(43), pl3. [DOI: 10.1126/scisignal.143pl3] 1Science SignalingSpirito and Giovambattista Pani (28 October 2008) Arcovito, Tommaso Galeotti, Henrik Østergaard, Jakob R. Winther, Marco De Giuseppe Maulucci, Valentina Labate, Marina Mele, Emiliano Panieri, GiuseppeOxidation-Sensitive Yellow Fluorescent ProteinHigh-Resolution Imaging of Redox Signaling in Live Cells Through an

This information is current as of 29 October 2008. The following resources related to this article are available online at http://stke.sciencemag.org.

Article Tools http://stke.sciencemag.org/cgi/content/full/sigtrans;1/43/pl3

Visit the online version of this article to access the personalization and article tools:

MaterialsSupplemental

http://stke.sciencemag.org/cgi/content/full/sigtrans;1/43/pl3/DC1 "Software"

Related Content http://stke.sciencemag.org/cgi/content/abstract/sigtrans;2006/332/eg6

's sites:ScienceThe editors suggest related resources on

References http://stke.sciencemag.org/cgi/content/full/sigtrans;1/43/pl3#otherarticles

This article cites 12 articles, 3 of which can be accessed for free:

Glossary http://stke.sciencemag.org/glossary/

Look up definitions for abbreviations and terms found in this article:

Permissions http://www.sciencemag.org/about/permissions.dtl

Obtain information about reproducing this article:

Association for the Advancement of Science; all rights reserved. for the Advancement of Science, 1200 New York Avenue, NW, Washington, DC 20005. Copyright 2008 by the American

(ISSN 1937-9145) is published weekly, except the last week in December, by the American AssociationScience Signaling

on October 29, 2008

stke.sciencemag.org

Dow

nloaded from

P R O T O C O L

www.SCIENCESIGNALING.org 28 October 2008 Vol 1 Issue 43 pl3 1

1Institute of General Pathology, Catholic University Medical School, 00168 Rome, Italy. 2Institute of Physics, Catholic University Medical School,00168 Rome, Italy. 3Novo Nordisk A/S, DK-2760 Måløv, Denmark. 4Department of Molecular Biology, August Krogh Building, Universitetsparken13, DK-2100 Copenhagen, Denmark.

*Corresponding author. E-mail, gpani@rm.unicatt.it

INTRODUCTION

Technical Challenges to Quantifying Changes in Redox StateApplication of Fluorescent Protein–Based ProbesRatiometric Measurements and Construction of the Redox Pseudoimage

MATERIALS

EQUIPMENT

RECIPES

INSTRUCTIONS

Mutagenizing YFP and Subcloning rxYFP into the pcDNA3 Mammalian Expression VectorrxYFP Expression in Tumor Cell LinesCell Preparation for Image AnalysisProbe Calibration: Determination of Fox, Fred, and a ValuesCell ImagingConstruction of Redox-Based Cell Pseudoimages at Single-Voxel Resolution

NOTES AND REMARKS

REFERENCES AND NOTES

High-Resolution Imaging of Redox Signaling in Live CellsThrough an Oxidation-Sensitive Yellow Fluorescent ProteinGiuseppe Maulucci,2 Valentina Labate,1 Marina Mele,1 Emiliano Panieri,1 Giuseppe Arcovito,2

Tommaso Galeotti,1 Henrik Østergaard,3 Jakob R. Winther,4 Marco De Spirito,2 Giovambattista Pani1*

Published 28 October 2008; Volume 1 Issue 43 pl3

on October 29, 2008

stke.sciencemag.org

Dow

nloaded from

We present the application of a redox-sensitive mutant of the yellow fluorescent protein (rxYFP) to image, with ele-vated sensitivity and high temporal and spatial resolution, oxidative responses of eukaryotic cells topathophysiological stimuli. The method presented, based on the ratiometric quantitation of the distribution of fluo-rescence by confocal microscopy, allows us to draw real-time “redox maps” of adherent cells and to score subtlechanges in the intracellular redox state, such as those induced by overexpression of redox-active proteins. Thisstrategy for in vivo imaging of redox signaling circumvents many of the technical limitations currently encoun-tered in the study of complex redox-based phenomena and promises to contribute substantially to this expandingarea of signal transduction.

Introduction

Technical Challenges to Quantifying Changes in Redox State

In recent years, reactive oxygen species (ROS) and, by extension, changes in the intracellular reductive/oxidative (redox) balancehave come into focus as major regulators of key cellular functions in both physiological and pathological settings (1). Tradition-ally viewed as mediators of cell damage by exogenous noxae, endogenously generated oxygen intermediates have also been rec-ognized to have signaling roles downstream of cytokine and mitogen receptors, activated oncogenes, nutrient sensors, andproapoptotic stimuli (2). Transient and reversible oxidation of functional cysteine protein residues, such as those located in thecatalytic sites of protein tyrosine phosphatases or in the DNA binding domains of transcription factors, and the consequentformation of either intramolecular disulfide bonds or mixed protein-glutathione disulfides, are major ROS-related signalingmechanisms and account for many of the pleiotropic effects of pro- and antioxidant stimuli on gene expression and on cell prolif-eration, migration, invasion, and death (1, 3, 4). Technical limitations in measuring intracellular ROS and rapidly changing intra-cellular redox states in intact cells in response to physiological stimuli have hindered the study of oxygen species as signaling in-termediates and the full recognition of their biological relevance. Considerable progress in the dynamics of cellular redoxchanges has been made by the introduction of cell-permeant redox-sensitive fluorescent dyes such as 2′,7′-dichlorofluoresceindiacetate (DCF-DA) or dihydrorhodamine 123 (DHR-123), but the utility of these dyes is attenuated by the low molecular speci-ficity and insufficient subcellular compartmentalization of the compounds. Although it is widely accepted that ratio-based meth-ods offer intrinsic advantages for fluorescence sensing (5, 6) because, for example, ratiometric measurements permit one to can-cel out most or all variability introduced by instrumentation or the effective dye content of cells, probes such as DCF-DA orDHR-123 generally display negligible spectral shifts and are therefore inadequate for quantitative sensing measurements.

Application of Fluorescent Protein–Based Probes

Fluorescent protein–based technology has opened new avenues for sensitive and noninvasive analysis of signal transduction in intactcells (7). Plasmid-encoded fluorescent probes can be targeted to specific cell compartments and coexpressed with reporters or pro-teins of interest, and differences in probe expression between cells can often be corrected by applying multiwavelength excitation oremission, followed by ratiometric signal calculation.

