Vol 4 Issue 3, 2010

_________________________________________________________

www.currentbiotica.com

285

ISSN 0973-4031

Modification of alkaline lysis method for rapid plasmid DNA isolation

S.V. Ramu, K.C. Babitha, K.S. Shailesh, Karaba N Nataraja and M. Udayakumar*

Department of Crop Physiology, University of Agricultural Sciences,

GKVK, Bangalore – 560 065, INDIA

*Corresponding author : udayakumar_m@yahoo.com

ABSTRACT

Isolation of quality plasmid DNA from bacterial cells is critical in molecular biology

experiments. Although efficient protocol for plasmid isolation are developed and standardized,

rapid and cost effective protocols are desirable while handling a large number of samples. In

present study we are reporting a simple procedure for extracting naked plasmid DNA which can

be used for a large number of samples with sufficient purity. The method involves denaturation

of high molecular weight chromosomal DNA using strong alkali, during neutralization process,

chromosomal DNA renatures, and proteins denature to form an insoluble clot in the presence of

choatropic agent guanidine hydrochloride, leaving plasmid DNA in the supernatant. The

modified protocol which is less expensive compared to the commercial plasmid DNA isolation

kit available, yields quality plasmid DNA. We tested the yield and quality of different kinds of

plasmid extracted from bacteria. The results suggest that the protocol can be effectively used for

molecular cloning, sequencing, and transfection.

KEYWORDS: Alkaline lysis, Guanidine hydrochloride, Plasmid extraction

INTRODUCTION

Bacterial plasmid DNA is widely

used as cloning vehicles in recombinant

DNA research. The isolation of plasmid

DNA is a critical step for many procedures

such as cloning, DNA sequencing,

transfection, and gene therapy. Most of the

applications require high purity plasmid

DNA. Certain methods like isolation by

anion-exchange columns, even though

widely used, are relatively expensive. The

method that use silica oxide as the DNA-

binding matrix has the limitation, as

bacterial lipopolysaccharide or endotoxin is

co-purified which can interfere with

downstream applications. The

lipopolysaccharide content in plasmid

preparation can heavily influence the

efficiency of transfection (Clevell, and

Helinski, 1969, Colman et.al 1978, Barnes,

1977).

Certain applications such as

recombinant bacterial colony screening to

permit analysis of many clones in a short

period, relatively less purified DNA can be

used (Telford et al.1977, Eckhardt et al.

1978 and Mickel et al 1977). Quick plasmid

DNA isolation methods involve boiling and

alkaline lysis (Holmes and Quigley 1981;

Sambrook and Russell 2001) and a few

other reliable protocols have multiple steps

and are time consuming (Mak et al. 1991;

Tarczynski et al. 1994; Wang et al. 1995;

Vol 4 Issue 3, 2010

_________________________________________________________

www.currentbiotica.com

286

ISSN 0973-4031

Aranishi 2002). A rapid protocol using

sucrose (8%) and triton X-100 (5%)

described by Liu and Mishra (1995) has

disadvantages. The high concentrations of

Triton X-100 may interfere with DNA

migration in agarose gel electrophoresis or

restriction digestion even after a 10-fold

dilution as suggested by the authors, and the

small volume of DNA used for restriction

digestion may be inadequate in many

circumstances. One-step procedure for

screening recombinant plasmids by size was

reported (Beuken et al.1998). Recently, a

rapid plasmid extraction method by the

direct boiling of E. coli cells, using 0.1%

Triton X-100 avoiding isopropanol/ethanol

precipitation and drying steps used in

standard plasmid preparation has been

reported (Ouyang et al., 2008). However,

the ratio of optical density (OD 260/280nm)

of extracted DNA was in the range of 2.7 to

3.4, suggesting the presence of impurities.

In this study we are reporting another

modified method for plasmid DNA

extraction from E. coli using Guanidine HCl

which is simple enough to isolate plasmid

vectors of different sizes and can yield

plasmid DNA in a form equally as pure as

the commercially available kits. The

procedure described is more versatile, cost

effective and rapid.

