encoding peroxidases could also be

Accepted 30 September, 2007. *For correspondence. [email protected]; Tel. (+33) 2 31 56 54 04; Fax (+33) 2 3156 53 11. †These authors equally contributed to this work.

Molecular Microbiology (2007) 66(5), 1148–1163 doi:10.1111/j.1365-2958.2007.05987.xFirst published online 28 October 2007

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd

mailto:[email protected]

identified in the E. faecalis genome. The npr geneencodes the biochemically well-characterized NADHperoxidase of E. faecalis (Claiborne et al., 1992; 1999and references therein). It is a flavoenzyme which dis-plays a single redox-active thiol, Cys42, which cyclesbetween sulfenate and thiol forms during the NADH-dependent reduction of hydrogen peroxide into water.Survey of the TIGR database revealed that the presenceof genes encoding NADH peroxidase is restricted to feweubacterial genera, such as Streptococcus, Lactobacillusand Listeria. The presumed function of NADH peroxidaseis to inactivate endogenous H2O2 formed, for example bya-glycerophosphate oxidase during glycerol metabolismor dismutation of O2

-, but the enzyme may also protectagainst exogenous H2O2 (Gordon et al., 1953). This activ-ity is greatly induced by aerobic growth, and regulation ofexpression of the npr gene by an OxyR-like enterococcalprotein has been suggested (Pugh and Knowles, 1982;Ross and Claiborne, 1997). However, the closest homo-logue to the Escherichia coli OxyR protein is HypR,but this regulator does not control expression of npr inE. faecalis (Verneuil et al., 2004).

The bacterial alkyl hydroperoxide reductase (Ahp)system was first discovered in Salmonella typhimurium inthe laboratory of Bruce Ames (Christman et al., 1985).This system is induced by hydrogene peroxide andcumen hydroperoxide treatments (Morgan et al., 1986).AhpC is the peroxide-reducing protein of the system andis representative of a very large and ubiquitous family ofcysteine-based peroxidases [thiol-specific antioxidant(TSA) family], now designed as peroxiredoxins. AhpF, onthe other hand, is a flavoprotein and acts as the AhpCreductase (Poole, 2005). Together, the two polypeptidesreduce alkyl hydroperoxides to the correspondingalcohols. Previously, Ahp was primarily associated withthe detoxification of organic hydroperoxides (Jacobsonet al., 1989; Antelmann et al., 1996). However, it wasshown that the katG/katE double mutant of E. coliretained the ability to rapidly scavange H2O2 and that thisresidual activity was due to Ahp (Seaver and Imlay, 2001).This led to the conclusion that Ahp is the primary scaven-ger of endogenous low level of H2O2 in E. coli, whilecatalase is a more effective scavenger of high levels ofH2O2 and presumably, when the absence of a carbonsource depletes the cell of NAD(P)H required for Ahpactivity. In contrast to the E. coli system, a Bacillus subtilisahpC mutant was more resistant to different concentra-tions (from 100 mM up to 20 mM) of exogenously suppliedhydrogen peroxide than the wild-type strain. The ahpCmutation led to elevated expression of the peroxideregulon including katA, which may be at the basis of theincreased resistance to H2O2 (Bsat et al., 1996). Similarresults have been recently communicated for Staphylo-coccus aureus (Cosgrove et al., 2007). An operon of two

genes encoding homologues of AhpC and AhpF proteinsis present in the E. faecalis V583 strain, and its expres-sion is under direct positive control of the transcriptionalregulator HypR (Verneuil et al., 2004).

Another putative AhpC/TSA family protein is annotatedin the genome of E. faecalis V583 strain and encoded bythe locus ef2932. As we show in this study, the polypep-tide encoded by this gene displays homology with severalthiol peroxidases (Tpxs) from different organisms.Homologous enzymes are distributed throughout mosteubacteria. As AhpC, these enzymes belong to the per-oxiredoxin family of antioxidant enzymes, but they receiveelectrons from a reducing system composed of thiore-doxin and thioredoxine reductase (Baker and Poole,2003). Kinetic studies with E. coli Tpx showed that it pref-erentially decomposes organic hydroperoxides over H2O2.Expression of the tpx gene is induced by oxygen, andinverted repeat sequences were essential for this induc-tion (Kim et al., 1996). Phenotypic analysis of an E. colitpx-deletion mutant showed that, while still viable, it wasmore susceptible to oxidative stress and displayed dimin-ished colony sizes and numbers after peroxide exposure(Cha et al., 1996).

In this study, we present, first, results strongly suggest-ing that locus ef2932 does encode a thiol peroxidase.Furthermore, isogenic deletion mutants of the three genesencoding NADH peroxidase and the two peroxiredoxinesof E. faecalis have been constructed, and their physio-logical functions in different oxidative stress situationscompared.

Results

ef2932 encodes a thiol peroxidase

Survey of the genome sequence of E. faecalis V583(The Institute of Genomic Research; http://www.tigr.org)revealed the presence of three genes encoding charac-terized or putative peroxidases. The npr gene (ef1211)encodes the biochemically well-studied NADH peroxi-dase. The gene is transcribed monocistronically (Verneuilet al., 2004), and its transcription is induced under aerobicgrowth (Pugh and Knowles, 1982). Due to its knownin vitro activities, it is generally assumed that this enzymeis important for the oxidative stress response inE. faecalis but so far, no genetic studies in order to pre-cisely define its physiological functions have beenperformed.

The two other genes identified in the genome sequence(ef2739 and ef2932) encode polypeptides belonging tothe ubiquitous family of peroxiredoxins. EF2739 showssignificant homology with peroxide-reducing protein AhpCof E. coli and S. typhimurium (54% and 55% identity,respectively). The corresponding gene is embedded in a

Physiological role of peroxidases in Enterococcus faecalis 1149

© 2007 The AuthorsJournal compilation © 2007 Blackwell Publishing Ltd, Molecular Microbiology, 66, 1148–1163

http://www.tigr.org

bicistronic operon structure (Verneuil et al., 2004), and thesecond gene (ef2738) of the operon shared low homology(around 30% identity) with the large subunit of Alkyl hydro-peroxide reductase (Ahp) from different bacteria. The ahpoperon seems to be involved in the oxidative stressresponse of E. faecalis because its expression is underthe direct control of the well-defined peroxide regulatorHypR (Verneuil et al., 2004). However, no reports aboutphysiological functions and implication of the gene prod-ucts of the E. faecalis ahp operon in the oxidative stressresponse have been published.

The polypeptide encoded by ef2932 showed, on theaverage, about 30% homology with bacterial thiolperoxidases. The biochemically best-characterized thiolperoxidase is the E. coli enzyme which contains threecysteines (C61, C82 and C95) (Cha et al., 1996, 2004).Mutagenesis studies showed that C61 is the peroxidaticcentre and it links with resolving C95 to form an intramo-lecular disulfide bond (Baker and Poole, 2003). In con-trast, C82 is not or less important for enzyme activity,because mutation of this residue only slightly affectsreaction rates. The E. faecalis polypeptide containstwo cysteine residues (C59 and C93), and they align withthe catalytically important E. coli ones. Therefore, weassumed that EF2932 could correspond to a thiol peroxi-dase (Tpx) of E. faecalis. Mutants harbouring point muta-tions in the presumed catalytic cysteines (exchange of C59

or C93 to serine) have been constructed, and the mutantenzymes as well as the wild-type Tpx protein were over-expressed and purified to homogeneity in E. coli. TheseTpx variants were then tested in a previously describedstandard assay for thiol peroxidase activity (Rho et al.,2006). In this assay, reactive oxygen species are gener-ated by a metal-catalysed oxidation system which coulddamage supercoiled (sc) DNA. As can be seen in Fig. 1,without enzyme added, all the scDNA was converted tothe open-circular form whereas scDNA in the positivecontrol, to which EDTA was added beforehand, was pro-

tected from nicking in the reaction condition. The mutantTpxC59S failed to protect the scDNA from degradation,whereas the wild-type enzyme and the TpxC93S variantdemonstrated protection activity.