Two groups have generated redox-sensitive variants of yellow fluorescent protein (rxYFP) and of green fluorescent protein (roGFP1and roGFP2), introducing, by amino acid substitution, two cysteine residues near the fluorophore (Cys149 and Cys202 in rxYFP)(8–11) (Fig. 1). Oxidation-dependent formation of an intramolecular disulfide bond between the two residues reversibly modifies flu-orescence emission of the protein, thereby enabling real-time monitoring of intracellular redox changes. GFP-based probes have beenused to measure ratiometrically the steady-state redox potential of the cytosol and mitochondrial matrix in eukaryotic cells (10–12),and rxYFP has been successfully used to measure nonratiometrically the ratio between reduced (GSH) and oxidized (GSSG) glu-tathione in bacteria and in yeast (8, 9).

This Protocol describes the use of rxYFP as a ratiometric probe for thiol-based redox signaling in mammalian cells. Ratiometricproperties of rxYFP were initially suggested by confocal imaging of B16F10 melanoma cells expressing rxYFP with different excita-tion wavelengths. When the cells were imaged at an excitation wavelength of 458 nm (ex458nm), the redox-dependent change in fluo-rescent emission was less (~50%) than the emission when the cells were imaged at an excitation wavelength of 488 nm, which is con-sidered the standard or canonical excitation wavelength for this fluorescent protein. Therefore, excitation at 458 nm can be used as areference excitation wavelength for ratiometric calculations.

P R O T O C O L

www.SCIENCESIGNALING.org 28 October 2008 Vol 1 Issue 43 pl3 2

on October 29, 2008

stke.sciencemag.org

Dow

nloaded from

Ratiometric Measurements and Construction of the Redox Pseudoimage

The fractional amount R of reduced rxYFP (rxYFPred) at equilibrium

can be related to easily measurable experimental quantities: fluorescence emission when excited at 488 nm (F488) and fluorescenceemission when excited at 458 nm (F458). Indeed, by assuming that probe concentration and path length are small enough, the fluores-cence contributions from the reduced (rxYFPred) and oxidized (rxYFPox) forms are proportional to their concentration [rxYFPred],[rxYFPox], and the total fluorescence intensities at wavelengths λ is

where ε λred and ε λox are factors accounting for the excitation intensity, extinction coefficient, path length, quantum efficiency, and theinstrumental efficiency of collecting emitted photons from reduced and oxidized rxYFP, respectively, at a wavelength λ. The ratio ofthe total fluorescence intensities measured at wavelengths λ488 and λ458, , by using Eq. 2 becomes

where Fox = ελ488ox / ελ458

ox and Fred = ελ488ox / ελ458

ox are the ratios of the completely reduced and oxidized protein, respectively.

By combining Eq. 1 and Eq. 3, we obtain

where a = ελ458ox / ελ458

ox is a probe-specific factor describing residual redox sensitivity at the reference excitation wavelength. Itshould be noted that at an entirely redox-insensitive wavelength (λi, corresponding to an isosbestic point), ελi

ox = ελired and a = 1. In this

case, Eq. 3 reduces to an even simpler expression R = (F – Fox)/(Fred – Fox). The fractional amount R of reduced rxYFP at equilibri-um, therefore, can be easily determined by measuring experimentally accessible quantities (F488, F458, Fox, Fred, a).

Experimental determination of Fox, Fred, and a requires exposing cells to extreme oxidizing and reducing conditions, as describedbelow under “Probe Calibration.” Importantly, the difference in Fox and Fred values defines the dynamic range of the probe.

As defined, R reports any changes in the oxidative-reductive state of the protein, independently of possible experimental artifacts (forexample, probe concentration, photobleaching, or fluctuations in intensity of the laser light used for excitation). R will vary between 1(protein completely reduced) and 0 (protein completely oxidized).

By mapping R over the entire confocal scanning field, pseudocolor images (yellow corresponding to reduced; red corresponding tooxidized) of cell redox status, with a resolution of 200 nm (the minimum confocal voxel size), can be created.

A detailed procedure is provided here for (i) YFP mutagenization into rxYFP and rxYFP subcloning into the pCDNA3 mammalianexpression vector; (ii) rxYFP expression in two different tumor cell lines; (iii) preparation of cells for imaging analysis; (iv) probecalibration (determination of Fox, Fred, and a values); (v) cell imaging; and (vi) construction of redox-based cell pseudoimages at theresolution of a single voxel.

P R O T O C O L

www.SCIENCESIGNALING.org 28 October 2008 Vol 1 Issue 43 pl3 3

RrxYFP

rxYFP rxYFPred

red ox

=+

[ ]

[ ] [ ]

F rxYFP rxYFPred red ox oxλλ λε ε= [ ] + [ ]

FrxYFP rxYFP

rxYFPred red ox ox

red red o

= [ ]+ [ ][ ]+

ε εε ελ

488 488

458xx oxrxYFPλ458 [ ]

λ λ

Ra F F

F aF F aox

red ox

= −− + −( )

( ) ( )1

FF

F= 488

458

(Eq. 1)

(Eq. 2)

(Eq. 3)

(Eq. 4)

on October 29, 2008

stke.sciencemag.org

Dow

nloaded from

Materials

Agarose

Antibiotics: 10 IU/ml penicillin + 10 mg/ml streptomycin in phosphate-buffered saline (PBS) (Eurobio, #CABPES01-0U)

B16F10 mouse melanoma cells [American Type Culture Collection (ATCC) #CRL-6475]

D-Glucose 45% solution in water, tissue culture grade (Sigma, #G8769)

Diamide (Sigma, #D3648)

Dithiotreitol (DTT) (Sigma, #D9779)

dNTPs (deoxynucleotide triphosphates) 10 mM each solution (Fisher Molecular Biology, #FS-013-2)

Dulbecco’s modified Eagle’s medium (DMEM) high glucose (BioWest, #L0106)

Eagle’s nonessential amino acids solution (Eurobio, #CSTAAN00-0U)

Eco RI (12 U/μl, Promega, #R6011)

Effectene transfection reagent (Qiagen, #301425)

Fetal calf serum (FCS) (BioWest, #S1520)

GENECLEAN II Kit (Qbiogene, #1001-400)

Glass-bottom, 35-mm culture dish (Integrated BioDiagnostics, IbiTreat μ-Dish, #80136)

HBSS (Hank’s balanced salt solution) (without Ca2+, Mg2+, and phenol red) (Bio-Whittaker, #10-547F)

Hepatocyte complete medium (HCM) [Lonza (Basel, Switzerland), #CC 3198]

