p

uor

G g

n ih si l

bu

P eru ta

N 010 2©

nat

ure

pro

toco

ls/

moc. e r

ut an .

ww

w / /:pt t

h

protocol

nature protocols | VOL.5 NO.6 | 2010 | 1061

IntroDuctIonNoncoding RNAs (ncRNAs) have essential and diverse cellular functions. They may function as catalysts, adapters and guides in processes such as pre-mRNA spicing (small nuclear RNAs (snRNAs)), translation (ribosomal RNAs (rRNAs); and trans-fer RNAs (tRNAs)), rRNA modification and processing (small nucleolar RNAs (snoRNAs)) (reviewed in ref. 1) as regulators of gene expression (such as microRNAs (miRNAs))2 and as media-tors of germline functions (piwi-associated RNAs (piRNAs))3,4. ncRNAs, such as miRNAs, are implicated in the pathogenesis of many human diseases5–7. To investigate the tissue and subcellular localisation of ncRNAs, we report an easy and rapid fluorescent (FISH) and chromogenic (CISH) in situ hybridization (ISH) pro-tocol based on locked nucleic acid (LNA)-modified oligonucleotide probes for the detection of ncRNAs in sections from FFPE tissues and in cultured cells.

Methods for in situ detection of RNAsIn situ hybridization is a powerful tool that offers the advantage of studying the expression level and localization of specific RNA species within individual cells in tissue sections and can provide invaluable insights into physiological and pathological proc-esses. Historically, ISH was developed using radiolabeled probes8. Although sensitive, the use of radioactive isotopes suffers from low spatial resolution, long exposure times and risks associated with handling of radioactive material9,10. The application of non-radioactively labeled nucleotides (e.g., biotin-UTP and digoxigenin (DIG)-UTP) considerably improved ISH11–13. More recently, fluo-rescently labeled probes provided more potential to ISH techniques overcoming the limitations of colorimetric-based detection and giving the possibility to visualize multiple targets in single cells. The application of tyramide signal amplification (TSA) has dramatically increased the sensitivity of FISH and offers several

advantages over alkaline phosphatase (AP)-based localization pro-cedures10. For FISH, TSA detection may provide up to a 100-fold increase in signal compared with conventional fluorescent probes, although it may lead to reduced subcellular resolution in the event of overamplification14–17. Another major improvement in stand-ard FISH and CISH protocols was the substitution of traditional DNA or RNA probes with LNA-modified oligonucleotide probes, which display markedly increased hybridization affinities toward complementary RNAs, compared with traditional RNA- or DNA-based probes18. Thus, stringent hybridization may be used, increas-ing the specificity and sensitivity of ISH detection4,19–22. However, the high autofluorescence of certain tissues may interfere with FISH. One way to bypass autofluorescence problems is the use of DIG-labeled probes. Probe binding can be detected colorimetrically by antibodies specific for DIG, which are coupled with an enzyme (AP). After adding the enzyme substratum (4-nitroblue tetrazo-lium chloride/5-bromo-4-chloro-3-indolyl-phosphatase), an intra-cellular blue–purple precipitate occurs, which can be detected by light microscopy.

After designing the hybridization probe, the next most important issue for any ISH protocol is the manner in which tissue sections or fixed cells are treated, to maximally preserve morphology and probe access to the target RNA. Typically, tissues or cells are fixed with formaldehyde-based or other fixatives and either embedded in paraffin or kept frozen. The sections are treated with proteases (such as proteinase K) to digest fixed cellular proteins and expose the cellular RNA to the probe. However, such treatment impairs tissue morphology and may destroy many protein epitopes, often precluding a simultaneous detection of proteins by immuno-fluorescence (IF). The parameters of protease treatment, such as enzyme concentration and reaction time, need to be determined empirically for each tissue and probe. Underdigestion of tissue

Rapid in situ codetection of noncoding RNAs and proteins in cells and formalin-fixed paraffin-embedded tissue sections without protease treatmentMariàngels de Planell-Saguer1,2, María Celina Rodicio2 & Zissimos Mourelatos1

1Department of Pathology and Laboratory Medicine, Division of Neuropathology, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania, USA. 2Department of Cell Biology and Ecology, Faculty of Biology, University of Santiago de Compostela, Santiago de Compostela, Spain. Correspondence should be addressed to Z.M. (mourelaz@uphs.upenn.edu).

Published online 20 May 2010; doi:10.1038/nprot.2010.62

noncoding rnas (ncrnas) comprise a diverse group of rnas that function in essential cellular processes such as pre-mrna splicing and mrna translation and also regulate various aspects of gene expression in physiology and development. Methods of subcellular and tissue localization of ncrnas are essential to understand their biological roles and their contribution to disease. We describe a rapid fluorescent (FIsH) or chromogenic (cIsH) in situ hybridization protocol for localization of ncrnas (including micrornas (mirnas), small nucleolar rnas (snornas), small nuclear rnas (snrnas), piwi-associated rnas (pirnas) and ribosomal rnas (rrnas)) in formalin-fixed, paraffin-embedded (FFpe) tissues and cultured cells, using locked nucleic acid (lna)-modified oligonucleotides. In this protocol, sections are heated in citrate buffer, which eliminates the need for protease treatment, thus preserving optimal morphology and protein epitopes, and allowing the simultaneous detection of proteins with immunofluorescence staining (IF). lna–FIsH requires 5 h, or between 10 and 36 h when combined with IF; lna–cIsH requires 2 d.

p

uor

G g

n ih si l

bu

P eru ta

N 010 2©

nat

ure

pro

toco

ls/

moc. e r

ut an .

ww

w / /:pt t

h

protocol

1062 | VOL.5 NO.6 | 2010 | nature protocols

will preserve morphology but will not expose cellular RNAs to the probe, whereas overdigestion will make morphology suboptimal and may also lead to considerable losses of cellular RNA, leading to decreased sensitivity. The major advantage of using a paraffin- embedding technique is superb histological preservation and the ability to archive FFPE tissues at room temperature (20–25 °C) at low cost. The main disadvantage is reduced sensitivity, compared with frozen sections. However, although frozen sections provide better probe access to target RNA, rendering ISH more sensitive than paraffin-embedded sections, they suffer from inferior cellular morphology.

Application of the methodThe ideal ISH technique would be rapid and combines the following:

1. Optimal preservation of tissues, using FFPE, with the ability to expose cellular RNAs to the probe without relying on protease treatment.

2. The high spatial resolution of fluorescent detection.3. The use of the most sensitive detections systems currently

available: LNA probes with or without tyramide amplification.

4. The ability for parallel codetection of proteins with IF.

In this study, we describe such a protocol for the detection of ncRNAs, including microRNAs, snoRNAs, snRNAs and rRNAs. An important improvement over previous ISH protocols is the use of heat treatment in the citrate buffer of tissue sections, which eliminates the need for protease treatment. Heat treatment is very commonly used to expose protein epitopes in fixed tissues and is widely used for immunohistochemistry and IF applications. By light microscopy, the cellular preservation after heat treatment is high, although the ultrastructural details of chromatin are impaired23. We also describe a sensitive protocol for CISH of piRNAs in FFPE tissues.

Experimental designCell culture and tissue sections. We have developed our protocol using HeLa cells, but any other adherent cell type can be used with no or minimal modifications, except the timing, which depends on the growth rate of the cell line used. The procedure described here used FFPE tissue sections obtained from the pathology core

laboratories of the University of Pennsylvania. We have used this protocol to successfully detect ncRNA and proteins in tissues from different sources without specific modifications, except thickness that ranged between 10 µm and 20 µm, depending on the tissue used. Here we present data from the brain, the spinal cord and the testis of adult mice.

Probe design. The length of the probes depends on the nature of the ncRNA to be detected, but typically, they range between 17 and 21 nucleotides for miRNAs and 19 and 30 nucleotides for other ncRNAs used in this protocol (Table 1). We recommend LNA modification of at least 20–25% of the probe and to purchase probes prelabeled with fluorochromes or DIG. To increase sensiti-vity, LNA probes can also be labeled at both ends (5′ and 3′).