Determination of the operon structure and mapping ofthe promoter of ef2932

Figure 2A shows the genome context of the gene ef2932encoding the Tpx of E. faecalis. Two genes encoding aputative DNA binding protein (ef2933) and a thiazol bio-synthesis protein (ef2934) are present upstream of the tpxgene in the same transcriptional direction. No Rho-independent transcriptional terminator could be identifiedbetween these genes and ef2932, whereas such astructure is present downstream of the tpx gene(DG25°C = -27.6 kcal mol-1). To define the operon structureof ef2932, a Northern blot analysis was realized(Fig. 2B1). A unique transcript of approximately 1.4 kbwas detected, which was considerably greater than theexpected size (0.5 kb) of a monocistronic transcript of thetpx gene. We concluded that tpx may be expressed in abicistronic operon including the upstream gene ef2933encoding a putative DNA binding protein (Fig. 2A).RT-PCR confirmed the existence of such a transcriptin vivo (Fig. 2B2). The transcriptional start site (+1)upstream of ef2933 was determined by 5′ RACE-PCR.It was identified as the ‘G’, located 28 nt upstream ofthe putative start codon (Fig. 2C). A putative -10 boxsequence matching four of the six bases (GATAAA,matches underlined) with the consensus sequence ofhousekeeping promoters is located 8 nt upstream the +1.No potential -35 box sequence could be revealed in areasonable distance from the -10 box. The Northern blotanalyses showed also that the tpx gene did not seem tobe significantly induced by H2O2 (Fig. 2B1).

tpx is directly regulated by HypR

We previously showed that, unlike npr, the transcription ofahpCF operon is directly controlled by the regulator HypR(Verneuil et al., 2004). Because AhpCF and Tpx are bothpart of the large family of peroxiredoxines, we wonderedwhether tpx expression may also be part of the HypRregulon. Real-time quantitative PCR was carried out usingsamples from the wild-type and hypR mutant harvested inthe middle of exponential growth phase after H2O2 stressor not. No significant difference was detected in internalcontrol amplifications of 23S rRNA, regardless of thestrain or the used culture conditions. Our results showedthat tpx expression was significantly downregulted(19.7-fold, P = 0.032) in the hypR mutant only under H2O2

condition. In JH2-2, the transcription of tpx was notinduced by the oxidative stress, confirming the Northern

SC

OC

1 2 3 4 5 6

Fig. 1. DNA cleavage protection assay by wild-type Tpx andTpxC59S as well as TpxC93S mutant proteins. The reaction wascarried out during 30 min at 37°C and stopped with 125 mM EDTA.The different lanes correspond to pUCB30 plasmid only (lane 1),to the reaction mixture without Tpx (negative control, lane 2),to the reaction mixture without Tpx, but EDTA was added beforeincubation (positive control, lane 3), with Tpx (lane 4), TpxC59Smutant (lane 5) and TpxC93S mutant (lane 6). SC and OC indicatethe supercoiled and open-circular forms of pUCB30 plasmid,respectively.

1150 S. L. Carbona et al.


blot experiment (Fig. 2B1). This type of regulation wasalso observed for ahpCF, and the combined resultsstrengthen the fact that HypR acts as an oxidative stress-specific transcriptional activator (Verneuil et al., 2004).

In order to analyse whether HypR directly controls theexpression of tpx, mobility shift protein–DNA bindingassay was performed. As expected, purified HypR boundspecifically to the region upstream of the tpx gene (Fig. 3).The addition of the unlabelled tpx promoter as competitorresulted in loss of shift compared with addition of a non-specific DNA fragment (Fig. 3). This proved that HypRbinds in a specific manner to the promoter regionupstream of the tpx locus.

Survival of peroxidase-deletion mutants againstexogenously provided H2O2

In order to define the physiological roles of the threeperoxidases, unmarked single mutants and the corre-sponding triple deletion mutant have been constructed.

CACAAACAAGTTGCTCGGAGAGGGGAACCGTGATAAACTGAATATGTGAAGTAGGTAACAAGGAGGACAGAGGATG-ef2933RBS Met-10

+1

0.63

0.96

1.3

130 bp64 bp

tpx ef2933 ef2934

A

B1

C

B2

1 2 31 2 3

0.2

0.6

1.0

CACAAACAAGTTGCTCGGAGAGGGGAACCGTGATAAACTGAATATGTGAAGTAGGTAACAAGGAGGACAGAGGATG-ef2933RBS Met-10

+1

tpx ef2933 ef2934

Te

Fig. 2. Characterization of the ef2932 gene encoding a putative thiol peroxidase (Tpx).A. Genomic context of tpx gene. The putative terminator of transcription (Te) and the distances between genes are indicated.B1. Northern blot analysis of E. faecalis RNA. Samples of total RNA were prepared from cultures grown in glass tubes without agitation. JH2-2wild-type cells were harvested from exponential growth phase (lane 1), at the beginning of stationary phase (lane 2), or after exposure ofexponentially growing cells to 2.4 mM H2O2 during 10 min (lane 3). Hybridization was performed with a probe specific for tpx gene. Sizes in kbdeduced from a RNA ladder are indicated on the right.B2. RT-PCR using one oligonuleotide specific for the tpx gene and a second one mapping inside ef2933 ORF, giving rise to the synthesis ofan amplimer of 750 bp. Lanes 1–3: DNA marker, PCR reaction on total RNA without reverse transcriptase reaction, and RT-PCR on total RNA,respectively. The absence of amplification in lane 2 demonstrates absence of chromosomal DNA contamination in the RNA preparation.C. Mapping of the 5′-ends of the ef2933-tpx mRNA by amplification of cDNA ends-PCR analysis. The transcriptional start site is indicated byan arrow. The -10 region, the ribosome binding site (RBS) and start codon are represented in bold letters and underlined.

1 2 3 4

Fig. 3. Electrophoretic mobility shift assay of HypR binding to thepromoter region of tpx. D4-labelled tpx promoter was incubatedwithout protein (lane 1), with purified HypR (lane 2), with anunlabelled competitor (lane 3), and with a non-specific DNAfragment (lane 4).



Growth characteristics of the mutant strains were not dif-ferent from those of the wild-type strain under aerobicgrowth in GM17 medium (data not shown), demonstratingthat the peroxidases are dispensable for cell viabilityunder aerobic conditions. However, all strains were moreaffected in their growth in the presence of differentconcentrations of H2O2 relative to the wild-type strain(Fig. 4A). The Dnpr mutant was the most sensitive, as itsgrowth was significantly inhibited at the lowest H2O2 con-centration tested (5 mM). The Dtpx mutant was slightlyless affected than Dnpr, strengthening the hypothesis that

the ef2932 locus encodes an antioxidant activity ofE. faecalis. Finally, significantly less sensitive, but alwaysmore affected in its growth relative to the wild-type wasthe DahpCF mutant strain (Fig. 4A). This demonstratedthat each peroxidase contributes to the oxidative defencesystem of E. faecalis. Moreover, the triple mutantDnpr/Dtpx/DahpCF displayed comparable growth charac-teristics as the Dnpr single mutant, arguing that the threemutations have no cumulative effects (Fig. 4A).

The effect of exogenous H2O2 stress on survival of eachmutant strain was then evaluated. Cells were challengedwith 7 mM H2O2, and cfu was determined every 2 h during6 h (Fig. 4B). Survival of the single and of the triplemutants were comparable after 2 h of challenge(1% and 0.6% survival, respectively), but significantlymore affected than the wild-type strain (50.6% survival).After longer incubation times with H2O2, differencesbetween the mutants could be detected. Indeed, 6 h afterthe H2O2 stress, the Dnpr and Dtpx single mutants showed29- and 57-fold greater killing than the wild-type strainrespectively, while the DahpCF mutant was only 4-foldmore sensitive (Fig. 4B). Survival of tpx mutants harbour-ing point mutations in the presumed catalytic cysteines(exchange of C59 or C93 to serine) was comparable to thatof the Dtpx mutant. As for the growth experiments, themutant deleted of the three peroxidases was only slightlymore sensitive than the single npr and tpx mutants(Fig. 4B).

Survival of the peroxidase mutants against internallyformed H2O2

In order to provoke an intracellular oxidative stress, glyc-erol was selected as the carbon source because its oxi-dation by aerobically grown E. faecalis cells producesH2O2 by glycerophosphate oxidase (Jacobs andVandemark, 1960a,b). The results of growth of the wild-type strain and the different peroxidase mutants inccM17MOPS medium supplemented with 0.3% glycerolare shown in Fig. 5A. Without added glycerol and usingthe wild-type strain, the maximal final OD600 was 0.18(which corresponds to approximately 2 generations) after24 h of incubation (data not shown). Compared with thewild-type strain (final OD600 = 3.5), the mutant with adefective npr gene was severely affected in its aerobicgrowth on glycerol and reached maximal final OD600 of0.38 (which corresponds to approximately 3 generations).The ahpCF-deletion mutant showed a significantlyreduced growth rate (m = 0.15 h-1 compared withm = 0.25 h-1 for the wild-type strain) during all the time-course of the experiment. The growth defects of bothmutants could be restored by complementation with thecorresponding wild-type alleles (Fig. 5A and data notshown). The growth rate of the Dtpx mutant was also

A

A A

A

A

B

B

B

B

C

C

C

C

D

D

D D

E

E

E E

0

1

2

3

4

5

6

OD

600nm

B

0,001

0,01

0,1

1

10

100

0

Time (hours)

Su

rviv

al (

%)

2 4 6

21 3 4

Fig. 4. Effect of exogenous H2O2 stress on growth (A) and survival(B) of peroxidase mutants.A. Wild-type strain (A, black bars), Dahp (B, squared bars), Dtpx(C, grey bars), Dnpr (D, hatched bars) and Dnpr/Dtpx/Dahp (E,dotted bars) mutants were harvested in exponential growth phase(OD = 0.5) and then treated with different H2O2 concentrations (5.0,5.5, 6.0, and 6.5). The OD600 was measured 15 h after the stress.B. Wild-type strain (�), Dahp (�), Dtpx (�), Dnpr (�),Dnpr/Dtpx/Dahp (x) and tpxC59 S (�) mutants were stressed with7 mM H2O2 at OD600 = 0.5. Number of cfu ml-1 was determinedevery 2 h during 6 h. Mean values of three independentexperiments are represented, and standard deviations are indicatedin A and B. Comparable result of strain tpxC59 S was obtained withthe tpxC93 S mutant (data not shown).



slightly reduced (m = 0.19 h-1), but the final OD600 is similarto that of the wild-type after 24 h of growth.