Hep G2 human hepatoma cells (ATCC, #HB-8065)

L-Glutamine 200 mM stock solution (Eurobio, #CSTGLU000U)

MgCl2 50 mM solution (Fisher Molecular Biology, #FS-B-007)

Oligonucleotide primers (Eco RI sites underlined):

FwrxYFP 5′-GT GAATTC ATG TCT AAA GGT GAA G-3′

RvrxYFP 5′-GT GAATTC TGC ATT ATT AGG CAG C-3′

P R O T O C O L

www.SCIENCESIGNALING.org 28 October 2008 Vol 1 Issue 43 pl3 4

1 10 20 30MetSerLysGlyGluGluLeuPheThrGlyValValProIleLeuValGluLeuAspGlyAspValAsnGlyHisLysPheSerValSerGlyGluGlyATGTCTAAAGGTGAAGAACTGTTTACGGGTGTTGTGCCGATCCTGGTGGAACTGGATGGTGATGTGAACGGTCATAAATTCTCTGTGTCTGGTGAAGGT 40 50 60GluGlyAspAlaThrTyrGlyLysLeuThrLeuLysPheIleValThrThrGlyLysLeuProValProTrpProThrLeuValThrThrPheAlaTyrGAAGGTGATGCAACCTACGGTAAGCTGACCCTGAAATTTATCGTGACCACGGGTAAACTGCCGGTTCCATGGCCGACCCTGGTGACCACCTTCGCGTAT 70 80 90GlyLeuGlnCysPheAlaArgTyrProAspHisMetLysArgHisAspPhePheLysSerAlaMetProGluGlyTyrValGlnGluArgThrIlePheGGTCTGCAATGCTTTGCGCGCTACCCGGATCACATGAAACGTCACGACTTTTTCAAATCTGCCATGCCGGAAGGTTATGTACAGGAACGTACCATCTTC100 110 120 130PheLysAspAspGlyAsnTyrLysThrArgAlaGluValLysPheGluGlyAspThrLeuValAsnArgIleGluLeuLysGlyIleAspPheLysGluTTCAAAGATGACGGTAACTACAAAACCCGTGCTGAAGTGAAATTTGAAGGTGATACCCTGGTGAACCGTATCGAACTGAAAGGTATTGATTTTAAAGAA 140 150 160AspGlyAsnIleLeuGlyHisLysLeuGluTyrAsnTyrAsnSerHisCysValTyrIleValAlaAspLysGlnLysAsnGlyIleLysValAsnPheGATGGTAACATCCTGGGCCATAAACTGGAATACAACTACAACTCTCATTGCGTATACATCGTGGCAGACAAACAGAAAAACGGTATCAAAGTGAACTTC 170 180 190LysIleArgHisAsnIleGluAspGlySerValGlnLeuAlaAspHisTyrGlnGlnAsnThrProIleGlyAspGlyProValLeuLeuProAspAsnAAAATCCGTCATAACATCGAAGATGGTTCTGTTCAACTGGCAGACCATTATCAGCAGAACACCCCAATTGGCGATGGCCCGGTGCTGCTGCCGGACAAC 200 210 220 230HisTyrLeuCysTyrGlnSerAlaLeuSerLysAspProAsnGluLysArgAspHisMetValLeuLeuGluPheValThrAlaAlaGlyIleThrHisCATTACCTGTGCTACCAGTCTGCCCTTTCGAAAGATCCGAACGAAAAACGTGACCACATGGTGCTGCTGGAATTTGTGACCGCTGCCGGCATCACGCAT 238GlyMetHisGluLeuTyrLysGGCATGCATGAGCTGTATAAA

Fig. 1. Amino acid and nucleotide sequence of rxYFP. Mutations relative to wild-type greenfluorescent protein are underlined in the sequence. Redox-active cysteines are shown in red.

on October 29, 2008

stke.sciencemag.org

Dow

nloaded from

PBS without calcium and magnesium (BioWest, #L0615-500)

pcDNA3.1(+) mammalian expression vector (Invitrogen, #V790-20)

Pfu Turbo DNA polymerase and buffer (Stratagene, #600153-82)

Pyruvate (100 mM, Eurobio, #010016)

QIAprep Spin Miniprep Kit (Qiagen, #27104)

T4 DNA-ligase and buffer (Invitrogen)

TOPO TA Cloning Kit, including TOP10 competent cells and the pCR2.1-TOPO cloning vector (Invitrogen, #K4500-01)

Trypsin-EDTA solution 1× in PBS (BioWest, #L0940)

Equipment

Thermal cycler

Agarose gel electrophoresis equipment (gel box, power source, ultraviolet light box)

Standard equipment for tissue culture (laminar flow cabinet, CO2 incubator, waterbath, micropipettes, battery-driven pipette-aid, sterileplasticware such as culture dishes and pipettes)

Inverted fluorescent microscope (Nikon Eclipse TE2000-U)

Inverted confocal microscope (DMIRE2, Leica Microsystems, Germany) equipped with the LCS 2.61 acquisition software (Leica Mi-crosystems, Germany) and 40× oil immersion objective [numerical aperature (NA) 1.25]

PC equipped with Windows 2000 or higher (minimum RAM requirement: 512 MB)

Redox Maps Generator 1.0 software (30.5 MB download, compressed zip f i le) (see http://stke.sciencemag.org/cgi/content/full/1/43/pl3/DC1)

Recipes

Recipe 1: Complete DMEM Medium

FCS 50 ml (10% v/v)

100 mM pyruvate 5 ml

Antibiotic solution 5 ml

L-Glutamine 5 ml

Eagle’s nonessential amino acids 5 ml

Add each of the listed reagents to one 0.5-liter bottle of DMEM. Filter-sterilize (0.2 μm) and store at 4°C for up to 1 month.

Recipe 2. Complete HBSS

FCS 250 μl (0.5% v/v)

D-Glucose 45% solution 1.1 (1 g/liter)

L-Glutamine 200 mM in PBS (500 μl) (2 mM final concentration)

Add each of the listed reagents to 50 ml of HBSS. Filter-sterilize (0.2 μm) and store at 4°C for up to 1 month.

P R O T O C O L

www.SCIENCESIGNALING.org 28 October 2008 Vol 1 Issue 43 pl3 5

on October 29, 2008

stke.sciencemag.org

Dow

nloaded from

Recipe 3: Diamide 1000× Stock Solution

Dissolve 172 mg of powder in 1 ml of distilled H2O (dH2O) for a final concentration of 1 M. Divide into 100-μl aliquots and store at −20°C.

