Periodontitis is associated with platelet activation

Downloaded from UvA-DARE, the Institutional Repository of the University of Amsterdam (UvA)http://dare.uva.nl/document/119416

Description ThesisFile ID 119416Filename thesis.pdf

SOURCE, OR PART OF THE FOLLOWING SOURCE:Type DissertationTitle Reactivity of neutrophils, monocytes and platelets in periodontitisAuthor E.A. NicuFaculty Faculty of DentistryYear 2008Pages 151

FULL BIBLIOGRAPHIC DETAILS: http://dare.uva.nl/record/288434

Copyrights It is not permitted to download or to forward/distribute the text or part of it without the consent of the copyright holder(usually the author), other then for strictly personal, individual use. UvA-DARE is a service provided by the Library of the University of Amsterdam (http://dare.uva.nl)

http://dare.uva.nl/document/119416

http://dare.uva.nl/record/288434

http://dare.uva.nl

Reactivity of neutrophils, monocytes and platelets in periodontitis Elena A. Nicu

Reactivity of neutrophils, monocytes

and platelets in periodontitis

Printing of this thesis was financially supported by:

The Netherlands Institute for Dental Sciences (IOT)

University of Amsterdam

Stichting NVvP

Copyright © 2008, Elena Alina Nicu

Reactivity of neutrophils, monocytes and platelets in periodontitis

ISBN 978-90-9023659-9

Printed by PrintPartners Ipskamp BV, Enschede.

Reactivity of neutrophils, monocytes

and platelets in periodontitis

ACADEMISCH PROEFSCHRIFT

ter verkrijging van de graad van doctor aan de Universiteit van Amsterdam

op gezag van de Rector Magnificus Prof. dr. D.C. van den Boom ten overstaan van een door het college voor promoties ingestelde commissie,

in het openbaar te verdedigen in de Agnietenkapel op donderdag 11 december 2008, te 10:00 uur

door

Elena Alina Nicu

Geboren te Rîmnicu-Vîlcea, Roemenië

Promotiecommissie

Promotores: Prof. dr. B.G. Loos

Prof. dr. U. van der Velden

Co-promotor: Prof. dr. V. Everts

Overige leden: Prof. dr. H.R. Büller

Prof. dr. W. Crielaard

Prof. dr. M.M. Levi

Prof. dr. A. Sturk

Prof. dr. J.G.J. van de Winkel

Faculteit der Tandheelkunde

The research presented in this thesis was performed at the Department of Periodontology of the Academic

Centre for Dentistry Amsterdam (ACTA).

Contents

Chapter 1 General introduction 7

Chapter 2 Hyper-reactive PMNs in FcγRIIa 131H/H genotype periodontitis patients

23

Chapter 3 Expression of FcγRs and mCD14 on polymorphonuclear neutrophils and monocytes may determine periodontal infection

45

Chapter 4 Soluble CD14 as a possible molecular link between atherosclerosis and chronic infectious diseases: periodontitis as model

69

Chapter 5 Periodontitis is associated with platelet activation

87

Chapter 6 Elevated platelet and leukocyte response to oral bacteria in periodontitis

105

Chapter 7 Summary and discussion

123

Samenvatting

135

Acknowledgements

147

List of publications 151

Chapter 1

General Introduction

7

Introduction

Introduction

The periodontium is the tooth-supporting organ. It comprises the periodontal ligament, the

alveolar bone, the radicular cementum and the gingiva. The periodontal ligament is the

soft connective tissue interposed between the root of each tooth and the inner wall of the

alveolar socket. At the soft-hard tissue borders of the periodontal ligament, the principal

periodontal ligament fibers are embedded in alveolar bone on one side and radicular

cementum on the other side. Covering and protecting these structures, the gingiva forms

the fourth component of the periodontium.

The periodontium can become inflamed; the mildest and most frequent

inflammatory condition of the periodontium is gingivitis. Gingivitis is highly prevalent

and readily reversible by effective oral hygiene. Gingivitis affects 50-90% of adults

worldwide, depending on its precise definition (1). Inflammation that extends deep into

the tissues and causes loss of supportive connective tissue and alveolar bone is known as

periodontitis. Periodontitis results in the formation of periodontal pockets; these are

deepened crevices between gingiva and tooth roots eventually leading to tooth loss. After

the age of fifty, virtually all individuals may present with some mild periodontal

destruction, one or two pockets deeper than 4 mm, or small gingival recessions. But the

severe forms of periodontitis will only occur in approximately 10% of the adult population

(2). Treatment of periodontitis includes mechanical removal of subgingival bacterial

plaque with scalers, curettes or ultra-sonic devices and intensive oral hygiene instructions

for the patient. A close to ideal oral hygiene is the only way to prevent formation of new

dental plaque deposits and re-infection of the subgingival tissues.

Fig. 1.1 Periodontitis is a multifactorial disease.

8

Chapter 1

Periodontitis is a multifactorial disease. In the light of current knowledge, genetic factors

represent the basis of susceptibility for periodontitis, and environment and lifestyle are

major modifying factors (Fig. 1.1). Dental plaque is the major environmental factor. As

dental plaque matures to a state that is associated with periodontitis, the number of Gram-

negative and anaerobe micro-organisms increases. Certain bacterial species have been

often associated with disease, and intensively studied, including Aggregatibacter

actinomycetemcomitans and Porphyromonas gingivalis (3). Several hundred different

bacterial species colonize the subgingival tissues, covering the root surfaces and the

epithelial lining of the pocket with a complex biofilm. A biofilm is a structured

community of micro-organisms encapsulated within a self-developed polymeric matrix

and adherent to a living or inert surface. Evidence is accumulating that the aggregated

organisms in biofilms are not merely passive neighbors, but rather are involved in a wide

range of physical, metabolic and molecular interactions (4). Dental biofilm pathogenicity

in the oral cavity is magnified by two biofilm characteristics: increased antibiotic

resistance and the inability of the community to be phagocytosed by host inflammatory

cells.

Smoking and emotional stress are lifestyle-associated factors that have been often

incriminated as major disease-modifiers. Smokers are much more likely to develop

periodontitis than non-smokers and smoking has a strong negative effect on the response

to periodontal treatment and other oral surgical interventions (1). Traumatic life events

that lead to depression or individual inability to cope with stress could increase the

person’s risk for periodontitis, most likely due to adverse immune responses (5).

The periodontal immune response has been compared to a double-edged sword, on

the one hand fighting microorganisms with which it comes into contact and, on the other

hand, mediating injury to the host. Maintaining a balance between these two conflicting

properties and the preservation of health is assured by proper immunoregulation.

Therefore, knowledge of the immune response to periodontal pathogens is ultimately

relevant for understanding pathogenesis of periodontitis.

The immune response in periodontitis

The local defense against pathogens from dental plaque is based on the integrity and

activity of the epithelial lining, secretion of gingival crevicular fluid and saliva, and local

inflammatory reactions. Subgingival accumulation of oral bacteria triggers inflammation

in the periodontium. Inflammation is the response of the host to infection or other insults

9

Introduction

and comprises a series of vascular reactions at the site of injury. The results of these

vascular reactions are exudation of fluid and plasma proteins and recruitment of

leukocytes to the site of injury. The goal of inflammation is confining the injury and

initiating the immune response, through which the infection is eliminated and the injury

repaired (6).

Professional phagocytes, comprising polymorphonuclear neutrophilic leukocytes

(PMNs) and monocyte/macrophage cells, play an important role in the host defense

against bacterial infections, and, as such, play an important role in periodontal disease.

The functional responses of the phagocytes to bacterial infections include chemotaxis,

migration, phagocytosis, degranulation and reactive oxygen species generation.

PMNs form the first line of defense, are the most abundant leukocytes in peripheral

blood (50-65%) and are characterized by a segmented nucleus and a rich granular

cytoplasm. The PMN granules contain large amounts of anti-microbial substances and

enzymes. The primary (or azurophilic) granules contain myeloperoxidase (MPO), serine

proteases (elastase, cathepsine G, and others), defensins and lysozyme. The secondary (or

specific) granules contain collagenase, lysozyme, vitamin B-binding protein and lactoferin

(7).

PMNs have the ability of sensing and moving towards chemical signals,

chemotaxins, generated at infectious sites. Among the chemotaxins recognized by PMNs

are N-formyl-methionyl peptides from bacteria, C5a from complement and IL-8 from

epithelial and other cells (8). Activated PMNs adhere to the vessel wall via selectins and

integrins, leave the blood circulation, and migrate to the site of infection with the ultimate

goal to phagocytose and kill pathogens. The bacterial killing by PMN takes place in a

membrane-confined vacuole, the phagolysosome, formed after fusion of PMN granules

with the bacterium-containing phagosome. The bacterial killing and digestion are

accomplished via oxygen-dependent and oxygen-independent pathways. In the oxygen-

dependent the NADPH-oxidase system (residing in the cytosol) is activated and generates

toxic oxygen species; in the oxygen-independent pathway, proteolytic enzymes stored in

the granules are activated and released within the phagolysosome. In periodontitis, a

hyper-production of proteolytic enzymes (9,10) and reactive oxygen species (11) has been

documented and these may play a role in the host-derived destruction of periodontal

tissues.

In inflammation, PMNs arrive at the site of injury first followed by monocytes (6).

Tissue macrophages differentiate from peripheral-blood monocytes. The monocytes, and

10

Chapter 1

their progeny, the macrophages and the dendritic cells are important players in the

pathogenesis of periodontitis. Various bacterial species in dental plaque are gram-negative

and their LPS interacts with CD14 and Toll-like receptors inducing the production of

cytokines and other mediators by macrophages or dendritic cells. A key cytokine in the

monocyte-associated periodontal destruction is interleukin-1 (IL-1), which is capable of

stimulating the collagenolytic and bone-destructive processes (12).

Not only PMNs and monocytes/macrophages can interact with bacteria, platelets

also have the ability to respond to infection. Activated platelets release anti-microbial

peptides and chemokines such as platelet factor 4, RANTES (13), and expose pro-

inflammatory receptors, facilitating their binding to leukocytes and endothelial cells (14).

Due to this interaction, leukocytes and endothelial cells increase the expression of

adhesion molecules and various cytokines (15,16). Bacteria-platelet interactions are made

possible either directly through a bacterial surface protein or indirectly by a bridging

molecule from plasma that links bacteria with platelet surface receptors. Gingipains, a

family of cysteine proteases produced by the periodontal pathogen P. gingivalis, can

directly activate platelets. Streptococcus sanguis was found to require immunoglobulin G

(IgG) interacting with an IgG receptor (FcγRIIa) to mediate platelet activation (17).

Recognition of bacteria by phagocytes: the receptors

In general, phagocytes lack the ability to recognize bacteria, and instead, depend on

opsonization. Opsonization is the process of coating of bacteria with plasma proteins in

order to signal and facilitate phagocytosis. There are three identified mechanisms: I) the

recognition of complement C3b by CR3 and CR4 (complement receptor 3 and 4); II) the

recognition of antibodies by Fc receptors; and III) the recognition of lipopolysaccharide-

binding protein by CD14 (18).

The PMN and monocyte complement receptors - CR3 (Mac-1; CD11b/CD18) and

CR4 (p150,95; CD11c/CD18) recognize and bind particles that have been coated by the

complement-derived opsonin, C3b.

Phagocytes bind and recognize targets also via antibodies (immunoglobulins).

Immunoglobulin G (IgG) is the predominant serum isotype during bacterial infections.

IgG1 and IgG3 are produced in response to proteinaceous antigens (such as P. gingivalis

hemagglutinin) and viruses; IgG2 is formed in response to the bacterial polysaccharides

and outer membrane proteins of gram-negative periodontal pathogens (19). IgG molecules

11

Introduction

contain two regions: one region (the Fab-domain) recognizes the pathogen, whereas the

other region (the Fc-domain) activates the immune system. Depending on their expression

on effector cells, FcγR exert different effects. Based on their affinity for monomeric IgG,

three types of FcγR on phagocytes have been identified: FcγRI, FcγRII, and FcγRIII (20).

FcγRI (CD64) is constitutionally highly expressed by monocytes and

macrophages. Under resting condition, PMNs do not express FcγRI (21). Expression of

FcγRI on PMNs can be induced by stimulation with interferon-γ (IFN-γ) or granulocyte

colony-stimulating factor (G-CSF) (22,23,24). FcγRII (CD32) is the most widely

distributed FcγR, expressed on PMNs, platelets, eosinophils, basophils, lymphocytes and

monocytes. There are several isoforms of FcγRII, with highly similar extracellular and

transmembrane domains, but with different intracellular signaling motifs (25,26). FcγRIIa

and FcγRIIc contain an immunoreceptor tyrosine-based activation motif (ITAM), thus

they function as activating receptors. FcγRIIb, on the other hand, contains an

immunoreceptor tyrosine-based inhibitory motif (ITIM), thus it is an inhibitory receptor

(27,28). PMNs and monocytes express both FcγRIIa and FcγRIIb (29,21). The balance

between activating and inhibitory FcγRII can shift in inflammatory states. IFN-γ induces

upregulation of FcγRIIa and concomitant downregulation of FcγRIIb, whereas interleukin-

4 (IL-4) can have the opposite effect (29). Two genes, FCG3A and FCG3B encode for

FcγRIII. FcγRIIIa is expressed by monocytes and NK cells (30,31,32), whereas FcγRIIIb

is solely expressed by PMNs and eosinophils (33).

Genetic polymorphisms with consequences for the receptor affinities for IgG-

subclasses have been identified in FCG2A, FCG3A and FCG3B (34,35,36,21). At

aminoacid position 131, FcγRIIa expresses either an arginine (R) or a histidine (H). The

genetic variation in the FcγRIIa has functional consequences: the FcγRIIa-H131 variant

binds human IgG2, whereas FcγRIIa-R131 does not (35). It has been speculated that this

polymorphism may have important consequences for the pathogenesis of periodontitis

(37). The polymorphism in FcγRIIIa yields either a valine (V) or a phenylalanine (F) at

aminoacid position 158. This substitution results in an increased affinity for IgG1 and

IgG3 of the FcγRIIIa-V158 variant (36,34). In the case of FcγRIIIb, the polymorphism

involves 4 aminoacids, combined in the NA1 and NA2 variants (38). FcγRIIIb-NA1 binds

IgG1 and IgG3 more efficiently than FcγRIIIb-NA2 (21).

Plasma-derived lipopolysaccharide-binding protein (LBP) and septin can directly

opsonize Gram-negative bacteria by interaction with the lipopolysaccharide (LPS) that

12

Chapter 1

forms part of the Gram-negative bacterial outer membrane (18). CD14 is an LPS co-

receptor and is mainly expressed on mature monocytes, macrophages and activated PMNs

(39). Soluble CD14 (sCD14) can be released from blood monocytes or produced in the

liver. Acting as a soluble LPS-receptor, sCD14 helps inducing responses in cells that

naturally lack CD14, such as endothelial cells (40). Another role is the neutralization and

clearance of LPS in Gram-negative infectious states (endotoxemic states). Acting as a

decoy receptor for serum LPS, sCD14 prevents extreme pro-inflammatory responses from

monocytes/macrophages (41).

Periodontitis in relation to atherosclerosis and cardiovascular diseases

Periodontitis shares its multifactorial character with other frequent diseases of the modern

world, such as diabetes and cardiovascular diseases. Furthermore, it has been postulated

that periodontitis and cardiovascular diseases have more in common than unfavorable

lifestyle (such as smoking and stress), as epidemiologic studies identified periodontitis as

a risk factor for future cardiovascular events such as stroke and myocardial infarction. In a

meta-analysis cumulating the results from several studies investigating the relationship

between periodontitis and coronary artery disease, presence of periodontitis associated

with an increase of 19% in the risk for myocardial infarction (Fig. 1.2), compared to

subjects without periodontitis (42); the risk increase was larger (44%) when only subjects

<65 years old were considered. However, the underlying mechanisms of the link between

periodontitis and cardiovascular diseases are still unclear.

Atherosclerosis, which lies at the base of myocardial infarction and stroke, is now

Fig. 1.2 Meta-analysis of nine studies on the impact of periodontitis for risk of future cardiovascular events (adopted from Janket et al., 2003).

13

Introduction

also considered as an inflammatory disease (43). The atherosclerotic process is initiated

when cholesterol-containing low-density lipoproteins accumulate in the intima and

activate the endothelium. Leukocyte adhesion molecules and chemokines promote

recruitment of monocytes and T cells. Monocytes differentiate into macrophages that

accumulate intracellular lipoprotein, which leads to foam-cell formation. Intensified

inflammatory activation may lead to local proteolysis, plaque rupture, and thrombus

formation, which causes ischemia and infarction. Chronic infections with Chlamydia

pneumoniae, Helicobacter pylori, cytomegalovirus (CMV) have been implicated in

atherosclerosis by stimulating disease progression and possibly plaque activation (43).

This activation could be due either to direct action in plaques or to remote signaling via

inflammatory mediators. Similar mechanisms of action are conceivable in periodontitis,

where chronic subgingival infection with periodontal pathogens is accompanied by

transient, low-grade bacteremias during dental procedures or daily activities like tooth

brushing or chewing (44,45). Moreover, a systemic inflammatory reaction is documented

in periodontitis, with increased production of IL-1β, IL-6, C-reactive protein and tumor-

necrosis factor (TNF)-α (46,47). There is evidence of the presence of periodontal

pathogens in atherosclerotic plaques (48). Therefore, direct or indirect priming of PMNs,

monocytes and platelets by periodontal pathogens, leading to increased inflammation at

sites of atherosclerotic activity, might be an important mechanism underlying the

increased risk for CVD in periodontitis patients.

General aim and outline of this thesis

The general scope of this thesis was to characterize the reactivity of PMNs, monocytes

and platelets against periodontal pathogens. The added knowledge will increase our

understanding of some patho-physiological processes in periodontitis, and may explain

inter-individual variation in clinical responses to pathogens. Moreover, this interaction is

important to dissect possible pathways of the association between periodontitis and

cardiovascular diseases, as endotoxemia, systemic exposure to periodontal pathogens and

the induced systemic inflammation seem to be important (49,50).

There is a need to incorporate host genetic diversity in functional studies in the

pathogenesis of periodontitis. One aspect of the host-derived breakdown of periodontal

tissues seems related to a hyper-reactive trait of PMNs (51,11). The nature of this hyper-

reactivity might be genetically-determined or derived from increased expression levels of

14

Chapter 1

phagocytic receptors (e.g FcγR, complement receptor, CD14) in response to the pathologic

processes accompanying periodontitis. The hypothesis that there are inter individual

differences in phagocyte reactivity due to variations in phagocytic receptors led to three

research questions.

1. Does the PMN activation via FcγRIIa among periodontitis patients with different

FcγRIIa genotypes (R/R and H/H) after stimulation with IgG-opsonized A.

actinomycetemcomitans differ? (Chapter 2)

2. Is the PMN and monocyte reactivity in periodontitis attributable to modified

expression of FcγRI, FcγRIIa, FcγRIII, CR3 or CD14? (Chapter 3)

3. Is periodontitis leading to increased sCD14 levels? (Chapter 4)

Furthermore, we hypothesized that in response to transient bacteremic episodes of

periodontal origin, PMNs, monocytes and platelets are primed in periodontitis patients.