Routinely we check growth of our constructed mutantson different carbohydrates. Lactose was chosen becausemilk and milk products are natural habitats for E. faecalis,and galactose and ribose (as well as glycerol) might becarbohydrates used by this commensal bacterium in theintestine. This showed that, in comparison with the wild-type strain, the Dnpr mutant had reduced growth rates andentered stationary phase at a lower OD600 when aerobi-cally grown on these sugars (Fig. 5B and data not shown).In contrast, no difference was observed under these con-ditions when the strains were grown on glucose (Fig. 5B)

or anaerobically on the different sugars (data not shown).The growth deficiency was specific for the NADHperoxidase mutant, because no growth differences wereobserved between the wild-type strain and the Dtpx andDahpCF mutants (data not shown).

Growth alterations of mutant strains correlates withextracellular accumulation of H2O2

The growth defect of the Dnpr mutant on glycerol andgalactose could be restored by the addition of bovin cata-lase to the growth medium. In the case of galactose, theaddition of catalase restored growth of the Dnpr mutantnearly to wild-type level (Fig. 6A). As we showed above,the Dnpr mutant stopped growing on glycerol after few

A

0

1

2

3

4

0 5 10 15 20 25

Time (hours)

OD

600n

m

B

0

1

2

3

4

5

6

7

0 10 20 30

Time (hours)

OD

600nm

Fig. 5. Growth of peroxidase mutants on different carbon sources.A. Wild-type strain (�), Dnpr (�), Dtpx (�) and Dahp () mutants,as well as the complemented Dnpr mutant (�), were cultured onccM17MOPS supplemented with glycerol. A comparable result asobtained with the last strain has also been obtained with acomplemented Dahp strain (data not shown).B. Wild-type strain (squares) and Dnpr mutant (triangles) weregrown on ccM17MOPS supplemented with galactose (opensymbols) or glucose (closed symbols). Comparable results as forgalactose has been obtained with lactose or ribose as the growthsubstrate. All experiments shown in A and B have been repeated atleast three times and mean values are shown.

A

0

1

2

3

4

5

6

7

0 2 4 6 8 10 12

Time (hours)

OD

600n

m

B

0

1

2

3

4

0 2 4 6 8 10 12

Time (hours)

OD

600n

m

Fig. 6. Effect of catalase on JH2-2 and Dnpr strains growth ongalactose (A) and glycerol (B). Wild-type strain (squares) andDnpr mutant (triangles) were aerobically grown on ccM17MOPSsupplemented with galactose or glycerol. After 2 h of culture, bovincatalase was added to the medium (indicated by the arrow) at afinal concentration of 500 U ml-1 (open symbols). Growth withoutcatalase is also shown (closed symbols). All experiments shown inA and B have been repeated at least three times and mean valuesare shown.



divisions. Interestingly, addition of catalase not onlyallowed this mutant to grow on this carbohydrate, but itgrew even more rapidly than the wild-type strain incu-bated without catalase. The addition of catalase was alsogrowth promoting for the JH2-2 strain, and it enteredstationary phase at a slightly higher OD600 than the Dnprmutant under these conditions (Fig. 6B).

The extracellular H2O2 concentration was then deter-mined for cultures grown on glycerol, galactose andglucose. When grown on glycerol, H2O2 concentrationsincreased steadily during the first hours of culture for thewild-type and the Dnpr mutant (Fig. 7A). After 4 h, theperoxide concentration for the wild-type and NADH

peroxidase mutant was around 235 and 350 mM, respec-tively. The production rates between 2 and 4 h ofculture for these strains were 490 � 61 mM min-1

per 109 cfu ml-1 (or 5 � 0.2 nmol min-1 per 109 cfu)and 885 � 84 mM min-1 per 109 cfu ml-1 (or 9 � 0.4 nmolmin-1 per 109 cfu), respectively. Growth rate of the Dnprmutant decreased after 4 h, and it completely stoppedgrowing after 6 h of culture. The extracellular H2O2 con-centration remained between 230 and 280 mM until theend of the experiment. In contrast, the extracellular per-oxide concentration dropped continuously in the wild-type cultures and, after 24 h, it was under the limit ofdetection by our assay (< 0.5 mM). Different from theDnpr mutant, the wild-type grew steadily over the entireduration of the experiment. It is noteworthy that the Dtpxmutant, who showed comparable growth characteristicson glycerol as the wild-type strain, demonstrated alsocomparable evolution concerning H2O2 production anddisappearance as the parental strain under these condi-tions (data not shown).

Increase in extracellular H2O2 concentration in theahpCF-deletion mutant grown on glycerol was comparableto that of the wild-type strain during the first 6 h of culture.After this time point, the peroxide concentration decreasedbut slower than the wild-type strain. After 24 h, the H2O2

concentration was still around 120 mM. Growth of thismutant strain was comparable during the first 6 h of cultureto that of the Dnpr mutant but, in contrast to this last strain,the DahpCF mutant continued to grow, albeit with a signifi-cantly reduced growth rate than the wild-type strain.

Increase in extracellular H2O2 concentration in the Dnprmutant grown on galactose was slower (158 � 41 mMmin-1 per 109 cfu ml-1) than on glycerol. However, after8 h, the peroxide concentration was around 250 mM(Fig. 7B). Thereafter, it decreased to 150 mM, a concen-tration which did not vary until the end of the experiment.In contrast, little or no H2O2 could be detected in wild-typecultures under these conditions. In comparison with thislast strain, the growth rate of the Dnpr mutant decreasedafter 4 h and it started to enter into stationary phase after8 h of culture.

As stated above, no growth differences were observedbetween the wild-type and the mutant strains when grownon glucose. We determined H2O2 accumulation underthese conditions for the wild-type strain and the Dnprmutant. For both strains, the peroxide concentrationswere comparable, and were about 20 mM in exponentiallygrowing cultures and 10 mM at the entrance of stationaryphase (data not shown).

Survival of peroxidase mutants inside mouseperitoneal macrophages

E. faecalis has been identified in the last years as a major

A

0,0

50,0

100,0

150,0

200,0

250,0

300,0

350,0

400,0

0 5 10 15 20 25

Time (hours)

[H2O

2] µ

M

0

1

2

3

4

5

6

OD

600nm

B

0,0

50,0

100,0

150,0

200,0

250,0

300,0

350,0

400,0

0 5 10 15 20 25

Time (hours)

[H2O

2] µ

M

0

1

2

3

4

5

6

OD

600nm

Fig. 7. Correlation between growth behaviour and H2O2 productionin wild-type and peroxydase mutants.A. Wild-type strain (squares), Dnpr (triangles) and Dahp (circles)mutants were cultured on ccM17MOPS supplemented with glycerol.H2O2 concentrations were determined in micromolar (filledsymbols).B. Wild-type (squares) and Dnpr (triangles) strains were culturedon ccM17MOPS supplemented with galactose. For a betterunderstanding, growth curves of the different strains are alsoshown (open symbols) in A and B. For H2O2 measures, meanvalues of two independent experiments are represented andstandard deviations are indicated.



component of hospital-caused acquired infections. Ingeneral, non-professional phagocytes are the firstdefence against invading pathogens, and the ability toavoid or survive phagocytic attack is thus very importantfor a pathogen. Because, during phagocytosis, phago-cytic cells generate reactive oxygen species which areinvolved in antibacterial activity (Hassett and Cohen,1989), we were interested to compare the intracellularsurvival of the three peroxidase mutants and the wild-typestrain inside infected mouse peritoneal macrophages.As it has been demonstrated in other studies (Gentry-Weeks et al., 1999; Verneuil et al., 2004), E. faecalissurvives much better inside the phagocytic cells thanE. coli (Fig. 8). In comparison with the E. faecalis wild-type strain, the Dnpr and DahpCF mutants were onlyslightly affected in their ability to survive the oxidativeburst (P > 0.05). In contrast, the Dtpx mutant was signifi-cantly more sensitive than the aforementioned E. faecalisstrains to the hostile phagocyte environment (P < 0.05),and nearly as sensitive as the previously characterizedhypR mutant (Verneuil et al., 2004). Complementation ofthe Dtpx mutant restored survival nearly to the level of thewild-type (Fig. 8). Finally, the triple peroxidase mutant waseven more sensitive than the Dtpx mutant, and its survivalwas similar to the E. coli control strain.

The Dtpx, and especially the Dtpx/Dnpr/Dahp triplemutant, are attenuated in virulence

To evaluate virulence in comparison with the JH2-2 wild-type, the different peroxidase mutants were tested in a

mouse peritonitis model (Fig. 9). Mutants affected in ahp-operon or npr gene killed mice as the parental strain(P = 0.38 and P = 0.75, respectively). In contrast, the Dtpxmutant was slightly, but significantly (P = 0.05) attenuatedin virulence. Wild-type level virulence was reconstituted inthe complemented Dtpx strain (data not shown). However,the greatest attenuation in this virulence test was obtainedwith the triple peroxidase mutant (P = 0.001). In fact, ascompared with the JH2-2 wild-type strain, the Dtpx/Dnpr/Dahp mutant showed a higher LD50 (7.1 ¥ 107 versus2.0 ¥ 107).

Discussion

Most aerobes have multiple, often overlapping pathwaysfor detoxifying reactive oxygen species. This seemed alsothe case for the opportunistic pathogen E. faecalis.Indeed, analysis of the genome sequence of strain V583revealed the presence of genes encoding a monofunc-tional catalase and up to three peroxidases. Please noteagain that E. faecalis cannot synthesize haem, and there-fore, without addition of this cofactor to the growthmedium, the catalase is inactive. The aim of the presentstudy was to analyse the physiological roles of the threeperoxidases in the oxidative stress response and the sur-vival inside macrophages of E. faecalis.