Controls. Suitable control experiments should be conducted to test the specificity of probes and antibodies being used. Positive controls should monitor the quality of sample preparation and confirm that all reagents used for detection have been properly prepared and applied. A positive control for this protocol could be a probe or an antibody that is highly expressed in all cell types and is known to work well with the material being analyzed. Probes against ribosomal RNA (similar to 18S rRNA) are good positive controls for the ISH process, whereas staining of Sm proteins represents a good positive control for the IF procedure. Negative controls are essential when establishing the procedure to monitor the level of nonspecific background. The best negative controls for the ISH procedure are those probes that are known to work but not expressed in the tissue or cell type being analyzed. For example, miR124 probes could be used as negative control in nonneuronal tissues, whereas probes against piRNAs can be used as negative con-trols in nongerminal tissues. Examples of other appropriate nega-tive control probes include probes with few mismatches, probes with scrambled sequence or pretreatment of the sample with RNase to ensure that probes hybridize to RNA species. Negative controls should also be considered to test antibody specificity during the IF process. One simple negative control can be the omission of the primary antibody, or the nonimmune serum or nonspecific immunoglobulin of the same isotype as the primary antibody.

An overview of the method. In this protocol, we describe a rapid and detailed procedure for the simultaneous detection of ncRNA

table 1 | Probes used in this protocol.

rna name company probe sequence (5′ to 3′) Modification Tm (°c)

mmu-miR-124 (brain-specific miRNA)

Exiqon ggcattcaccgcgtgcctta 5′-FITC 80

Cy3-28S IDT CG + AGGGCA + ACGGAG + GCC + AC 5′–Cy3 71.5

Cy3-18S-Probe1 IDT CTG + CGGTA + TCCA + GGCGG + CT 5′–Cy3 72.6

Cy3-18S-Probe2 IDT TTT + ACT T + CC T + CT AG + A TA + G TCA 5′–Cy3 56.1

Cy3-snRNA U2 IDT AA + TCCATTT + AATATATT + GTCCTCGGA + TAGA 5′–Cy3 58.4

Cy3-snoRNA U3 IDT AG + AAAT + GAT + CCCT + GAAAGT + ATAGT 5′–Cy3 58.7

XL-piR-3 probe IDT 5′-GG + ACATGA + CATTGGTGC + TCTTCT + ACTTA 3′–DIG 71.0The LNA Tm prediction tool is accessible at http://lna-tm.com.

p

uor

G g

n ih si l

bu

P eru ta

N 010 2©

nat

ure

pro

toco

ls/

moc. e r

ut an .

ww

w / /:pt t

h

protocol

nature protocols | VOL.5 NO.6 | 2010 | 1063

and proteins in FFPE sections using fluorescence-conjugated LNA-modified oligonucleotide probes and IF; in the situation of a high background caused by autofluorescence, we used LNA–CISH. In the case of low-abundant RNAs (such as miRNAs), it can be com-bined with TSA techniques to enhance detection sensitivity. For cells, the protocol can be completed in < 3 h starting with fixation, and in ~5 h when combined with IF. For FFPE tissues, after the desired material is embedded and sectioned, the protocol can be carried out within 5 h or between 16 and 36 h when combined with IF. The LNA–CISH method for the sensitive detection of piRNAs in FFPE tissues needs 2 d to be completed. An overview of our protocol is provided in Figure 1 and representative images of its applications are shown in Figures 2–5.

MaterIalsREAGENTS

Cells (e.g., Human HeLa cells, mouse MN-1 cells and so on)Dulbecco’s modified Eagle’s medium high glucose 1× (DMEM; Gibco, cat. no. 11965)Fetal bovine serum (FBS; Sigma-Aldrich, cat. no. F2442-500 ml)L-Glutamine (Mediatech, cat. no. 25-005-Cl)Penicillin–streptomycin solution 10× (Mediatech, cat. no. 30-002-CI)6-Well tissue culture plates (Becton Dickinson, cat. no. 353046)Formaldehyde (methanol free), 10% ultrapure EM grade (Polysciences, cat. no. 04018) ! cautIon Formaldehyde is corrosive. Harmful if swallowed. May cause irritation to skin, eyes and respiratory tract. May cause blindness and cancer. The risk of cancer depends on the duration and level of exposure. Use gloves, safety glasses and a mask.10× Phosphate-buffered saline (PBS; Sigma-Aldrich, cat. no. P5493-1L)Triton X-100 (Roche, cat. no. 10 789 704 001) ! cautIon Harmful if swallowed. Causes severe eye irritation. May be harmful if inhaled or if it comes in contact with skin. Use gloves and safety glasses.Water, sterile (for RNA work) (DEPC treated and nuclease free; Fisher Scientific, cat. no BP561-1; or Millipore-purified)Xylene, ACS reagent >98.5% as xylene + ethylbenzene (Sigma-Aldrich, cat. no. 676748-1L) ! cautIon Xylene is very hazardous in case of skin contact (irritant), eye contact (irritant) or ingestion. Use in a fume hood. Dispose off waste using approved disposal protocol. Xylene is flammable and a contact hazard; wear gloves while handling.Ethyl alcohol absolute, anhydrous (Pharmco-Aaper, cat. no. 111ACS200)Distilled water (dH

2O)

Sodium citrate tribasic dihydrate (Na3C

6H

5O

7.2H

2O; Sigma-Aldrich, cat. no.

C8532-100G) ! cautIon Eye, skin and respiratory tract irritant. Prolonged or repeated exposure may cause allergic reaction in some individuals. Use gloves and work in a fume hood.Albumin from bovine serum, minimum 96% electrophoresis (BSA; Sigma-Aldrich, cat. no. A2153-50G)LNA oligonucleotide probes (Exiqon miRCURY LNA probes; Exiqon or Integrated DNA Technologies (IDT)) (see REAGENT SETUP and Table 1)Saline-sodium citrate buffer 20× (SSC; Mediatech, cat. no. 46-020-CM)

••

•••••

••

•

•

•••

•

•

•

Dextran sulfate sodium salt (Fisher Scientific, cat. no. BP1585-100) (see REAGENT SETUP ISH in cells and tissue)Polyoxyethylene sorbitan monolaurate (Tween-20; Bio-RAD, cat. no. 170-6531)Hydrogen peroxide 30% (vol/vol) (H

2O

2; Sigma-Aldrich, cat. no.

216763-500ML)1 M Tris-HCl pH 7.5 (Invitrogen, cat. no. 15567-027)Sodium chloride (NaCl; Sigma-Aldrich, cat. no. S6191-1KG)Blocking reagent (Perkin Elmer, cat. no. FP1020)Dimethyl sulfoxide (DMSO; Sigma-Aldrich, cat. no. D-2438-50ML) ! cautIon It is recommended to wear safety glasses and work in the fume hood as DMSO can cause chronic damage to the eyes and the vapor is an irritant. Thick rubber gloves are also recommended because nitrile gloves dissolve with exposure to DMSO, which can then penetrate the skin.Tyramide signal amplification plus fluorescence systems containing fluores-cein-conjugated tyramide and amplification buffer (TSA Plus; Perkin Elmer, cat. no. NEL741) (see REAGENT SETUP)

•

•

•

••••

•

B: Tissue sections

C: CISHB: FISH and TSAA: FISH

Step 4: Immunofluorescence

Primary antibody incubation

Washes

Secondary antibody incubation

Washes

Step 1: Specimen preparation

Step 2: Fixation and permeabilization

Step 3: Detection of RNAs

Tyramide signal amplification

H2O2 treatment

Blocking

Anti-FITC/HRP incubation

Pre-hybridization

Hybridization

Washes

Washes

Washes

Washes

Pre-hybridization

Hybridization

Stringency washes

Anti-DIG incubation

Developing

Mounting

Washes

Washes

Dehydration

Pre-hybridization

Hybridization

Washes

Mounting

DNA staining

Observation

Blocking

Plating of cells Dry sections

A: Cell culture

Fixation and wash

Permeabilization and wash

Deparaffinization

Antigen retrieval and wash

A: Cell culture B: Tissue sections

Mounting

DNA staining

Observation Observation

Mounting

DNA staining

Observation

Figure 1 | Flow diagram showing an overview of the protocol.