This priming would than be a part of the pathogenic processes linking periodontitis and

cardiovascular disease. We analyzed the cellular response of PMNs, monocytes and

platelets to the periodontal pathogens A. actinomycetemcomitans, P. gingivalis and T.

forsythia. This interest materialized in two research questions.

4. Are circulating platelets from patients with periodontitis more activated than

control platelets? (Chapter 5)

5. Do platelets, PMNs and monocytes from patients with periodontitis respond in a

hyper-reactive fashion to periodontal pathogens compared to cells from

periodontally healthy controls? (Chapter 6)

Finally, Chapter 7 summarizes and interprets the main findings of the studies in the

context of the research questions, and suggests new directions for future research.

The chapters 2-6 of this thesis have been published as individual studies, thus some

repetition, especially in the introductory sections, is inherent.

15

Introduction

REFERENCES

1 Pihlstrom BL, Michalowicz BS, Johnson NW. 2005. Periodontal diseases. Lancet

366:1809-1820.

2 Brown LJ, Oliver RC, Loe H. 1990. Evaluating periodontal status of US employed

adults. J Am Dent Assoc 121:226-232.

3 van Winkelhoff AJ, Loos BG, van der Reijden WA, van der Velden U. 2002.

Porphyromonas gingivalis, Bacteroides forsythus and other putative periodontal

pathogens in subjects with and without periodontal destruction. J Clin Periodontol

29:1023-1028.

4 Thomas JG and Nakaishi LA. 2006. Managing the complexity of a dynamic biofilm.

J Am Dent Assoc 137:10S-115.

5 Genco RJ, Ho AW, Grossi SG, Dunford RG, Tedesco LA. 1999. Relationship of

stress, distress and inadequate coping behaviors to periodontal disease. J Periodontol

70:711-723.

6 Majno G. 1982. Inflammation and infection: historic highlights. Monogr Pathol1-17.

7 Kuijpers TW, Tool AT, van der Schoot CE, Ginsel LA, Onderwater JJ, Roos D,

Verhoeven AJ. 1991. Membrane surface antigen expression on neutrophils: a

reappraisal of the use of surface markers for neutrophil activation. Blood 78:1105-

1111.

8 Zadeh HH, Nichols FC, Miyasaki KT. 1999. The role of the cell-mediated immune

response to Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis in

periodontitis. Periodontology 2000 20:239-288.

9 Figueredo CM, Gustafsson A, Asman B, Bergstrom K. 1999. Increased release of

elastase from in vitro activated peripheral neutrophils in patients with adult

periodontitis. J Clin Periodontol 26:206-211.

16

Chapter 1

10 Gustafsson A and Asman B. 1996. Increased release of free oxygen radicals from

peripheral neutrophils in adult periodontitis after Fc delta-receptor stimulation. J Clin

Periodontol 23:38-44.

11 Matthews JB, Wright HJ, Roberts A, Cooper PR, Chapple IL. 2007. Hyperactivity

and reactivity of peripheral blood neutrophils in chronic periodontitis. Clin Exp

Immunol 147:255-264.

12 Tatakis DN. 1993. Interleukin-1 and bone metabolism: a review. J Periodontol

64:416-431.

13 Fitzgerald JR, Foster TJ, Cox D. 2006. The interaction of bacterial pathogens with

platelets. Nat Rev Microbiol 4:445-457.

14 Klinger MH and Jelkmann W. 2002. Role of blood platelets in infection and

inflammation. J Interferon Cytokine Res 22:913-922.

15 Celi A, Pellegrini G, Lorenzet R, De Blasi A, Ready N, Furie BC, Furie B. 1994.

P-selectin induces the expression of tissue factor on monocytes. PNAS 91:8767-8771.

16 Slupsky JR, Kalbas M, Willuweit A, Henn V, Kroczek RA, Muller-Berghaus G.

1998. Activated platelets induce tissue factor expression on human umbilical vein

endothelial cells by ligation of CD40. Thromb Haemost 80:1008-1014.

17 McNicol A, Zhu R, Pesun R, Pampolina C, Jackson EC, Bowden GH, Zelinski T.

2006. A role for immunoglobulin G in donor-specific Streptococcus sanguis-induced

platelet aggregation. Thromb Haemost 95:288-293.

18 Wright SD, Ramos RA, Patel M, Miller DS. 1992. Septin: a factor in plasma that

opsonizes lipopolysaccharide-bearing particles for recognition by CD14 on

phagocytes. J Exp Med 176:719-727.

19 Ebersole JL and Taubman MA. 1994. The protective nature of host responses in

periodontal diseases. Periodontol 2000 5:112-141.

20 Deo YM, Graziano RF, Repp R, Van de Winkel JG. 1997. Clinical significance of

IgG Fc receptors and Fc gamma R-directed immunotherapies. Immunol Today 18:127-

135.

17

Introduction

21 Huizinga TW, Kerst M, Nuyens JH, Vlug A, dem Borne AE, Roos D, Tetteroo

PA. 1989. Binding characteristics of dimeric IgG subclass complexes to human

neutrophils. J Immunol 142:2359-2364.

22 Repp R, Valerius T, Sendler A, Gramatzki M, Iro H, Kalden JR, Platzer E. 1991.

Neutrophils express the high affinity receptor for IgG (Fc gamma RI, CD64) after in

vivo application of recombinant human granulocyte colony-stimulating factor. Blood

78:885-889.

23 Guyre PM, Morganelli PM, Miller R. 1983. Recombinant immune interferon

increases immunoglobulin G Fc receptors on cultured human mononuclear

phagocytes. J Clin Invest 72:393-397.

24 Perussia B, Kobayashi M, Rossi ME, Anegon I, Trinchieri G. 1987. Immune

interferon enhances functional properties of human granulocytes: role of Fc receptors

and effect of lymphotoxin, tumor necrosis factor, and granulocyte-macrophage colony-

stimulating factor. J Immunol 138:765-774.

25 Brooks DG, Qiu WQ, Luster AD, Ravetch JV. 1989. Structure and expression of

human IgG FcRII(CD32). Functional heterogeneity is encoded by the alternatively

spliced products of multiple genes. J Exp Med 170:1369-1385.

26 Warmerdam PA, Van de Winkel JG, Gosselin EJ, Capel PJ. 1990. Molecular basis

for a polymorphism of human Fc gamma receptor II (CD32). J Exp Med 172:19-25.

27 van den Herik-Oudijk IE, Capel PJ, van der BT, van de Winkel JG. 1995.

Identification of signaling motifs within human Fc gamma RIIa and Fc gamma RIIb

isoforms. Blood 85:2202-2211.

28 van den Herik-Oudijk IE, Westerdaal NA, Henriquez NV, Capel PJ, van de

Winkel JG. 1994. Functional analysis of human Fc gamma RII (CD32) isoforms

expressed in B lymphocytes. J Immunol 152:574-585.

29 Pricop L, Redecha P, Teillaud J-L, Frey J, Fridman WH, Sautes-Fridman C,

Salmon JE. 2001. Differential Modulation of Stimulatory and Inhibitory

Fc{{gamma}} Receptors on Human Monocytes by Th1 and Th2 Cytokines. J

Immunol 166:531-537.

18

Chapter 1

30 Ravetch JV and Kinet JP. 1991. Fc receptors. Annu Rev Immunol 9:457-492.

31 Van de Winkel JG and Anderson CL. 1991. Biology of human immunoglobulin G

Fc receptors. J Leukoc Biol 49:511-524.

32 Hulett MD and Hogarth PM. 1994. Molecular basis of Fc receptor function. Adv

Immunol 57:1-127.

33 Huizinga TW, van der Schoot CE, Jost C, Klaassen R, Kleijer M, dem Borne AE,

Roos D, Tetteroo PA. 1988. The PI-linked receptor FcRIII is released on stimulation

of neutrophils. Nature 333:667-669.

34 De Haas M, Koene HR, Kleijer M, de Vries E, Simsek S, van Tol MJ, Roos D,

dem Borne AE. 1996. A triallelic Fc gamma receptor type IIIA polymorphism

influences the binding of human IgG by NK cell Fc gamma RIIIa. J Immunol

156:2948-2955.

35 Warmerdam PA, Van de Winkel JG, Vlug A, Westerdaal NA, Capel PJ. 1991. A

single amino acid in the second Ig-like domain of the human Fc gamma receptor II is

critical for human IgG2 binding. J Immunol 147:1338-1343.

36 Koene HR, Kleijer M, Algra J, Roos D, dem Borne AE, De Haas M. 1997. Fc

gammaRIIIa-158V/F polymorphism influences the binding of IgG by natural killer cell

Fc gammaRIIIa, independently of the Fc gammaRIIIa-48L/R/H phenotype. Blood

90:1109-1114.

37 Wilson ME and Bronson PM. 1997. Opsonization of Actinobacillus

actinomycetemcomitans by immunoglobulin G antibodies to the O polysaccharide of

lipopolysaccharide. Infect Immun 65:4690-5.

38 Huizinga TW, Kleijer M, Tetteroo PA, Roos D, von dem Borne AE. 1990. Biallelic

neutrophil Na-antigen system is associated with a polymorphism on the phospho-

inositol-linked Fc gamma receptor III (CD16). Blood 75:213-7.

39 Ziegler-Heitbrock HW and Ulevitch RJ. 1993. CD14: cell surface receptor and

differentiation marker. Immunol Today 14:121-125.

19

Introduction

40 Ulevitch RJ and Tobias PS. 1995. Receptor-dependent mechanisms of cell

stimulation by bacterial endotoxin. Annu Rev Immunol 13:437-457.

41 Maliszewski CR. 1991. CD14 and immune response to lipopolysaccharide. Science

252:1321-1322.

42 Janket SJ, Baird AE, Chuang SK, Jones JA. 2003. Meta-analysis of periodontal

disease and risk of coronary heart disease and stroke. Oral Surg Oral Med Oral Pathol

Oral Radiol Endod 95:559-569.

43 Hansson GK, Robertson AK, Soderberg-Naucler C. 2006. Inflammation and

atherosclerosis. Annu Rev Pathol 1:297-329.

44 Forner L, Larsen T, Kilian M, Holmstrup P. 2006. Incidence of bacteremia after

chewing, tooth brushing and scaling in individuals with periodontal inflammation. J

Clin Periodontol 33:401-407.

45 Geerts SO, Nys M, De MP, Charpentier J, Albert A, Legrand V, Rompen EH.

2002. Systemic release of endotoxins induced by gentle mastication: association with

periodontitis severity. J Periodontol 73:73-78.

46 Loos BG. 2005. Systemic markers of inflammation in periodontitis. J Periodontol

76:2106-2115.

47 Paraskevas S, Huizinga JD, Loos BG. 2008. A systematic review and meta-analyses

on C-reactive protein in relation to periodontitis. J Clin Periodontol 35:277-290.

48 Haraszthy VI, Zambon JJ, Trevisan M, Zeid M, Genco RJ. 2000. Identification of

periodontal pathogens in atheromatous plaques. J Periodontol 71:1554-1560.

49 Pussinen PJ, Alfthan G, Tuomilehto J, Asikainen S, Jousilahti P. 2004. High

serum antibody levels to Porphyromonas gingivalis predict myocardial infarction. Eur

J Cardiovasc Prev Rehabil 11:408-411.

50 Pussinen PJ, Tuomisto K, Jousilahti P, Havulinna AS, Sundvall J, Salomaa V.

2007. Endotoxemia, immune response to periodontal pathogens, and systemic

inflammation associate with incident cardiovascular disease events. Arterioscler

Thromb Vasc Biol 27:1433-1439.

20

Chapter 1

51 Fredriksson M, Gustafsson A, Asman B, Bergstrom K. 1998. Hyper-reactive

peripheral neutrophils in adult periodontitis: generation of chemiluminescence and

intracellular hydrogen peroxide after in vitro priming and FcgammaR-stimulation. J


21

Chapter 2

Hyper-reactive PMNs in FcγRIIa 131H/H genotype

periodontitis patients

E.A. Nicu1, U. van der Velden1, V. Everts2, A.J. Van Winkelhoff3, D. Roos4, B.G.

Loos1

Departments of 1 Periodontology , 2 Oral Cell Biology and 3 Oral Microbiology, Academic Centre for

Dentistry Amsterdam (ACTA), University of Amsterdam and VU University Amsterdam, The Netherlands

4 Department of Blood Cell Research, Sanquin Research and Landsteiner Laboratory, Academic Medical

Center (AMC), University of Amsterdam, The Netherlands

Journal of Clinical Periodontology 2007; 34:938-945

23

Hyper-reactive PMNs in FcγRIIa 131H/H genotype periodontitis patients

Abstract Receptors for the Fc part of IgG (FcγRIIa) on polymorphonuclear leukocytes (PMN)

mediate phagocytosis and cell activation. Previous results show that one of the genetic

variants of the FcγRIIa, the 131H/H, is associated with more periodontal breakdown than

the R/R. This may be due to a hyper-reactivity of the H/H-PMNs upon interaction with

bacteria. We aimed to study whether the FcγRIIa genotype modifies the PMN reactivity in

periodontitis patients. A cohort of 98 periodontitis patients was genotyped. From these, 10

H/H and 10 R/R consented to participate. PMNs were incubated with immune serum-

opsonized A. actinomycetemcomitans. Phagocytosis, degranulation (CD63 and CD66b

expression), respiratory burst and elastase release were assessed. Patients of the H/H

genotype showed more bone loss than the H/R or R/R (P=0.038). H/H-PMNs

phagocytosed more opsonized A. actinomycetemcomitans than did R/R-PMNs (P=0.019).

The H/H-PMNs expressed also more CD63 and CD66b than did the R/R-PMNs (P=0.004

and 0.002, respectively) and released more elastase (P=0.001). The genotyping results

confirm previous reports that more periodontal destruction occurs in the H/H genotype

than in H/R or R/R. The functional studies indicate a hyper-reactivity of the H/H- PMN in

response to bacteria that may be one of several pathways leading to more periodontal

breakdown.

24

Chapter 2

Introduction Periodontitis is a chronic infectious disease of the supportive tissues of the teeth

characterized by gradual loss of periodontal attachment and alveolar bone.

Periodontopathic bacteria such as Aggregatibacter actinomycetemcomitans and

Porphyromonas gingivalis have been implicated in the pathogenesis of the disease (1,2).

However, recent literature indicates a genetically determined hyperactivity of the host

response, which constitutes one aspect of the susceptibility to periodontitis (3). Disease

resistance seems to be characterized by a proper defense against periodontal pathogens

without concomitant damage to the host itself.

In the course of periodontal infection, the human polymorphonuclear neutrophilic

leukocyte (PMN) represents the first line of antibacterial defense. The PMNs have also

been implicated in periodontal tissue degradation by releasing proteases and reactive

oxygen species (4,5,6,7). The PMN constitutively expresses two types of Fcγ receptors:

FcγRIIa and FcγRIIIb. The FcγR recognize and bind the constant part of immunoglobulin

G. FcγRIIa mediates phagocytosis (8), killing of opsonized cellular targets via antibody-

dependent cellular cytotoxicity (9), and respiratory burst (10). Important to note is that

FcγRIIa contains a transmembrane domain, that facilitates signal transduction to the cell.

This is not the case for FcγRIIIb, which does not contain a cytoplasmic domain but is

anchored to the cell membrane via a glycosyl-phosphatidylinosytol (GPI)-anchor. The role

of FcγRIIIb in activation of PMNs has been debated. Some investigators have shown that

this receptor is indeed capable of inducing signal transduction, possibly with the help of

FcγRIIa (11), whereas others have suggested that FcγRIIIb does not contribute to effector

functions (12).

FcγRIIa occurs in two allotypic forms, designated FcγRIIa-H131 and FcγRIIa-

R131 due to the genetically determined presence of either a histidine or an arginine

residue at amino acid position 131 (13). The genotype prevalence strongly depends on

ethnicity and is a source of conflicting results. In the general population, the genotype

distribution is similar in African-Americans and Caucasians, and distinct from that of

Japanese or Chinese (14). Among Caucasians, the prevalence of FcγRIIa-131H/H

genotype has been reported to be higher in chronic or aggressive periodontitis than in

healthy subjects (15). On the other hand, Nibali et al. (2006) found no difference in the

genotype frequency between aggressive periodontitis patients and healthy controls when

considering either all subjects or only the Caucasians (16). Moreover, Caucasian

25


periodontitis patients with the H/H genotype have more periodontal breakdown than those

with the H/R or R/R genotype (17).

The genetic variation in the FcγRIIa has functional consequences: the FcγRIIa-

H131 genotype binds IgG2-opsonized particles more efficiently than FcγRIIa-R131

genotype (18). This phenomenon may have important consequences for the pathogenesis

of periodontitis, as has also been speculated by others (19). It is known that IgG2

dominates the humoral immune response against polysaccharide antigens that are

abundant on the cell wall of the gram-negative periodontal pathogens. For example, IgG2

is the main immunoglobulin subclass reactive with A. actinomycetemcomitans (20). It has

been hypothesized that the highly efficient binding of opsonized particles to FcγRIIa in the

H/H genotype may result in a hyper-reactive state of the PMN (15,17). The strongly

activated H/H PMN may release more of its granule contents, thus contributing to

collateral damage, i.e. loss of periodontal connective tissue, periodontal ligament and

alveolar bone in the defense process against periodontal pathogens. However, this

hypothesis has never been tested.

The purpose of the present study was to investigate whether the FcγRIIa H/H and

R/R genotypes have functional consequences for the reactivity of the PMN from

periodontitis patients. This might contribute to the periodontitis phenotype in patients. We

analyzed PMN activation in both H/H and R/R genotypes following incubation with

opsonized A. actinomycetemcomitans. We studied four PMN functional parameters:

phagocytosis, degranulation, respiratory burst, and elastase activity.

Materials and methods

Screening of periodontitis patients

98 periodontitis patients from a cohort within the Department of Periodontology,

Academic Center for Dentistry Amsterdam (21) were genotyped for this study. Genomic

DNA was extracted from blood by means of the Puregene DNA isolation kit (Gentra

Systems, Minneapolis, MN, USA). Five µL of the purified DNA solution (concentration

70 - 100 ng DNA / µL solution) was added to a PCR reaction with allele-specific primers

for FcγRIIa-H131 and FcγRIIa-R131 (22). Based on these PCR results, all FcγRIIa-

H/H131 and FcγRIIa-R/R131 patients were selected as two contrasting groups for the

PMN functional assays.