Evidences that ef2932 locus encodes a thiol peroxidasein E. faecalis

Besides the well-characterized NADH peroxidase(Claiborne et al., 1992, 1999) encoded by the npr geneand the alkyl hydroperoxide reductase system encodedby ahpC (encoding the peroxide reducing protein) and

Fig. 8. Time-course of intracellular survival of the E. faecalis andE. coli DH5a strains within murine peritoneal macrophages. Micewere infected with JH2-2 strain (�), Dnpr (�), Dtpx (), Dahp (�)mutants, complemented Dtpx mutant (�), Dtpx/Dnpr/Dahp triplemutant (*) and E. coli DH5a strain (�). The data are themeans � standard deviations for the number of viable intracellularbacteria per 105 macrophages in three independent experimentswith three wells.

Fig. 9. Kaplan–Meier survival curves of peritoneally infected miceafter injection of E. faecalis JH2-2 (6.2 ¥ 107 cfu) (�),Dnpr(7.0 ¥ 107 cfu) (�), Dahp (5.9 ¥ 107 cfu) (�), Dtpx (5.5 ¥ 107 cfu)(), and Dtpx/Dnpr/Dahp triple mutant (7.0 ¥ 107 cfu) (*). The LD50

values for the different strains are: 2.0 ¥ 107, 2.0 ¥ 107, 2.0 ¥ 107,3.9 ¥ 107, and 7.1 ¥ 107, respectively.



ahpF (the putative AhpC reductase), a third peroxidasemay be present in E. faecalis. Despite poor homology tothiol peroxidases of different microorganisms, results pre-sented in this study showed that this locus does encode athiol peroxidase (Tpx) homologue of E. faecalis. First, theE. coli redox-active cysteine residues (Cha et al., 1996,2004) are conserved in the E. faecalis sequence (C59 andC93). Second, inactivating the corresponding gene by theintroduction of a central deletion led to a mutant whichwas extremely sensitive to exposure to H2O2. Third,exchange of C59 or C93 into serine also led to a peroxide-sensitive phenotype, which supports the assumption thatthese residues are important for catalytic activity of theenzyme. Fourth, expression of the tpx gene is under thedirect control of the hydrogen peroxide regulator HypR.Interestingly, this enterococcal regulator also regulatesdirectly expression of ahpCF operon (Verneuil et al.,2004). So, both peroxiredoxines are part of the HypRregulon in E. faecalis. The deregulation of expression ofthese operons in the hypR mutant may also be at thebasis of its H2O2 sensitivity and its reduced capacity tosurvive inside peritoneal macrophages (Verneuil et al.,2004). Lastly, wild-type Tpx protected scDNA from nickingby reactive oxygen species generated by a metal-catalysed oxidation system. In this assay, the single-pointTpxC59S variant failed to protect scDNA, arguing thatCys59 is the peroxidatic cysteine in the E. faecalis Tpx. Incontrast, the TpxC93S enzyme was as effective in pro-tection of scDNA as the wild-type protein. Using the samesystem, a comparable result has been obtained for theM. tuberculosis TpxC93S (Rho et al., 2006). However,these authors showed also that TpxC93S had no peroxidereduction activity in a coupled assay with thioredoxin/thioredoxin reductase and NADPH as the reducing agent.So, the functional relevance of Cys93 in the E. faecalisTpx remains to be analysed.

HypR is the closest relative of OxyR, which is the mainregulator of the oxidative stress response in E. coli (Storzand Imlay, 1999). OxyR exists in an inactive or activeconformation: in the presence of peroxides, two cysteineresidues are oxidized, which led to activation of the regu-lator (Monqkolsuk and Helmann, 2002). The homologybetween OxyR and HypR is poor, and HypR did not containany cysteines. Therefore, it is still unknown how HypRsenses the presence of peroxides.As we showed here, thetpx gene is part of a bicistronique operon structure with aputative DNA binding protein of unknown function. Inter-estingly, the DNA binding protein contains two cysteineresidues, and we asked whether it may correspond to theperoxide sensor which might, after activation, interact withHypR. Inactivation of this gene should result in a mutantstrain sensitive to H2O2. However, introduction of a mark-erless in-frame deletion did not modify H2O2 sensitivity ofthe corresponding mutant (data not shown).

The three peroxidases are important to fight externallyprovided H2O2

The physiological functions of the three peroxidases havebeen analysed. Results obtained with cultures exposed toexogenously provided H2O2 showed that all of them arepart of the peroxide defence system of E. faecalis but Tpxand Npr seemed to be more important than AhpCF underthese stress conditions. Surprisingly, the individual muta-tions had no additive effects because the mutant withdeficiencies in the three peroxidases are only slightlymore affected than the single mutants. This suggests thatthe different peroxidases have specialized roles for pro-tecting the cells against oxidative stress. The reasonsmay be due to different substrate specificities and/or dif-ferent cellular locations of these enzymes. It has beenshown that Ahp and Tpx preferentially detoxify alkylhydroperoxides and lipid peroxides have been supposedto be their natural substrates (Jacobson et al., 1989; Chaet al., 2004). In E. coli, the cellular locations of these twoperoxiredoxines are different. Ahp has been located in thecytoplasm, whereas Tpx seems to be a periplasmicenzyme, despite the absence of a signal sequence (Chaet al., 1995; Link et al., 1997). Furthermore, Mycobacte-rium tuberculosis Tpx was described as a culture filtrateprotein in search for vaccine candidates, and proteomicstudies identified it in cell wall fractions (Rho et al., 2006;Rosenkrands et al., 2000a, b). It is characterized as oneof the antigens strongly recognized in animals infectedwith this organism and induces a strong proliferativeresponse in humans and mice (Weldingh et al., 1998).The lack of cumulative effects of the mutations inE. faecalis may be explained by assuming that the threeperoxidases form an antioxidant shield protecting differentsensitive targets in E. faecalis. By inactivating one of theperoxidases, this shield becomes leaky, leading toperoxide-induced lethal damages.

Npr and AhpCF are important for oxidativegrowth on glycerol

In order to provoke an internal generation of H2O2, we firstanalysed growth of the different peroxidase mutants onglycerol as a growth substrate. Under aerobic conditionsand after its uptake, glycerol is first phosphorylated byglycerol kinase, which is then oxidized by glycerol-3-phosphate oxidase in E. faecalis (Pugh and Knowles,1982). In this last reaction, the electrons are transferred toO2, which is reduced to H2O2. Because the three peroxi-dases are important to fight exogenously added H2O2, weassumed that they might be also implicated in the detoxi-fication of the H2O2 formed intracellularly under thiscondition. However, the thiol peroxidase is rather dispens-able for the aerobic growth on glycerol. Early studies on



NADH peroxidase predicted that one of its physiologicalrole may be the scavenging of the H2O2 formed byglycerol-3-phosphate oxidase (Gordon et al., 1953). If thisis correct, we supposed that in the Dnpr mutant, H2O2

would accumulate, which should become graduallygrowth inhibitory during culture on this substrate. So, wewere surprised to find that the NADH peroxidase-deficientmutants virtually did not at all grow on glycerol. Indeed,they stopped growing after a few (1 or 2) divisions. Fromour results it is estimated that the Dnpr mutant stoppedgrowing when the extracellular peroxide concentrationexceeded 0.25 mM H2O2.

H2O2 can readily diffuse into or out of the cells (Seaverand Imlay, 2001). As we showed in this study, the Dnprmutant seemed to have virtually no H2O2 scavengingactivity when cultured aerobically on glycerol. So, theintracellular H2O2 concentration might be the same as theextracellular concentration for this strain. Nevertheless,external addition of 0.3 mM H2O2 to a culture at OD600 of0.3 had no influence on growth for the wild-type as well asfor the Dnpr mutant (data not shown). Thus, our combinedresults seem to indicate that H2O2 is more damaging ifgenerated inside cells than if added externally to thecultures.

Growth on glycerol is also dependent on a functionalahpCF operon. However, unlike the Dnpr mutant, theAhpCF-deficient strain grew on this substrate but, in com-parison with the wild-type, with a significant reducedgrowth rate. This double dependence of glycerol catabo-lism on two peroxidases was an interesting but unex-pected finding. H2O2 measurements showed that allstrains, including the wild-type (see below), accumulatedhydrogen peroxide in the first hours of culture. Whereasthe accumulated H2O2 was subsequently completelydegraded in the culture of the wild-type strain, the perox-ide concentration remained constant at a high level inthe Dnpr mutant, demonstrating that Npr is absolutelyrequired for the elimination of the accumulated H2O2.However, the results obtained with the AhpCF deficientstrain showed that H2O2 scavenging in this mutant wasalso suboptimal, suggesting that the fast and completedegradation of hydrogen peroxide, as observed in thewild-type, necessitates the activities of the two peroxy-dases, Npr and Ahp, in E. faecalis.

As mentioned above, also the E. faecalis wild-typestrain accumulated significant amounts of H2O2 in the first10 h of culture, despite the presence of functional Npr andAhp. The addition of catalase after 2 h of culture acceler-ated considerably aerobic growth on glycerol of this strain,strongly suggesting that the H2O2 produced was growthinhibitory for the wild-type strain. Glycerol may be a sub-strate for E. faecalis in the intestine, and its metaboliza-tion near the oxygenated luminal surface may impose,according to our results, severe oxidative stress on

colonic epithelial cells. The ability to damage eukaryoticcellular DNA by the production of O2

- (17.2 nmol min-1 per109 cfu) by this commensal bacterium has been recentlydemonstrated, and the authors postulated that this maycontribute to carcinogenesis (Huycke et al., 2001, 2002).