MATERIALS AND METHODS

The research experiments were

conducted at the Department of Crop

Physiology, University of Agricultural

Sciences, Bangalore during 2009-2010.

Cell strains and media:

Escherichia coli (DH5α) cultures

harboring different plasmids were grown in

Lauria (L) broth containing yeast extract

5gL-1

, NaCl 10gL-1

and tryptone 10gL-1

(Sambrook et.al, 1989) with appropriate

antibiotics (Kanamycin 50µg/mL;

Ampicilin 100µg/mL, and Chloramphenicol

25µg/mL). Different vectors used are

presented in the table 1 and figure 1a.

Procedure for extraction of plasmid DNA:

About 1.5 mL of bacterial cultures

grown in 3ml of L-broth containing

appropriate antibiotics was transferred to

microfuge tubes and spun at 12,000xg for 60

seconds to pellet down the cells. The

remaining 1.5ml culture was transferred to

the same tube after discarding the

supernatant and centrifuged to collect cells.

The supernatant was carefully removed with

a fine-tip pipette and the pellet was

thoroughly resuspended in 200ul of Solution

I (Sterile distilled water and RNase A

solution – (2.5mg/ml), stored at 4°C) by

vortexing. To the reaction mixture, 200µL

of Solution II (Alkaline SDS solution – 1%

NaOH and 2 % sodium dodecyl sulfate

(SDS), stored at room temperature) was

added and the tube was gently inverted to

get a clear suspension. To the suspension,

350 µL of Solution III (3M Guanidine HCl

(Sigma Aldrich Chemical Company, USA)

prepared in water and stored at room

temperature.) was added and the contents of

the tube were gently mixed by inverting for

a few seconds. The tube then was

centrifuged for 5-10 min at 12,000xg and the

clear supernatant was transferred to a fresh

centrifuge tube. To the reaction mix, equal

volumes of absolute alcohol was added and

incubated at room temperature for 10 min.

Generally any DNA would get precipitated

if the alcohol concentration is above 66%

and hence alcohol twice the volume of the

supernatant is generally added. On the other

hand isopropanol at a final concentration of

Vol 4 Issue 3, 2010

_________________________________________________________

www.currentbiotica.com

287

ISSN 0973-4031

30-50% could be conveniently used). . The

DNA pellet from the reaction mixture was

collected by centrifugation (10 min at

12000xg) and the supernatant was removed

by pipetting. The pellet was washed with

chilled ethanol (70%, v/v) by centrifuging at

12,000xg for 5 min. The DNA pellet was

dried at 650C for 3 to 5 min or air dried until

the ethanol evaporated. The purified DNA

was dissolved in 30-50µl of Tris or TE

buffer (10mM, pH 8 according to the pellet

size and used for analysis. The isolated

DNA was quantified using

spectrophotometer (UV-VIS, Simadzu,

Japan) and also by analyzed by agarose gel

electrophoresis (Sambrook et al., 1989). The

efficiency of the protocol was compared

with plasmid isolation from kit (Kit product

code PLN70-1KT Sigma, USA)

To check the quality of DNA

isolated, restriction analysis was done at

370C for 1 hr using specific restriction

enzymes (SacI, XhoI and SmaI, MBI,

Fermentas,USA). The identity of the

plasmids was confirmed by amplifying the

gene of interest by PCR using specific

primers. All the PCRs were carried out

under the following conditions; 940C for 4

min, 940Cfor 1min, 56-57

0C for 1 min and

720C for 1 min, followed by 25 cycles and

final extension of 720Cfor 8min.

RESULTS AND DISCUSSION

Exposure of bacterial suspensions to

strong anionic detergent at high pH

denatures chromosomal DNA and proteins.

There is a narrow range of pH (about 12.0-

12.5) within which denaturation of linear

DNA but not covalently coiled circular

DNA (CCC-DNA) occurs and that this

property can be used for purifying CCC-

DNA. In present protocol the cells were

suspended in sterile distilled water without

considering the pH of the solution. Plasmid-

containing cells were lysed completely with

strong detergent, SDS and alkali NaOH

(1%).