table 2 | Primary antibodies used in this protocol.

name protein target company cat. no. Host Dilution

Anti-TUJ1 Neuronal class III b-tubulin Covance MMS-435P Mouse 1:500

Y12 Sm proteins — — Mouse 1:500

Anti-fluorescein peroxidase conjugated (FITC/HRP)

Fluorescein Rockland 600-103-096 Goat 1:1,000

Anti-digoxigenin Digoxigenin Roche 11-093-274 Sheep 1:1,000

p

uor

G g

n ih si l

bu

P eru ta

N 010 2©

nat

ure

pro

toco

ls/

moc. e r

ut an .

ww

w / /:pt t

h

protocol

1064 | VOL.5 NO.6 | 2010 | nature protocols

Anti-fluorescein (goat) peroxidase conjugated (FITC/HRP), (Rockland, cat. no. 600-103-096) (see Table 2)Magnesium chloride (MgCl

2; Sigma-Aldrich, cat. no. M8266-100G )

Blocking reagent (Roche, cat. no. 11 096176 001)Levamisole solution 20× (Invitrogen, cat. no. 00-2205)Anti-DIG-AP, Fab fragments (cat. no. 11 093 274 910)5-Bromo-4-chloro-3-indolylphosphate (BCIP; Roche, cat. no. 11 383 221 001)Nitro-blue tetrazolium chloride (NBT; Roche, cat. no. 11 383 213 001)Perma-Mount (Fisher Scientific, cat. no. SP15-100)Primary antibody(ies) (see REAGENT SETUP and Table 2)Secondary antibody(ies) coupled to a fluorochrome (e.g., Alexa-Fluor, cat. no. 488, 564, and so on) (see REAGENT SETUP)Normal serum of the host species of the secondary antibody (e.g., normal mouse serum and normal goat serum) (Jackson ImmunoResearch Laboratories)4′,6-diamidino-2-phenylindole, dihydrochloride (DAPI; Molecular Probes, cat. no. D1306)ProLong Gold antifade reagent (Invitrogen, cat. no. P36930) ! cautIon Protect from light.Clear nail polish

EQUIPMENTThermo Scientific HERAcell CO

2 (Thermo Scientific, cat. no. 51013669)

Glass pasteur pipettesVacuum pumpMicroscope slides 25 mm × 75 mm × 1.0 mm (Fisher Scientific, cat. no. 12-550-15)Multiwell (6-well) plates (Becton Dickinson, cat. no. 353046)Tissue-Tek slide staining set (Sakura Finetek, cat. no. 4451)Liquid-repellent slide marker Pen (super Pap Pen; ProSciTech, cat. no. ID300)Cover glass 22 mm × 50 mm (Fisher Scientific, cat. no. 12-548-5E)Absorbent Kimwipes (Kimtech Science, cat. no. 34155)Staining dish, 20 slide unit, Wheaton (Wheaton, cat. no. 21043)Vertical staining jars with cover (Wheaton, cat. no. 432-1)Incubation chamber for slide incubation (custom made) (see EQUIPMENT SETUP)Paper filters (Whatman-Schleider & Schuell, cat. no. 1003-917)Flat-nose forcepsCover glass 22 mm × 22 mm (Fisher Scientific, cat. no. 12-548B)Boekel Scientific shake ‘n’ bake hybridization oven (Boekel Scientific, model 136400) at 47 °C and ~50–55 °CBoekel Scientific incubator (Boekel Scientific, model 133000) at ~50–55 °COrbital shaker (Artisan Scientific, VWR model DS-500 Signature Digital)Water bath (Fisher Scientific, Bath ISOTEMP MDL 205) with accurate temperatures between 15 and 80 °C

•

•••••

••••

•

•

•

•

••••

•••

•••••

••••

•••

Block heater (brand and model not critical)TimerPipettes for volumes 0.5–1,000 µlPipette tips for volumes 0.5–1,000 µlSerological pipette for volumes 2–25 mlBench-top pipette-aidStandard plastic labware (Eppendorf tubes, Eppendorf; Falcon tubes, Falcon) and glassCardboard microscope slide tray Fisherbrand (Fisher Scientific, cat. no. 12-587-10)Microscope slide storage boxes Fisherbrand (Fisher Scientific, cat. no. 03-448)Aluminum foilMicroscope (e.g., Nikon), fluorescence equipped with ×10, ×20 and ×40, dry objectives; ×63 and ×100 oil objectives and fluorescence filter sets for DAPI/fluorescein isothiocyanate (FITC)/Texas red or rhodamine/Cy3 charge-coupled device camera (Photometrics)Confocal laser-scanning microscope (e.g., Zeiss LSM510-META inverted confocal laser-scanning microscope, Zeiss) equipped with suitable lasersLight microscope with camera (e.g., Leica LM LB2 microscope with Leica DFC-480 digital camera, Leica)Computer with software controlling image acquisition and processing

REAGENT SETUPMedium; 10% (vol/vol) FBS, l-glutamine and 10-U ml–1 penicillin–strepto-mycin To prepare 1 liter of medium, add 10 of ml L-glutamine, 10 ml of penicillin–streptomycin and 100 ml of FBS in 880 ml of DMEM. Sterilize by filtration through a 0.22-µm filter and maintain the culture medium at 4 °C until required. crItIcal Prewarm the feeding medium to 37 °C using a water bath. Any unused solution should be discarded after 28 d.2% Formaldehyde To prepare 50 ml, add 10 ml of formaldehyde 10% to 40 ml of PBS 1×.Permeabilization buffer (1× PBS/0.5% Triton X-100) To prepare 50 ml buffer, add 5-ml 10× PBS to 40 ml. Add 250 µl of Triton X-100 by stirring.Ethanol Ethanol (100%) was diluted with dH

2O to 30, 50, 70 and 95%.

Antigen unmasking buffer (10-mM sodium citrate) To prepare 1-liter buffer, add 2.94 g of sodium citrate tribasic salt dihydrate (C

6H

5Na

3O

7.2H

2O)

to 1-liter dH2O. Adjust pH to 6.0 and filter.

1× PBS To prepare 1 liter of PBS, add 100 ml of 10× PBS to 900 ml of dH2O.

4× SSC To prepare 1,000 ml, add 200 ml of 20× SSC to 800 ml of water.Prehybridization buffer (3% BSA in 4× SSC) To prepare 100 ml, add 3 g of BSA to 100 ml of 4× SSC. crItIcal Prepare fresh on the day of the experiment.25% Dextran sulfate Dissolve 25 g of dextran sulfate sodium salt in water to a final volume of 100 ml by stirring.