Npr activity is also needed for aerobic growth onlactose, galactose and ribose

No growth difference was observed between the threeperoxidase mutants and the wild-type when grown aero-bically on glucose. In contrast, we discovered that whenusing lactose, galactose or ribose as carbon sourcesunder aerobic conditions, growth of the Dnpr, but not ofthe other mutants, slowed progressively over time in com-parison with the wild-type. Due to the well-known activityof NADH peroxidase, we supposed that catabolism ofthese substrates led to the formation of H2O2, whichaccumulates until growth inhibitory concentrations in theabsence of a functional NADH peroxidase. Experimentsconducted with bovine catalase strengthened our inter-pretation, and quantification experiments clearly showedthat E. faecalis generated substantial amounts of H2O2

when grown on these substrates, but not when grownunder these conditions on glucose. However, in compari-son with growth on glycerol, production rates as well asfinal concentrations of H2O2 are lower on the other sugars.Unlike some Streptococci (Pericone et al., 2003),E. feacalis lacks pyruvate oxidase. Furthermore, itsNADH oxidase is of the water-forming type (Schmidtet al., 1986). Therefore, the source of the H2O2 productionon lactose, galactose and ribose remains hithertounexplained.

Tpx is the most important antioxidant activityinside macrophages

Macrophages are central to the effector arm of immunedefence against most pathogens. Through a variety of cellsurface receptors, macrophages internalize microbes intophagosomes that undergo maturational events thatexpose the microbe to acid, lytic enzymes, oxygenatedlipids, fatty acids, reactive oxygen and, in the case ofmurine macrophages, reactive nitrogen species (Aderemand Underhill, 1999; Nathan and Shiloh, 2000). Due toprofound biochemical shifts during the host cell’s effort tokill and degrade the microbial pathogens, the phagosomeis a difficult organelle to study. One of the main objectivesof our laboratory is to identify genes important forthe survival of E. faecalis inside the macrophageenvironment. For example, the hypR mutant is severelyaffected (Verneuil et al., 2004). This transcriptional regu-lator was shown to regulate directly the expression of theahpCF (Verneuil et al., 2004) and tpx operon (this study),



and we assumed that this should explain its macrophagephenotype. In the present study, we showed that a tpxmutant is significantly more sensitive against macrophagekilling than the ahp and also npr mutants, identifying thethiol peroxidase as the most important protective enzy-matic activity among the three peroxidases of E. faecalisinside murine macrophages. Because the single tpxmutant is nearly as sensitive as the hypR mutant, it isstrongly suggested that macrophage sensitivity of thelatter mutant is mainly due to the deregulation of tpx geneexpression. Nevertheless, also Ahp and Npr are impli-cated in protecting E. faecalis against macrophage killing,because the triple peroxidase mutant was even moresensitive than the single tpx and hypR mutants.

The enterococcal peroxidases are importantvirulence factors

In comparison with the other single mutants, the Dtpxstrain was also less virulent in a mouse peritonitis model.However, mice killing by the Dtpx/Dnpr/Dahp triple mutant

was significantly more attenuated than that of the Dtpxmutant, demonstrating cumulative effects of mutations ingenes encoding the three peroxidases of E. faecalis. Thisalso showed that an intact oxidative defence systemseems to be important for E. faecalis virulence.

In conclusion, our study showed that the differentperoxidases of E. faecalis have distinct cellular roles(Fig. 10). They are all important to protect cells from lethaldamage provoked by externally provided H2O2. However,they seem to protect different sensitive targets because amutant defective in the three peroxidase-encoding geneswas not more sensitive as the individual mutants. Npr isthe most important peroxidase for protecting the cellsagainst internally formed H2O2 during aerobic catabolismof especially glycerol, but also lactose, galactose andribose (Fig. 10). However, optimal growth on glycerol wasalso dependent on active Ahp reductase. We demon-strated that the growth inhibitory phenotypes are corre-lated with the accumulation of H2O2 in the growth medium.On the other hand, the Tpx enzyme is clearly the mostimportant activity to protect the cells against the complexantibacterial weapons synthesized during the oxidativeburst inside mouse peritoneal macrophages (Fig. 10). Theattenuated virulence of the Dtpx mutant demonstratedfurther the in vivo functional importance of the thiol per-oxidase and, in consequence, may identify it as a poten-tial drug target.

Experimental procedures

Bacterial strains, plasmids and media

Strains and plasmids used in this study are listed in Table 1.Cultures of E. faecalis strains were performed on M17

In vitroH2O2 challenge

Metabolicoxidative stress

Oxidative burst(phagocytes)

Tpx Npr AhpNpr AhpTpx AhpNpr

Virulence test(Mouse peritonitis)

Tpx Npr Ahp

Fig. 10. Summary of the roles of the three peroxidases Tpx, Nprand Ahp in oxidative stress responses and virulence in E. faecalisdetermined in this study. Thick dark, thin dark and dotted barsindicate an essential role, an important role and a minor role of theperoxidases, respectively.

Table 1. Bacterial strains and plasmids used in this study.

Strain or plasmid Relevant characteristics Reference or source

StrainE. faecalis

JH2-2 FusR RifR, plasmid-free wild-type strain Yagi and Clewell (1980)Dnpr JH2-2 isogenic npr-deletion mutant This workDahpCF JH2-2 isogenic ahp-deletion mutant This workDtpx JH2-2 isogenic tpx-deletion mutant This workDnpr/Dtpx/DahpCF JH2-2 isogenic triple mutant with deletions in the aforementioned genes This worktpxC59 S JH2-2 isogenic tpxC59 S mutant This worktpxC93 S JH2-2 isogenic tpxC93 S mutant This work

E. coliTop10F′ F′{lacIq, Tn1(TetR)} mcrA D(mrr-hsdRMS-mcrBC) f 80lacZDM15 DlacX74 recA1

araD139 D(ara-leu)7697 galU galK rpsL (StrR) endA1 nupGInvitrogen

DH5a supE44 D{lacU169 {F80dLacZDM15} hsdR17 recA1 endA1 gyrA96 thi-1 relA1 InvitrogenM15[pREP-4] NalS, StrS, RifS, Thi-, Lac-, Ara+, Gal+, Mtl-, F-, RecA+, Uvr+, Lon+

[pREP-4 orip15A, lacI, KanR]Qiagen

PlasmidpUCB30 oripMB1, lacZ�, AmpR, EmR Benachour et al. (2007)pMAD oripE194ts, EmR, AmpR, bgaB Arnaud et al. (2004)pGEM-T easy f1 ori, lacZ, AmpR PromegapQE70 oripColE1, AmpR Qiagen



medium (Terzaghi and Sandine, 1975) supplementedwith 0.5% (w/v) glucose (GM17) or on M17 MOPS mediumto test other carbon sources. This last medium, furthercalled ccM17MOPS (carbohydrate-cured M17MOPS), isdepleted of carbohydrates, and the usual b-disodium-glycerophosphate buffer of M17 is substituted with 3-N-morpholino-propanesulfonic acid (MOPS) (ResearchOrganics) added to a final concentration of 42 gl-1. The pH isadjusted to 7.3 with NaOH and, after autoclavation, inocu-lated with E. faecalis JH2-2 strain (2% of an overnightculture) for digestion of carbohydrates during 17 h at 37°Cwithout shaking. The final OD600 was 0.8–0.9. After centrifu-gation, the supernatant is filtered and autoclaved. Thereafter,the medium (ccM17MOPS) is ready for further use and canbe stored as the classical M17 medium at 4°C for maximal2 weeks. When indicated, H2O2 (Prolabo) and catalase frombovin liver (900 000 U ml-1; Sigma) were added to themedium at a final concentration ranging from 5 to 7 mM and500 U ml-1, respectively. E. coli Top10F′ and DH5a strainswere cultivated at 37°C in Luria–Bertani (LB) medium withampicillin (100 mg ml-1) under vigorous agitation.

Growth and survival experiments and measurement ofproduced H2O2

Growth experiments of different E. faecalis strains were per-formed with shaking (160 r.p.m) at 37°C in GM17 medium orin ccM17MOPS medium supplemented with either 0.3% ofglycerol, 1% of galactose, lactose or ribose. Growth andsurvival experiments were carried out on exponentiallygrowing cells (0.4 < OD600 < 0.5), which were harvested bycentrifugation and resuspended in fresh GM17 supplementedwith different concentrations of H2O2. For the growthexperiments, OD600 values were determined after 15 h ofincubation. In the survival experiments, the number ofcfu ml-1 was determined every 2 h during a period of 6 h. Theproduction of H2O2 was quantified using the Amplex RedHydrogen Peroxide/peroxidase Assay kit (Invitrogen) accord-ing to the instructions of the manufacturer. Briefly, E. faecalisstrains were cultured with shaking at 37°C in ccM17MOPSsupplemented with glycerol, galactose or glucose. At giventime points, 1 ml of culture was centrifuged and appropriatelydiluted (10-fold or 100-fold for low or higher H2O2 concentra-tions, respectively) with 1¥ reaction buffer in order that theH2O2 concentration in the assay was between 0.5 and 3 mM.In parallel, H2O2 standard curves (0–5 mM H2O2) were pre-pared using 10- or 100-fold diluted ccM17 medium supple-mented with the appropriate carbon source (dilution of themedium was conducted in 1¥ reaction buffer). The fluores-cence was measured using a spectrofluorometer (JY3 DJobin Yvon). Moreover, number of cfu ml-1 was determinedfor each point by plate counts.