In molecular cloning, chaotropic

agents like guanidine HCL are used to

destroy the 3-dimensional structures of

proteins which convert most proteins to a

randomly coiled state (Tanford 1968.,

Gordon 1972). This strong denaturant can

solubilize insoluble or denatured proteins

such as inclusion bodies (Mukhopadhyay

1997, Rudloph, and Lilie1996). This can be

used as the first step in refolding proteins

(Levine et al.1995) or enzymes into their

active form (Mukhopadhyay 1997).

Guanidine HCl, an inhibitor of RNase, is

used in the isolation of RNA to dissociate

the nucleoprotein into its nucleic acid and

protein moieties (Cox 1968). Highly

concentrated (6 - 8 M) Guanidine HCl

solutions are used to denature native

globular proteins. It apparently disrupts

hydrogen bonds which hold the protein in its

unique structure. However, there also is

evidence suggesting that guanidine HCl may

disrupt hydrophobic interactions by

promoting the solubility of hydrophobic

residues in aqueous solutions (Gordon et al.

1972).

In the protocol reported here, we

used 3M Guanidium HCl to dissociate the

nucleoprotein and other protein moieties.

Alkaline extraction method is designed to

prevent the generation of the "irreversibly

denatured" form, at the same time; the

extracts must be alkaline enough for

denaturation of chromosomal DNA to occur.

The medium concentration of guanidine HCl

caused precipitation of protein-SDS

complexes (Kay et.al 1952 and Marko et.al

1951) and of high molecular weight RNA

(Crestfield et.al 1955). In this way, most of

Vol 4 Issue 3, 2010

_________________________________________________________

www.currentbiotica.com

288

ISSN 0973-4031

the three major contaminating

macromolecules are co-precipitated and

removed by a single centrifugation in a

bench-top centrifuge at room temperature.

As shown in the figure 1a ,1b and 1c pure

plasmid DNA was recovered from the

supernatant by ethanol precipitation.

The data revealed that the present

protocol can yield good quantity of plasmid

DNA (Table 1), and the optical density (OD)

ratios at 260/280mn wavelength indicated

good quality DNA as compared with that of

Kit method. The OD ratio at 260/280shows

that the presences of impurities are

significantly less compared to the method

described by Ouyang et al. (2008). The

obtained plasmid DNA is suitable for

digestion by restriction enzymes (Figure 3).

The target genes in the respective plasmid

DNA was confirmed through PCR

amplification using gene specific primers,

which also suggest the suitability of plasmid

isolated for further applications (Figure 2).

The protocol described here is a cost

effective. Each isolated plasmid sample

approximately cost about 35-40

INR/sample, where as many commercial kits

are cost about 150 INR /sample (Sigma

Plasmid kit) and 125 INR/ sample (Qiagen

Plasmid kit), which offer great economy for

routine recombinant plasmid isolation in

terms of daily use. Each isolated plasmid

sample approximately cost about two-three

times lesser than many commercial kits. The

protocol developed in the present study is

simple, reliable, rapid and cost effective for

plasmid isolation from bacterial cells.

ACKNOWLEDGEMENT: Authors are

thankful to Dr. Purshotham and Dr. Kiran

Ghnati Seeds company, Mansanto,

Bangalore respectively for reviewing the

manuscript and their critical comments. .

Table 1: Quantification of naked plasmid DNA. All plasmid DNAs were extracted

through the method reported in this study and quantified using spectrophotometer

Plasmids isolated using

modified method

Plasmids isolated using

DNA extraction kit Sl.No Sample ID

Plasmid

~size(kb)with

insert ng. µL-1

260/280 ng. µL-1

260/280

1 pRT1002x35s

3.7 272.38 1.47 150.21 1.87

2 pKM igrA

5 300.33 2.19 200.12 1.92

3 pRTigrA

5.8 143.3 1.87 100.23 1.84

4 pDonor Gus P1-P4 6.0 162.7 2.07 200.22 1.96

5 pDonor Gus P4r-

P3r 6.1 171.12 1.94 153.32 1.89

6 pDonor Gus P3-P2 6.0 522.94 2.23 195.65 1.79

7 pCAMBIA0390

4.2 1483.4 2.06 154.89 1.93

8 pEKM

15 150.3 2.08 156.23 1.87

Vol 4 Issue 3, 2010

_________________________________________________________

www.currentbiotica.com

289

ISSN 0973-4031

1 2 3 4 5 6 7 8 9

A) B)

1 2 3 4 5 6 7

C)

Figure 1: Ethidium Bromide stained gel showing different plasmids isolated through rapid

method reported.