•••••••

•

•

••

•

•

•

a

b

c

HeLa

d

e

f

Brain

g

h

i

Spinal cord

j

k

l

Testis

18S rRNA

Sm

18S rRNA+

Sm

Figure 2 | Codetection of 18S rRNA and Sm proteins in HeLa cells and FFPE mouse tissues using directly labeled LNA probes for FISH, combined with IF. FISH for 18S rRNA was performed using two different LNA probes directly labeled with Cy3 fluorophore (red; panels a,d,g and j). IF for Sm proteins was performed in the same sections with Y12 monoclonal antibody and Alexa Fluor-488-labeled anti-goat secondary antibody (green; panels b,e,h and k). Merged images of 18S rRNA and Sm proteins are reported in panels c,f,i and l. All images were acquired using an inverted Eclipse TE2000 Nikon microscope and recorded with a CCD digital camera. (a–c) HeLa cells; (d–f) brain; (g–i) spinal cord; and (j–l) testis. Images were acquired with a ×40 objective for panels a–c, and ×20 for all other panels. The expected localization of 18S rRNA and Sm proteins is seen with 18S rRNA found in nucleoli and cytoplasm of cells and Sm proteins in the nuclei. The expression pattern of 18S rRNA in mouse testis (high expression in spermatogonia and early primary spermatocytes, near the base of the seminiferous tubule, and much lower expression in later-stage spermatocytes, toward the lumen of the tubules) is consistent with the known expression pattern of rRNA in rat testes24. Bar: (a–c), 10 µm; (d–l), 20 µm.

p

uor

G g

n ih si l

bu

P eru ta

N 010 2©

nat

ure

pro

toco

ls/

moc. e r

ut an .

ww

w / /:pt t

h

protocol

nature protocols | VOL.5 NO.6 | 2010 | 1065

Hybridization buffer (10% dextran sulfate in 4× SSC) To prepare 10 ml, add 2 ml of 20× SSC, 4 ml of dextran sulfate 25% and 4 ml of water. Mix compounds well. crItIcal Prepare fresh on the day of the experiment.LNA oligonucleotide probes Probes labeled with Cy3 at the 5′-end are purchased from IDT or Exiqon. Use 1–2 ng of labeled probe per ml of hybridization buffer.

Probes labeled with fluorescein at the 5′-end are purchased from Exiqon, and usually have a concentration of 25 µM. Dilute the probe 1:10 with DEPC-treated water to a final concentration of 2.5 µM. Add 1 µl of the diluted probe pmoles to 1,000 µl of hybridization buffer.

Probes labeled with DIG at the 3′-end are purchased from IDT or Exiqon. Use 5 pmol ml − 1 of hybridization buffer. crItIcal The specific concen-tration to be used in each ISH experiment should be determined. Labeled probes should be aliquoted when received to avoid efficiency decrease with multiple freeze and thaw cycles.

Washing buffer I (4× SSC, 0.1% Tween-20) To prepare 1 liter of buffer, add 200 ml of 20× SSC to 799 ml of water and 1,000 µl of Tween-20.Washing buffer II (2× SSC) To prepare 1 liter of buffer, add 100 ml of 20× SSC to 900 ml of autoclaved Millipore (Milli-Q) H

2O.

Washing buffer III (1× SSC) To prepare 1 liter of buffer, add 50 ml of 20× SSC to 950 ml of autoclaved Milli-Q H

2O.

1× PBS To prepare 1 liter of PBS, add 100 ml of 10× PBS to 900 ml of autoclaved Milli-Q H

2O.

TN buffer (0.1 M Tris-HCl pH 7.5, 0.15 M NaCl) Add 100 ml of 1-M Tris-HCl and 100 ml of 1.5-M NaCl to 800 ml of autoclaved Milli-Q water.TNB blocking buffer (0.1-M Tris-HCl pH 7.5, 0.15-M NaCl, 0.5% (wt/vol) blocking reagent) Dissolve 0.5-g blocking reagent in 100-ml TN buffer. Heat gradually to 60 °C with continuous stirring to completely dissolve the blocking reagent (this may take up to several hours). Prepare aliquots and store the working solution at 4 °C. For long-term use, store aliquots at − 20 °C. Discard any unused blocking buffer that has been stored for more than 24 h at room temperature.TNT buffer (0.1-M Tris-HCl pH 7.5, 0.15-M NaCl, 0.2% (vol/vol) Triton X-100) Add 100 ml of 1-M Tris-HCl, 100 ml of 1.5-M NaCl and 20 ml of 10% (vol/vol) Triton X-100 complete with autoclaved Milli-Q water up to 1,000 ml.Hydrogen peroxide solution (3% (vol/vol) H

2O

2/1× PBS) Add 1 ml of 30%

H2O

2 to 9 ml of 1× PBS. crItIcal Prepare fresh on the day of use.

FITC/HRP solution Dilute FITC/HRP (dilution 1:1,000) in TNB buffer.Tyramide amplification solution (supplied with the kit) Dilute fluoro-chrome (fluorescein)-conjugated tyramide 1:50 in the amplification reagent supplied with the kit and use immediately. ! cautIon Protect from light.1× PBS To prepare 1 liter of PBS, add 100 ml of 10× PBS to 900 ml of autoclaved dH

2O.

Blocking solution (4% BSA/1× PBS) To prepare 100 ml, add 10 ml of 10× PBS to 90 ml of dH

2O. Add 4 g of BSA and stir until completely dissolved.

crItIcal Prepare fresh on the day of the experiment.

c

d

Tuj1

Tuj1+DAPI

a

b

miR-124

miR-124+DAPI

e

f

miR-124+Tuj1+DAPI

miR-124+Tuj1Figure 3 | Codetection of miR-124 and neuron-specific class III b-tubulin (TuJ-1) in FFPE mouse brain by LNA–FISH with TSA amplification and IF, respectively. Neuron-specific miR-124 (green) was visualized in adult mouse brain sections using fluorescein-conjugated miRCURY LNA detection probes and amplified using TSA (green; a,b,e and f). Punctate staining of the cytoplasm and nucleus of neurons is seen and consists of the detection of mature miR-124 (cytoplasm) and precursors (nucleus). Neuron-specific class III b-tubulin was detected in the same section using the Tuj-1 antibody and Alexa Fluor-594-labeled anti-goat secondary antibody (red; c,d,e and f). The expected expression pattern of neuron-specific class III b-tubulin is seen with cytoplasmic neuronal staining extending into neuronal processes. Nuclei were stained with DAPI (blue; b,d and f). All images were acquired with a ×63 objective using a Zeiss LSM510-META inverted confocal laser-scanning microscope. Bar, 10 µm.

a c e

b d fBrain

U2 snRNA DAPI U2 snRNA+DAPI

g i k

h j lSpinal cord

U3 snoRNA DAPI U3 snoRNA+DAPI

m o q

n p rTestis

28S rRNA DAPI 28S rRNA+DAPI

Figure 4 | Representative FISH micrographs of different ncRNAs in mouse FFPE tissues using directly labeled LNA probes. Panels: a–f. U2 snRNA was detected in the dentate gyrus of the hippocampus of mouse brain using an LNA probe directly labeled with Cy3 fluorophore (red; panels a,b) and nuclei were stained with DAPI (blue; c,d). The expected nuclear localization of U2 snRNA and its enrichment in Cajal bodies are evident. Merged images are in panels e and f. White boxes indicate the regions magnified in panels b–f. Panels g–l. U3 snoRNA was detected in mouse spinal cord using an LNA probe directly labeled with Cy3 fluorophore (red; panels g,h) and nuclei were stained with DAPI (blue; i,j). The expected nucleolar localization of U3 snoRNA is evident. Merged images are in panels k and l. Panels h–l represent magnifications from parts of panels g–k, respectively. Panels m–r. 28S rRNA was detected in mouse testis using an LNA probe directly labeled with Cy3 fluorophore (m,n) and nuclei were stained with DAPI (blue; o,p). The expected nucleolar and cytoplasmic localization of 28S rRNA is evident. Merged images are in panels q,r. White boxes indicate the regions magnified in panels n–r. All images were acquired using an inverted Eclipse TE2000 NIKON microscope and ×20 objective. Bar, 20 µm.

p

uor

G g

n ih si l

bu

P eru ta

N 010 2©

nat

ure

pro

toco

ls/

moc. e r

ut an .

ww

w / /:pt t

h

protocol

1066 | VOL.5 NO.6 | 2010 | nature protocols

Primary and secondary antibody solution (2% of BSA/1× PBS) To prepare 100 ml, add 2 g of BSA to 90ml of H

2O and 10 ml of 10× PBS and mix until

completely dissolved. Dilute the antibodies at the appropriate concentration (to be determined by the end). crItIcal Prepare fresh on the day of the experiment.IF washing buffer (0.2% BSA/1× PBS) To prepare 100 ml of buffer, add 10 ml of 10× PBS to 90 ml of dH

2O. Add 0.2 g of BSA and stir until

completely dissolved. crItIcal Prepare fresh on the day of the experiment.1× PBS To prepare 1 liter of PBS, add 100 ml of 10× PBS to 900 ml of autoclaved water (dH

2O).