Construction of unmarked deletion mutants

Primers were purchased from Operon (Köln, Germany). Thegeneral protocol for the construction of deletion mutants isshown in Fig. 11. Depending on the operon system, a DNAchromosomal fragment (3.5 kb for tpx and npr; 4.5 kb forahpCF) comprising the gene to be deleted was amplified by

PCR using Pfu ultra proofreading DNA polymerase (Strat-agene) and oligonuleotides O1/O2. Each PCR fragment wasthen purified with the NucleoSpin Extract II kit (Macherey-Nagel, Düren), cut with the corresponding restrictionendonucleases (RE) and ligated into the cloning vectorspUCB30 and, for the complementation experiments, pMAD(see below). Recombinant plasmids were purified, diluted(1 ng ml-1) and used as templates for inverse PCR with Pfuultra polymerase and oligonucleotides O3/O4. This step intro-duced a central deletion of 870 and 388 bp for npr and tpxgenes, respectively. For the ahpCF operon, the deletedregion (1537 bp) includes 295 bp of the 3′-end of ahpC, theahpC-ahpF intergenic region and 1143 bp of the 5′-end ofahpF. After purification and restriction, PCR products wereligated and transformed into E. coli TOP10F′ electrocompe-tent cells. Clones were screened by PCR using oligonucle-otides boarding the deleted sequence (O5/O6 in Fig. 11), andpositive clones (i.e. containing the plasmid with the deletedsequence) were directly used for PCR with Pfu ultra poly-merase in order to amplify the entire sequence, which wasthen cloned into the pMAD vector (Arnaud et al., 2004). Thisshuttle vector carries the lacZ gene of Bacillus stearothermo-philus, which allows a quick colorimetric blue/white discrimi-nation of bacteria which have lost the plasmid on Xgal(5-bromo-4-chloro-3-indoyl-b-D-galactopyranoside, Eurobio)plates (80 mg ml-1). The usefulness of this plasmid for allelicexchanges in E. faecalis has recently been demonstrated

3,5 to 4,5 kpb

RE

RE

pUCB30

PCR O1/O2 (Pfu polymerase)

Restriction / Ligation

PCR O3/O4 (Pfu polymerase)

O1

O2

O3

O4

RE

RE

Restriction / Ligation /Transformation

pMAD

PCR (O1/O2) (Pfu polymerase)

Restriction / Ligation into pMAD

O5

O6

Fig. 11. Schematic presentation for the construction of deletionmutants in E. faecalis. Detailed explanations are given underConstruction of unmarked deletion mutants in the Experimentalprocedures section.



(Verneuil et al., 2006). After transformation of E. faecalisJH2-2 strain with the pMAD plasmids containing the deletedsequences and incubation at 37°C on plates containing Xgaland erythromycine (Erm, 150 mg ml-1), some dark blue colo-nies were picked up and isolated on fresh Xgal + Erm plates,which were incubated at 44°C overnight. The presence of thewild-type and mutated alleles was checked by PCR, and foreach construction, the positive clones were inoculated intoGM17 medium supplemented with Erm and incubated at44°C overnight without shaking. This step has been repeatedonce. Cultures were next inoculated (1:200, v/v) into GM17medium without Erm and incubated over day at 30°C, andthen overnight at 44°C without shaking. This step wasrepeated 2–5 times. After each 44°C overnight incubation,cultures were diluted (10-6) and spreaded on GM17 agarsupplemented with Xgal and incubated for 48–72 h at 37°C.White colonies were subsequently controlled for Erm sensi-tivity, and sensitive clones were tested by PCR for the pres-ence of a deleted chromosomal copy of npr, tpx and ahpCFgenes. The single mutants were subsequently used to con-struct the triple mutant (Dnpr/Dtpx/DahpCF). The complemen-tation of each single mutant was performed by knocking inthe wild-type allele into the corresponding mutant usingpMAD as described previously (Verneuil et al., 2006).To construct the tpxC59S mutant, two independent PCRwere performed: the first one was realized with DNAtpx1(5′CTTTTGGATCCCAGTTAATGATATATTC) and tpxC59S(5′CACACGTGTTTCTTCA CTGCAAACG) primers, ensuringthe amplification of the 3′ part of the tpx gene and introducingthe mutation of the cystein 59 into serine (C59S) (underlinedletter indicates the single base mismatch); the secondone, realized with DNAtpx2bis (5′GTGCTACCATGGCCTTATTTGATGTATAATTTGC) and tpxC59Scomp (the comple-mentary reverse of tpxC59S), allowed the amplification of the5′ part of the tpx gene and also introduced the mutation C59S.The two PCR fragments were then purified (Macherey-Nagel,Düren) on the same column, and a PCR using the externalprimers DNAtpx1 and DNAtpx2bis was performed on thispurified mix. This step produced a DNA fragment includingthe complete tpx gene containing the C59S mutation. Thisstrategy was also used to construct the C93S mutant. Themutated fragments were then cut with the appropriate restric-tion enzymes and cloned into the pMAD plasmid, which wasthen transformed into E. coli Top10F′ strain. The resultingplasmid was used to transform E. faecalis JH2-2 cells, whichwere then submitted to the above-described mutationprocedure. White clones were analysed for the presence ofthe corresponding point mutation by sequencing.

RNA isolation, real-time quantitative PCR, Northern blotanalysis, and mapping of the transcriptional start site

Total RNAs of E. faecalis were isolated using the RNeasyMidi Kit (Qiagen). Northern blots, real-time quantitative PCRanalysis and mapping of the transcriptional start site wereperformed on RNAs extracted from JH2-2 cultures grown inGM17 without agitation. Cells were either harvested from theexponential growth phase and submitted, or not, to a treat-ment of 30 min with 2.4 mM H2O2, which is the best adapta-tion condition for E. faecalis (Flahaut et al., 1998), or at thebeginning of stationary phase. Reverse transcript PCR

(RT-PCR) was carried out with the Omniscript enzyme(Qiagen) and the following oligonucleotides: ef1933for(GTAGCCATTTCTACAGTACC) and tpxrev (CCGACGAAACTTCTGAGAC). For real-time quantitative PCR, specificprimers were designed using the Primer3 software, avail-able at the website http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi, to produce amplicons of equivalent length(100 bp). Two micrograms of total RNA was reverse tran-scribed using the Omniscript enzyme (Qiagen) and randomhexamer primers according to the manufacturer’s instruc-tions. Five microliters of the resulting cDNA synthesis reac-tion mixture (100-fold diluted) was used for subsequent PCRamplification with the appropriate forward and reverseprimers (1 mM final concentration) and the QuantitTect SYBRGreen PCR mix (Qiagen). Quantification of 23S rRNA levelswas used as an internal control because they were notaltered by the stress condition. Amplification, detection andreal-time analysis were performed in duplicate with threedifferent RNA samples, using the Bio-Rad iCycler iQ detec-tion system (Bio-Rad). The value used for comparison ofgene expression in various strains and environments was thenumber of PCR cycles required to reach the threshold cycle(CT). To relate the CT value to the abundance of an mRNAspecies, CT was converted to ‘n-fold difference’ by comparingmRNA abundance in the JH2-2 wild-type strain (stressed ornot) with that obtained with the hypR mutant strain. The n-folddifference was calculated by the formula (n = 2-x) whenCT mutant < CT JH2-2, and (n = -2x) when CT mutant > CT JH2-2, withx = (CT mutant – CT JH2-2). Student’s t-test was used for statisticalcomparison and was considered as ‘significant’ whenP-values < 0.005. For Northern blot analysis, 20 mg of RNAswas submitted to electrophoretic migration and transferred toa nylon membrane (Hybond-N+, Amersham) during 12 h inSSC 20¥. Membrane was then fixed by UV irradiation (UltraViolet CrossLinker, Amersham, 70 mJ cm-2) and hybridizedwith a 32P-labelled probe specific for the tpx gene synthesizedwith the primer 5′-CCGACGAAACTTCTGAGAC-3′ and 2 mCiof [a-32P]-dATP using as a template the pUCB30 plasmidharbouring an internal fragment of the tpx gene. Hybridizationwas performed at 55°C during 16 h and after two washes withSSC 3¥/SDS 0.2%, the membrane was exposed to a storagephosphor screen (Packard Instrument Company, Canberra,Australia) for 24 h and then read with the CycloneTM system.Finally, transcriptional start point of ef2933-tpx wasdetermined by RACE-PCR as previously described (Verneuilet al., 2006) using Dna2 (5′GCTTTGGGCTATTTGCTAGTG-3′), Dna4 (5′GCACATGCTAACCATAACCGC-3′) and Anchor(5′GACCACGCG TATCGATGTCGAC-3′) primers.