Recipe 4: DTT Stock Solution

Dissolve 154 mg of powder in 1 ml of dH2O for a final concentration of 1 M. Divide into 100-μl aliquots and store at −20°C.

Instructions

Mutagenizing YFP and Subcloning rxYFP into the pcDNA3 Mammalian Expression Vector

The DNA construct encoding rxYFP can be prepared by standard mutagenesis and cloning techniques, as detailed in Østergaard et al.(8). Relative to wild-type GFP, rxYFP carries the mutations C48V, S65A, V68L, S72A, Q80R, N149C, M153V, S202C, T203Y, andD234H (A, Ala; C, Cys; D, Asp; H, His; L, Leu; M, Met; N, Asn; Q, Gln; R, Arg; S, Ser; T, Thr; V, Val; W, Trp; and Y, Tyr); Cys149 andCys202 constitute the redox-active pair. The native and partially solvent-exposed Cys48 is removed by a Cys-to-Val mutation to preventinterfering redox reactions. The complete nucleotide and amino acid sequence of rxYFP is shown in Fig. 1.

The plasmid pHOJ124, which contains the engineered rxYFP cDNA inserted into the pFHC2102 vector, may be obtained from theauthors (H.Ø. and J.R.W). Below, we describe the specific instructions for subcloning rxYFP into the pCDNA3 vector at the Eco RIsite. Eco RI sites are introduced by polymerase chain reaction (PCR) amplification with the primers listed in the Materials section.

1. Prepare two 50-μl PCR reactions containing 5 μl of 10? PCR buffer, 1.5 μl of 50 mM MgCl, 1 μl of 10 mM dNTPs, 5 μl of eachprimer (10 μM in solution), and 1 μl of Pfu Turbo DNA polymerase; add 300 ng of template to one tube and just water to the sec-ond one, as a control for DNA contamination.

2. Perform PCR using the following parameters.

4 cycles:

94°C × 30 s

50°C × 30 s

72°C × 30 s

29 cycles:

94°C × 30 s

66°C × 30 s

72°C × 40 s

3. Purify the PCR product by agarose gel electrophoresis followed by the GENECLEAN method according to the manufacturer’sinstructions.

4. Subclone the PCR product into pCR2.1-TOPO using the TopoTA cloning system according to the manufacturer’s instructions.

5. Transform TOP10-competent cells with the TOPO cloning reaction according to the manufacturer’s instructions using kanamycinas the selective agent; recover the pCR2.1-rxYFP plasmid DNA from surviving colonies by standard procedures.

6. Separately digest pCR2.1-rxYFP and the pcDNA3 expression vector with Eco RI and then purify the rxYFP fragment and the lin-earized vector by agarose gel electrophoresis using the GENECLEAN method.

7. Insert the rxYFP fragment into pcDNA3 by incubating it with T4 DNA-ligase according to the manufacturer’s instructions.

8. Transform DH-5α–competent E. coli with 5 μl of the crude ligation mixture and plate cells on agar plates using ampicillin as theselective agent by standard techniques; incubate at 37°C overnight.

P R O T O C O L

www.SCIENCESIGNALING.org 28 October 2008 Vol 1 Issue 43 pl3 6

on October 29, 2008

stke.sciencemag.org

Dow

nloaded from

9. Extract plasmid DNA from 5 to 10 colonies using the QIAprep Spin Miniprep Kit.

10. For each isolated clone, determine the correct orientation of the rxYFP insert in the pcDNA3 vector by transfecting the plasmidinto B16F10 cells with the Effectene transfection reagent, according to the manufacturer’s instructions.

11. Verify protein expression by conventional epifluorescence or confocal microscopy. rxYFP-positive cells should appear fluores-cent (emitting yellow-green color after excitation at 488 nm) 24 hours after transfection.

12. Verify the integrity of the rxYFP construct of properly oriented clones by DNA sequencing.

rxYFP Expression in Tumor Cell Lines

We describe methods for transfecting B16F10 cells, but a similar method can be used for transfecting HepG2 cells. HepG2 cellsshould be grown in HCM instead of Complete DMEM, and the cells should be plated at a density of 150,000 (instead of200,000) cells per 1.2 ml of medium in 35-mm glass-bottom culture dishes. We recommend preparing at least two 35-mm dishesof cells per experiment.

1. Wash one 25-cm2 flask of adherent B16F10 cells twice with 5 ml of PBS (without Ca2+ and Mg2+); then incubate in 1 ml of 1×trypsin-EDTA solution for 5 to 10 min at 37°C.

Note: Inspect cells after 5 min and proceed once cells begin to lift from the dish.

2. Inactivate trypsin by adding 4 volumes of Complete DMEM Medium (Recipe 1).

3. Count the cells and plate at 200,000 cells per 1.2 ml of Complete DMEM Medium (Recipe 3) in IbiTreat μ-Dish glass-bottom35-mm culture dishes. Gently swirl the plates to ensure even distribution of cells on the dish surface. Incubate overnight at 37°Cwith 5% CO2.

4. Transfect the cells with pcDNA3-rxYFP using standard transfection reagents and methods.

Note: We use the Effectene transfection reagent and follow the manufacturer’s instructions for setting up the transfection. Cellsmay also be transfected with a second contruct expressing another gene of interest (GOI) in addition to pcDNA3-rxYFP. We rec-ommend using a pcDNA3-rxYFP:GOI plasmid ratio of 1:2 (0.25μg of rxYFP and 0.5 μg of GOI).

5. After adding the transfection solutions to the cells, incubate for 48 hours at 37°C with 5% CO2.

6. Verify protein expression by conventional epifluorescence or confocal microscopy. rxYFP-positive cells should appear fluores-cent (emitting yellow-green color after excitation at 488 nm) 24 hours after transfection.

Cell Preparation for Image Analysis

Cells may be stimulated for various time periods. Control cells that are not stimulated but that are incubated for the same length oftime in Complete HBSS (Recipe 2) should always be included. All experimental conditions should be performed on at least two dish-es. For control cells and cells that will be exposed to stimuli for several hours, the cells are transferred to the microscope after treat-ment. Cells that are to be exposed to short-term stimuli for real-time imaging of cellular responses are treated at the microscope. Thistreatment at the microscope is described briefly here, but details about image acquisition appear in “Cell Imaging.”