26

Chapter 2

Recruitment of patients Periodontitis patients n=98 Age 44.9 ± 8.4 Gender

Male 44 (44.9 %) Female 54 (55.1 %)

Ethnicity Non-caucasian 20 (20.4 %) Caucasian 78 (79.6 %)

Smoking Non-smoker 23 (23.4 %) Former smoker 27 (27.6 %) Current smoker 48 (49.0 %)

Number of teeth Total 26.0 ± 3.3 With bone loss

< 40 % bone loss 15.8 ± 6.6 40-60 % bone loss 6.9 ± 4.0 >60 % bone loss 3.2 ± 3.4

Genotype FcγRIIa* R/R 22 (22.4 %) H/R 48 (49.0 %) H/H 28 (28.5%)

From the genotyping results of the 98 patients, it appeared that 48 (49%) were

heterozygous H/R, 28 (29%) homozygous H/H, and 22 (22%) homozygous R/R (Table

2.1). All 28 H/H and all 22 R/R subjects were searched within the computer system of the

Dental Faculty and approached to participate, but only 10 in each group consented to

donate blood for PMN functional assays. All subjects were informed both verbally and in

writing about the purpose of the study. The Ethics Committee of the Academic Medical

Center of the University of Amsterdam approved the study. The 20 participants had

received active periodontal therapy and were in periodontal maintenance. They were free

from systemic diseases and had no clinical symptoms of bacterial, viral or parasitic

infections at the time of the study. None of the subjects had taken any form of medication

that could affect their immune status, such as anti-inflammatory agents, antibiotics or

immunosuppressants during the last 2 weeks prior to blood collection. For all participants,

Table 2.1 Summary of characteristics of the 98 patients screened for FcγRIIa polymorphism. Values are means ± standard deviations or numbers of subjects (with percentage in brackets) * Genotyping results for Caucasian patients only are 18 R/R (23.7%), 38 H/R (50%) and 20 H/H (26.3%).

27


smoking status and smoking history were recorded and subjects were classified as non-

smokers (never smokers or those who quit > 10 years ago), former smokers (those who

quit smoking in the last 10 years) and currents smokers. All patients showed on dental

radiographs periodontal bone loss of > 1/3 of the root length on ≥ 2 teeth.

Bacteria and immune serum

To obtain immune serum against A. actinomycetemcomitans, we selected 10 periodontitis

patients who were culture positive for A. actinomycetemcomitans; they were patients from

the departmental clinic who were in active periodontal treatment. The undiluted serum of

these patients was tested against A. actinomycetemcomitans serotype a strain HG 569,

serotype b strain HG 90, serotype c strain HG 683, serotype d strain 3381, and serotype e

strain HG 1650. Bacteria were grown for 18 hours in brain heart infusion broth

supplemented with 5 mg/L hemin and 1 mg/L menadione at 37°C in humidified 5% CO2.

Bacteria were harvested, washed twice in PBS, checked for purity and the concentration

was adjusted to approximately 5 * 108 CFU/mL. All bacterial preparations were sonicated

on ice for 2 min, at 5-sec intervals, amplitude 18, by means of a Soniprep-150 ultrasonic

disintegrator (MSE, London, UK). Immunodiffusion of whole serum was carried out in

1% agarose (Sigma Chemicals Co., St. Louis, MO, USA) in 50 mM Tris-HCl buffer, pH

7.6. Fifteen µL of undiluted serum and 15 µL of the sonic extract were allowed to

precipitate for 48 h at room temperature. A. actinomycetemcomitans serotype c was the

only one of the five serotypes tested that induced immunodiffusion bands with the serum

from the most of the 10 patients: 5 out of the 10 periodontitis patients sera tested were

positive against serotype c. Subsequently we pooled all available sera from these 5

patients (pooled whole serum [Serum]) and stored it at -20°C in 50-µL aliquots to be used

as an opsonization source throughout all experiments. For some experiments, the serum

was incubated at 56°C for 30 minutes to remove complement activity and the resulting

heat-inactivated serum (HIS) was used as a source of immunoglobulins.

Phagocytosis assay

Blood was collected from patients by venous puncture in the antecubital fossa with

minimal stasis, in sodium heparine-containing vacuum tubes (Vacutainer, BD, Alphen a/d

Rijn, the Netherlands). Heparinized blood was diluted 1:1 in PBS containing 10% (w/v)

sodium citrate, layered on Percoll (δ=1.078 g/mL) and centrifuged at 800 x g, at 20°C for

28

Chapter 2

20 min without brake. Supernatant was discarded and the pellet, containing erythrocytes

and PMNs, was washed with ice-cold NH4Cl buffer (155 mM NH4Cl, 10 mM KHCO3, 0.1

mM EDTA at pH 7.4) to lyse the erythrocytes. After a centrifugation step, PMNs were

washed in PBS, counted and the concentration was adjusted to 1 x 107cells/mL in HEPES

buffer (123 mM NaCl, 5 mM KCl, 1mM CaCl2, 1mM MgCl2, 25 mM HEPES, 10 mM

glucose, pH 7.4). Purity and viability was >95%, as determined by flow cytometry and

trypan blue exclusion, respectively.

A. actinomycetemcomitans serotype c (5x 108 CFU/mL) was used in the

phagocytosis assay and was labeled with fluorescein isothiocyanate (FITC 0.015 mg/mL,

Sigma) for 30 minutes at 37°C. After a wash step to remove unbound FITC, the bacteria

were resuspended in PBS and stored in 1 mL aliquots at -20°C until use. Opsonization of

unlabeled or FITC-labeled A. actinomycetemcomitans was performed with 3% (v/v) serum

or HIS for 30 min at 37°C. After opsonization, bacteria were washed and resuspended in

HEPES buffer.

PMNs and opsonized FITC-A. actinomycetemcomitans were mixed at a ratio of 1:

25 in Eppendorf vials containing 175 µL of HEPES buffer and were incubated in a

shaking water bath at 37°C. After 30 minutes, the samples were placed on ice to stop

phagocytosis. Samples were centrifuged at 500 x g for 5 minutes at 4°C and the

supernatants were collected and stored at -20°C for later use. Cells were fixed with 2%

paraformaldehyde in PBS and analyzed within one hour by flow cytometry. Trypan blue

0.064% (w/v) was used to quench fluorescence from adherent, non-ingested FITC-A.

actinomycetemcomitans The percentage (%) of phagocytic PMNs and the mean

fluorescent intensity (MFI) of the phagocytic PMNs were measured in the samples by

means of a FACScan flow cytometer (Becton-Dickinson, San Jose, CA) equipped with a

laser beam emitting at 488 nm. PMNs were gated according to their forward and side-

scatter properties and at least 10 000 cells per sample were counted using the CellQuest

software (Becton-Dickinson). The phagocytic index (PI) was calculated as previously

described (23). Briefly, the PI takes into account the percentage phagocytic PMNs and the

number of fluorescent bacteria per phagocytic PMN (PI = MFI of phagocytic PMNs * %

phagocytic PMNs). Phagocytosis of opsonized A. actinomycetemcomitans is plotted as the

PI of cells when challenged with opsonized A. actinomycetemcomitans minus background

(i.e. negative control, cells incubated with non-opsonized A. actinomycetemcomitans).

29


PMN degranulation assay

PMNs (1 x 107cells/mL) and serum-opsonized A. actinomycetemcomitans, HIS-opsonized

A. actinomycetemcomitans or non-opsonized A. actinomycetemcomitans (5 x 108

CFU/mL) were mixed at a ratio of 1: 25 for PMN and bacteria, respectively, and incubated

in a shaking water bath at 37°C. After 30 minutes, the reaction was stopped by placing the

samples on ice. Samples were washed and the PMNs were resuspended in HEPES buffer.

Fusion of primary (azurophilic) and secondary (specific) granules with the plasma

membrane was quantified by measuring the appearance of the granule markers CD63 and

CD66b, respectively, at the cell surface. The samples were incubated for 30 minutes on ice

with mouse anti-human phycoerythrin (PE)-conjugated CD63, mouse anti-human FITC-

conjugated CD66b, IgG1-PE isotype control and IgG1-FITC isotype control (Sanquin

Reagents, Amsterdam, The Netherlands) at a final concentration of 10 µg/mL. After

incubation, cells were washed twice with HEPES buffer, resuspended in 2% (v/v)

paraformaldehyde in PBS and analyzed by flow cytometry. Data are expressed as the

relative MFI, calculated as the MFI of cells when challenged with A.

actinomycetemcomitans (serum-, HIS-opsonized or non-opsonized) minus background

(i.e. negative control, cells incubated in HEPES buffer).

Respiratory burst assay

Hydrogen peroxide production by PMN was measured by the use of Amplex Red

hydrogen peroxide kit (Molecular Probes, Leiden, the Netherlands) according to the

manufacturer’s protocol. Briefly, the PMN concentration was adjusted to 1 * 106 cells/mL.

Cells were stimulated with serum-opsonized A. actinomycetemcomitans, HIS-opsonized A.

actinomycetemcomitans and non-opsonized A. actinomycetemcomitans in a PMN to A.

actinomycetemcomitans ratio of 1:100. Fifty µL of PMN suspension and 50 µL stimulus

were added to 100 µL of reaction buffer in 96-wells plate. The increase in absorbance at

590 nm was monitored for 90 minutes. The maximal increase in fluorescence was

calculated over a 30-min interval. Data are expressed as relative H2O2 release calculated as

the difference between the H2O2 release from PMN incubated in the presence of A.

actinomycetemcomitans and the H2O2 release from PMN incubated in HEPES buffer as a

negative control.

30

Chapter 2

Elastase activity assay

Elastase activity was measured by the hydrolysis of N-methoxysuccinyl-Ala-Ala-Pro-Val-

pNA (Sigma) as described (24), with minor modifications. Briefly, 75 µL from the

supernatants collected following phagocytosis assay (see section Phagocytosis assay) were

added to 25 µl of 0.1 M Tris-HCl buffer pH 7.2, containing 0.5 M NaCl, and 1 mM N-

methoxysuccinyl-Ala-Ala-Pro-Val-pNA. The absorbance was measured at 405 nm for 30

min after the addition of the substrate. Data are expressed as elastase activity calculated as

the difference between the elastase activity from PMN incubated in the presence of A.

actinomycetemcomitans and the elastase activity from PMN incubated in HEPES buffer as

a negative control.

Statistical analysis

Tabulation of data, box plot generation and data analysis were performed with the SPSS

12.0 package. Means, standard deviations, medians and frequency distributions were

calculated. In the patient screening part of the study, differences between the H/H, H/R,

and R/R genotype groups for the radiographic bone levels were analyzed in a general

linear model (ANCOVA), taking the genotype as fixed factor, and age and Caucasian race

as covariates. In the functional studies, differences between the FcγRIIa-H/H131 and

R/R131 patient groups were statistically analyzed with the Mann-Whitney U test or the

chi-square test, where appropriate. Differences between PMN functional parameters under

different conditions within the FcγRIIa-H/H131 and R/R131 patient groups were

statistically analyzed with the Friedman test for related samples; P-values <0.05 were

considered statistically significant.

The distribution of our data (phagocytosis, CD63, CD66b, respiratory burst,

elastase) was skewed and far from normal. This was the reason for using non-parametric

statistics (Mann-Whitney U tests) when comparing the H/H and R/R. In the cases where

we found statistically significant differences between H/H and R/R, we log-transformed

the experimental data to get a reasonable approximation to a normal distribution. We

performed an exploratory linear regression analysis of the PMN activation parameters

using the log-transformed data. We have used the values of phagocytosis, CD63, CD66b,

or elastase as dependent variable and FcγRIIa genotype, age, gender, race and smoking as

independent variables.

31


Results Screening of periodontitis patients. A description of characteristics of 98 patients

initially genotyped is provided in Table 2.1. The mean age of the screened patients was

44.9 years, and slightly more females participated in the study. The great majority was

Caucasian and almost half of the participants were current smokers. On average, 26.0 teeth

were present and 10.1 (39%) showed bone loss on ≥40% of the root length. The

genotyping showed that 22% of the patients were homozygous R/R, 49% heterozygous

H/R, and 29% homozygous H/H. When we tabulated for Caucasians only, we observed

that 24% were R/R, 50% H/R, and 26% H/H.

The scores of radiographic bone loss were analyzed by genotype. While the

number of teeth per genotype was not different, it was observed that patients with the H/H

genotype had more teeth with bone loss in the category 40-60% of the root length than

patients with H/R or R/R genotype, after adjusting for age and Caucasian race (P=0.038;

Table 2.2).

Study population for PMN functional assays. A description of the patient group used

for functional assays is provided in Table 2.3. The patients were on average 45 years old

and gender distribution was not significantly different between the R/R and H/H subjects.

Eighteen of the 20 patients were of Caucasian origin, 8 were current smokers, and 5 were

non-smokers, while 7 were former smokers. Smoking status was not different between the

H/H and R/R groups (P=0.129). There was a trend towards more bone loss in the H/H

patients than in the R/R patients (number of teeth with bone loss in the category 40-60%

of the root length: 8.2 ± 3.4 and 5.5 ± 4.0 for H/H and R/R groups respectively; P=0.08).

Genotypes R/R H/R H/H

n=22 n=48 n=28

Number of teeth present 25.8 ± 0.6 25.6 ± 0.4 26.9 ± 0.5

Number of teeth with bone loss

< 40 % bone loss 17.7 ± 1.3 15.2 ± 0.9 15.3 ± 1.2

40-60 % bone loss * 5.4 ± 0.8 6.6 ± 0.5 8.3 ± 0.7

> 60 % bone loss 2.6 ± 0.7 3.6 ± 0.5 3.1 ± 0.6

Table 2.2 Periodontal characteristics of the 98 patients screened for FcγRIIa polymorphism, according to genotype.

Table 2.2 Periodontal characteristics of the 98 patients screened for FcγRIIa polymorphism, according to genotype. Values are means ± standard deviation. * P=0.038

32

Chapter 2

R/R H/H n=10 n=10 Age 45 ± 11.4 44 ± 8.5 Gender

Male 5 4 Female 5 6

Ethnicity Non-caucasian 1 1 Caucasian 9 9

Smoking Non-smoker 4 1 Former smoker 4 3 Current smoker 2 6

Number of teeth Total 25.4 ± 3.6 27.4 ± 2.4 With bone loss

< 40 % bone loss 16.8 ± 7.7 16.0 ± 7.4 40-60 % bone loss 5.5 ± 4.0 8.2 ± 3.4 >60 % bone loss 3.0 ± 3.3 3.1 ± 3.2

Table 2.3 Summary of the characteristics of the group of patients used in the present study. Values are means ± standard deviations or numbers of subjects.

33


Phagocytosis. From the phagocytosis experiments, a phagocytic index (PI) taking into

account both percentage of phagocytic cells and number of fluorescent bacteria per

phagocytic cell (MFI of these cells) was calculated. For both H/H and R/R genotypes, the

PI was higher using serum than when using HIS for opsonization of A.

actinomycetemcomitans (Fig. 2.1; P=0.009 and P=0.005, respectively). The PI of A.

actinomycetemcomitans opsonized with serum in H/H and R/R genotypes was

comparable, whereas phagocytosis after Fcγ-receptor-mediated activation only (i.e. when

using HIS-opsonized A. actinomycetemcomitans) was significantly higher in the

FcγRIIa131H/H group than in the FcγRIIa131R/R group (P=0.019).

Degranulation.

Primary granules. Degranulation of primary PMN granules is a measure of PMN

activation and was analyzed by the expression of CD63 (Fig. 2.2A). In the H/H subjects,

the expression of CD63 was higher when A. actinomycetemcomitans was opsonized with

whole serum (MFI median 7.25), than when HIS was used for A. actinomycetemcomitans

opsonization (median 5.49), while non-opsonized A.a provoked only a minimal CD63

Fig. 2.1 Box plots showing phagocytic index for H/H and R/R PMNs with whole serum- or HIS-opsonized A. actinomycetemcomitans. AU, arbitrary units; Aa, A. actinomycetemcomitans; HIS, heat-inactivated serum. *P=0.019

34

Chapter 2

expression (median 0.7; P=0.0002). Among R/R patients this pattern was also seen, i.e.

MFI of CD63 with serum-opsonized A. actinomycetemcomitans (median 5.46) was higher

than with HIS-A. actinomycetemcomitans (median 2.05), while again non-opsonized A.

actinomycetemcomitans was essentially not inducing any CD63 upregulation (median

0.84; p<0.0001).

When comparing the CD63 expression between groups, H/H and R/R patients

released similar amounts of primary granules in response to serum-opsonized A.

actinomycetemcomitans (P=0.190). Interestingly, however, when HIS was used for

opsonization of bacteria, indicating the FcγR stimulation only, the PMNs from H/H

patients expressed significantly more CD63 than the PMNs from R/R patients (P=0.004;

Fig. 2.2A).

Secondary granules. Degranulation of secondary PMNs granules is also a measure

of PMN activation and was analyzed by the expression of CD66b; the results are

summarized in Fig. 2.2B. In the H/H subjects, the expression of CD66b was higher when

A. actinomycetemcomitans was opsonized with serum (median 57.01) than when HIS was

used for A. actinomycetemcomitans opsonization (median 37.42), while non-opsonized A.a

induced very limited CD66b expression (median 2.58; P=0.0001). The same pattern was

Fig. 2.2 Box plots showing markers of degranulation of primary granules (panel A, CD63) and secondary granules (panel B, CD66b) for H/H and R/R PMNs with whole serum- or HIS-opsonized or non-opsonized A. actinomycetemcomitans. MFI, mean fluorescence intensity; Aa, A. actinomycetemcomitans; HIS, heat-inactivated serum; *P=0.004; **P=0.002

35


seen in R/R patients, i.e., the MFI of CD66b in response to serum-opsonized A.

actinomycetemcomitans was higher (median 43.52) than in response to HIS-A.

actinomycetemcomitans (median 14.08), while non-opsonized A. actinomycetemcomitans

was not inducing CD66b expression (median 1.365; P<0.0001).

When comparing the two groups, H/H and R/R PMNs released similar amounts of

secondary granules in response to serum-opsonized A. actinomycetemcomitans (P=0.436).

However, when FcγRIIa were stimulated with HIS-opsonized A. actinomycetemcomitans,

the PMNs from H/H patients expressed significantly more CD66b than did the PMNs from

R/R patients (P=0.002).

Linear regression analysis considering genotype, age, gender, race and smoking as

independent factors indicated that genotype was the only parameter significantly

associated with CD66b expression after stimulation with HIS-A. actinomycetemcomitans

(t=-2.417, P=0.03; Table 2.4).

Genotype Age Gender Race Smoking (P-value) (P-value) (P-value) (P-value) (P-value) Phagocytosis-HIS 0.129 0.798 0.815 0.445 0.550 CD63-HIS 0.068 0.164 0.206 0.515 0.139 CD66b-HIS 0.03 0.119 0.383 0.473 0.186 Elastase-HIS <0.0001 0.531 0.897 0.308 0.315 Elastase-Serum <0.0001 0.442 0.897 0.264 0.06

Table 2.4 Linear regression analysis of phagocytosis, CD63, CD66b and elastase activity after simulation with HIS-A. actinomycetemcomitans or Serum-A. actinomycetemcomitans using genotype, age, gender, race and smoking as independent variables.