Gel mobility shift assay

DNA fragment of about 600 pb corresponding to the promoterregion of tpx (ptpx) was inserted into the pGEMT vector(Promega) and cloned in E. coli DH5a. This was then ampli-fied by PCR using D4-labelled primers (Proligo). The dilutedlabelled DNA (1:40) was incubated in interaction buffer[Tris HCl 40 mM (pH 7.5), BSA 200 mg ml-1, CaCl2 2 mM,DTT 2 mM, poly-dI-dC 20 mg ml-1, b-mercaptoethanol 1%]with 230 ng of 6His-HypR protein purified as previouslydescribed (Verneuil et al., 2004), at room temperature during15 min. Furthermore, the specificity of the interaction was



http://frodo.wi.mit.edu/cgi-bin/primer3

http://www.cgi

tested by addition to the mixture of either a competitor DNA(C) corresponding to the unlabelled ptpx fragment, or adiluted non-competitor DNA (1:8) corresponding to an inter-nal fragment of a non-specific gene (ef0074). The interactionmixes were electrophoresed on a 5% polyacrylamide gel in1¥ Tris-Borate-EDTA buffer at 120 V for 75 min. Gels werevisualized with the ProXpress scanner (Perkin Elmer).

Cloning of tpx genes into an expression vector andpurification of recombinant and mutant Tpx proteins

Genomic DNA prepared from JH2-2 wild-type strain and fromthe isogenic tpxC59S and tpxC93S mutants were used as thePCR template. The three genes were amplified with the fol-lowing primers: pQE1tpx (GATTAAGGATCCATGAATGTTACAAGAAAAGG) and pQE2tpx (GATTAAGGATCCCACTTTTTTTGCAGATTCTAACG) (BamHI restriction sites under-lined) using Pfu ultra polymerase (Stratagen). After purifica-tion with NucleoSpin Extract II kit (Macherey-Nagel, Düren) ofthe PCR product, 300 ng were mixed with 50 ng pQE70 andthe DNAs restricted with BamHI (Amersham). Followingrestriction, the enzyme was heat inactivated by incubation for15 min at 70°C, and the reaction mixture was purified with theNucleoSpin Extract II kit. T4 DNA Ligase was added, andligation mixture (final volume of 10 ml) was incubated at roomtemperature overnight. Finally, after ligation, the DNA waselectroporated into competent E. coli M15[pREP-4] cells.Sequences of recombinant clones were verified bysequencing. Overexpression of recombinant Tpx, TpxC59Sand TpxC93S proteins was performed in 500 ml LB medium.Induction was realized by adding 1 mM IPTG at OD600 of 0.6,and the growth is continued during 3 h. Cells were harvestedand washed with 20 ml of buffer A (HEPES 50 mM pH 8.0,NaCl 300 mM, imidazole 5 mM). The lysis was performed byone passage through the one-shot cell disrupter (Constant-System, Northants, UK) at 2.15 kbar. Cell debris wereremoved by two centrifugations (3000 g, 10 min and13 000 g, 30 min). Supernatant was mixed with 0.75 ml ofNi-NTA agarose and loaded onto a column. Washing stepswere performed with 10 ml of buffer A and 20 ml of buffer B(HEPES 50 mM pH 8.0, NaCl 300 mM, imidazole 15 mM)before elution of proteins with 2.5 ml of buffer C (HEPES50 mM pH 8.0, NaCl 300 mM, imidazole 250 mM). Sodiumchloride and imidazole were removed from protein extractswith PD-10 desalting column system (GE Heathcare) equili-brated with HEPES 0.1 M pH 8.0. Protein concentrationswere determined by the method of Bradford with BSA as astandard. Purification was controlled by SDS-PAGE usingMiniProtean®3 apparatus (Bio-Rad) on 12.5% polyacrylamidegel. Proteins were stained with Coomassie brilliant blueR250.

DNA cleavage protection assay

Protection assays against nicking of supercoiled DNAplasmid was carried as described by Rho et al. (2006) withminor modifications. 6.6 mg ml-1 of pUCB30 plasmid (Bena-chour et al., 2007) was mixed with 5 mM DTT, 15 mM FeCl3and 50 mM of Tpx or cyteine-to-serine mutant proteins. Thereaction was carried out in 0.1 M HEPES pH 7.0 at 37°C

during 30 min before adding EDTA to a final concentration of125 mM to stop the DNA cleavage and loading onto a 0.7%agarose gel. As a negative control, in one sample the Tpxprotein was omitted from the reaction mixture.

Survival assays in mouse peritoneal macrophages

Survival of E. faecalis single and triple mutants, and also ofcomplemented mutants, were tested by using an in vivo/in vitro infection model as previously described (Gentry-Weeks et al., 1999; Verneuil et al., 2004). All experimentswere performed five times, and results were subjected tostatistical analysis by using one-way ANOVA with a Bonferronicorrection post-test with GraphPad Prism version 5.00 forWindows (GraphPad Software, San Diego, CA).

Mouse peritonitis model

Testing of the wild-type and mutant strains was performed asdescribed by Teng et al. (2002). Briefly, the strains were incu-bated in BHI broth overnight at 37°C under constant agitation.The cells were harvested by centrifugation, twice washedwith ice-cold 0.85% saline solution, and resuspended in thesame solution to reach a density of ~1.5 ¥ 1010 cfu ml-1. Theinoculum size was confirmed by plating onto BHI agar. Dilu-tions (2- to 10-fold) of the bacterial suspension, prepared inchilled 0.85% saline solution, were used as inocula, after10-fold diluting them in 25% sterile rat faecal extract (SRFE,from a single batch) (Pai et al., 2003) Outbred ICR femalemice, 4–6 weeks old (Harlan Italy S.r.l., San Pietro al Nati-sone, Udine, Italy), were used. Mice were injected intraperi-toneally with 1 ml of each bacterial inoculum made in 25%SRFE, then housed 5 per cage and fed ad libitum. A controlgroup of mice was injected with 25% SRFE only. Mice weremonitored every 3 h, and the number of surviving mice wasrecorded. The LD50 was determined as described by Reedand Muench (1938). Survival curves were obtained by theKaplan–Meier method and compared by log-rank test usingthe GraphPad Prism software (GraphPad Software, SanDiego, CA). Comparisons with P-values < 0.05 were consid-ered to be significant. All strains were tested more than oncein this virulence test.

Acknowledgements

A special thanks to the outstanding technical assistant ofAnnick Blandin. We thank also Michel Débarbouillé for thegenerous gift of plasmid pMAD, and Nicolas Boudeau forhelp in Northern blot experiments and mapping of the tran-scriptional start site of the tpx operon.

References

Aderem, A., and Underhill, D.M. (1999) Mechanisms ofphagocytosis in macrophages. Annu Rev Immunol 17:593–623.

Antelmann, H., Engelmann, S., Schmid, R., and Hecker, M.(1996) General and oxidative stress responses in Bacillussubtilis: cloning, expression, and mutation of the alkyl



hydroperoxide reductase operon. J Bacteriol 178: 6571–6578.

Arnaud, M., Chastanet, A., and Debarbouille, M. (2004) Newvector for efficient allelic replacement in naturally non-transformable, low-GC-content, gram-positive bacteria.Appl Environ Microbiol 70: 6887–6891.

Baker, L.M., and Poole, L.B. (2003) Catalytic mechanism ofthiol peroxidase from Escherichia coli. Sulfenic acid forma-tion and overoxidation of essential CYS61. J Biol Chem278: 9203–9211.

Benachour, A., Auffray, Y., and Hartke, A. (2007) Construc-tion of plasmid vectors for screening replicons from Gram-positive bacteria and their use as shuttle cloning vectors.Curr Microbiol 54: 342–347.

Bsat, N., Chen, L., and Helmann, J.D. (1996) Mutation of theBacillus subtilis alkyl hydroperoxide reductase (ahpCF)operon reveals compensatory interactions among hydro-gen peroxide stress genes. J Bacteriol 178: 6579–6586.

Cha, M.K., Kim, H.K., and Kim, I.H. (1995) Thioredoxin-linked‘thiol peroxidase’ from periplasmic space of Escherichiacoli. J Biol Chem 270: 28635–28641.

Cha, M.K., Kim, H.K., and Kim, I.H. (1996) Mutation andmutagenesis of thiol peroxidase of Escherichia coli and anew type of thiol peroxidase family. J Bacteriol 178: 5610–5614.

Cha, M.K., Kim, W.C., Lim, C.J., Kim, K., and Kim, I.H. (2004)Escherichia coli periplasmic thiol peroxidase acts as lipidhydroperoxide peroxidase and the principal antioxidativefunction during anaerobic growth. J Biol Chem 279: 8769–8778.

Christman, M.F., Morgan, R.W., Jacobson, F.S., and Ames,B.N. (1985) Positive control of a regulon for defensesagainst oxidative stress and some heat-shock proteins inSalmonella typhimurium. Cell 41: 753–762.

Claiborne, A., Ross, R.P., and Parsonage, D. (1992) Flavin-linked peroxide reductases: protein-sulfenic acids and theoxidative stress response. Trends Biochem Sci 17: 183–186.

Claiborne, A., Yeh, J.I., Mallett, T.C., Luba, J., Crane, E.J.,et al. (1999) Protein-sulfenic acids: diverse roles for anunlikely player in enzyme catalysis and redox regulation.Biochemistry 38: 15407–15416.

Cosgrove, K., Coutts, G., Jonsson, I.-M., Tarkowski, A., Kokai-Kun, J.F., Mond, J.J., and Foster, S.J. (2007) Catalase(KatA) and alkyl hydroperoxide reductase (AhpC) havecompensatory roles in peroxide stress resistance and arerequired for survival, persistence, and nasal colonization inStaphylococcus aureus. J Bacteriol 189: 1025–1035.