Unstimulated control cells

1. Completely remove growth medium from a dish of cells and replace with 1 ml of prewarmed Complete HBSS (Recipe 4).

2. Put lids into the “airtight” position and incubate cells for 30 to 60 min at 37°C with 5% CO2.

3. Take dishes, one at a time, to the confocal microscope for imaging.

Long-term stimulation of cells

Cells may be stimulated overnight and redox signaling assessed. At least two dishes should be prepared for each stimulation conditionand for the control (unstimulated cells).

P R O T O C O L

www.SCIENCESIGNALING.org 28 October 2008 Vol 1 Issue 43 pl3 7

on October 29, 2008

stke.sciencemag.org

Dow

nloaded from

1. Replace the standard growth medium with prewarmed Complete HBSS (Recipe 2) containing the appropriate stimulating agent orComplete HBSS (Recipe 2) without any stimulating agent (control).

2. Put lids into the “airtight” position and incubate cells for 16 to 20 hours at 37°C with 5% CO2.

3. Take dishes, one at a time, to the confocal microscope for imaging; compare stimulated and unstimulated dishes.

Short-term stimulation of cells

1. Place dish of cells on the confocal microscope and remove the lid of the dish.

2. Record a fluorescence baseline.

3. Pause image acquisition.

4. Add the solution containing the stimulating agent, pipetting gently to avoid generating turbulence.

Note: Use concentrated stimuli and add small volumes gently by forming a drop at the pipette tip and touching the drop careful-ly to the surface of the medium.

5. Resume image acquisition.

Note: For microscopes equipped with a perfusion chamber, it is not necessary to pause image acquisition to add the stimulus.

Probe Calibration: Determination of Fox, Fred, and a Values

To calibrate the fluorescent probe, determine the Fox, Fred , and a values by exposing transiently transfected cells to extreme oxidizingand reducing conditions (see Table 1 for examples of Fox, Fred, and a determined in B16F10 cells). Recall that Fox and Fred representthe values of F when the protein is 100% oxidized and reduced, respectively, and is a probe-specific factor. Fox is calculated by ex-posing the cells to diamide (Fox = Fdiamide), whereas Fred is calculated by exposing the cells to DTT (Fred = FDTT). The values of Fox andFred are functions of the excitation intensities at two different wavelengths and, therefore, must be recalculated if the relative excitationintensities are changed.

The ratio between cell fluorescence in oxidizing and reducing conditions (a = Fox/Fred) upon excitation at 458 nm (ex458nm) is thevalue of a. This can be determined in the “real-time” mode by imaging the same cells under the two different conditions by applyingthe oxidizing and reducing agents sequentially. If different samples are used, fluorescence values should be normalized relative to therespective baseline values at ex458nm to take into account cell-to-cell differences in probe concentration.

1. For each condition (oxidized and reduced), completely remove growth medium from a dish of cells and replace with 1 ml of pre-warmed Complete HBSS (Recipe 2) to which either 10 mM DTT (1:100 from 1 M stock, recipe 3; reduced condition) or 5 mMdiamide (1:20 from 1 M stock, recipe 4; oxidized condition) was added.

2. Put lids into the “airtight” position and incubate cells for 30 min at 37°C with 5% CO2.

3. Take dishes, one at a time, to the confocal microscope for imaging.

Note: Diamide or DTT may also be added in the “real-time” mode. After establishing a baseline, acquire images for at least 30min after addition of diamide or DTT and calculate F in both oxidizing and reducing conditions.

P R O T O C O L

www.SCIENCESIGNALING.org 28 October 2008 Vol 1 Issue 43 pl3 8

Table 1. Fox, Fred, and a were determined by detecting the fluorescence of whole B16F10 cells (n = 5), excited at 488 and 458 nm inthe emission range of 530 to 600 nm, after treatments with the potent thiol oxidant and GSH depletor diamide (5 mM) and with saturat-ing concentration (10 mM) of the thiol reducing agent DTT, respectively. The difference in Fox and Fred values defines the dynamicrange of the probe. Values are mean ± SD of five independent ROIs.

Fox Fred a

1.14 ± 0.12 2.12 ± 0.19 0.87 ± 0.09

on October 29, 2008

stke.sciencemag.org

Dow

nloaded from

Cell Imaging

The procedure described here is based on the use of a Leica confocal microscope (DMIRE2, Leica Microsystems, Germany), but canbe adapted to similar equipment. These procedures require prior familiarity with confocal microscopy techniques and instrumentation.

1. Turn on the microscope and launch the LCS 2.61 acquisition software (Leica Microsystems, Germany).

2. Place the dish containing treated or control cells under the microscope.

Note: Only remove one dish of cells from the incubator at a time for imaging.

3. Put a drop of oil on the 40× oil immersion objective and choose a field of cells for imaging using the 40× oil immersion objective(NA 1.25) or an objective with higher magnification to obtain high-resolution images.

Note: A good field of cells would contain at least four to six fluorescent cells, fully adherent to the substrate and sufficiently dis-tant to be isolated as individual regions of interest (ROIs). Very bright cells should be excluded from the analysis, to avoid arti-facts from signal saturation.

4. Set the photomultiplier emission filter in the 530- to 600-nm range, set the photomultiplier offset to 0%, and the pinhole diameterto 1 airy unit (AU).

5. Select 488 and 458 nm as excitation wavelengths and perform a continuous scan of both the 488- and 458-nm channels in thechosen field.

Note: 488 nm must be the first excitation wavelength in the sequence.

6. Adjust the other instrument settings to optimize the signal-to-noise ratio and to avoid photomultiplier saturation.

7. Set beam properties and instrument settings in order to excite the sample sequentially at 488 and 458 nm, using the “betweenlines” scan option to reduce the temporal delay between acquisition of the two images from seconds to milliseconds.

8. Select the scan mode (single scan, temporal scan, z-scan, or other) according to the experimental design, acquire the image(s),and save the image or images or the series as .tif files.

Note: There are various options for the scan mode. Single scans are appropriate for the construction of “static” bidimensionalredox maps, whereas z-scan allows tridimensional reconstruction. Temporal scans are indicated for kinetics (for example, cellu-lar responses to growth factors or drugs) and for the study of cell motility.

Construction of Redox-Based Cell Pseudoimages at Single-Voxel Resolution

Redox-based cell pseudoimages are created with custom software called “Redox Maps Generator” 1.0, which is provided as Supple-mentary Materials. The program is organized into three subsections: “Image loader and pre-processor,” “R-image properties andprobe calibration,” and “Experimental results” (Fig. 2).

Help is available within the Redox Maps Generator software; simply select “Show context help” under the “Help” menu, then clickon any object or input box. This will open a pop-up window that contains notes and contextual help about the selected object.