A) Lane1-DNA marker λ-HindIII, Lane 2-9 different plasmid as represented in table 2. (2:

pRT100, 3: pKM igrA, 4: pRTigrA, 5: pDONORgusp1-p4, 6: pDONORgusp4r-p3r,

7: pDONORgusp3-p32, 8: pCAMBIA0390, 9: pEKM),

B) Lane1-5 different plasmid isolated using kit (1: pRT100, 2: pRT100igrA, 3: pKMigrA, 4:

pCambia0390 5: pBinAR cryEPSPS 6. 1kb ladder

c) Lane1- Lambda DNA HindIII cut(digest); Lanes 2, 4 & 6 - pKMdestination vector; Lanes 3, 5

& 7- pDONOR vector; Lane 2,3 extracted through traditional method ( i.e., alkali

lysis by phenol chloroform method). Lane 4, 5 plasmid extraction through kit method.

Lane 6&7- plasmid isolation through rapid method.

1 2 3 4 5 6

Vol 4 Issue 3, 2010

_________________________________________________________

www.currentbiotica.com

290

ISSN 0973-4031

1 2 3 1kb 4 5 6 B1 B2 B3

Figure 2: PCR amplification of various DNA inserts within plasmid vector using gene specific

primers in the binary vector carrying three different genes.

Lanes. 1, 2, & 3 from pKMNWBGW isolated through the method proposed in this paper.

Lanes 4, 5 & 6 from the pKMNWBGW isolated through kit method.

Lanes B1, B2 & B3 are the negative controls for the specific primers.

Lane 1&4 amplified using Forward: ggggatccagcagtcgaggggagcgagc and Reverse:

gggatatcgactccatgtacgctacgccg primers. Lane 2&5 are amplified using Forward:

5’ctcgaggcaccaatctagacctc3’ and Reverse: 5’ccatggttttttctctacctctctc3’ primers. Lane

3&6 were amplified using Forward: ccatgggacttttctagttgca and Reverse:

5’ggggtaccttatttgattttctaaag3’ primers.

Figure 3: Restriction digestion of plasmid DNAs extracted from (by) rapid method.

Lane –1 plasmid DNA uncut of pKMNWBGW, 2, 3 and 4: digested plasmid of pKMNWBGW

with restriction enzyme SacI, lane 5 – 1 kb ladder, lane 6 uncut plasmid DNA of pDONOR221,

lane 7- digested plasmid DNA using XhoI –SmaI.

2.2kb

1.8kb

1 2 3 4 5 6 7

1.1kb

Vol 4 Issue 3, 2010

_________________________________________________________

www.currentbiotica.com

291

ISSN 0973-4031

REFERENCES

Aranishi, F. ( 2002) Flexprep: scale-flexible

rapid plasmid preparation for analysis

of recombinant clones. Mol.

Biotechnol., 21(1): 39–41.

Barnes, W.M. (1977), Plasmid detection and

sizing in single colony lysates,

Science., 195(4276) : 393-394.

Beuken, e., Vink, c. and Bruggeman, C.A.

(1998) One-step procedure for

screening recombinant plasmids by

size. Biotechniques., 24(5): 748– 750.

Clevell, D.B. and Helinski, D.R. (1969),

Supercoiled Circular DNA-Protein

Complex In Escherichia Coli:

Purification And Induced Conversion

To An Open Circular DNA Form,

Proc. Nat. Acad. Sci. USA., 62: 1159-

1166.

Colman, A., Byers, M.J., Primrose, S.B. and

Lyons, A. (1978) Rapid purification of

plasmid DNAs by hydroxyapatite

chromatographyEur. J. Biochem., 91:

303-310.