36

Chapter 2

Respiratory burst. Respiratory burst is a major anti-bacterial function of the PMN and it

was analyzed by measuring extracellular H2O2 release (Fig. 2.3). In both H/H and R/R

patients, serum-opsonized A. actinomycetemcomitans induced a more intense H2O2 release

(median 803.0 and median 701.5, respectively) than HIS-opsonized A.

actinomycetemcomitans (median 503.5 and median 387.5, respectively), which in turn was

higher than the response induced by non-opsonized A. actinomycetemcomitans (median

55.0 and median 64.0, respectively; P<0.0001).The release of H2O2 into the extracellular

medium of H/H PMNs was not different from that of R/R PMNs, irrespective of the

stimulus used (serum-opsonized A. actinomycetemcomitans P=0.739; HIS-opsonized A.

actinomycetemcomitans P=0.796; non-opsonized A. actinomycetemcomitans P=0.739).

Elastase activity. Elastase is one of the proteolytic enzymes present in the PMN primary

granules, released upon activation of the PMN and capable of degrading extracellular

matrix proteins of the connective tissue. The release of active elastase into culture

supernatants following interaction with A. actinomycetemcomitans is presented in Fig. 2.4.

PMNs from H/H subjects released high amounts of active elastase when stimulated with

serum- or HIS-opsonized A. actinomycetemcomitans (median elastase 0.310 units/mL and

0.239 U/mL, respectively). The non-opsonized A. actinomycetemcomitans induced very

low levels of elastase release in PMN supernatants from H/H patients (median 0.058

U/mL). In striking contrast to the H/H PMNs, the R/R PMNs showed low release of

Fig. 2.3 Box plots showing respiratory burst by H/H and R/R PMNs with whole serum- or HIS-opsonized A. actinomycetemcomitans or non-opsonized A. actinomycetemcomitans. AU, arbitrary units; Aa, A. actinomycetemcomitans; HIS, heat-inactivated serum.

37


elastase after incubation with serum-A. actinomycetemcomitans (median 0.075 U/mL),

HIS-A. actinomycetemcomitans (median 0.060 U/mL), or non-opsonized A.

actinomycetemcomitans (median 0.052 U/mL).

In comparison to the R/R group, H/H PMNs released significantly higher amounts

of active elastase in response to serum-A. actinomycetemcomitans and HIS-A.

actinomycetemcomitans (P<0.001 and P=0.001, respectively). Linear regression analysis

considering genotype, age, gender, race and smoking as independent factors indicated that

genotype was the only parameter significantly associated with elastase release after

stimulation with either HIS-A. actinomycetemcomitans or serum-A.

actinomycetemcomitans (P<0.0001; Table 2.4).

Discussion We have investigated the relationship between cellular functions of PMNs and the FcγRIIa

genotype in periodontally diseased individuals. A significantly higher degree of

phagocytosis, degranulation and elastase release from PMNs of 131H/H patients than of

Fig. 2.4 Box plots showing elastase activity released by H/H and R/R PMNs with whole serum- or HIS-opsonized A. actinomycetemcomitans or non-opsonized A. actinomycetemcomitans. U/mL, elastase units per mL supernatant; Aa, A. actinomycetemcomitans; HIS, heat-inactivated serum. ***P<0.001

38

Chapter 2

131R/R patients was demonstrated when HIS was used for opsonization of A.

actinomycetemcomitans.

The results presented in this study support the hypothesis that the FcγRIIa H/H

genotype may induce a hyper-reactive phenotype of the PMNs, which in response to

periodontal pathogens will release more bioactive molecules that could aggravate the

periodontal destruction. Our results are in line with the idea that the periodontal

breakdown in periodontitis is partly caused by hyper-reactive PMNs (25,5). However,

these latter studies suggested the constitutive nature of the PMN hyper-responsiveness

without shedding light on possible molecular mechanisms involved.

The higher activity of the PMNs of the H/H genotype that we have observed is

most likely the functional consequence of the strong binding of the IgG2 on the bacteria to

the FcγRIIa, because the FcγRIIa H/H is the only PMN receptor that efficiently recognizes

IgG2 (18). The HIS employed in this study contains immunoglobulins specific for the A.

actinomycetemcomitans serotype c strain HG 683 as confirmed in the immunodiffusion

assays. We did not further purify IgG2 from HIS, but it may be the main immunoglobulin

subclass reactive with A. actinomycetemcomitans, as it dominates the antibody response

against polysaccharide antigens that are abundant on the cell wall of the gram-negative

periodontal pathogens (20).

In the case of the more reactive genotype of the FcγRIIa, the H/H, our data

demonstrate a higher release of elastase, contributing to a more severe breakdown of the

extracellular matrix in the periodontal tissues.

Another mechanism proposed for the tissue breakdown induced by hyper-reactive

PMN is the release of oxygen reactive species (26). We observed no significant difference

in H2O2 production between the H/H and R/R PMNs, although degranulation was clearly

increased in the H/H genotype. This unexpected result could be due to a possible

difference in the release of other oxygen species than H2O2. For example, using FcγR-

stimulated PMNs and chemiluminiscence as a measure of all oxygen reactive species

produced, Fredriksson et al. (1998) showed a higher oxidative burst in periodontitis

patients than in controls (27). However, in the same study, there was no difference

between patients and controls when intracellular H2O2 was assessed (27). Therefore, a

future assessment of respiratory burst in H/H and R/R PMNs should take into

consideration the production of all reactive oxygen species rather than relying only on

H2O2 release.

39


A limitation of our study is the low number of participants. From the 98

periodontitis patients genotyped for FcγRIIa 131H/R polymorphism, all H/H (n=28) and

all R/R (n=22) patients were approached to participate in this study. However, only 10

H/H and 10 R/R subjects agreed to donate blood necessary for the PMN functional assays.

We decided to select the homozygous H/H and R/R as two contrasting groups to be

compared with respect to PMN functions. The reason for not including any heterozygous

H/R was first the difficulty in recruiting enough subjects and second, if there is a

difference between genotypes, it should be more clearly visible when using the

homozygous donors. Nevertheless, how PMNs from H/R subjects behave remains to be

elucidated. It was important to note that after performing FcγRIIa genotyping of the 98

periodontitis patients in this cohort, the H/H genotype was associated with more teeth

belonging to the category with bone loss in the 40-60% of the root length. These data

confirmed previous reports and support the view that the H/H genotype may be regarded

as a putative severity factor for periodontitis in Caucasians (15,17). This may be one

important aspect of the genetic make-up of the immune response.

The distribution of smokers and non-smokers was uneven in our R/R and H/H

groups. This drawback was due to the limited number of persons with the required

genotypes who agreed to participate and hence, unavoidable. However, literature reports

on the effect of smoking on the function of PMN are contradictory and do not support a

definitive answer on the matter. Ryder et al. (1998) and Sørensen et al. (2004) describe a

reduced response to stimulation in PMN from smokers when compared to non-smokers

(28,29). Gustafsson et al. (2000) found no difference between the PMN from smokers and

non-smokers after Fcγ-receptors stimulation with opsonized bacteria (30). The issue of the

possible influence of smoking status or other background characteristics on the measured

PMN parameters was a matter of concern for us, as well. We performed an exploratory

linear regression analysis using phagocytosis, CD63, CD66b, or elastase as dependent

variable, and FcγRIIa genotype, age, gender, race and smoking as independent variables.

For none of the parameters of interest, smoking was not significantly contributing to the

measured values nor did age, gender or race. The only parameter significantly associated

with the values of phagocytosis, CD63, CD66b, elastase was the FcγRIIa genotype.

The phagocytosis and degranulation were higher for both H/H and R/R groups

when whole serum-opsonized bacteria were used in comparison to HIS. This indicates that

complement factors in whole serum are important mediators of these processes, thus PMN

40

Chapter 2

reactivity is most likely also affected by complement receptor stimulation. Our data

confirm previous reports that cooperative Fc and C3 receptor interaction is required for

optimal PMN defense against A. actinomycetemcomitans (31).

In conclusion, in the current study we found that FcγRIIa polymorphism influences

the functions of PMNs in periodontitis patients. Individuals with an H/H genotype show a

hyper-reactive phenotype, with increased Fcγ-mediated phagocytosis, degranulation and

granular enzymes release, which may be one of the several factors contributing to the

severity of the periodontitis in these patients.

Acknowledgements The present study was supported by The Netherlands Institute for Dental Sciences. We

thank Nannette Brouwer and Anton Tool for expert assistance in setting up the

phagocytosis and degranulation assays.

REFERENCES

1 Slots J. 1999. Update on Actinobacillus Actinomycetemcomitans and Porphyromonas

gingivalis in human periodontal disease. J Int Acad Periodontol 1:121-126.




29:1023-1028.

3 Van Dyke TE and Sheilesh D. 2005. Risk factors for periodontitis. J Int Acad

Periodontol 7:3-7.

4 Van Dyke TE, Levine MJ, Genco RJ. 1985. Neutrophil function and oral disease. J

Oral Pathol 14:95-120.

5 Fredriksson MI, Gustafsson AK, Bergstrom KG, Asman BE. 2003.

Constitutionally hyperreactive neutrophils in periodontitis. J Periodontol 74:219-24.

6 Janoff A. 1985. Elastase in tissue injury. Annu Rev Med 36:207-216.

41

https://www.researchgate.net/publication/19242309_Neutrophil_function_and_oral_disease?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/19242309_Neutrophil_function_and_oral_disease?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/282089028_Risk_factors_for_periodontitis?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/282089028_Risk_factors_for_periodontitis?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/19273991_Elastase_in_Tissue_Injury?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=


7 Weiss SJ. 1989. Tissue destruction by neutrophils. N Engl J Med 320:365-376.

8 Anderson CL, Shen L, Eicher DM, Wewers MD, Gill JK. 1990. Phagocytosis

mediated by three distinct Fc gamma receptor classes on human leukocytes. J Exp Med

171:1333-1345.

9 Graziano RF and Fanger MW. 1987. Fc gamma RI and Fc gamma RII on

monocytes and granulocytes are cytotoxic trigger molecules for tumor cells. J

Immunol 139:3536-3541.

10 Anderson CL, Looney RJ, Culp DJ, Ryan DH, Fleit HB, Utell MJ, Frampton

MW, Manganiello PD, Guyre PM. 1990. Alveolar and peritoneal macrophages bear

three distinct classes of Fc receptors for IgG. J Immunol 145:196-201.

11 Chuang FY, Sassaroli M, Unkeless JC. 2000. Convergence of Fc gamma receptor

IIA and Fc gamma receptor IIIB signaling pathways in human neutrophils. J Immunol

164:350-360.

12 Scott-Zaki P, Purkall D, Ruddy S. 2000. Neutrophil chemotaxis and superoxide

production are induced by cross-linking FcgammaRII receptors. Cell Immunol 201:89-

93.

13 Warmerdam PA, Van de Winkel JG, Gosselin EJ, Capel PJ. 1990. Molecular basis

for a polymorphism of human Fc gamma receptor II (CD32). J Exp Med 172:19-25.

14 van der Pol WL and van de Winkel JGJ. 1998. IgG receptor polymorphisms: risk

factors for disease. Immunogenetics 48:222-232.

15 Yamamoto K, Kobayashi T, Grossi S, Ho AW, Genco RJ, Yoshie H, De Nardin E.

2004. Association of Fcgamma receptor IIa genotype with chronic periodontitis in

Caucasians. J Periodontol 75:517-522.

16 Nibali L, Parkar M, Brett P, Knight J, Tonetti MS, Griffiths GS. 2006. NADPH

oxidase (CYBA) and FcgammaR polymorphisms as risk factors for aggressive

periodontitis: A case-control association study. Journal of Clinical Periodontology

33:529-539.

42

Chapter 2

17 Loos BG, Leppers-Van de Straat FG, Van de Winkel JG, van der Velden U. 2003.

Fcgamma receptor polymorphisms in relation to periodontitis. J Clin Periodontol

30:595-602.

18 Warmerdam PA, Van de Winkel JG, Vlug A, Westerdaal NA, Capel PJ. 1991. A

single amino acid in the second Ig-like domain of the human Fc gamma receptor II is

critical for human IgG2 binding. J Immunol 147:1338-1343.

19 Wilson ME and Bronson PM. 1997. Opsonization of Actinobacillus

actinomycetemcomitans by immunoglobulin G antibodies to the O polysaccharide of


20 Wilson ME and Hamilton RG. 1992. Immunoglobulin G subclass response of

localized juvenile periodontitis patients to Actinobacillus actinomycetemcomitans Y4


21 Bizzarro S, van der Velden U, ten Heggeler JM, Leivadaros E, Hoek FJ, Gerdes

VE, Bakker SJ, Gans RO, ten Cate H, Loos BG. 2007. Periodontitis is characterized

by elevated PAI-1 activity. J Clin Periodontol 34:574-580

22 Flesch BK, Bauer F, Neppert J. 1998. Rapid typing of the human Fc gamma receptor

IIA polymorphism by polymerase chain reaction amplification with allele-specific

primers. Transfusion 38:174-176.

23 Hildemann S, Hammer C, Krombach F. 1992. Heterogeneity of alveolar

macrophages in experimental silicosis. Environ Health Perspect 97:53-57.

24 Claesson R, Johansson E, Carlsson J. 1994. Oxygen-dependent modulation of

release and activity of polymorphonuclear leukocyte granule products. Oral Microbiol

Immunol 9:81-87.




43


26 Chapple ILC, Brock G, Eftimiadi C, Matthews JB. 2002. Glutathione in gingival

crevicular fluid and its relation to local antioxidant capacity in periodontal health and

disease. Mol Pathol 55:367-373.





28 Ryder MI. 2007. The influence of smoking on host responses in periodontal

infections. Periodontology 2000 43:267-277.

29 Sorensen LT, Nielsen HB, Kharazmi A, Gottrup F. 2004. Effect of smoking and

abstention on oxidative burst and reactivity of neutrophils and monocytes. Surgery

136:1047-1053.

30 Gustafsson A, Asman B, Bergstrom K. 2000. Cigarette smoking as an aggravating

factor in inflammatory tissue-destructive diseases. Increase in tumor necrosis Factor-

alpha priming of peripheral neutrophils measured as generation of oxygen radicals. Int

J Clin Lab Res 30:187-190.

31 Wilson ME and Genco RJ. 1989. The role of antibody, complement and neutrophils

in host defense against Actinobacillus actinomycetemcomitans. Immunol Invest

18:187-209.

44

Chapter 3

Expression of FcγRs and mCD14 on polymorphonuclear

neutrophils and monocytes

may determine periodontal infection

E.A. Nicu1, U. van der Velden1, V. Everts2, B.G. Loos1

Departments of 1 Periodontology and 2 Oral Cell Biology, Academic Centre for Dentistry Amsterdam

(ACTA), University of Amsterdam and VU University Amsterdam, the Netherlands

Clinical and Experimental Immunology 2008; 154:177-186

45

Expression of FcγRs and mCD14 on polymorphonuclear neutrophils and monocytes may determine periodontal infection

Abstract Variance in expression of receptors for IgG (FcγRs), complement (CR3) and LPS

(mCD14) on polymorphonuclear neutrophils (PMNs) and monocytes might affect

susceptibility for infection with certain pathogens in periodontitis, a chronic infectious

disease of tooth-supportive tissues. Levels of FcγRI, IIa, III, CR3, and mCD14 on PMNs

and monocytes were measured in 19 periodontitis patients and 18 healthy controls.

Subgingival infection with A. actinomycetemcomitans (Aa) and P. gingivalis (Pg) was

determined. Activation of PMNs and monocytes in response to stimulation with A.

actinomycetemcomitans and P. gingivalis was assessed by means of change in mCD14

expression. Periodontitis is associated with an enrichment of the FcγRIII+ monocytes

(P=0.015) with concomitant low mCD14 (P=0.001). Unadjusted data showed that the

subjects culture-positive for A. actinomycetemcomitans (Aa+) had significantly lower

expression of monocytic FcγRI (P=0.005) and FcγRIIa (P=0.015) than Pg+ subjects. The

FcγRI was still lower on monocytes from Aa+ subjects after adjusting for the background

factors (P=0.037). PMNs from Aa+ subjects responded in a hyper-reactive manner, in

particular when stimulated with A. actinomycetemcomitans (P=0.011). Lower FcγRs

expression by monocytes is related to a higher susceptibility of a subject to become

infected with A. actinomycetemcomitans. The higher proportion of FcγRIII+ monocytes

may be involved in the chronicity of this condition. Hyper-reactive PMNs in Aa+ subjects

may contribute to accelerated breakdown of tooth-supportive tissues.

46

Chapter 3

Introduction

Periodontitis is a chronic infectious disease of the supportive tissues of the teeth

characterized by gradual loss of periodontal attachment and alveolar bone. Approximately

10% of the population suffers from the severe form and, if untreated, it may result in tooth

loss. The major pathogens associated with periodontitis are Aggregatibacter

actinomycetemcomitans (Aa) and Porphyromonas gingivalis (Pg) (1,2). In conjunction

with the bacterial challenge, an important role in the onset and progression of periodontitis

is played by the host immune response (3). A phagocytic response represents the first

barrier to the penetration of bacteria into periodontal tissue (4). However, in addition to

their defensive role, the phagocytes (polymorphonuclear neutrophils [PMNs] and

monocytes) may also be responsible for collateral damage to the periodontal tissues, thus

the host defense may be at the cost of periodontal attachment and alveolar bone (5,6).

One aspect of the host-derived breakdown of periodontal tissues is related to a

hyper-reactive trait of PMNs in response to immunoglobulin G (IgG)-opsonized antigens

(7,8,9). The nature of this hyper-reactivity might be related either to the genetically-

determined increased binding capacity of the receptors for IgG (FcγR) on PMNs or to the

increased expression levels of Fcγ-receptors.

There are several types of FcγRs identified on phagocytes: FcγRI (CD64), FcγRIIa

(CD32) and FcγRIII (CD16) (10). Previous studies have shown that single-nucleotide

polymorphisms, affecting the IgG-binding domain of the genes of FcγRIIa and IIIb, have

functional consequences. PMNs from periodontitis patients bearing the more reactive

genotype (i.e. FcγRIIa-131H/H and FcγRIIIb-NA1/NA1) show hyper-reactivity in

response to stimulation with A. actinomycetemcomitans or P. gingivalis (11,9).

Furthermore, periodontitis patients with FcγRIIa-131H/H genotype have more severe

periodontal breakdown than the patients with FcγRIIa-131H/R or 131R/R genotype

(9,12,13,14). There are several studies that reported the expression of FcγRs on peripheral

PMNs in periodontitis (15,16), but a difference of expression levels between patients and

controls could not be demonstrated.