PBS–Triton buffer (1× PBS/0.3%Triton X-100) To prepare 1 liter, add 100 ml of 10× PBS to 900 ml of autoclaved dH

2O. Add 3ml of Triton X-100 and mix.

Blocking solution (5% normal serum/PBS–Triton buffer) Dilute 5% normal serum from the same host species as secondary antibody (e.g., normal mouse serum and normal goat serum) in PBS–Triton buffer. crItIcal Prepare fresh on the day of the experiment.Primary and secondary antibody(ies) solution They are diluted in PBS–Triton buffer (for antibody dilutions, see Table 2). crItIcal Prepare fresh on the day of the experiment.1× PBS To prepare 1 liter of PBS, add 100ml of 10× PBS to 900 ml of autoclaved water (dH

2O).

DAPI stock solution (5 mg ml − 1) To prepare a 5-mg ml − 1 DAPI stock solution, dissolve the contents of one vial (10 mg) in 2-ml autoclaved water (dH

2O). ! cautIon For long-term storage, the stock solution can be

aliquoted and stored at ≤ − 20 °C. For short-term storage, the solution can be kept at 2–6 °C, protected from light. When handled properly, DAPI solutions are stable for at least 6 months.DAPI staining solution (0.5 µl of DAPI stock solution in 0.2% BSA/1× PBS) To prepare 50 ml of this solution, dissolve 200 mg of BSA in 1× PBS and add 0.5 µl of DAPI stock solution. ! cautIon Protect from light. crItIcal Prepare fresh on the day of the experiment.

proceDurespecimen preparation1| Preparation of the specimen takes two different paths: follow option A when working with cell culture or option B if tissue sections are used.(a) cell culture ● tIMInG 16–18 h (i) The day before the experiment, plate the cells of interest on sterile glass coverslips in a 6-well plate in 2 ml of growth

media. Incubate overnight at 37 °C, in 5% of CO2. Depending on the cell type, adjust the number of plated cells to obtain 60–70% of confluence on the day of the experiment.

(b) tissue sections ● tIMInG 16 h (i) Adhesion of the section to the slide is essential to prevent tissue loss during subsequent incubations and washes.

Place the sections in the oven overnight at 47 °C. ! cautIon All experiments using animals should be carried out under institutional and national guidelines.

Fixation and permeabilization2| Follow option A for cell culture or option B for tissue sections.(a) cell culture ● tIMInG 35 min (i) Wash the cells briefly with 1× PBS. (ii) Fix for 10 min with 2% formaldehyde at room temperature. (iii) Wash in 1× PBS (three times for 1 min each).

Nucleus(germinal vesicle)

Figure 5 | LNA–CISH for piRNA (XL-piR-3) in Xenopus laevis oocyte. A 3′-DIG-labeled LNA-modified probe antisense to XL-piR-3 piRNA was used along with anti-DIG–alkaline phosphatase Fab fragments and NBT/BCIP substrate for chromogenic detection. Cytoplasmic staining is evident; unstained refractile cytoplasmic particles represent yolk. Image was acquired with a Leica LM LB2 microscope and ×10 objective. Bar, 100 µm.

Blocking solution before anti-DIG (30-mM Tris pH 7.4, 150-mM NaCl, 1% blocking reagent, 0.5% Triton and 1-mM levamisole in 17.8 ml H

2O) To

prepare 20 ml of solution, dissolve 0.2 g of blocking reagent (Roche), 600 µl of 1M Tris-HCl pH 7.4, 600 µl of 5-M NaCl, 0.1 ml of Triton and 1 drop of levamisole in 18.7 ml of autoclaved ddH

2O. Levamisole

is used to block endogenous alkaline phosphatases before applying HRP-conjugated antibodies. crItIcal Prepare fresh on the day of the experiment.Staining solution (10-mM Tris-HCl pH 9.0, 50-mM MgCl

2, 100-mM NaCl

and 0.1% Tween-20) Add 10 ml of 1-M Tris, 50 ml of 1-M MgCl2, 20 ml of

5-M NaCl, 1 ml of Tween-20 and 919 ml of H2O.

Developing solution (10-mM Tris-HCl pH 9.0, 50-mM MgCl2, 100-mM

NaCl and 0.1% Tween-20 (staining solution) with NBT/BCIP) To 10 ml of staining solution, add 48 µl of 50 mg ml − 1 NBT and 35 µl of 50 mg ml − 1 BCIP. crItIcal Prepare fresh on the day of the experiment.EQUIPMENT SETUPIncubation chamber (for slide incubation) A simple homemade humid chamber can be made as follows: place filter papers saturated in water at the bottom of a plastic box that does not permit light to enter. Place the slides on top of these papers; then place the lid on the box and place the box in an incubator at the necessary temperature.Preparation of glassware Wash and autoclave glassware.

p

uor

G g

n ih si l

bu

P eru ta

N 010 2©

nat

ure

pro

toco

ls/

moc. e r

ut an .

ww

w / /:pt t

h

protocol

nature protocols | VOL.5 NO.6 | 2010 | 1067

(iv) Add 1 ml of cold permeabilization buffer (see REAGENT SETUP) to each well and keep aside at 4 °C for 5 min. (v) Remove the permeabilization buffer. (vi) Wash three times briefly, adding 1 ml of 1× PBS each time.(b) tissue sections: deparaffinization/rehydration and antigen unmasking ● tIMInG 2.5 h (i) It is necessary to completely remove the embedding material. Deparaffinize and rehydrate tissue sections using

standard methods described in box 1. ? troublesHootInG

(ii) Certain paraffin-embedded sections need to undergo an antigen retrieval procedure to uncover antigenic sites of proteins to antibodies and expose cellular RNAs to probes. We used heat treatment (box 2) by boiling the sections in 0.01 M of sodium citrate buffer (pH 6.0) for 10 min.

(iii) Let the slides cool for 30 min. (iv) Wash sections in dH2O three times for 5 min each with gentle shaking. (v) Wash sections in 1× PBS for 5 min with gentle shaking.

Detection of rnas in cells and tissues3| We have used three different procedures for detection of RNAs in cells and tissues. Follow option A for detection of abundant ncRNAs (such as rRNAs, snRNAs, snoRNAs and tRNAs); follow option B for the detection of low-abundant RNAs (such as miRNAs and piRNAs); or follow option C when using cells or tissues with a high level of autofluorescence.(a) FIsH for the detection of abundant rnas ● tIMInG 2h (i) Make a circle on the glass around the tissue with a liquid-repellent slide marker pen. (ii) Before hybridization, block in prehybridization buffer (see REAGENT SETUP) for 20 min at 22–25 °C below the

predicted probe Tm (usually around 45–55 °C). ? troublesHootInG

(iii) In the meantime, prewarm the hybridization mix at the same temperature as that of the hybridization process. (iv) Do not drain prehybridization solutions from the slides until the probe solution is diluted and ready for use. (v) Place the slides on a humid chamber. (vi) Hybridize for 1 h at the same temperature of prehybridization, using around 100–300 µl of hybridization buffer

(see REAGENT SETUP) in each slide. Pipette carefully onto the slides to completely cover the sections. ! cautIon Keep protected from light and do not let the sections dry out at any time during the hybridization process. This will significantly increase the background. crItIcal step Hybridization longer than 1 h does not improve the signal intensity. ? troublesHootInG

(vii) Wash the slides three times, for 5 min each, in washing buffer I (see REAGENT SETUP) at the same temperature (3 × 5 min). ! cautIon Keep protected from light.

(viii) Wash the slides in washing buffer II (see REAGENT SETUP) at the same temperature (1 × 5 min). ! cautIon Keep protected from light.