Cox.R.A, (1968): The use of guanidium

chloride in the isolation of nucleic

acids. Methods Enzymology., 12: 120-

129.

Crestfield, A.M., Smith, K.C. and Allen,

F.W. Y(1955), The Preparation And

Characterization of Ribonucleic Acids

From Yeast, J. Biol. Chem., 21: 6185-

193.

Eckhardt, T. (1978), A rapid method for the

identification of plasmid

deoxyribonucleic acid in bacteria.

Plasmid, 1: 584-588.

Gordon J.A (1972): Denaturation of

globular proteins. Interaction of

guanidium salts with three proteins.

Biochemistry, 11: 1862-1870.

Holmes, D.S. and Quigley, M. (1981) A

rapid boiling method for the

preparation of bacterial plasmids.

Anal. Biochem., 114(1): 193–197.

Kay, E.R.M., Simmons, N.S. and Dounce,

A.L. (1952), An improved preparation

of sodium deoxyribonucleate J. Am.

Chem. Soc., 74:1724-1726.

Lan Ouyang, Liang Qin, Zhiwu Xu, Jianguo

He and Qiuyun Liu. (2008) A rapid

plasmid preparation method by the

direct boiling of Escherichia coli cells.

J. Rapid Methods & Automation

Microb., 16: 22–29.

Levine, A.D., et al. (1995), High Level

Expression and Refolding of Mouse

Interleukin 4 Synthesized in

Escherichia coli. J. Biol. Chem., 270:

7445-7452

Liu, Z. and Mishra, N.C. ( 1995) Single-tube

method for plasmid miniprep from

large numbers of clones for direct

screening by size or restriction

digestion. Biotechniques., 18(2):214–

217.

Mak, Y.M., Sornarajah, R. and Ho, K.K.

(1991) A rapid procedure for detecting

recombinant plasmids using butanol

extraction. Biotechniques., 11(16):

723.

Vol 4 Issue 3, 2010

_________________________________________________________

www.currentbiotica.com

292

ISSN 0973-4031

Marko, A.M. and Butler, G.C. (1951) The

Isolation Of Sodium

Desoxyribonucleate With Sodium

Dodecyl Sulfate J. Biol. Chem., 190:

165-176.

Mickel, S., Arena, V. Jr. and Bauer, W.

(1977) Physical properties and gel

electrophoresis behavior of R12-

derived plasmid DNAs, Nucleic Acids

Research., 4: 1465-1482.

Mukhopadhyay, A. (1997) Inclusion bodies

and purification of proteins in

biologically active forms Adv.

Biochem. Eng. Biotechnol., 56:61-109.

Rudloph, R. and Lilie, H. (1996), In vitro

folding of inclusion body proteins

FASEB J., 10: 49-56

Sambrook, J. and Russell, D.W. (2001)

Molecular Cloning: A Laboratory

Manual, Cold Spring Harbor

Laboratory Press, Cold Spring Harbor,

NY.3rd Ed, pp. 1.32, 1.35, 1.38.

Tanford.C. (1968): Protein denaturation.

Adv. Protein chemistry., 23: 121-282.

Tarczynski, M.C., Meyer, W.J., Min, J.J.,

Wood, K.A. and Hellwig, R.J. (1994)

Two minute miniprep method for

plasmid DNA isolation.

Biotechniques., 16(3): 514–519.

Telford, J., Boseley, P, Schaffner, W. and

Birnstiel, M. (1977), Novel screening

procedure for recombinant plasmids.

Science., 195: 391-393.

Wang, K., Gan, L. and Hood, L. (1995) A

microtiter plate-based highthroughput

DNA purification method. Anal.

Biochem., 226(1): 85–90.

[MS received 18 August 2010; Accepted 12 November 2010]

Disclaimer: Statements, information, scientific names, spellings, inferences, products, style, etc. mentioned in Current

Biotica are attributed to the authors and do in no way imply endorsement/concurrence by Current Biotica. Queries related to

articles should be directed to authors and not to editorial board.