In contrast to the PMN, little data exist on the expression of FcγR by monocytes in

periodontitis. Nagasawa et al. (17) described an increased percentage of FcγRIII+

monocytes in chronic periodontitis, but did not analyze expression of other FcγRs on

monocytes. Percentages of FcγRIII+ monocytes are also increased in other chronic

inflammatory conditions, such as rheumatoid arthritis (18). Moreover, the monocytes and

47

Expression of FcγRs and mCD14 on polymorphonuclear neutrophils and monocytes may determine the periodontal infection

macrophages of rheumatoid arthritis patients express increased levels of FcγRI and

FcγRIIa. It is conceivable that similar changes in the FcγR expression would occur in

periodontitis, as periodontitis and rheumatoid arthritis appear to share many pathologic

features (19).

In addition to the FcγRs, there are other classes of immune receptors important for

the antibacterial functions of PMNs and monocytes. CD14 is a lipopolysaccharide (LPS)

co-receptor and involved in the recognition of gram-negative bacteria and clearance of

circulating LPS. Membrane-bound CD14 (mCD14) is mainly expressed on mature

monocytes, macrophages and activated neutrophils (20). The β 2-integrins are

heterodimeric receptors consisting of a common β -subunit (CD18) associated with a

unique α -subunit (CD11a, b, c, or d). These receptors are involved in infection and

inflammation by mediating cell-cell, cell-extracellular matrix and cell-pathogen

interactions (21).

The first aim of the present study was to assess the expression of different FcγRs

by PMNs and monocytes from untreated periodontitis patients and healthy controls. In

addition we analyzed the expression levels of two other molecules important for

phagocyte-bacterial interactions: the complement receptor CR3 (CD11b/CD18) and

membrane-bound CD14. The second aim of the study was to explore the activation of

PMNs and monocytes in response to stimulation with two important periodontal

pathogens, A. actinomycetemcomitans and P. gingivalis.

Materials and methods Study population

We recruited 19 periodontitis patients who were referred to the Department of

Periodontology of the Academic Center for Dentistry Amsterdam (ACTA) for diagnosis

and treatment of periodontitis. All patients had ≥8 teeth with radiographic bone loss

beyond 30% of the root length. Age-, gender-, race- and smoking status-matched controls

were selected among subjects registered for restorative dental procedures or who visited

the dental school for regular dental check-ups. Control subjects were selected if they were

not missing more than one tooth per quadrant (3rd molar excluded) and if they showed on

dental bitewing radiographs <1 year old a distance between the cemento-enamel junction

and the alveolar bone crest of <3 mm. Besides their periodontal condition, all participants

48

Chapter 3

were otherwise healthy and had not taken any antibiotics during the last 6 months and no

medication that could influence the immune response during the last 2 weeks.

All patients were initially screened in the departmental clinic and had agreed to accept the

proposed treatment plan. All samples were taken before the start of the periodontal

therapy. All subjects were informed verbally and written about the purposes of the study

and had signed an informed consent. The Medical Ethical Committee of the Academic

Medical Center of the University of Amsterdam approved the study.

Blood sampling

All participants were asked to fast for at least 12 hours before the clinical visit. Fasting

blood samples were obtained between 8.30 and 10.30 AM by venipuncture in the

antecubital fossa. The venous blood was collected into evacuated tubes (BD Vacutainer

System, Plymouth, UK) with anti-coagulant (one 5 mL - EDTA tube for automated

leukocyte counting and leukocyte differential count and one 5 mL Na-citrate tube for flow

cytometric analysis).

Bacterial sampling

Subgingival microbiological samples were taken from all subjects to determine the

presence of the periodontal pathogens A. actinomycetemcomitans and P. gingivalis.

Samples were taken after venous blood collection to avoid possible phagocyte activation.

Sampling, laboratory procedures, and identification of A. actinomycetemcomitans and P.

gingivalis were performed as described before (2).

Flow cytometric analysis

For cell surface staining, citrated whole blood (40 µl) was incubated for 30 min on ice

with saturated concentrations (1-10 µg/mL) of the fluorochrome-conjugated antibodies.

CD14-PE (8G3), CD16-FITC (5D2), and CD11b-FITC (B2) were purchased from

Sanquin (Amsterdam, The Netherlands). CD32-FITC (AT10) and CD64-FITC (10.1) were

obtained from Serotec (Marseille, France). Appropriate isotype controls were used: PE-

IgG2a, FITC-IgG1, FITC-IgG2a from Sanquin and FITC-IgM from Beckman-Coulter

(Fullerton, CA, USA). After incubation, 3 mL of ice-cold NH4Cl buffer (155 mM NH4Cl,

10 mM KHCO3, 0.1 mM EDTA at pH 7.4) was added to lyse the erythrocytes, samples

placed on ice for 15 min and then centrifuged at 500g, 4°C. The cell pellet was washed

49


Fig. 3.1 (A) Identification of PMNs and monocytes by whole blood flow cytometry. (B, C) Representative dot plots of monocytes in whole blood from (B) one periodontitis patient and (C) one control subject. The fraction of FcγRIII+ monocytes (above fluorescence threshold on the Y-axis) from the total monocyte population was 32.9% in the periodontitis patient and 15.3% in the control subject.

two times (500g, 4°C) in HEPES-buffer (137 mM NaCl, 2.7 mM KCl, 1.0 mM MgCl2, 5.6

mM glucose, 20 mM HEPES, 1 mg/mL bovine serum albumin, 3.3 mM NaH2PO4, pH 7.4)

and resuspended in HEPES-buffer containing 0.3% formaldehyde (final concentration).

Flow cytometric analysis was performed within 2h of sample preparation. Expression of

CD11b, CD14, CD16, CD32 and CD64 is indicated as the geometric mean fluorescence

intensity (MFI).

Flow cytometric analysis was performed in a FACScan flow cytometer with

CellQuest software (Becton Dickinson, San Jose, CA, USA). The PMNs and the

monocytes were identified based on their forward and sideward scatter light patterns (Fig.

3.1A). Based on the binding of the corresponding isotype control antibody, a fluorescence

threshold was set (≤1% of cells being positive for the isotype control antibody)(22);

monocytes were considered to be FcγRIII+ when fluorescence was above this threshold

(Fig. 3.1B, C). The fraction (%) of FcγRIII+ was calculated from the total monocyte

population.

Bacterial stimulation assays

Brain-heart infusion broth enriched with hemin (5 mg/L) and menadione (1 mg/L) was

used for the bacterial culturing. A. actinomycetemcomitans Y4 was grown aerobically for

18h at 37°C in humidified 5% CO2, whereas P. gingivalis W83 was grown anaerobically

(80% N2, 10% H2, 10% CO2) for 48h at 37°C. The bacterial suspensions were washed,

50

Chapter 3

reduced to an optical density of 1 at 600 nm in HEPES buffer, and stored in aliquots at -

20°C.

Fresh citrated blood (25 µl) was added to a mix containing 55 µl of A.

actinomycetemcomitans- or P. gingivalis- suspension, 4 µg/mL CD14-PE. The mix was

incubated for 60 min at room temperature. In the control tubes, whole blood was incubated

with HEPES containing no bacteria. After the incubation period, 1 mL of lysis solution

was added to the samples, thoroughly mixed and placed on ice for 15 min. The cells were

mildly fixed by addition of 1 mL of HEPES containing 0.3% PFA.

The same FACS-settings were used to determine the expression of mCD14 on PMNs and

monocytes (See above: Flow cytometric analysis). As the mCD14 baseline values were

different among subjects within our study group, the effect of stimulation was expressed

as the percent change of mCD14-MFI: [the % change in MFI = (the MFI of stimulated

cells – MFI of untreated cells)/ MFI of untreated cells*100]; the value of untreated cells

was taken as 0% change (23).


Data analyses were performed with the SPSS package, version 14.0 (SPSS Inc., Chicago,

IL, USA). Means ± standard deviations (SD), and frequency distributions were calculated.

Prior to the analyses normal distributions of data were confirmed by Kolmogorov-Smirnov

goodness-of-fit test. Differences in background characteristics between patients and

controls were statistically analyzed with the Student’s t-test or the χ2-test (or Fisher exact

test), where appropriate. Differences in the receptor expression levels between patients and

controls were compared using t-tests. Furthermore, differences in the analyzed parameters

were explored in a general linear model using periodontal condition and colonization with

A. actinomycetemcomitans or P. gingivalis as fixed factors, and age, gender, race, and

smoking status as co-variates. Colonization with A. actinomycetemcomitans and P.

gingivalis appeared to significantly influence the expression of some receptors. Therefore

the study population was grouped according to the subgingival presence of A.

actinomycetemcomitans or P. gingivalis (i.e. Pg–Aa– [n=18], Aa+ [n=9], Pg+ [n=7] and

Pg+Aa+ [n=3] donors) and receptor expression patterns and cell activation after bacterial

stimulation were compared in a one-way ANOVA with the Tukey-Kramer post-test for

uneven groups (after confirming equal variances between subgroups using the Levene’s

test). A Pearson’s correlation coefficient and a partial correlation coefficient correcting for

51


Table 3.1 Characteristics of the study population. Aa, A. actinomycetemcomitans; Pg, P. gingivalis aValues are means ± standard deviations or numbers (%) of subjects; bP =0.004 (χ2-test).

periodontal condition, colonization with A. actinomycetemcomitans or P. gingivalis, age,

gender, race, smoking status, between mCD14 on monocytes and % FcγRIII+ monocytes

were calculated. The effects of A. actinomycetemcomitans- vs. P. gingivalis- stimulation

were compared with paired t-tests; P-values <0.05 were considered statistically

significant.

Results Characteristics of the study population. On the basis of the radiographic bone loss

criterion (less than 3 mm between the alveolar bone crest and the cemento-enamel junction

on all teeth) one control subject was excluded from the analysis. The culturing results

revealed that 12 subjects were Aa+, of which 9 periodontitis patients and 3 controls. Nine

patients were Pg+, whereas only 1 control tested positive for P. gingivalis (P=0.004, Table

3.1). The Aa+ subjects were younger (mean age 34.8 ± 11.2) than the Pg+ individuals

(mean 48.3 ± 6.4, P=0.033).

Parameter a Control Periodontitis n = 18 n = 19 Age 40.8 ± 10.1 42.0 ± 9.9 Gender

Male 6 (33 %) 7 (37 %) Female 12 (67 %) 12 (63 %)

Ethnicity Non-Caucasian 4 (22 %) 4 (21 %) Caucasian 14 (78 %) 15 (79 %)

Smoking Non-smoker 13 (72 %) 13 (68 %) Smoker 5 (28 %) 6 (32 %)

C-reactive protein (mg/L) 2.2 ± 3.9 3.6 ± 5.1 Leukocytes (x 109/L) 5.8 ± 1.6 6.5 ± 2.1

Neutrophils (x 109/L) 3.3 ± 1.1 3.8 ± 1.5 Monocytes (x 109/L) 0.4 ± 0.1 0.5 ± 0.2 Lymphocytes (x 109/L) 2.0 ± 0.6 2.1 ± 0.5

Subgingival colonization b Aa-Pg- 14 (78 %) 4 (21 %) Aa+Pg- 3 (17 %) 6 (32 %) Aa- Pg+ 1 (5 %) 6 (32 %) Aa+Pg+ 0 3 (15 %)

Number of teeth Total 28.7 ± 1.6 27.2 ± 2.5 With bone loss

≥ 30 % 0 17.1 ± 5.1 ≥ 50 % 0 6.7 ± 4.2

52

Chapter 3

Receptors expression by PMNs and monocytes. The expression of all tested receptors

by PMNs was comparable in patients and controls (Fig. 3.2A-E). Periodontitis patients had

a higher percentage of FcγRIII+ monocytes and lower monocytic mCD14 expression than

controls (Fig. 3.2E, F). Overall, the level of mCD14 was inversely correlated with the

percentage of FcγRIII+ monocytes (r=-0.473, P=0.003). This correlation was not found in

Fig. 3.2 PMN and monocyte expression of (A) FcγRI, (B) FcγRIIa, (C) FcγRIII, (D) CR3, (E) mCD14, and (F) %’s of FcγRIII+ monocytes, for controls (open bars, n=18) and periodontitis patients (closed bars, n=19). Values are means ± standard deviation. aP=0.001; bP=0.015.

Fig. 3.3 Correlation between mCD14 and % FcγRIII+ monocytes in (A) controls (open symbols) and (B) periodontitis patients (closed symbols). Each symbol represents one subject. Pearson’s correlation coefficient r=-0.473, overall P=0.003, in patients r=-0.618, P=0.005, in controls r=-0.124, P=0.624.

53


control subjects (r=-0.124, P=0.624; Fig. 3.3A), but was strong within periodontitis

patients (r=-0.618, P=0.005; Fig. 3.3B).

In Tables 3.2 and 3.3 we present adjusted data from a general linear model (GLM),

for which periodontal condition and colonization with A. actinomycetemcomitans/P.

gingivalis were entered as fixed factors and age, gender, race and smoking status as co-

variates. Neither colonization with A. actinomycetemcomitans/P. gingivalis nor other

potential confounding factors were associated with expression levels by the PMNs of any

of the receptors tested (Table 3.2). Further, in the GLM we observed that a lower

expression of FcγRI by monocytes was present in the Aa+ subjects (Table 3.3). After

correcting for periodontal condition, colonization with A. actinomycetemcomitans/P.

gingivalis, age, gender, race, smoking status, the correlation between mCD14 and %

FcγRIII+ monocytes was still apparent (radj=-0.382, Padj=0.034).

54

Table 3.2. Receptor expression by PMNs. Aa = A. actinomycetemcomitans, Pg = P. gingivalis a Values are adjusted means (confidence intervals) for MFIs and corresponding adjusted P-values obtained from a general linear model using periodontal condition and colonization with A. actinomycetemcomitans or P. gingivalis as fixed factors and age, gender, race, smoking status as covariates.

Table 3.3. Receptor expression by monocytes. Aa= A. actinomycetemcomitans, Pg = P. gingivalis. a Values are adjusted means (confidence intervals) for MFIs or proportion of FcγRIII + cells and corresponding Padj-values obtained from a general linear model using periodontal condition and colonization with A. actinomycetemcomitans or P. gingivalis as fixed factors and age, gender, race, smoking status as covariates. b Aa+ subjects had lower levels of monocytic FcγRI than Aa-Pg- (Padj=0.026) and Pg+ subjects (Padj=0.007) in post-hoc testing. c % FcγRIII + is inversely correlated with mCD14 on monocytes; partial correlation coefficient (corrected for periodontal condition, colonization with Aa/Pg, age, gender, race, smoking status) r = -0.382, P=0.034

PMNs a Control Periodontitis Aa-Pg- Aa+ Pg+ Aa+Pg+ n=18 n=19 Padj n=18 n=9 n=7 n=3 Padj

FcγRI 2.4 (0.3-4.4) 2.5 (1.1-3.8) 0.960 2.1 (0.6-3.6) 2.1 (0-4.2) 4.9 (2.4-7.3) 0.7 (0-4.4) 0.157 FcγRIIa 116.9 (103.1-130.7) 105.4 (96.2-114.6) 0.159 102.7 (92.4-112.9) 108.1 (93.8-122.4) 115.6 (99.2-132.0) 118.2 (93.1-143.2) 0.538 FcγRIII 508.9 (398.2-619.6) 522.9 (449.1-596.8) 0.828 578.7 (496.2-661.2) 505.9 (391.1-620.6) 502.8 (371.5-634.2) 476.3 (275.7-677.0) 0.668 CR3 96.9 (2.9-191.0) 153.1 (90.4-215.8) 0.308 195.9 (125.8-266.0) 88.8 (0-186.3) 147.3 (35.76-258.9) 68.0 (0-238.4) 0.352 mCD14 3.1 (1.8-4.4) 3.9 (3.0-4.8) 0.301 4.7 (3.7-5.7) 4.1 (2.7-5.5) 3.5 (1.9-5.1) 1.8 (0-4.2) 0.204

Monocytes a Control Periodontitis Aa-Pg- Aa+ Pg+ Aa+Pg+ n=18 n=19 Padj n=18 n=9 n=7 n=3 Padj

FcγRI 42.5 (30.6-54.3) 47.8 (39.9-55.7) 0.441 50.9 (42.0-59.7) 32.3 b (20.0-44.7) 59.6 (45.5-73.7) 37.7 (16.2-59.2) 0.037

FcγRIIa 113.7 (96.0-131.5) 107.0 (95.2-118.8) 0.515 107.6 (94.4-

120.8)

91.5 (73.4-109.9) 126.8 (105.7-147.8) 115.6 (83.4-147.7) 0.105 FcγRIII 2.4 (0-7.4) 5.6 (2.2-8.9) 0.285 7.6 (3.8-11.3) 1.3 (0-6.5) 6.4 (0.4-12.3) 0.7 (0-9.8) 0.269 CR3 136.3 (69.8-202.7) 175.9 (131.6-220.2) 0.309 216.8 (167.3-

266.3)

118.3 (49.4-187.1) 166.9 (88.1-245.8) 122.3 (1.9-242.7) 0.177 mCD14 83.9 (62.6-105.2) 52.1 (37.9-66.4) 0.015 66.2 (50.3-82.0) 79.5 (57.4-101.6) 62.9 (37.6-88.2) 63.6 (25.0-102.2) 0.707

% FcγRIII+ c 16.3 (11.4-21.2) 21.7 (18.4-25.0) 0.068 19.4 (15.7-23.0) 15.7 (10.6-20.8) 21.8 (15.9-27.6) 19.2 (10.3-28.2) 0.470


Receptor expression on PMNs and monocytes in Aa–Pg–, Aa+, Pg+ and Aa+Pg+

subjects. The significance of colonization with A. actinomycetemcomitans or P. gingivalis

for some of the receptor expression levels prompted us to further explore expression of

receptors in subgroups of subjects (patients and controls) based on their colonization with

A. actinomycetemcomitans or P. gingivalis.

Receptor expression levels on PMNs did not significantly differ between Aa–Pg–,

Aa+, Pg+ and Aa+Pg+ subjects (Fig. 3.4A-E). On monocytes we observed that FcγRI and

Fig. 3.4 PMN and monocyte expression of (A) FcγRI, (B) FcγRIIa, (C) FcγRIII, (D) CR3 and (E) mCD14 for Aa-Pg– subjects (open bars, n=18), Aa+ subjects (bright grey bars, n=9), Pg+ subjects (dark grey bars, n=7), and Aa+Pg+ subjects (closed bars, n=3). Values are means ± standard deviation; Aa (A. actinomycetemcomitans), Pg (P. gingivalis). a On panel A – Monocytes: P=0.005 for the overall ANOVA; post-hoc P=0.004. b On panel B – Monocytes: P=0.015 for the overall ANOVA; post-hoc P=0.009.

56

Chapter 3

FcγRIIa were present at lower levels in Aa+ subjects than in the other three subgroups

(overall ANOVA P=0.005 and P=0.015, respectively). In particular, the FcγRI and

FcγRIIa expression levels on monocytes from Aa+ subjects were lower than on monocytes

from Pg+ subjects (P=0.004 and P=0.009, respectively, Fig. 3.4A, B).