Box 1 | DEPARAFFINIZATIoN AND REHYDRATIoN SEQUENCE 1. Place the slides in a slide rack that is completely immerged in large volumes of solution (200 ml).2. Dewax the slides by immersing in xylene for 5 min, three times.! cautIon Wear gloves to avoid irritation from xylene. crItIcal step Check whether all sections are dewaxed. If traces of wax are still present, leave for a further 5 minutes.3. Remove xylene immersing the slides in 100% ethanol twice, for 10 min each.4. Rehydrate tissue sections gradually by passing the slides sequentially through the ethanol series: for 10 min in 95% and for 5 min each in 70, 50 and 30% ethanol and twice in dH2O. crItIcal step All of the above solutions should be changed regularly, i.e., after every four or five in situ hybridizations.

Box 2 | ANTIGEN UNMASKING USING BLoCK HEATER 1. Increase the temperature of the block heater. Remove one platform just before to place the Wheaton jar with the slides.2. Place the slides in the Wheaton jar containing 10-mM sodium citrate buffer pH 6.0 at room temperature.3. Bring slides to boiling point in sodium citrate. Maintain boiling for 10 min. crItIcal step Do not overboil as tissue may lift off the slide.4. Cool slides for 30 min on bench top.

p

uor

G g

n ih si l

bu

P eru ta

N 010 2©

nat

ure

pro

toco

ls/

moc. e r

ut an .

ww

w / /:pt t

h

protocol

1068 | VOL.5 NO.6 | 2010 | nature protocols

(ix) Wash the slides in washing buffer III (see REAGENT SETUP) at the same temperature (1 × 5 min). ! cautIon Keep protected from light.

(x) Finally, wash in 1× PBS (see REAGENT SETUP) at room temperature (1 × 5 min). ! cautIon Keep protected from light. ? troublesHootInG

Now there are two options: either go to Step 4 to continue with the IF staining protocol or proceed to nuclear staining and mounting (Steps 5–9).(b) FIsH for the detection of low-abundant rnas and tyramide signal amplification ● tIMInG 4 h (i) Make a circle on the glass around the tissue with the liquid-repellent slide marker. (ii) Prehybridize for 20 min at 22–25 °C below the predicted Tm (around 45–55 °C) value of the LNA oligonucleotide probe

used; use around 200 µl of prehybridization mix (see REAGENT SETUP) in each slide in a humid chamber. ? troublesHootInG

(iii) At the same time, you can prewarm the hybridization buffer at the same temperature as that of the hybridization process. (iv) Place the slides in a humid chamber. (v) Add the probe to the hybridization buffer (see REAGENT SETUP). Use around 100–300 µl of hybridization buffer in

each slide and hybridize for 1 h at the same temperature as determined in the previous step. ! cautIon Keep protected from light. crItIcal step A longer hybridization time does not improve the signal intensity but can increase the background. ? troublesHootInG

(vi) Wash the slides three times, for 5 min each, in washing buffer I (see REAGENT SETUP) with agitation at 5 °C higher than the hybridization temperature, to reduce the background (3 × 5 min). ! cautIon Keep protected from light. ? troublesHootInG

(vii) Wash the slides in washing buffer II (see REAGENT SETUP) at the same temperature (1 × 5 min). ! cautIon Keep protected from light.

(viii) Wash the slides in washing buffer III (see REAGENT SETUP) at the same temperature (1 × 5 min). ! cautIon Keep protected from light.

(ix) Finally, wash in 1× PBS (see REAGENT SETUP) at room temperature (1 × 5 min). ! cautIon Keep protected from light. ? troublesHootInG

(x) Place the slides horizontally in the incubation chamber and cover the sections with hydrogen peroxide solution (see REAGENT SETUP).

(xi) Incubate for 20 min at room temperature. H2O2 is used to quench endogenous peroxidase activity before applying HRP-conjugated antibodies. crItIcal step Hydrogen peroxide solution must be freshly prepared before use.

(xii) Wash the slides with TN buffer on the shaker for 5 min (see REAGENT SETUP). (xiii) Incubate the slides for 30 min at room temperature in TNB blocking buffer (see REAGENT SETUP) in the incubation

chamber. (xiv) Prepare the primary antibody (anti-FITC/HRP) in FITC/HRP solution (see REAGENT SETUP). (xv) Add 100–300 ml of FITC/HRP solution to the sections and incubate for 30 min at room temperature in the incubation

chamber. ? troublesHootInG

(xvi) Wash slides three times, for 5 min each, with TNT buffer in the dark with shaking. (xvii) Prepare tyramide amplification solution (see REAGENT SETUP). (xviii) Add 100–300 µl of tyramide amplification solution to the sections and incubate for 10 min room temperature in the

incubation chamber. (xix) Wash slides three times, for 5 min each, with TNT buffer in the dark with agitation. (xx) Wash slides in 1× PBS (see REAGENT SETUP) at room temperature (1 × 5 min) in the dark.

? troublesHootInGNow there are two options, either go to Step 4 to continue with the IF staining protocol or proceed to nuclear staining and mounting (Steps 5–9).(c) DIG-labeled lna oligonucleotide probes for cIsH ● tIMInG 4 h (i) Make a circle on the glass around the tissue with the liquid-repellent slide marker. (ii) Prehybridize for 20 min at 22–25 °C below the predicted Tm (around 45–55 °C) value of the LNA oligonucleotide probe

used; use around 200 µl of prehybridization mix (see REAGENT SETUP) in each slide in a humid chamber. ? troublesHootInG

p

uor

G g

n ih si l

bu

P eru ta

N 010 2©

nat

ure

pro

toco

ls/

moc. e r

ut an .

ww

w / /:pt t

h

protocol

nature protocols | VOL.5 NO.6 | 2010 | 1069

(iii) In the meantime, you can prewarm the hybridization buffer at the same temperature as that of the hybridization process.

(iv) Add the probe to the hybridization buffer (see REAGENT SETUP). Use around 100–300 µl of hybridization buffer in each slide and hybridize for 1 h at the same temperature as determined in the previous step. ! cautIon Keep protected from light. crItIcal step A longer hybridization time does not improve the signal intensity but can increase the background. ? troublesHootInG

(v) Wash the slides three times, for 5 min each, in washing buffer I (see REAGENT SETUP) with agitation at 5 °C higher than the hybridization temperature, to reduce the background (3 × 5 min). ! cautIon Keep protected from light.

(vi) Wash the slides in washing buffer II (see REAGENT SETUP) at the same temperature (1 × 5 min). ! cautIon Keep protected from light.

(vii) Wash the slides in washing buffer III (see REAGENT SETUP) at the same temperature (1 × 5 min). ! cautIon Keep protected from light.

(viii) Finally, wash in 1× PBS (see REAGENT SETUP) at room temperature (1 × 5 min). ! cautIon Keep protected from light. ? troublesHootInG

(ix) Block the specimen for 1 h with blocking solution before anti-DIG incubation. ? troublesHootInG

(x) Prepare a humidified slide incubation chamber. (xi) Place the slides horizontally in the incubation chamber and cover the sections with 100–150 µl of anti-DIG antibody

in blocking solution overnight at 4 °C. ? troublesHootInG

(xii) Wash the slides with PBST four times, for 10 min each, on the shaker. (xiii) Wash the slides twice with staining solution, for 10 min each, on the shaker. (xiv) Develop the slides with developing solution.

! cautIon NBT and BCIP solutions are photosensitive. (xv) To stop color reaction, wash slides in 1× PBS for 2 × 5 min. (xvi) Dehydrate by passing through graded EtOH (50, 80, 95, 95, 100 and 100%) and xylene (see box 3). (xvii) Leave in xylene until mounting with the coverslip. Dry one by one and mount the coverslip with Permount.

Alternatively, slides can be mounted with aqueous medium without dehydration, but doing so will cause higher background levels.

IF staining4| Follow options A to detect proteins using cells or option B to detect proteins using tissue sections.(a) cells ● tIMInG 3 h (i) Add blocking solution and incubate for 15 min at room temperature.