The software has several optional features: (i) Either the entire image can be processed or an ROI may be selected for processing.(ii) If the quality of the original images is low due to noise or low probe concentration, the images may be low-pass filtered to ob-tain higher-quality redox-based pseudoimages. The low-pass filter calculates the interpixel variation between the pixel being pro-cessed and those pixels surrounding it. Pixels to include are defined and then compared to surrounding pixels to determine the inter-pixel variation. If the interpixel has a variation greater than a specified percentage of the total pixel intensity, then the average pixelvalue is calculated from the neighboring pixels. If the variation is less than the specified percentage, the calculation is not per-formed. The percentage can be specified in the %Tol box (for “percent tolerance”), and the default value for “%Tol” is 40%. “Xsize” and “Y size” specify the size in pixels of the horizontal and vertical axes of the convolution matrix used in the calculations(the default is 2). Ideally, images should be processed without performing this calculation. (iii) Signal thresholds can be set in theoriginal images in order to remove background noise or to select a particular range of fluorescence values: By doing so, brightnessvalues of pixels below the lower threshold and above the upper threshold are set to 0. The other pixels maintain their original value.

Once the images have been processed, then the software displays the “R values” graph, as well as the mean R values and standard devia-tion R values (ΔR) from the histograms. A three-dimensional (3D) graph with all the image histograms is also generated as the “3D Sur-face” to illustrate differences in the processed image series. Some properties of the 3D graph are customizable. The processed images arestored as .tif files, along with a text file that contains all the values of the R-image histograms and their mean R values and ΔR values.

P R O T O C O L

www.SCIENCESIGNALING.org 28 October 2008 Vol 1 Issue 43 pl3 9

on October 29, 2008

stke.sciencemag.org

Dow

nloaded from

When the program is launched, the paths to each pair of processed files are displayed in real time in the “path to ch1” and “path toch2” dialog boxes. The total number of pairs of images is displayed in the “Files read” dialog box.

1. Create the folder C:\Redox Maps Generator Installer\, then download and unpack the program file “RedoxMapsGeneratorIn-staller.zip” into this folder.

2. From the C:\Redox Maps GeneratorInstaller\ folder, execute the “setup.exe” file and select the directory in which to install the program.

3. Launch “Redox Maps Generator” either from the Start/Programs menu or by navigating to the folder in which is was installedand opening the file “Redox Maps Generator.exe.”

4. Under “Image loader and pre-processor” (Fig. 3) in the “Image type” input box, select the option appropriate to the original images[8 bits, 16 bits, Float, Complex, RGB (red green blue), HSL (hue saturation lightness)]. The default setting is 8 bits.

Note: The test files are 8-bits images.

P R O T O C O L

www.SCIENCESIGNALING.org 28 October 2008 Vol 1 Issue 43 pl3 10

1. Image loader and pre-processor

2. R-image properties and probe calibration

3. Experimental results

Redox maps generator 1.0© 2007-2008 G. Maulucci, Physics institute U.C.S.C. Romefor info and debugging: giuseppe.maulucci@rm.unicatt.it

Fig. 2. The main screen of the Redox Maps Generator software.

on October 29, 2008

stke.sciencemag.org

Dow

nloaded from

5. For image series acquired in xyz mode, enter the ΔZ separation value (in μm)between adjacent frames in the “ΔZ (μm) or ΔT (s)” input box. Use the samebox to enter the time (in seconds) between adjacent frames for images seriesacquired in xyt mode.

Note: If the values of ΔZ or ΔT are not entered, and you are performingtemporal scans or z-scans, the default value will be automatically set to1. For the test files, use this default value.

6. To enable the ability to select an ROI from the original image, press the “ROIselection window” button. The arrowhead on the ROI button is green whenthis option is selected.

Note: This step is optional. If this is enabled, then when the image pro-cessing starts (Step 12), a window will appear allowing the ROI to beselected. If no ROI is selected, the entire image will be processed.

7. To remove background noise or to select a particular range of fluorescencevalues, apply a threshold to the images in the “range ch1” and “range ch2”input boxes by choosing the lower and the upper values of the pixels to be in-cluded; then use the “low pass filter” input box to calculate the interpixelvariation between the included pixels and those pixels surrounding it.

Note: This step is optional. If the “range ch1” and “range ch2” lowerand upper values are set, respectively, to 0 and 255, no threshold willbe applied. If “X size” and “Y size” values are both set to 1, images arenot low-pass filtered. For the test images, set in the “Low Pass Filterbox”: “Xsize” = 3; “Ysize” = 3; “%tol” = 0; and set in the “rangech1” and in “range ch2” box: “lower v.” = 25; “upper v.” = 255.

8. Insert the Fox, Fred, and a values into “2. R-image properties and probe cali-bration” (Fig. 4).

Note: The a value depends upon the probe and the wavelengths used.The default is 0.89, for rxYFP as the probe and 458 and 488 nm as theexcitation wavelengths. For the test images set: “Fred” = 2.12; “Fox” = 1.14; “a” = 0.89.

9. Specify the width (in pixels) of the border to create around the R-imagein the “border size” input box in “2. R-image properties and probe cali-bration.”

Note: The default border value is 3, which may be used with imageswith a convolution matrix (kernels) up to 7 × 7. For images with kernelsn x n, a larger border should be specified of at least (n/2) − 1 if n is aneven number representing pairs of images, (n − 1)/2 if n is odd. For thetest files, use the default border value.

10. Apply a threshold for the R-image in the “range R-image” input box by set-ting the lower and the upper values of the pixels you want to include in theprocessed image.

Note: This step is optional. The R expression in Eq. 3 can be singular(that is, F458 = 0) in some pixels, because of laser misalignment or mis-takes in optical settings. The singular points are automatically set to255 in the R-image. If it is possible, correct the optical problem (for ex-ample, by image rephasing). To avoid the visualization of these pixels,set the upper value equal to 254. For the test images set in the “RangeR image” box: “Lower v.” = 0; “Upper v.” = 254.

11. From the “Palette” option, choose the color palette for the R-image thatwill be displayed.

12. Press the white arrow button in the upper bar or open the “Operate” menu,then select “Run.”

P R O T O C O L

www.SCIENCESIGNALING.org 28 October 2008 Vol 1 Issue 43 pl3 11

1. Image loader and pre-processor

Fig. 3. The “Image loader and pre-processor” sec-tion of the software.