Expression levels of FcγRIII, CR3, and mCD14 were not significantly different

between the monocytes from Aa–Pg–, Aa+, Pg+ and Aa+Pg+ donors (Fig. 3.4C, D, E), even

though the same trend of lower monocytic expression in Aa+ subjects was visible for

FcγRIII and CR3 (overall ANOVA P=0.168 and P=0.149, respectively). The expression

profile in the subjects colonized with both A. actinomycetemcomitans and P. gingivalis

(Aa+Pg+ subjects) seemed to be the result of a combined effect of the two bacterial species;

the levels of FcγRI, FcγRIIa, FcγRIII and CR3 resembled the levels of Aa+ subjects,

whereas the mCD14 in Aa+Pg+ subjects seemed more similar to the Pg+ subjects.

PMN and monocyte activation in response to A. actinomycetemcomitans or P.

gingivalis. The above results indicated that the subjects having different periodontal

infection patterns show variability in the numbers of phagocytic receptors. The question

arose whether A. actinomycetemcomitans and P. gingivalis can activate PMNs and

monocytes differentially. Thus, we tested the reactivity of PMNs and monocytes from all

donors to these periodontal pathogens. The change in mCD14 expression was used as a

measure of cell activation. Both stimulation with A. actinomycetemcomitans and P.

gingivalis resulted in activation of PMNs and monocytes. Important to note was that the %

change in mCD14-MFI on PMNs and monocytes after P. gingivalis or A.

actinomycetemcomitans stimulation did not differ significantly between patients and

controls (data not shown).

57


The % change in mCD14 expression by PMNs induced by A.

actinomycetemcomitans was of a higher magnitude than after P. gingivalis stimulation

(P<0.0001). PMNs from A. actinomycetemcomitans-culture positive subjects, showed an

enhancement of mCD14 after A. actinomycetemcomitans or P. gingivalis stimulation in

contrast to PMNs from Pg–Aa–, Pg+ and Aa+Pg+ subjects who showed downregulation or

less upregulation of mCD14 (P=0.011 and P=0.053, respectively; Fig. 3.5A, B). In

particular, A. actinomycetemcomitans stimulation resulted in increased mCD14 on PMNs

from Aa+ subjects, thus higher than on PMNs from Pg+ and Pg–Aa– subjects (P=0.022 and

P=0.021, respectively).

On monocytes, A. actinomycetemcomitans induced also a higher % change in

mCD14 than P. gingivalis (P<0.0001). The activation of monocytes by A.

actinomycetemcomitans was strong, as evidenced by the up-regulation of mCD14 up to

200%, whereas P. gingivalis induced hardly any increase in mCD14 on monocytes

(<25%). Monocytes from Pg¯Aa¯, Aa+, Pg+ or Aa+Pg+ subjects had comparable response

to A. actinomycetemcomitans and P. gingivalis (Fig. 3.5A, B).

Discussion This study was undertaken to investigate expression patterns of some major receptors by

phagocytic cells in periodontitis and health to further elucidate susceptibility, infection

patterns and biological pathways in this inflammatory condition. On PMNs we found no

Fig. 3.5 Percent change of mCD14 expression on PMNs and monocytes in response to (A) A. actinomycetemcomitans (Aa) or (B) P. gingivalis (Pg). Data are means ± standard deviation for Aa–Pg– subjects (open bars, n=18), Aa+ subjects (bright grey bars, n=9), Pg+ subjects (dark grey bars, n=7), and Aa+Pg+ subjects (closed bars, n=3); On panel A – PMN activation: P=0.011 for the overall ANOVA; a,b post-hoc P=0.021 and P=0.022, respectively.

58

Chapter 3

differences between patients and controls in the expression patterns of the tested receptors.

On monocytes we found also a comparable expression of FcγRI, II, and CR3 in patients

and controls. However, an intriguing finding of this study is the heterogeneity of receptor

expression levels between individuals. In the general linear models, bacterial infection

patterns appeared as a major determinant for expression levels by monocytes. When we

subdivided the study population into Pg─Aa─, Aa+, Pg+ and Aa+Pg+ subjects, the

expression of FcγRI and IIa by monocytes was significantly lower in Aa+ subjects than in

Pg+ subjects (Fig. 3.4); after correcting for periodontal condition and potential

confounding factors, the expression of FcγRI monocytes was still decreased in Aa+

subjects (Table 3.3).

One possible explanation for the lower levels of FcγRs on monocytes from Aa+

subjects might be due to genotypic differences, possibly making these individuals more

susceptible to become infected with A. actinomycetemcomitans. Similarly, genetically-

defined deficiencies in various components of the innate immune system (mannose-

binding lectin, vitamin D receptor, mannose-associated serine-protease-2, Toll-like

receptors, etc.) have been associated with a greater risk of infection with Mycobacterium

tuberculosis, meningococci or gram-negative bacteria (24,25,26,27,28). In periodontitis it

has been shown that polymorphisms in the FcγRs and IL-6 genes are associated with

increased odds of detecting A. actinomycetemcomitans, P. gingivalis and Tannerella

forsythia after adjustment for age, ethnicity, smoking and periodontitis extent (29).

However, in our study neither the FcγRIIa 131H+ (131 H/R or H/H) nor the CD14 -260T+

(-260 C/T or T/T) genotypes showed increased odds of detecting A.

actinomycetemcomitans or P. gingivalis in subgingival plaque samples (data not shown).

Alternatively, the lower expression of FcγRs on monocytes in Aa+ subjects might be a

consequence of the infection with A. actinomycetemcomitans. In order to elucidate this,

future studies are needed evaluating the effects of therapeutic elimination of A.

actinomycetemcomitans from the subgingival flora on the expression of FcγRs. In line

with this possibility there are studies demonstrating the effects of medication on FcγRs

expression levels in rheumatoid arthritis. Expression levels of FcγRs with cell activation

potential on peripheral monocytes in patients suffering from rheumatoid arthritis were

increased before therapy in comparison to healthy subjects (30,31,32,33). The levels of

FcγRs are changed to “healthy” levels due to treatment (33,34,35). This change in

expression levels of FcγRs correlates with clinical improvement, thus restoring expression

59


levels of FcγRs can have beneficial effects. Similarly, it is conceivable that periodontal

therapy may have an effect on expression levels of FcγRs.

Normally, the majority of monocytes (90%) do not express FcγRIII and show high

levels of mCD14 (36). However, we found an increased % of FcγRIII+ monocytes and a

lower level of mCD14 on monocytes from periodontitis patients compared to healthy

controls (Fig. 3.2). These results are in line with previous studies showing an increased %

of FcγRIII+ monocytes in chronic periodontitis and lower mCD14 on peripheral monocytes

from early-onset periodontitis patients (37,17). Furthermore, we demonstrated a

correlation between the mCD14 on monocytes and the % of FcγRIII+ monocytes,

suggesting that periodontal infection affects the monocyte phenotype leading to

differentiation of the CD14lowFcγRIII+ cells (36). The CD14lowFcγRIII+ monocytes account

for about 10% of monocytes in healthy adults and are expanding up to 40% in

inflammatory conditions such as rheumatoid arthritis (18,31), sepsis (38) or Kawasaki

disease (39). In our study mCD14 was lowest on monocytes from Pg+ subjects (51.8 ±

13.8 MFI, Fig. 3.4E; adjusted mean 62.9 MFI, Table 3.3) and not significantly different

than the overall value noted for the whole periodontitis patient group (53.1 ± 20.9 MFI,

Fig. 3.2E; adjusted mean 52.1 MFI, Table 3.3). This suggests that individuals infected

with P. gingivalis show the most marked changes in the monocyte phenotype and they

account for the difference in mCD14 expression noted between patients and controls.

The association between P. gingivalis and a lower mCD14 expression on

monocytes is supported by in vitro findings where P. gingivalis LPS was able to induce

maturation of CD14lowFcγRIII+ dendritic cells (40). Compared to the CD14bright-

monocytes, the CD14lowFcγRIII+ monocyte subset can differentiate into dendritic cells that

produce lower amounts of IL-1β, IL-6, IL-12, TNF-α and IL-8, but have higher phagocytic

and oxidative activity (41). These dendritic cells are capable of antigen presentation, but

fail to efficiently stimulate T-cells, possibly due to lack of co-stimulatory molecules (40).

These characteristics of the dendritic cells originating from the CD14lowFcγRIII+

monocytes are possibly contributing to the perpetuation of chronic inflammation in

periodontitis, as they might be unable to efficiently coordinate the antibacterial defense in

the inflamed periodontium. We hypothesize that during periodontal infection frequent

bacteremic episodes, especially of P. gingivalis origin, lead to the early selection of the

CD14lowFcγRIII+ precursors of dendritic cells, which are ultimately unable to clear the

periodontal infection.

60

Chapter 3

PMN receptor expression was essentially not different between patients and

controls and a possible relation to the infection pattern was not found. Thus, in contrast to

monocytes for which we suggest a role in the susceptibility to certain infection patterns,

the PMNs may be solely involved in bacterial clearance. It is commonly accepted that

during their antibacterial functions PMNs induce collateral damage in inflamed

periodontal tissues, which is largely attributable to the production of proteolytic enzymes

(i.e. matrix-metalloproteinases, elastase) and reactive oxygen species (42). In particular

this process is relevant, since hyper-reactive PMNs in periodontitis have been

demonstrated by several research groups and several mechanisms have been proposed

(7,43,8,9). The PMNs from Aa+ subjects showed a stronger response to both P. gingivalis

and A. actinomycetemcomitans (measured by the change in mCD14), further providing

evidence for a hyper-reactive trait of the PMNs from A. actinomycetemcomitans-infected

subjects, possibly aggravating the periodontal inflammatory reactions in this individuals

(7,8,9). This hypothesis may be strengthened by the observations that A.

actinomycetemcomitans induced stronger PMN activation than P. gingivalis (Fig. 3.5A,

B). A. actinomycetemcomitans might be in general a stronger stimulator of phagocytes

than P. gingivalis (44,45,46,47). A. actinomycetemcomitans LPS is inducing higher

amounts of IL-1β, TNF-α and IL-8 in PMNs than P. gingivalis LPS (48), evoking a more

acute, E.coli - like inflammatory immune response. This might help explaining the severe

and relative early onset of periodontal breakdown associated with A.

actinomycetemcomitans infection, especially in patients with aggressive periodontitis (49).

An interesting aspect of the periodontal pathogen P. gingivalis is its capability to produce

bacterial cysteine proteinases (gingipains) which are able to proteolyse human monocyte

mCD14 (50,51). However, protease inhibitors present in serum inhibit the gingipain

activity (51), since in our bacterial stimulation assays A. actinomycetemcomitans and P.

gingivalis were similarly able to induce mCD14 upregulation on monocytes, although of

different amplitude.

In conclusion, we suggest that receptor expression patterns by monocytes may be

related to the susceptibility of a subject to become infected with certain periodontal

pathogens. The enrichment of the FcγRIII+ monocytes in periodontitis, in particular in

patients that are culture-positive for P. gingivalis, may result in formation of a dendritic

cell type that can stimulate T cells less efficiently. As monocytes and their progeny, the

dendritic cells, are expected to orchestrate the immune response in periodontitis, the

61


FcγRIII+ monocytes may be involved in the chronicity of the infection. PMNs from A.

actinomycetemcomitans-culture positive subjects respond in a hyper-reactive fashion to

the infection, and in particular seem to get strongly activated when stimulated with A.

actinomycetemcomitans. In this way PMNs may contribute to advanced breakdown of

tooth-supportive tissues through an enhanced release of a variety of proteolytic enzymes

and reactive oxygen species.

Acknowledgements This study was supported by the Netherlands Institute for Dental Sciences (IOT), the

Department of Periodontology, ACTA and Philips Oral Healthcare EMEA.

We thank Dimitris Papapanagiotou and Denise Duijster for their help in recruiting the

participants of this study.

REFERENCES

1 Slots J. 1999. Update on Actinobacillus Actinomycetemcomitans and Porphyromonas

gingivalis in human periodontal disease. J Int Acad Periodontol 1:121-126.




29:1023-1028.

3 Ebersole JL, Taubman MA, Smith DJ, Frey DE, Haffajee AD, Socransky SS.

1987. Human serum antibody responses to oral microorganisms. IV. Correlation with

homologous infection. Oral Microbiol Immunol 2:53-59.

4 Van Dyke TE, Levine MJ, Genco RJ. 1985. Neutrophil function and oral disease. J

Oral Pathol 14:95-120.

5 Page RC and Schroeder HE. 1976. Pathogenesis of inflammatory periodontal

disease. A summary of current work. Lab Invest 34:235-249.

62

https://www.researchgate.net/publication/10829317_Update_on_Actinobacillus_Actinomycetemcomitans_and_Porphyromonas_gingivalis_in_human_periodontal_disease?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/10829317_Update_on_Actinobacillus_Actinomycetemcomitans_and_Porphyromonas_gingivalis_in_human_periodontal_disease?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/22377397_Page_RC_Schroeder_HE_Pathogenesis_of_inflammatory_periodontal_disease_A_summary_of_current_work_Lab_Invest_34_235-249?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/22377397_Page_RC_Schroeder_HE_Pathogenesis_of_inflammatory_periodontal_disease_A_summary_of_current_work_Lab_Invest_34_235-249?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

Chapter 3

6 Madianos PN, Bobetsis YA, Kinane DF. 2005. Generation of inflammatory stimuli:

how bacteria set up inflammatory responses in the gingiva. J Clin Periodontol 32

Suppl 6:57-71.







Immunol 147:255-264.

9 Nicu EA, van der Velden U, Everts V, van Winkelhoff AJ, Roos D, Loos BG.

2007. Hyper-reactive PMNs in FcgammaRIIa 131 H/H genotype periodontitis patients.

J Clin Periodontol 34:938-945.

10 Deo YM, Graziano RF, Repp R, Van de Winkel JG. 1997. Clinical significance of

IgG Fc receptors and Fc gamma R-directed immunotherapies. Immunol Today 18:127-

135.

11 Kobayashi T, van der Pol WL, Van de Winkel JG, Hara K, Sugita N, Westerdaal

NA, Yoshie H, Horigome T. 2000. Relevance of IgG receptor IIIb (CD16)

polymorphism to handling of Porphyromonas gingivalis: implications for the

pathogenesis of adult periodontitis. J Periodontal Res 35:65-73.

12 Yamamoto K, Kobayashi T, Grossi S, Ho AW, Genco RJ, Yoshie H, De Nardin E.

2004. Association of Fcgamma receptor IIa genotype with chronic periodontitis in

Caucasians. J Periodontol 75:517-522.

13 Wolf DL, Neiderud AM, Hinckley K, Dahlen G, van de Winkel JGJ, Papapanou

PN. 2006. Fcgamma receptor polymorphisms and periodontal status: a prospective

follow-up study. J Clin Periodontol 33:691-698.



30:595-602.

63


15 Leino L, Hurttia HM, Sorvajarvi K, Sewon LA. 1994. Increased respiratory burst

activity is associated with normal expression of IgG-Fc-receptors and complement

receptors in peripheral neutrophils from patients with juvenile periodontitis. J

Periodontal Res 29:179-184.




17 Nagasawa T, Kobayashi H, Aramaki M, Kiji M, Oda S, Izumi Y. 2004. Expression

of CD14, CD16 and CD45RA on monocytes from periodontitis patients. J Periodontal

Res 39:72-8.

18 Kawanaka N, Yamamura M, Aita T, Morita Y, Okamoto A, Kawashima M,

Iwahashi M, Ueno A, Ohmoto Y, Makino H. 2002. CD14+,CD16+ blood monocytes

and joint inflammation in rheumatoid arthritis. Arthritis Rheum 46:2578-2586.

19 Mercado FB, Marshall RI, Bartold PM. 2003. Inter-relationships between

rheumatoid arthritis and periodontal disease. A review. J Clin Periodontol 30:761-772.



21 Luo BH, Carman CV, Springer TA. 2007. Structural basis of integrin regulation and

signaling. Annu Rev Immunol 25:619-647.

22 Ziegler-Heitbrock HW, Strobel M, Kieper D, Fingerle G, Schlunck T,

Petersmann I, Ellwart J, Blumenstein M, Haas JG. 1992. Differential expression of

cytokines in human blood monocyte subpopulations. Blood 79:503-511.

23 Inoue T, Sakai Y, Morooka S, Hayashi T, Takayanagi K, Takabatake Y. 1996.

Expression of polymorphonuclear leukocyte adhesion molecules and its clinical

significance in patients treated with percutaneous transluminal coronary angioplasty. J

Am Coll Cardiol 28:1127-1133.

24 Garred P, Madsen HO, Svejgaard A, Michaelsen TE. 1999. Mannose-binding

lectin and meningococcal disease. Lancet 354:336-

64

Chapter 3

25 Stengaard-Pedersen K, Thiel S, Gadjeva M, Moller-Kristensen M, Sorensen R,

Jensen LT, Sjoholm AG, Fugger L, Jensenius JC. 2003. Inherited deficiency of

mannan-binding lectin-associated serine protease 2. N Engl J Med 349:554-560.

26 Agnese DM, Calvano JE, Hahm SJ, Coyle SM, Corbett SA, Calvano SE, Lowry

SF. 2002. Human toll-like receptor 4 mutations but not CD14 polymorphisms are

associated with an increased risk of gram-negative infections. J Infect Dis 186:1522-

1525.

27 Bellamy R, Ruwende C, Corrah T, McAdam KP, Thursz M, Whittle HC, Hill

AV. 1999. Tuberculosis and chronic hepatitis B virus infection in Africans and

variation in the vitamin D receptor gene. J Infect Dis 179:721-724.

28 Garred P, Harboe M, Oettinger T, Koch C, Svejgaard A. 1994. Dual role of

mannan-binding protein in infections: another case of heterosis? Eur J Immunogenet

21:125-131.

29 Nibali L, Ready DR, Parkar M, Brett PM, Wilson M, Tonetti MS, Griffiths GS.

2007. Gene polymorphisms and the prevalence of key periodontal pathogens. J Dent

Res 86:416-420.

30 Hepburn AL, Mason JC, Davies KA. 2004. Expression of Fc{gamma} and

complement receptors on peripheral blood monocytes in systemic lupus erythematosus

and rheumatoid arthritis. Rheumatology (Oxford) 43:547-554.

31 Wijngaarden S, van Roon JAG, Bijlsma JWJ, van de Winkel JGJ, Lafeber FPJG.

2003. Fc{gamma} receptor expression levels on monocytes are elevated in rheumatoid

arthritis patients with high erythrocyte sedimentation rate who do not use anti-

rheumatic drugs. Rheumatology (Oxford) 42:681-688.

32 Shinohara S, Hirohata S, Inoue T, Ito K. 1992. Phenotypic analysis of peripheral

blood monocytes isolated from patients with rheumatoid arthritis. J Rheumatol 19:211-

215.

33 Torsteinsdottir I, Arvidson NG, Hallgren R, Hakansson L. 1999. Monocyte

activation in rheumatoid arthritis (RA): increased integrin, Fc gamma and complement

receptor expression and the effect of glucocorticoids. Clin Exp Immunol 115:554-560.