? troublesHootInG (ii) In the meantime, prepare primary antibody solution with the corresponding antibody dilution (see REAGENT SETUP). (iii) Aspirate blocking solution (for cells). (iv) Pipet 1,000 µl of primary antibody solution and add to the well, ensuring that all sections on the glass slide are

covered. ? troublesHootInG

(v) Incubate for 1 h at room temperature (or longer, depending on the antibody). ? troublesHootInG

Box 3 | DEHYDRATIoN SEQUENCE 1. Place the slides in a slide rack that is completely immerged in large volumes of solution (200 ml).2. Hydrate the slides by immerging in water for 1 min, three times.3. Dehydrate tissue sections gradually by passing the slides sequentially through ethanol for 1 min each at concentrations of 50, 80, 95 and 95%.4. Pass the slides twice in xylene for 2 min each. crItIcal step All of the above solutions should be changed regularly, i.e., after using four or five times.

p

uor

G g

n ih si l

bu

P eru ta

N 010 2©

nat

ure

pro

toco

ls/

moc. e r

ut an .

ww

w / /:pt t

h

protocol

1070 | VOL.5 NO.6 | 2010 | nature protocols

(vi) Remove the primary antibody. (vii) Rinse the cells with IF washing buffer (see REAGENT SETUP), three times for 5 min each, with gentle agitation.

? troublesHootInG (viii) In the meantime, prepare secondary antibody solution (for cells) with the corresponding secondary antibody dilution

(see REAGENT SETUP). (ix) Pipette 1,000 µl of secondary antibody solution over the cells. (x) Incubate for 45 min at room temperature. (xi) Remove the secondary antibody. (xii) Rinse the slides with 1× PBS three times for 10 min with gentle agitation.

? troublesHootInG(b) tissue sections ● tIMInG 3–18 h depending on the primary antibody used (i) Block the slides in blocking solution (for tissue) (see REAGENT SETUP) for 1 h at room temperature.

! cautIon The sections should never dry during the entire procedure. ? troublesHootInG

(ii) In the meantime, prepare primary antibody solution with the corresponding primary antibody dilution (see REAGENT SETUP).

(iii) Remove the blocking solution and carefully dry the outside of the glass slides with Kimwipes. (iv) Mark a circle around the tissue section with the liquid-repellent slide marker pen. The liquid blocker pen is very

resistant to PBS in IF staining procedure. (v) Prepare a humid chamber for slide incubation (only for tissue slides). (vi) Pipette 100–300 µl of primary antibody solution inside the water repellent circle, ensuring that all sections on the

glass slide are covered. ? troublesHootInG

(vii) Place slides into the incubation chamber (see EQUIPMENT SETUP). (viii) Incubate overnight at 4 °C.

pause poInt A shorter incubation (e.g., 1 h) at room temperature is also possible, but the penetration of antibodies into the sections might be reduced.

(ix) Remove primary antibody solution. (x) Wash slides in 1× PBS (three times for 5 min each with gentle agitation). (xi) In the meantime, prepare secondary antibody solutions (see REAGENT SETUP). (xii) Carefully dry the glass slides outside the repellent circle. (xiii) Pipette 100–300 µl of secondary antibody solution over the sections. (xiv) Incubate for 45 min at room temperature. (xv) Remove secondary antibody solution. (xvi) Rinse the slides with 1× PBS three times for 5 min each with gentle agitation. (xvii) When the signal and background levels are satisfactory, you can proceed to the nuclear staining process.

? troublesHootInG

Dna staining for cells and tissue sections ● tIMInG 30 min5| Add DAPI staining solution (see REAGENT SETUP) and incubate for 5 min at room temperature in the dark.! cautIon Keep protected from light.

6| Wash the cells or slides in 1× PBS (see REAGENT SETUP) at room temperature (3 × 5 min) with agitation.! cautIon Keep protected from light.

Mounting ● tIMInG 10–15 min depending on the number of samples7| Discard the buffer and cover with an appropriate mounting medium using glass coverslips or slides. Let the slides dry by letting them stand upright for 2 min. crItIcal step Remember that the slides are light sensitive and hence must be protected from direct light.? troublesHootInG

8| Add ~25 µl of ‘Prolong Gold’ to each section and place the glass coverslip on the slide or cover the slide with a glass coverslip. crItIcal step Avoid bubbles while mounting by pressing the coverslip from one edge of the slide to the other with the thumb to press out the small bubbles on the section.

p

uor

G g

n ih si l

bu

P eru ta

N 010 2©

nat

ure

pro

toco

ls/

moc. e r

ut an .

ww

w / /:pt t

h

protocol

nature protocols | VOL.5 NO.6 | 2010 | 1071

9| The staining procedure is now complete. Wait for at least 1 h before viewing. Store the slides overnight at 4 °C in the dark to allow the mounting medium to polymerize. Seal coverslips with nail polish. pause poInt The preparations can be stored for months at 4 °C in a dark place.

Microscope, image acquisition and analysis ● tIMInG variable10| We used a fluorescence microscope with appropriate filters for fluorescent methods (option A). We used a light microscope for colorimetric methods (option B).(a) Fluorescence methods (i) For FISH and IF analysis, a fluorescence microscope with appropriate filters is required. View the slides using either an

inverted or epifluorescence microscope equipped with a charge-coupled device (CCD) camera and image analysis software. (ii) Imaging can also be performed with a confocal laser-scanning microscope equipped with appropriate lasers, filters

and CCD camera. We used a Nikon Eclipse TE2000 microscope equipped with Reflected Light Fluorescence Attachment and a CCD-based image analysis system. Each image field was captured as a digital image using the SPOT Advanced System. Imaging was achieved using ×4, ×10, ×20 and ×40 magnification. For confocal microscopy, we used a Zeiss LSM510-META confocal laser-scanning microscope.

(b) colorimetric methods (i) Light microscope: we used a Leica LM LB2 microscope with a Leica DFC-480 digital camera. Imaging was achieved

using ×10 magnification.

● tIMInGStep 1A, Cell culture: 16–18 hStep 1B, Tissue sections: 16 hStep 2A, Cell culture: 35 minStep 2B, Tissue sections: deparaffinization/rehydration and antigen unmasking: 2.5 hStep 3A, FISH for the detection of abundant RNAs: 2 hStep 3B, FISH for the detection of low-abundant RNAs and tyramide signal amplification: 4 hStep 3C, DIG-labeled LNA oligonucleotide probes for CISH: 4 hStep 4A, Cells: 3 hStep 4B, Tissue sections: 3–18 hSteps 5 and 6, DNA staining for cells and tissues sections: 30 minSteps 7–9, Mounting: 10–15 minStep 10, Microscope, image acquisition and analysis: variable

? troublesHootInGTroubleshooting advice can be found in table 3.

table 3 | Troubleshooting table.

step problem possible reason solution

3B(vi, xv) 3C(iv, xi) 4A(v)

High background fluorescence

Probe or antibody concentration too high

Reduce the concentration of primary antibody/probe Reduce the hybridization or staining time

3A(ii); 3B(ii) 3C(ii, ix); 4A(i); 4B(i)

Insufficient blocking (e.g., pre-hybridization)

Tissue sections may not be adequately pre-hybridized before the application of probe or antibody. It may therefore be necessary to pre-hybridize for long

3A(x); 3B(ix–xx); 3C(viii); 4A(vii); 4A(xii); 4B(xvii)

Insufficient washings The washing of the tissue sections may have been insufficient. Washing for long or at a higher stringency may counteract this

3A(vi); 3B(v); 4A(iv); 4B(vi)

Partially unhybridized areas

The sections had not been covered uniformly with the probe/antibody

Make sure that the tissue remains humid for the entire staining procedure

(continued)

p

uor

G g

n ih si l

bu

P eru ta

N 010 2©

nat

ure

pro

toco

ls/

moc. e r

ut an .