2. R-image properties and probe calibration

Fig. 4. The “R-image properties and probe calibra-tion” section of the software.

on October 29, 2008

stke.sciencemag.org

Dow

nloaded from

13. Select the folder where the images are stored and click on the “Select Cur Dir” button to begin construction of the redox-based cellpseudoimages. The dialog box will display the path to the selected folder in which at least one pair of images is stored; the twooriginal images and the R-image will be displayed in three windows (“channel 1”, “channel 2”, and “Redox Map”, respectively),and all three histograms will be plotted in real time.

Note: (i) If the “ROI selection window” button is green (enabled), then a window appears allowing the ROIs to be directly selectedon the image. Use the selection tool to draw a rectangle around the ROI and then press “OK.” (ii) During the image processing, thecalculation can be aborted by pressing the red circle button (“Abort execution” command) in the upper bar. (iii) For test files,choose the directory C:\Redox Maps GeneratorInstaller\Test, in which the files test_ch00.tif and test_ch01.tif are contained, andthen press the “Select Cur Dir” button. (iv) The image files must be in .tif format. If the images are in formats other than .tif, pre-pare a list of the files you wish to process in a text file. Save this file as “files.txt” and store it in the same working directory inwhich the images are stored. Next, press the “file reader debugger” button in the “1. Image loader and pre-processor” section be-fore proceeding.

P R O T O C O L

www.SCIENCESIGNALING.org 28 October 2008 Vol 1 Issue 43 pl3 12

3. Experimental results

Fig. 5. The “Experimental results” section of the software.

Fig. 6. Real-time quantitation of intracellular redox changes in response to chemical oxidation-reduction of B16F10 cells ex-pressing rxYFP. Average values for R (A) or fluorescence at 488 nm (B) were monitored over time in three distinct ROIs, in re-sponse to redox stimuli (1 mM DTT and 1 mM diamide). Magnification, 20×. Note the higher consistency among different ROIsin the R-based analysis. (See text for details.)

on October 29, 2008

stke.sciencemag.org

Dow

nloaded from

P R O T O C O L

www.SCIENCESIGNALING.org 28 October 2008 Vol 1 Issue 43 pl3 13

p66shcpBabe p66shcA

R

0.3000.3500.4000.450

0.5000.5500.6000.650

pBabe p66shcA

R

0.35

0.4

0.45

0.5

0.55

CMV-Flag CMV-GrxV

CMV- flag

ox

red

CMV- GrxV

ox

redA BB16F10 HepG2

75 µm75 µm 75 µm 75 µm

Fig. 7. Coexpression of rxYFP with genes of interest and effects on the intracellular redox state. (A) A substantial increase inthe average R value, with a yellow-to-red shift in cell pseudocolor, reveals reduction of rxYFP by the thiol-reducing enzymeglutaredoxin V. (B) The opposite effect is observed when the mitochondrial generator of ROS p66shc is coexpressed withrxYFP. Quantitation from multiple ROIs [n = 20 in (A); n = 6 to 8 in (B)] are reported in the histograms. Columns are the mean± SD of average R values. Expression of the transgenes was verified by Western blotting (not shown).

%++$μ*N

ox

red

N

BA

20 µm

100 µm

x (µm)

R rxYF

P

Fig. 8. High-resolution subcellular redox mapping of cultured B16F10 cells expressing rxYFP. (A) Distribution of rxYFP redoxstates in a fully spreaded cell cultured in standard growth medium. Cell nucleus (N) is indicated. Protein oxidation prevails in thecytosol and at the intracellular side of the plasma membrane. (B) Distribution of R values along a cell section crossing nucleusand cytosol (white bar). Average values for the nuclear (blue highlight) and cytoplasmic (cyan highlight) areas are indicated bydotted lines. The x axis indicates the pixel position with respect to the 100-μm section bar.

on October 29, 2008

stke.sciencemag.org

Dow

nloaded from

14. When the execution is complete, proceed to the “3. Experimental results” section (Fig. 5) to set the properties of the 3D graph us-ing the controls to the left of the graph:

(i) The plot may be reversed along the x,y,z plane (“invert x,” “invert y,” “invert z”).(ii) The x, y, and z axes may be automatically scaled (“auto x,” “auto y,” “auto z”).(iii) The plot style may be selected through the “plot style” menu (the default is a surface plot).(iv) The transparency of the plot may be set using the “transparency” dial.(v) An image of the plot may be projected onto the xz, yz, or xy plane (“xz proj,” “yz proj,” “xy proj”).(vi) The projections may be viewed alone using the “show projections only” button.

Note: This graph is only generated when multiple pairs of images are analyzed, for example, a z-series or time series. No graphwill show when only a single pair of images is analyzed.

15. To access the processed images, which are stored as .tif files, and a text file called “results.txt”, which contains all the values of the R-imagehistograms and their mean R values and ΔR values, go to the “results” folder, a subdirectory of the original working directory.

Notes and Remarks

For image fluorescence quantitation, average R values should be determined within multiple ROIs, single cells, or small cellclusters for each sample, and their mean ± SD determined and used for further statistical analysis—either two-tailed Student’s ttest or one-way analysis of variance followed by Tukey HSD post hoc comparison (a user-friendly free tool for these calculationsis available at http://faculty.vassar.edu/lowry/VassarStats.html).

Three examples that illustrate the application of the method are provided. In the first example, we performed real-time quantita-tion of intracellular redox changes in response to chemical oxidation-reduction (Fig. 3). The images were collected at low magni-fication (20×), and multiple ROIs (two of which correspond to single cells and one of which corresponds to a cluster of cells)were chosen for quantitation. Cells were exposed, sequentially, to a reductant (1 mM DTT) and then to a strong thiol oxidant (1mM diamide), and fluorescence emissions were measured over time. The reduction-oxidation kinetics were evaluated by the Rparameter after image construction (Fig. 6A). The raw change in fluorescence emission upon excitation at 488 nm was calculated(Fig. 6B). Ratiometric use of the probe cancelled out cell-to-cell differences likely due to unequal probe expression and photo-bleaching. In this example (panels A and B), the fast kinetics of response to stimuli indicates rapid equilibration of the probewith the redox environment, a key prerequisite for use of this method in cell signaling studies. Baseline average R values werecalculated for the three ROIs: ROI 1 = 0.38 ± 0.04; ROI 2 = 0.41 ± 0.03; ROI 3 = 0.38 ± 0.02.