65


34 Magnusson SE, Engstrom M, Jacob U, Ulfgren AK, Kleinau S. 2007. High

synovial expression of the inhibitory FcgammaRIIb in rheumatoid arthritis. Arthritis

Res Ther 9:R51-

35 Wijngaarden S, van Roon JA, Van de Winkel JG, Bijlsma JW, Lafeber FP. 2005.

Down-regulation of activating Fcgamma receptors on monocytes of patients with

rheumatoid arthritis upon methotrexate treatment. Rheumatology (Oxford) 44:729-734.

36 Ziegler-Heitbrock HW. 1996. Heterogeneity of human blood monocytes: the CD14+

CD16+ subpopulation. Immunol Today 17:424-428.

37 Buduneli N, Bicakci N, Keskinoglu A. 2001. Flow-cytometric analysis of

lymphocyte subsets and mCD14 expression in patients with various periodontitis

categories. J Clin Periodontol 28:419-424.

38 Fingerle G, Pforte A, Passlick B, Blumenstein M, Strobel M, Ziegler-Heitbrock

HW. 1993. The novel subset of CD14+/CD16+ blood monocytes is expanded in sepsis

patients. Blood 82:3170-3176.

39 Katayama K, Matsubara T, Fujiwara M, Koga M, Furukawa S. 2000.

CD14+CD16+ monocyte subpopulation in Kawasaki disease. Clin Exp Immunol

121:566-570.

40 Kanaya S, Nemoto E, Ogawa T, Shimauchi H. 2004. Porphyromonas gingivalis

lipopolysaccharides induce maturation of dendritic cells with CD14+CD16+

phenotype. Eur J Immunol 34:1451-1460.

41 Almeida J, Bueno C, Alguero MC, Sanchez ML, de Santiago M, Escribano L,

Diaz-Agustin B, Vaquero JM, Laso FJ, San Miguel JF, Orfao A. 2001.

Comparative Analysis of the Morphological, Cytochemical, Immunophenotypical, and

Functional Characteristics of Normal Human Peripheral Blood Lineage-/CD16+/HLA-

DR+/CD14-/lo Cells, CD14+ Monocytes, and CD16- Dendritic Cells. Clin Immunol

100:325-338.

42 Woessner JF, Jr. 1991. Matrix metalloproteinases and their inhibitors in connective

tissue remodeling. FASEB J 5:2145-2154.

66

Chapter 3

43 Gustafsson A, Ito H, Asman B, Bergstrom K. 2006. Hyper-reactive mononuclear

cells and neutrophils in chronic periodontitis. J Clin Periodontol 33:126-129.

44 Nonnenmacher C, Dalpke A, Zimmermann S, Flores-de-Jacoby L, Mutters R,

Heeg K. 2003. DNA from periodontopathogenic bacteria is immunostimulatory for

mouse and human immune cells. Infect Immun 71:850-856.

45 Harokopakis E, Albzreh MH, Haase EM, Scannapieco FA, Hajishengallis G.

2006. Inhibition of proinflammatory activities of major periodontal pathogens by

aqueous extracts from elder flower (Sambucus nigra). J Periodontol 77:271-279.

46 Kobayashi H, Nagasawa T, Aramaki M, Mahanonda R, Ishikawa I. 2000.

Individual diversities in interferon gamma production by human peripheral blood

mononuclear cells stimulated with periodontopathic bacteria. J Periodontal Res

35:319-328.

47 Reddi K, Wilson M, Nair S, Poole S, Henderson B. 1996. Comparison of the pro-

inflammatory cytokine-stimulating activity of the surface-associated proteins of

periodontopathic bacteria. J Periodontal Res 31:120-130.

48 Yoshimura A, Hara Y, Kaneko T, Kato I. 1997. Secretion of IL-1 beta, TNF-alpha,

IL-8 and IL-1ra by human polymorphonuclear leukocytes in response to

lipopolysaccharides from periodontopathic bacteria. J Periodontal Res 32:279-286.

49 van der Velden U, Abbas F, Van Steenbergen TJ, De Zoete OJ, Hesse M, De

Ruyter C, De Laat VH, de Graaff J. 1989. Prevalence of periodontal breakdown in

adolescents and presence of Actinobacillus actinomycetemcomitans in subjects with

attachment loss. J Periodontol 60:604-610.

50 Duncan L, Yoshioka M, Chandad F, Grenier D. 2004. Loss of lipopolysaccharide

receptor CD14 from the surface of human macrophage-like cells mediated by

Porphyromonas gingivalis outer membrane vesicles. Microb Pathog 36:319-325.

51 Sugawara S, Nemoto E, Tada H, Miyake K, Imamura T, Takada H. 2000.

Proteolysis of human monocyte CD14 by cysteine proteinases (gingipains) from

Porphyromonas gingivalis leading to lipopolysaccharide hyporesponsiveness. J

Immunol 165:411-418.

67

Chapter 4

Soluble CD14 as a possible molecular link between

atherosclerosis and chronic infectious diseases: periodontitis

as model

E.A. Nicu1, M.L. Laine2, S.A. Morré3,4, U. van der Velden1 and B.G. Loos1

Departments of 1 Periodontology and 2 Oral Microbiology, Academic Center for Dentistry Amsterdam

(ACTA), Universiteit van Amsterdam and VU University Amsterdam, The Netherlands

3Laboratory of Immunogenetics, Department of Pathology and Section Infectious Diseases, Department of

Internal Medicine, VU University Medical Center, Amsterdam, The Netherlands; and 4Department of

Medical Microbiology, Maastricht University Medical Center, Maastricht, The Netherlands.

Submitted to Innate Immunity

69

Soluble CD14 as a possible molecular link between atherosclerosis and chronic infectious diseases: periodontitis as model

Abstract Lipopolysaccharide (LPS) binds to soluble (s) CD14. The LPS-sCD14 complexes activate

endothelial and smooth muscle cells, exacerbating inflammation in atherosclerotic lesions.

We hypothesized that sCD14 is an important link between atherosclerosis and low-grade

infectious processes, such as chronic periodontitis. sCD14 levels were determined by

ELISA in healthy controls (n=57) and untreated patients (59 moderate and 46 severe) and

their relation with markers of systemic inflammation (CRP levels, leukocyte, neutrophil

and lymphocyte counts) was assessed. Anti-A. actinomycetemcomitans and anti-P.

gingivalis IgG levels were established by ELISA and CD14-260 genotype was determined

in a TaqMan allelic discrimination assay. Increased levels of sCD14 were more frequent

among periodontitis patients (P=0.026) and showed a severity-dependence with increasing

levels of periodontal breakdown (P=0.008). In patients, levels of sCD14 correlated

positively with CRP (P=0.043), leukocyte numbers (P=0.011) and negatively with anti-A.

actinomycetemcomitans IgG (P=0.007). In a multivariate analysis, sCD14 levels were

predicted by ethnicity, age, educational level, and in Caucasian subjects also by the

severity of periodontal destruction, but not by anti-P. gingivalis IgG or the CD14-260

genotype. Periodontitis is associated with elevated levels of sCD14. We suggest that

increased sCD14 levels in periodontitis might lead to increased activation of non-CD14

expressing cells, possibly activating atherogenesis.

70

Chapter 4

Introduction Cardiovascular diseases (CVD) are a leading cause of global mortality, accounting for

almost 17 million deaths annually or 30% of all global mortality (1). The underlying

mechanism associated with CVD is atherosclerosis. In the recent years, a growing interest

is emerging in aspects of infection and inflammation, as they may also be important risk

factors in the initiation and progression of atherosclerosis (2). Longstanding, systemic

chronic inflammation has been attributed to repeated, transient dissemination of certain

micro-organisms in the peripheral circulation. These include Helicobacter pylori,

Chlamydia pneumoniae, and cytomegalovirus (3). The systemic chronic inflammation is

evidenced by elevated C-reactive protein (CRP); this acute-phase protein is regarded as a

risk factor for CVD (4). Periodontitis may be a source of daily, low-grade bacteremias.

The periodontal pockets form ports of entry which lead to transient bacteremias and

leakage of bacterial products into blood (5). Periodontitis is also clearly associated with

elevated levels of CRP and increased risk for CVD (6,7).

Lipopolysaccharide (LPS), the common component of Gram-negative bacteria,

might be the trigger for the events linking some chronic infectious processes and

atherosclerosis (8). LPS is recognized by CD14-expressing immune cells (9). Membrane-

bound CD14 (mCD14) is mainly expressed on mature monocytes, macrophages and

activated neutrophils (10). Soluble (s)CD14 can be the result of shedding / cleavage of

mCD14 or be produced in the liver. Automatic text mining of the literature has identified

the CD14 molecule as an important link between atherosclerosis and periodontitis (11). In

periodontitis, elevated serum levels of LPS have bee reported,(8) as well as elevated levels

of sCD14 (12). Moreover, in the latter, Japanese study, treatment of periodontitis was

shown to decrease the sCD14 levels (12). Gram-negative periodontal pathogens, such as

Aggregatibacter actinomycetemcomitans and Porphyromonas gingivalis, might contribute

to the overall pro-atherogenic burden in periodontitis patients as a result of recurrent

bacteremic episodes (5).

CD14 binds LPS linked with LPS-binding-protein (LBP); the CD14-LPS-LBP

complex activates Toll-like receptors 2 and 4 and will, through activation of downstream

molecules, result in production of cytokines such as tumor necrosis factor (TNF)-alpha,

interleukin (IL)-1, IL-6 and growth factors (13). The resulting pro-inflammatory milieu

can accelerate atherogenesis. Endothelial and smooth muscle cells, lacking their own

mCD14, are directly activated by a LPS-sCD14 complex (14,15), leading to the

71


expression of cell adhesion molecules, thereby increasing procoagulant activity, and

exacerbating inflammation in atherosclerotic vessel walls (16).

The promotor region of the CD14 gene contains a single nucleotide polymorphism

(C>T) at position -260. The CD14-260 T allele has been associated not only with increased

levels of sCD14 (17), myocardial infarction (18), and increased susceptibility to chronic

C. pneumoniae infection in coronary artery disease patients (19), but also with severe

periodontitis (20).

Given above, we hypothesized that CD14 is an important molecular link between

atherosclerosis and low-grade infectious processes. Using periodontitis as a model, we

investigated sCD14 plasma levels in relation to systemic markers of inflammation,

especially CRP, infection with the periodontal pathogens A. actinomycetemcomitans and

P. gingivalis, and the CD14-260 genotype.


Our study population was derived from two previous studies.(21,22) We included all

subjects for which the plasma levels of sCD14, serology, and CD14-260 genotype could be

determined. Fifty-seven healthy controls and untreated periodontitis patients (59 moderate

and 46 severe) were included. For details of dental inclusion criteria for patients and

controls, see Bizzarro et al (22). Exclusion criteria for controls and patients were: (I) the

presence of systemic disease (especially cardiovascular disorders, diabetes mellitus,

allergy), (II) a recent history or the presence of any acute or chronic infection, (III)

systemic antibiotic treatment within the last 3 months, (IV) the use of any medication

(including sporadic NSAID’s), and (V) pregnancy. For all participants smoking habits

were recorded; non-smokers were subjects who never smoked or quitted smoking >10

years ago. Educational level was used as surrogate marker for social class and the given

scores were 0 or 1 for the subjects with educational level < highschool or ≥ highschool,

respectively. From height and weight measurements the body mass index (BMI) was

calculated. Subjects from European ancestry were entered as Caucasian and individuals

from other or mixed ancestry were scored as non-Caucasian.

All subjects were both verbally and written informed about the purpose of the

study and gave written informed consent to participate. The Medical Ethical Committee of

the Academic Medical Center of the University of Amsterdam approved the study.

72

Chapter 4

Lipids profile and systemic markers of inflammation.

Plasma levels of total cholesterol, HDL cholesterol and triglycerides were determined by

standard (enzymatic) methods in a hospital based diagnostic clinical laboratory; LDL

cholesterol was calculated (23). Plasma levels of CRP were determined using a high

sensitivity (latex enhanced) nephelometric method on the BN ProSpec analyzer (Dade

Behring, Marburg, Germany). EDTA blood was used for automated leukocyte counting

and leukocyte differentiation.

Infection with A. actinomycetemcomitans and P. gingivalis.

The determination of serum IgG levels against two relevant periodontal pathogens, A.

actinomycetemcomitans and P. gingivalis, was a modification of the enzyme-linked

immunosorbent assay (ELISA) described by Pussinen et al.(24) As antigens we used a

mixture of five strains of A. actinomycetemcomitans and eight strains of P. gingivalis. The

strains were ATCC 29523, Y4, NCTC 9710, 3381 and OM2 534 for A.

actinomycetemcomitans, representing the serotypes a, b, c, d and e, and W83, HG 184,

A7A1-28, ATCC 49417, HG 1690, HG 1691 and 34-4 for P. gingivalis, representing the

capsule serotypes K1-K7, as well as the uncapsulated strain 381. A.

actinomycetemcomitans were grown for 18h in brain heart infusion (BHI) broth (Sigma

Chemical Co., St.Louis, MO) aerobically at 37°C in humidified 5% CO2. P. gingivalis

were grown anaerobically (80% N2, 10% H2, 10% CO2) at 37°C for 18h in BHI broth

supplemented with haemin (5 mg/L) and menadione (1 mg/L) (Sigma). The bacteria were

washed once with phosphate-buffered saline (PBS; 10 mM phosphate, 150 mM NaCl,

pH=7.4) and then fixed overnight at 4°C in 0.5% paraformaldehyde-PBS. The bacterial

suspensions were washed three times in PBS and brought to an optical density

corresponding to an absorbance of 0.15 at 580 nm in ELISA-buffer (PBS, 0.5% bovine

serum albumin, 0.05% Tween 20).

For ELISA, equal volumes of the five A. actinomycetemcomitans or of the eight P.

gingivalis strains were mixed and 150 µl of the mixture was used to coat Microlon ELISA

plates (Greiner Bio-One B.V., Alphen a/d Rijn, The Netherlands). The unspecific binding

was blocked by 5% bovine serum albumin in PBS at room temperature for 30 min. Diluted

(1:1500) serum samples were tested in duplicate. The plates were incubated for 2h at room

temperature, washed 3 times in ELISA-buffer. The horse-radish peroxidase-conjugated

goat anti-human IgG (Vector Laboratories Inc., Burlingame, CA) diluted (1:2000; 150 µl)

73


was added and the plates were incubated for 2h at room temperature. Substrate was then

added, and absorbance values were measured at 450 nm with a multilabel counter (Wallac

Victor 1420, Perkin-Elmer Life Sciences, Boston, MA).

We selected a cut-off point for defining seropositivity, the 75th percentile of the

control population (OD=0.744 for A. actinomycetemcomitans and OD=0.915 for P.

gingivalis, respectively). The subjects were considered seropositive for A.

actinomycetemcomitans and P. gingivalis when the corresponding IgG value was higher

than the threshold.

CD14 –260 genotype

Genomic DNA was isolated from blood samples by means of the Puregene DNA isolation

kit (Gentra Systems, Minneapolis, MN, USA) according to the manufacture’s instructions.

We assessed the C>T substitution in the proximal CD14 promoter GC box at position –

260 from the translation start site (NCBI SNP CLUSTER ID: rs2569190). A realtime

TaqMan PCR was performed using standard conditions with the following primers and

probes: forward primer GACACTGCCAGGAGACACAGAA and reverse primer

GCCAGCCCCCTTCCTTT, and probes: TGTTACGGCCCCCCT-VIC-MGB (for the

common allele, the C allele), TTACGGTCCCCCTCC-6-FAM-MGB (for the rare allele,

the T allele).

Soluble CD14 (sCD14)

The concentration of sCD14 was measured by a sandwich ELISA using two monoclonal

antibodies (MAbs) against different epitopes of sCD14 (R&D systems, Abingdon, UK) in

accordance to the manufacturer’s instructions. In brief, EDTA plasma specimens were

diluted 1:200 and incubated in duplicate for 3h in a 96-well plate precoated with the anti-

CD14 MAb. The plate was incubated for 1h with the other anti-CD14 MAb conjugated

with peroxidase. Substrate was then added, and absorbance values were measured at 450

nm with a multilabel counter (Wallac Victor 1420). The concentration of each sample was

determined by extrapolation from a standard curve estimated from a panel of sCD14

standards of known concentrations. Serum levels of sCD14 were expressed as mg/L. The

intra- and inter-assay coefficients of variation were 2.4% and 6.3%, respectively.

74

Chapter 4


Data analyses were performed with the SPSS 15.0 package (SPSS Inc., Chicago, IL,

USA). Means, standard deviations and frequency distributions were calculated; the

background characteristics were compared with one-way ANOVA or χ2-test (or Fisher

exact test), where appropriate. Normal distribution of data was assessed by Kolmogorov-

Smirnov goodness-of-fit test and if needed, the log-transformed values were employed.

Differences in sCD14 between controls, moderate and severe patients were compared with

the Kruskal-Wallis test. For sCD14 the 75th percentile of values of the control subjects was

used as cut-off point for a frequency distribution analysis followed by χ2-test. Correlations

between sCD14 levels, infection with A. actinomycetemcomitans or P. gingivalis, CRP,

and numbers of leukocytes, neutrophils and lymphocytes, and for patients also between

sCD14 and the number of teeth with ≥50% bone loss, were investigated by Spearman

correlation coefficients, ρ. A multivariate analysis (backward stepwise linear regression

with P=0.10 to enter and P=0.05 to leave) was performed considering the sCD14 levels as

the outcome variable. Predictor variables were age, gender, ethnicity, smoking,

educational level, BMI, CD14-260 genotype, anti-A. actinomycetemcomitans IgG levels,

anti-P. gingivalis IgG levels, total cholesterol, triglycerides, and no. of teeth with ≥50%

bone loss.

Results Study population. Two third of the study population was European Caucasian (Table 4.1)

and the remainder had a mixed racial background. Periodontitis patients had a lower

educational level than the healthy controls (P=0.002).

Lipids profile and systemic markers of inflammation. Levels of total cholesterol,

HDL, LDL, and triglycerides were roughly comparable in controls, moderate or severe

periodontitis patients. The total number of leukocytes was increased in moderate and

severe periodontitis compared to controls (P<0.001; Table 4.1). The increase was largely

explained by the increase in neutrophil counts in periodontitis compared to health

(P<0.001). CRP levels showed a tendency to be increased in moderate and severe

periodontitis groups compared to the control group

(P=0.072).

Infection with A. actinomycetemcomitans and P. gingivalis. The anti-A.

actinomycetemcomitans and the anti-P. gingivalis IgG levels were increased in

75


periodontitis compared to health (P=0.002 and P=0.006, respectively). As expected, more

A. actinomycetemcomitans-seropositive and P. gingivalis-seropositive subjects were

present among moderate and severe periodontitis patients than among controls (P=0.004

and P=0.049, respectively; Table 4.1).