ww

w / /:pt t

h

protocol

1072 | VOL.5 NO.6 | 2010 | nature protocols

antIcIpateD resultsIf negative controls such as mismatched or scrambled sequences are used, then no signal should be detected demonstrat-ing the specificity of the staining. To develop our protocol, we have chosen ncRNAs of different abundance, with tissue- or cell-specific expression and with known localization in different cellular compartments. The expected expression pattern and subcellular localization have been confirmed for all the snRNAs used in the protocol (Figs. 2–5). Examples of ncRNA detection using the LNA–FISH protocol are shown in Figures 2–4 and codetection of proteins is shown in Figures 2 and 3. ncRNAs are labeled in red (when the probe is labeled with Cy-3) in Figures 2 and 4; or green (when the probe is labeled with fluorescein and the TSA amplification system is used) in Figure 3. Proteins are labeled either green (when the second-ary antibody is coupled to Alexa Fluor-488) in Figure 2, or red (when the secondary antibody is coupled to Alexa Fluor-594) in Figure 3. Nuclei stain blue when DAPI is used (Figs. 3 and 4). LNA–CISH has been used to overcome the problem of a high autofluorescence background of tissues that limits the detection of ncRNAs such as piRNAs (Fig. 5). In this procedure, we used a DIG-labeled probe and colorimetric detection with NBT/BCIP; a blue–purple-colored precipitate is expected, which can be clearly distinguished from the background (Fig. 5).

table 3 | Troubleshooting table (continued).

step problem possible reason solution

2B(i) No signal or weak Incomplete removal of paraffin wax (tissue)

Check there should be no residual wax before proceeding

Low gene expression Amplify the signal with tyramide Can use two different probes targeting the same transcriptUse double labeled (5′ and 3′) LNA probes to increase sensitivity

3A(vi); 3B(vi) Probe or cellular RNA degradation

Avoid possible nuclease contamination

Immunodetection failed

Repeat the immunodetection with freshly prepared (new) chemicals (including dilution buffers)

Unspecific signal Sequence similarity of the probe

Select a more specific probe from the sequence of the gene. Colocalization of two different probes targeting the same tran-script should be a good indication that the probes are specific for their cognate target. The use of different fluorophores for the two probes facilitates confirmation of their colocalization

Too much probe applied Reduce the concentration of antibody/probe Reduce incubation time

Washes are not sufficient or they need to be more stringent

More washes

3A(vi); 7 Background staining on slide

Glass slides inadequately cleaned

Ensure high-quality, very clean, glass slides are used

Tissue allowed to dry during hybridization or detection

Ensure humidity of hybridization chamber

acknoWleDGMents We are grateful to the members of our laboratory and to Francesco Lotti for stimulating discussions and to Gideon Dreyfuss for providing the Y12 antibody. Supported by NIH grants GM0720777 and NS056070 to Z.M.

autHor contrIbutIons M.d.P.-S. developed the protocols and performed all the experiments. M.d.P.-S., M.C.R. and Z.M. contributed to the design and analysis of experiments and wrote the paper.

coMpetInG FInancIal Interests The authors declare no competing financial interests.

Published online at http://www.natureprotocols.com/. Reprints and permissions information is available online at http://npg.nature.com/ reprintsandpermissions/.

1. Gesteland, R.F., Cech, T.R. & Atkins, J.F. The RNA World (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2005).

2. Liu, X., Fortin, K. & Mourelatos, Z. MicroRNAs: biogenesis and molecular functions. Brain Pathol. 18, 113–121 (2008).

3. Hartig, J.V., Tomari, Y. & Forstemann, K. piRNAs—the ancient hunters of genome invaders. Genes Dev. 21, 1707–1713 (2007).

4. Kirino, Y. et al. Arginine methylation of Piwi proteins catalysed by dPRMT5 is required for Ago3 and Aub stability. Nat. Cell Biol. 11, 652–658 (2009).

5. Calin, G.A. & Croce, C.M. MicroRNA signatures in human cancers. Nat. Rev. Cancer 6, 857–866 (2006).

6. Nicoloso, M.S. & Calin, G.A. MicroRNA involvement in brain tumors: from bench to bedside. Brain Pathol. 18, 122–129 (2008).

7. Nelson, P.T., Wang, W.X. & Rajeev, B.W. MicroRNAs (miRNAs) in neurodegenerative diseases. Brain Pathol. 18, 130–138 (2008).

p

uor

G g

n ih si l

bu

P eru ta

N 010 2©

nat

ure

pro

toco

ls/

moc. e r

ut an .

ww

w / /:pt t

h

protocol

nature protocols | VOL.5 NO.6 | 2010 | 1073

8. Pardue, M.L. & Gall, J.G. Molecular hybridization of radioactive DNA to the DNA of cytological preparations. Proc. Natl. Acad. Sci. USA 64, 600–604 (1969).

9. Baldino, F. Jr, Chesselet, M.F. & Lewis, M.E. High-resolution in situ hybridization histochemistry. Methods Enzymol. 168, 761–777 (1989).

10. Zaidi, A.U., Enomoto, H., Milbrandt, J. & Roth, K.A. Dual fluorescent in situ hybridization and immunohistochemical detection with tyramide signal amplification. J. Histochem. Cytochem. 48, 1369–1375 (2000).

11. Singer, R.H. & Ward, D.C. Actin gene expression visualized in chicken muscle tissue culture by using in situ hybridization with a biotinated nucleotide analog. Proc. Natl. Acad. Sci. USA 79, 7331–7335 (1982).

12. Farquharson, M., Harvie, R. & McNicol, A.M. Detection of messenger RNA using a digoxigenin end labelled oligodeoxynucleotide probe. J. Clin. Pathol. 43, 424–428 (1990).

13. Morris, R.G. et al. Sensitivity of digoxigenin and biotin labelled probes for detection of human papillomavirus by in situ hybridisation. J. Clin. Pathol. 43, 800–805 (1990).

14. van Gijlswijk, R.P. et al. Horseradish peroxidase-labeled oligonucleotides and fluorescent tyramides for rapid detection of chromosome-specific repeat sequences. Cytogenet. Cell Genet. 75, 258–262 (1996).

15. Macechko, P.T., Krueger, L., Hirsch, B. & Erlandsen, S.L. Comparison of immunologic amplification vs enzymatic deposition of fluorochrome-conjugated tyramide as detection systems for FISH. J. Histochem. Cytochem. 45, 359–363 (1997).

16. Speel, E.J., Saremaslani, P., Roth, J., Hopman, A.H. & Komminoth, P. Improved mRNA in situ hybridization on formaldehyde-fixed and paraffin-embedded tissue using signal amplification with different haptenized tyramides. Histochem. Cell Biol. 110, 571–577 (1998).

17. Yang, H., Wanner, I.B., Roper, S.D. & Chaudhari, N. An optimized method for in situ hybridization with signal amplification that allows the detection of rare mRNAs. J. Histochem. Cytochem. 47, 431–446 (1999).

18. Vester, B. & Wengel, J. LNA (locked nucleic acid): high-affinity targeting of complementary RNA and DNA. Biochemistry 43, 13233–13241 (2004).

19. Wienholds, E. et al. MicroRNA expression in zebrafish embryonic development. Science 309, 310–311 (2005).

20. Nelson, P.T. et al. RAKE and LNA-ISH reveal microRNA expression and localization in archival human brain. RNA 12, 187–191 (2006).

21. Silahtaroglu, A.N. et al. Detection of microRNAs in frozen tissue sections by fluorescence in situ hybridization using locked nucleic acid probes and tyramide signal amplification. Nat. Protoc. 2, 2520–2528 (2007).

22. Obernosterer, G., Martinez, J. & Alenius, M. Locked nucleic acid-based in situ detection of microRNAs in mouse tissue sections. Nat. Protoc. 2, 1508–1514 (2007).

23. Solovei, I. et al. Spatial preservation of nuclear chromatin architecture during three-dimensional fluorescence in situ hybridization (3D-FISH). Exp. Cell Res. 276, 10–23 (2002).

24. Kimura, T. et al. Quantification of in situ hybridization signals in rat testes. J. Histochem. Cytochem. 52, 813–820 (2004).