Flahaut, S., Laplace, J.M., Frere, J., and Auffray, Y. (1998)The oxidative stress response in Enterococcus faecalis:relationship between H2O2 tolerance and H2O2 stressproteins. Lett Appl Microbiol 26: 259–264.

Frankenberg, L., Brugna, M., and Hederstedt, L. (2002) Enter-ococcus faecalis heme-dependent catalase. J Bacteriol184: 6351–6356.

Gentry-Weeks, C.R., Karkhoff-Schweizer, R., Pikis, A.,Estay, M., and Keith, J.M. (1999) Survival of Enterococcusfaecalis in mouse peritoneal macrophages. Infect Immun67: 2160–2165.

Gilmore, M.S., Coburn, P.S., Nallapareddy, S.R., andMurray, B.E. (2002) Enterococcal virulence. In The Entero-

cocci: Pathogenesis, Molecular Biology, Antibiotic Resis-tance and Infection Control. Gilmore, M.S., Clewell, D.B.,Courvalin, P.M., Dunny, G.M., Murray, B.E., and Rice, L.B.(eds). Washington, DC: American Society for MicrobiologyPress, 301–354.

Gordon, J., Holman, R.A., and McLeod, J.W. (1953) Furtherobservations on the production of hydrogen peroxide byanaerobic bacteria. J Pathol Bacteriol 66: 527–537.

Hassett, D.J., and Cohen, M.S. (1989) Bacterial adaptation tooxidative stress: implications for pathogenesis and interac-tion with phagocytic cells. FASEB J 3: 2574–2582.

Huycke, M.M., Moore, D., Joyce, W., Wise, P., Shepard, L.,Kotake, Y., and Gilmore, M.S. (2001) Extracellular super-oxide production by Enterococcus faecalis requires dem-ethylmenaquinone and is attenuated by functional terminalquinol oxidases. Mol Microbiol 42: 729–740.

Huycke, M.M., Abrams, V., and Moore, D.R. (2002) Entero-coccus faecalis produces extracellular superoxide andhydrogen peroxide that damage colonic epithelial cell DNA.Carcinogenesis 23: 529–536.

Jacobs, N.J., and Vandemark, P.J. (1960a) The purificationand properties of the alpha-glycerophosphate-oxidizingenzyme of Streptococcus faecalis 10C1. Arch BiochemBiophys 88: 250–255.

Jacobs, N.J., and Vandemark, P.J. (1960b) Comparison ofthe mechanism of glycerol oxidation in aerobically andanaerobically grown Streptococcus faecalis. J Bacteriol79: 532–538.

Jacobson, F.S., Morgan, R.W., Christman, M.F., and Ames,B.N. (1989) An alkyl hydroperoxide reductase from Salmo-nella typhimurium involved in the defense of DNA againstoxidative damage. J Biol Chem 264: 1488–1496.

Kim, H.K., Kim, S.J., Lee, J.W., Lee, J.W., Cha, M.K., andKim, I.H. (1996) Identification of promoter in the 5′-flankingregion of the Escherichia coli thioredoxin-linked thiol per-oxidase gene: evidence for the existence of oxygen-relatedtranscriptional regulatory protein. Biochem Biophys ResCommun 221: 641–646.

Link, A.J., Robison, K., and Church, G.M. (1997) Comparingthe predicted and observed properties of proteins encodedin the genome of Escherichia coli K-12. Electrophoresis18: 1259–1313.

Monqkolsuk, S., and Helmann, J.D. (2002) Regulation ofinducible peroxide stress responses. Mol Microbiol 45:9–15.

Morgan, R.W., Christman, M.F., Jacobson, F.S., Storz, G.,and Ames, B.N. (1986) Hydrogen peroxide-inducible pro-teins in Salmonella typhimurium overlap with heat shockand other stress proteins. Proc Natl Acad Sci USA 83:8059–8063.

Nathan, C., and Shiloh, M.U. (2000) Reactive oxygen andnitrogen intermediates in the relationship between mam-malian hosts and microbial pathogens. Proc Natl Acad SciUSA 97: 8841–8848.

Pai, S.R., Singh, K.V., and Murray, B.E. (2003) In vivo effi-cacy of the ketolide ABT-773 (Cethromycin) against entero-cocci in a mouse peritonitis model. Antimicrobial AgentsChemother 47: 2706–2709.

Pericone, C.D., Park, S., Imlay, J.A., and Weiser, J.N. (2003)Factors contributing to hydrogen peroxide resistance inStreptococcus pneumoniae include pyruvate oxidase



(SpxB) and avoidance of the toxic effects of the Fentonreaction. J Bacteriol 185: 6815–6825.

Poole, L.B. (2005) Bacterial defenses against oxidants:mechanistic features of cystein-based peroxidases andtheir flavoprotein reductases. Arch Biochem Biophys433: 240–254.

Pugh, S.Y., and Knowles, C.J. (1982) Growth of Streptococ-cus faecalis var. zymogenes on glycerol: the effect ofaerobic and anaerobic growth in the presence andabsence of haematin on enzyme synthesis. J GenMicrobiol 128: 1009–1017.

Reed, L.J., and Muench, H. (1938) A simple method of esti-mating fifty percent endpoints. Am J Hyg 27: 493–497.

Rho, B.S., Hung, L.W., Holton, J.M., Vigil, D., Kim, S.I., Park,M.S., et al. (2006) Functional and structural characteriza-tion of a thiol peroxidase from Mycobacterium tuberculosis.J Mol Biol 361: 850–863.

Riboulet, E., Verneuil, N., La Carbona, S., Sauvageot, N.,Auffray, Y., Hartke, A., and Giard, J.-C. (2007) Relation-ships between oxidative stress response and virulencein Enterococcus faecalis. J Mol Microbiol Biotechnol 13:140–146.

Richards, M.J., Edwards, J.R., Culver, D.H., and Gaynes,R.P. (2000) Nosocomial infections in combined medical-surgical intensive care units in the United States. InfectControl Hosp Epidemiol 21: 510–515.

Rosenkrands, I., King, A., Weldingh, K., Moniatte, M., Moertz,E., and Andersen, P. (2000a) Towards the proteome ofMycobacterium tuberculosis. Electrophoresis 21: 3740–3756.

Rosenkrands, I., Weldingh, K., Jacobsen, S., Hansen, C.V.,Florio, W., Gianetri, I., and Andersen, P. (2000b) Mappingand identification of Mycobacterium tuberculosis pro-teins by two-dimensional gel electrophoresis, micro-sequencing and immunodetection. Electrophoresis21: 935–948.

Ross, R.P., and Claiborne, A. (1997) Evidence for regulationof the NADH peroxidase gene (npr) from Enterococcusfaecalis by OxyR. FEMS Microbiol Lett 151: 177–183.

Schmidt, H.L., Stocklein, W., Danzer, J., Kirch, P., andLimbach, B. (1986) Isolation and properties of an H2O-

forming NADH oxidase from Streptococcus faecalis. Eur JBiochem 156: 149–155.

Seaver, L.C., and Imlay, J.A. (2001) Alkyl hydroperoxidereductase is the primary scavenger of endogenous hydro-gen peroxide in Escherichia coli. J Bacteriol 183: 7173–7181.

Storz, G., and Imlay, J.A. (1999) Oxidative stress. Curr OpinMicrobiol 2: 188–194.

Stuart, C.H., Schwartz, S.A., Beeson, T.J., and Owatz, C.B.(2006) Enterococcus faecalis: its role in root canal treat-ment failure and current concepts in retreatment. J Endod32: 93–98.

Teng, F., Wang, L., Singh, K.V., Murray, B.E., and Weinstock,G.M. (2002) Involvement of PhoP-PhoS homologs inEnterococcus faecalis virulence. Infect Immun 70: 1991–1996.

Terzaghi, B.E., and Sandine, W.E. (1975) Improved mediumfor lactic Streptococci and their bacteriophages. ApplMicrobiol 29: 807–813.

Verneuil, N., Sanguinetti, M., Le Breton, Y., Posteraro, B.,Fadda, G., Auffray, Y., et al. (2004) Effects of the Entero-coccus faecalis hypR gene encoding a new transcriptionalregulator on oxidative stress response and intracellularsurvival within macrophages. Infect Immun 72: 4424–4431.

Verneuil, N., Maze, A., Sanguinetti, M., Laplace, J.M., Bena-chour, A., Auffray, Y., et al. (2006) Implication of (Mn)superoxide dismutase of Enterococcus faecalis in oxidativestress responses and survival inside macrophages.Microbiology 152: 2579–2589.

Weldingh, K., Rosenkrands, I., Jacobsen, S., Rasmussen,P.B., Elhay, M.J., and Andersen, P. (1998) Two-dimensional electrophoresis for analysis of Mycobacteriumtuberculosis culture filtrate and purification and character-ization of six novel proteins. Infect Immun 66: 3492–3500.

Wells, C.L., Jechorek, R.P., and Erlandsen, S.L. (1990) Evi-dence for the translocation of Enterococcus faecalis acrossthe mouse intestinal tract. J Infect Dis 162: 82–90.

Yagi, Y., and Clewell, D.B. (1980) Recombination-deficientmutant of Streptococcus faecalis. J Bacteriol 143: 966–970.



Comparative study of the physiological roles of three peroxidases (NADH peroxidase, Alkyl...

Documents

Transcript of Comparative study of the physiological roles of three peroxidases (NADH peroxidase, Alkyl...