In the second example, intracellular redox changes induced by transfection of B16F10 cells or HepG2 hepatoma cells withglutaredoxin V (GRX-V) and the ROS-generating protein p66, respectively, were monitored (Fig. 7). Cotransfection of GRX-Vshifts the cell into a more reduced state as indicated by the change in rxYFP fluorescence (red-to-yellow shift of cell pseudocol-or) in B16F10 melanoma cells (Fig. 7A). A substantial shift to red in the overall cell pseudocolor, indicating cell oxidation, wasobserved upon expression of the ROS-generating protein p66 in HepG2 hepatoma cells (Fig. 7B) (13). In both cases, cells wereanalyzed 72 hours after transfection. These examples illustrate the potential utility of this method to investigate intracellular re-dox changes induced by expressing a protein of interest.

In the last example, a “redox cell map” showing cellular redox states at subcellular resolution was created for an adherent, fullyspread B16F10 cell (Fig. 8). The high degree of spatial resolution provided by this technique enables the generation of redox cellmaps. Protein oxidation is most prevalent in the cytosol and on the intracellular side of the plasma membrane, as indicated by theorange pseudocoloring, while the nucleus is clearly distinguishable as a more reduced environment, as indicated by the prevalenceof yellow (Fig. 8A). The graph in Fig. 8B summarizes the distribution of R values along a cell section crossing nuclear and cytoso-lic regions (white bar). On the x axis is the pixel position with respect to the 100-μm section bar. The nuclear region averages 6.8(average R value within the blue box) and the cytoplasmic regions average 2.8 (average R value in the cyan boxes) (Fig. 8B).

We describe a method for the sensitive and reliable detection of intracellular redox changes in live mammalian cells at high spa-tial and temporal resolution. This protocol can be modified by targeting rxYFP to specific subcellular locations using varioussignal sequences. Moreover, additional fluorescent markers with emission spectra that do not overlap with this probe and that arespecific for organelles, proteins, or cell functions may be co-imaged with rxYFP to help in the interpretation of redox maps. Fi-nally, although information provided by R-based pseudoimages is largely qualitative in nature, it may be developed into a morequantitative tool to assess the intracellular redox potential, assuming oxidized/reduced glutathione (GSSG/GSH) as the largelypredominant redox couple in equilibrium with rxYFP (9).

P R O T O C O L

www.SCIENCESIGNALING.org 28 October 2008 Vol 1 Issue 43 pl3 14

on October 29, 2008

stke.sciencemag.org

Dow

nloaded from

In conclusion, this new methodology promises to open new avenues to the investigation of redox-based signal transduction in in-tact cells. Although operations related to the generation and analysis of redox images can in principle be performed with severalimage analysis software and calculation tools, we have developed and here described a user-friendly dedicated software that al-lows fast and reliable construction of redox cell maps. This tool is particularly useful for processing large numbers of imagefiles, such as those generated during kinetic studies.

References and Notes1. T. Finkel, Oxidant signals and oxidative stress. Curr. Opin. Cell Biol. 15, 247–254 (2003). 2. G. Pani, B. Bedogni, R. Colavitti, R. Anzevino, S. Borrello, T. Galeotti, Cell compartmentalization in redox signaling. IUBMB Life 52, 7–16 (2001). 3. S. G. Rhee, S. W. Kang, W. Jeong, T. S. Chang, K. S. Yang, H. A. Woo, Intracellular messenger function of hydrogen peroxide and its regulation by peroxiredoxins.

Curr. Opin. Cell Biol. 17, 183–189 (2005). 4. H. Liu, R. Colavitti, I. I. Rovira, T. Finkel, Redox-dependent transcriptional regulation. Circ. Res. 97, 967–974 (2005). 5. J. R. Lakowicz, Principles of Fluorescence Spectroscopy (Kluwer Academic/Plenum, New York, ed. 2, 1997).6. Z. Gryczynski, I. Gryczynski, J. R. Lakowicz, Fluorescence sensing methods. Methods Enzymol. 360, 44–75 (2003).7. J. Zhang, R. E. Campbell, A. Y. Ting, R. Y. Tsien, Creating new fluorescent probes for cell biology. Nat. Rev. Mol. Cell Biol. 3, 906–918 (2002). 8. H. Østergaard, A. Henriksen, F. G. Hansen, J. R. Winther, Shedding light on disulfide bond formation: Engineering a redox switch in green fluorescent protein.

EMBO J. 20, 5853–5862 (2001). 9. O. Björnberg, H. Ostergaard, J. R. Winther, Measuring intracellular redox conditions using GFP-based sensors. Antioxid. Redox Signal. 8, 354–361 (2006).

10. C. T. Dooley, T. M. Dore, G. T. Hanson, W. C. Jackson, S. J. Remington, R. Y. Tsien, Imaging dynamic redox changes in mammalian cells with green fluorescent pro-tein indicators. J. Biol. Chem. 279, 22284–22293 (2004).

11. G. T. Hanson, R. Aggeler, D. Oglesbee, M. Cannon, R. A. Capaldi, R. Y. Tsien, S. J. Remington, Investigating mitochondrial redox potential with redox-sensitivegreen fluorescent protein indicators. J. Biol. Chem. 279, 13044–13053 (2004).

12. M. Gutscher, A. L. Pauleau, L. Marty, T. Brach, G. H. Wabnitz, Y. Samstag, A. J. Meyer, T. P. Dick, Real-time imaging of the intracellular glutathione redox potential.Nat. Methods 5, 553–559 (2008).

13. O. R. Koch, S. Fusco, S. C. Ranieri, G. Maulucci, P. Palozza, L. M. Larocca, A. A. M. Cravero, S. M. Farre’, M. De Spirito, T. Galeotti, G. Pani, Role of the life spandeterminant P66shcA in ethanol-induced liver damage. Lab. Invest. 88, 750–760 (2008).

14. This work was supported by grants from the European Association for the Study of Diabetes (EASD, to G.P.), Ministero Affari Esteri, Italian-Argentinian collaborativeResearch Program (L.401/1990, to T.G.), and Catholic University (to M.D.S.). G.P. is an associate partner of the Diagnostic Molecular Imaging (DiMI) European Net-work of Excellence.

10.1126/scisignal.143pl3

Citation: G. Maulucci, V. Labate, M. Mele, E. Panieri, G. Arcovito, T. Galeotti, H. Østergaard, J. R. Winther, M. De Spirito, G. Pani, High-resolution imaging ofredox signaling in live cells through an oxidation-sensitive yellow fluorescent protein. Sci. Signal. 1, pl3 (2008).

P R O T O C O L

www.SCIENCESIGNALING.org 28 October 2008 Vol 1 Issue 43 pl3 15

on October 29, 2008

stke.sciencemag.org

Dow

nloaded from