CD14 –260 genotype. CD14-260 allele frequencies in periodontitis patients and

controls did not show a significant deviation from the Hardy-Weinberg equilibrium

(P>0.05). We did not observe differences in the distribution of the CD14-260 genotypes or

of the allele frequencies between patients and controls, neither when the entire study

population was analyzed, nor when considering only Caucasian subjects (Table 4.1).

76

Chapter 4

Table 4.1 Study population. Values are means ± standard deviation or numbers (%) of subjects. BMI, body mass index;

Aa, A. actinomycetemcomitans; Pg, P. gingivalis; OD, optical density at 450nm.

†In Caucasians, the genotype frequencies: for controls 20% C/C, 54%C/T and 26% T/T; for moderate periodontitis

patients 21% C/C, 61% C/T and 18%; for severe periodontitis patients 26% C/C, 59%C/T and 15% T/T (P=0.807). T-

allele frequencies in Caucasians were 53%, 49% and 44% in controls, moderate and severe patients, respectively

(P=0.307) and did not significantly deviate from the Hardy-Weinberg equilibrium (P>0.05).

Control

Moderate periodontitis

Severe periodontitis

P-value

(n=57) (n=59) (n=46) Background characteristics

Age 41.5 ± 10.8 42.9 ± 7.8 45.0 ± 9.1 0.184 Gender (males) 19 (33.3%) 21 (35.6%) 20 (43.5%) 0.547 Ethnicity (Caucasian) 35 (61.4%) 38 (64.4%) 34 (73.9%) 0.389 Smoking (smokers) 9 (15.8%) 14 (23.7%) 16 (34.8%) 0.081 Education (<high school) 13 (22.8%) 32 (54.2%) 22 (47.8%) 0.002 BMI (kg/m2) 24.8 ± 4.0 25.5 ± 5.0 24.7 ± 3.9 0.618 No. of teeth present 28.3 ± 2.0 26.2 ± 3.4 26.1 ± 3.0 <0.001 No. of teeth with bone loss

≥ 30% 0 13.6 ± 5.7 20.7 ± 3.8 ≥ 50% 0 2.9 ± 2.0 10.5 ± 4.0

Total cholesterol (mmol/L) 5.4 ± 1.2 5.3 ± 1.2 5.6 ± 1.0 0.442 HDL (mmol/L) 1.4 ± 0.3 1.3 ± 0.3 1.4 ± 0.4 0.073 LDL (mmol/L) 3.2 ± 0.8 3.4 ± 0.9 3.5 ± 0.9 0.104

Triglycerides (mmol/L) 1.3 ± 0.7 1.6 ± 1.5 1.3 ± 0.7 0.175 Systemic inflammatory markers

Leukocytes (x109 /L) Total 5.9 ± 1.5 7.2 ± 2.1 7.2 ± 2.0 <0.001 Neutrophils 3.3 ± 1.1 4.2 ± 1.4 4.2 ± 1.6 <0.001 Lymphocytes 2.0 ± 0.6 2.3 ± 0.8 2.3 ± 0.6 0.071

C-reactive protein (mg/L) 2.2 ± 2.7 3.8 ± 3.8 3.4 ± 4.8 0.072 Infection with periodontal bacteria

Anti-Aa IgG (OD450) 0.6 ± 0.5 1.0 ± 0.6 1.1 ± 0.7 0.002 Anti-Pg IgG (OD450) 0.7 ± 0.2 0.9 ± 0.6 1.0 ± 0.7 0.006 Aa-seropositive 14 (25%) 30 (51%) 24 (52%) 0.004 Pg-seropositive 14 (25%) 21 (36%) 22 (48%) 0.049

CD14 (-260C>T) rs2569190 Genotypes frequency (%)†

C/C 10 (18%) 17 (29%) 11 (24%) C/T 32 (56%) 29 (49%) 28 (61%) 0.448 T/T 15 (26%) 13 (22%) 7 (15%)

T allele frequency (%) 54% 47% 46% 0.324

77


sCD14 plasma levels. Periodontitis patients showed a tendency towards increased sCD14

levels compared to controls (P=0.061; Fig. 4.1A). In a frequency distribution analysis

using as threshold the 75th percentile of the sCD14 levels of the control subjects (2.03

mg/L), we observed that a higher number of moderate and severe periodontitis patients

had sCD14 values above this threshold compared to healthy controls (34% and 50.0%,

respectively versus 25%; P=0.026). Furthermore, in patients (moderate and severe), the

sCD14 levels were positively correlated with the severity of periodontal destruction (no.

of teeth with ≥50% bone loss, ρ=0.256, P=0.008; Fig. 4.1B).

Correlation between sCD14 and systemic parameters. For the total study population,

the sCD14 levels were positively correlated with CRP plasma levels, leukocyte, neutrophil

and lymphocyte counts (Table 4.2), although the correlation coefficients were rather low.

These correlations were present in periodontitis patients, but were not found within the

control subjects (P>0.05). In particular, CRP (ρ=0.198, P=0.043) and the total numbers of

leukocytes (ρ=0.249, P=0.011) correlated positively with the sCD14 in periodontitis

Fig. 4.1 A) Box (25 to 75 percentiles) and whisker (10 to 90 percentiles) plots for sCD14 in controls, patients with moderate periodontitis and patients with severe periodontitis; the horizontal line inside the box indicates the median (the 50th percentile). P-value calculated by Kruskal-Wallis test. B) Correlation between sCD14 levels and severity of bone loss (no. of teeth with ≥50%BL) tested by Spearman rank correlation in periodontitis patients (moderate and severe). The correlation coefficient, ρ and the P-value are indicated. Each symbol represents one subject. BL=bone loss

78

Chapter 4

patients. Interestingly, in periodontitis patients, the levels of sCD14 were negatively

correlated with the anti- A. actinomycetemcomitans IgG levels (ρ=-0.262, P=0.007).

Table 4.2 Correlation coefficients of sCD14 with infection with A. actinomycetemcomitans, P. gingivalis, CRP, numbers of leukocytes, neutrophils and lymphocytes. *Calculated by Spearman rank correlation coefficient. †P<0.05; ‡ P<0.01; Aa, A. actinomycetemcomitans; Pg, P. gingivalis

Linear regression analysis of the sCD14 levels. In a final step we designed a linear

regression analysis, trying to identify significant associations of sCD14 with risk factors

for periodontitis. The sCD14 levels were not normally distributed (Kolmogorov-Smirnov

goodness-of-fit test P<0.05); hence in the linear regression analysis the log-transformed

values were employed. The variables retained in the model after the backward linear

regression were ethnicity, age, educational level, the severity of periodontal destruction

(no. of teeth with ≥50% bone loss) and the anti-A. actinomycetemcomitans IgG levels

(Table 4.3). Ethnicity and age had the highest predictive value (P<0.001 and P=0.004,

respectively), whereas educational level, severity of periodontal destruction and anti-A.

actinomycetemcomitans IgG levels showed trends towards linear association (P=0.042,

P=0.083 and P=0.098, respectively); as ethnicity was the most significant predictor for the

higher sCD14 levels in this model, we applied the regression again for the sub-group of

subjects of Caucasian origin. Among these subjects, in addition to age (P=0.004), severity

of periodontal destruction (P=0.016), anti-A. actinomycetemcomitans IgG levels

(P=0.053), and smoking status (P=0.074) were retained in this model as important

predictors for the sCD14 levels. The proportion of variance (R-squared) explained by the

predictors retained in the final models was 25.9% for the regression model of the total

study group and 22.1% for the model on Caucasian subjects.

All Control Periodontitis Periodontitis

Correlation

coefficient

subjects subjects patients Moderate

Severe

of sCD14 with* n=162 n=57 n=105 n=59 n=46

Anti-Aa IgG -0.149 0.005 -0.262‡ -0.276† -0.279

Anti-Pg IgG 0.030 -0.063 -0.032 0.009 -0.110

CRP 0.173† 0.053 0.198† 0.311† 0.164

Leukocytes 0.237‡ 0.107 0.249† 0.245 0.228

Neutrophils 0.156† 0.020 0.172 0.162 0.186

Lymphocytes 0.220‡ 0.203 0.186 0.182 0.198

79


Table 4.3 Multivariate analysis of sCD14. *P-values from a multivariate analysis (backward stepwise linear regression with P=0.10 to enter and P=0.05 to leave) using the sCD14 levels as dependent variable and age, gender, ethnicity, smoking status, educational level, body mass index (BMI), total cholesterol levels, triglycerides levels, anti-Aa IgG levels, anti-Pg IgG levels and severity of periodontal destruction (no. teeth with ≥50%BL) as predictors; the regression coefficients, β, the 95% CI and the P-values of the predictors that remained in the final model are presented. BL=bone loss; Aa, A.actinomycetemcomitans; †As above (*), but for subjects of Caucasian background. ‡ n.r., not retained in the final model (P-value associated with this predictor was >0.10).

Discussion Periodontitis is a disease where bacteremias occur regularly due to a breach in the mucosal

barrier, while patients are not obviously ill. The aim of the current study was to investigate

sCD14 as a possible molecular link between atherosclerosis and chronic infectious

processes. Periodontitis served as a model of such chronic, underdiagnosed infectious

processes. We observed that higher values of sCD14 are more often present among

untreated periodontitis patients than among healthy controls. Our study is in agreement

with a previous report demonstrating increased serum sCD14 values in untreated

periodontitis Japanese patients (12). Furthermore, we demonstrated a positive correlation

of the sCD14 levels with the severity of periodontal destruction in periodontitis patients. It

is important to note that the sCD14 levels were positively correlated with established

systemic inflammatory markers, such as CRP and numbers of leukocytes. It has been

proposed that these markers could be elevated by undiagnosed, chronic infectious

processes; the consequences of the created pro-inflammatory milieu within the vasculature

could be the exacerbation of disease activity within atherosclerotic plaques and the

precipitation of acute cardiovascular events (25). sCD14 is involved in LPS-clearance (26)

and given the frequent low-grade bacteremias in periodontitis (5), leading to elevated

All subjects

n=162

Caucasians

n=107

β (95% CI) P* β (95% CI) P†

Ethnicity 0.251 (0.165, 0.337) <0.001 - -

Age 0.007 (0.002, 0.011) 0.004 0.005 (0.001, 0.009) 0.023

Educational level -0.087 (-0.171, -0.003) 0.042 n.r. ‡ -

No. teeth with ≥50%BL 0.007 (-0.001, 0.016) 0.083 0.010 (0.002, 0.019) 0.016

anti-Aa IgG levels -0.055 (-0.121, 0.010) 0.098 -0.068 (-0.136, 0.001) 0.053

Smoking n.r. ‡ - 0.098 (-0.010, 0.206) 0.074

80

Chapter 4

blood levels of LPS (8), the positive correlation with disease severity points into the

direction that the sCD14 increases with the need to remove LPS from circulation.

Therefore we propose that periodontitis is one of the undiagnosed infections inducing a

systemic, sub-clinical inflammatory reaction that contributes to an increased

atherothrombotic burden.

In this study we looked for alternative modifying factors that could induce

variation in the sCD14 levels measured. A role for the positive infectious serology with H.

pylori, C. pneumoniae and cytomegalovirus in the chronic inflammatory reaction in

patients with cardiovascular disease has been proposed (3). In our periodontitis model, we

investigated the relationship between history of infection with two Gram-negative

established periodontal pathogens, A. actinomycetemcomitans and P. gingivalis and the

sCD14 levels. The anti-P. gingivalis IgG were not correlated with the sCD14 levels. Our

results showed that the sCD14 levels were negatively associated with the levels of anti-A.

actinomycetemcomitans IgG in periodontitis patients (Table 4.2). We suggest that the

negative correlation demonstrates that with a poor IgG-response to A.

actinomycetemcomitans, sCD14 becomes increasingly important in the clearance of A.

actinomycetemcomitans-derived LPS.

The CD14−260 polymorphism has been described as a modifying factor for

myocardial infarction and atherosclerosis, in Asian and Caucasian populations; the T-

allele carriers have elevated levels of soluble and membrane-bound CD14 (18,27). Albeit

not conclusive, there are indications for the association of the CD14 T/T genotype with

severe periodontal disease (20). In our study, the CD14−260 genotypes were present with

similar frequency in patients and controls. Within the Caucasians, the allele frequencies

are similar to those reported in the literature (28,20). The sCD14 levels were not correlated

with the CD14−260 genotypes, neither in the entire group nor in the Caucasian sub-group.

The lack of association between the CD14−260 genotypes and sCD14 levels is not

completely surprising. Contradictory reports on the correlation between CD14−260

genotypes and sCD14 levels have been documented on even larger groups than the present

relatively-small study population; Koenig et al. (28) found a significant effect of the

CD14−260 genotypes on sCD14 in 312 Germans suffering from coronary artery disease, but

not in their age- and gender-matched 476 healthy controls. It could be speculated that it is

not the CD14-260 polymorphism per se that is responsible for modified CD14 levels, but

the linkage disequilibrium with other genetic variations, leading to conflicting results in

different ethnic groups (27).

81


In the current study, we found elevated sCD14 levels that were increasing with the

severity of periodontal destruction and were paralleled by markers of a systemic

inflammatory reaction. Our findings support the hypothesis of a pro-atherogenic milieu in

untreated periodontitis patients resulting from recurrent bacteremic episodes. Since

periodontal therapy results in a reduction of sCD14 plasma values (12), future strategies

for reducing the risk for cardiovascular events might consider periodontal therapy among

the prevention methods to reduce the overall pro-atherogenic burden. However, such

studies are still in demand.

Aknowledgements The present study was supported by The Netherlands Institute for Dental Sciences, Philips

Oral Healthcare EMEA and the INFOBIOMED Network of Excellence (IST

2002507585). We thank J. Pleijsters for the CD14 genotyping and J. Brunner, C.J. Bosch-

Tijhof and S. Asikainen for providing the bacterial strains used in the study.

REFERENCES

1 Anderson KM, Castelli WP, Levy D. 1987. Cholesterol and mortality. 30 years of

follow-up from the Framingham study. JAMA 257:2176-2180.

2 Hansson GK, Robertson AK, Soderberg-Naucler C. 2006. Inflammation and

atherosclerosis. Annu Rev Pathol 1:297-329.

3 Anderson JL, Carlquist JF, Muhlestein JB, Horne BD, Elmer SP. 1998.

Evaluation of C-reactive protein, an inflammatory marker, and infectious serology as

risk factors for coronary artery disease and myocardial infarction. J Am Coll Cardiol

32:35-41.

4 Ridker PM, Hennekens CH, Buring JE, Rifai N. 2000. C-reactive protein and other

markers of inflammation in the prediction of cardiovascular disease in women. N Engl

J Med 342:836-843.




82

Chapter 4











252:1321-1322.



11 Hettne KM, Weeber M, Laine ML, ten CH, Boyer S, Kors JA, Loos BG. 2007.

Automatic mining of the literature to generate new hypotheses for the possible link

between periodontitis and atherosclerosis: lipopolysaccharide as a case study. J Clin


12 Hayashi J, Masaka T, Ishikawa I. 1999. Increased levels of soluble CD14 in sera of

periodontitis patients. Infect Immun 67:417-420.

13 Liuzzo G, Angiolillo DJ, Buffon A, Rizzello V, Colizzi C, Ginnetti F, Biasucci LM,

Maseri A. 2001. Enhanced response of blood monocytes to in vitro

lipopolysaccharide-challenge in patients with recurrent unstable angina. Circulation

103:2236-2241.

14 Pugin J, Ulevitch RJ, Tobias PS. 1995. Activation of endothelial cells by endotoxin:

direct versus indirect pathways and the role of CD14. Prog Clin Biol Res 392:369-373.

15 Loppnow H, Stelter F, Schonbeck U, Schluter C, Ernst M, Schutt C, Flad HD.

1995. Endotoxin activates human vascular smooth muscle cells despite lack of

83


expression of CD14 mRNA or endogenous membrane CD14. Infect Immun 63:1020-

1026.

16 Lo SK, Cheung A, Zheng Q, Silverstein RL. 1995. Induction of tissue factor on

monocytes by adhesion to endothelial cells. J Immunol 154:4768-4777.

17 Baldini M, Lohman IC, Halonen M, Erickson RP, Holt PG, Martinez FD. 1999. A

Polymorphism* in the 5' flanking region of the CD14 gene is associated with

circulating soluble CD14 levels and with total serum immunoglobulin E. Am J Respir

Cell Mol Biol 20:976-983.

18 Hubacek JA, Pit'ha J, Skodova Z, Poledne R. 1999. C(-260)->T polymorphism in

the promoter of the CD14 monocyte receptor gene as a risk factor for myocardial

infarction. Circulation 99:3218-3220.

19 Rupp J, Goepel W, Kramme E, Jahn J, Solbach W, Maass M. 2004. CD14

promoter polymorphism -159C>T is associated with susceptibility to chronic

Chlamydia pneumoniae infection in peripheral blood monocytes. Genes Immun 5:435-

438.

20 Laine ML, Morre SA, Murillo LS, van Winkelhoff AJ, Pena AS. 2005. CD14 and

TLR4 gene polymorphisms in adult periodontitis. J Dent Res 84:1042-1046.

21 Nicu EA, van der Velden U, Everts V, Loos BG. 2008. Expression of FcRs and

mCD14 on polymorphonuclear neutrophils and monocytes may determine the

periodontal infection. Clinical & Experimental Immunology; in press



by elevated PAI-1 activity. J Clin Periodontol 34:574-580.

23 Friedewald WT, Levy RI, Fredrickson DS. 1972. Estimation of the concentration of

low-density lipoprotein cholesterol in plasma, without use of the preparative

ultracentrifuge. Clin Chem 18:499-502.

84

Chapter 4

24 Pussinen PJ, Vilkuna-Rautiainen T, Alfthan G, Mattila K, Asikainen S. 2002.

Multiserotype enzyme-linked immunosorbent assay as a diagnostic aid for

periodontitis in large-scale studies. J Clin Microbiol 40:512-518.

25 Danesh J, Collins R, Peto R. 1997. Chronic infections and coronary heart disease: is

there a link? Lancet 350:430-436.



27 Eng HL, Wang CH, Chen CH, Chou MH, Cheng CT, Lin TM. 2004. A CD14

promoter polymorphism is associated with CD14 expression and Chlamydia-

stimulated TNF alpha production. Genes Immun 5:426-430.

28 Koenig W, Khuseyinova N, Hoffmann MM, Marz W, Frohlich M, Hoffmeister A,

Brenner H, Rothenbacher D. 2002. CD14 C(-260)-->T polymorphism, plasma levels

of the soluble endotoxin receptor CD14, their association with chronic infections and

risk of stable coronary artery disease. J Am Coll Cardiol 40:34-42.

85

https://www.researchgate.net/publication/11534288_Multiserotype_Enzyme-Linked_Immunosorbent_Assay_as_a_Diagnostic_Aid_for_Periodontitis_in_Large-Scale_Studies?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



Chapter 5

Periodontitis is associated with platelet activation

D. Papapanagiotou1, ¶, E.A. Nicu1, ¶, , S. Bizzarro1, V.E.A. Gerdes2,3, J.C. Meijers2, R.

Nieuwland4, U. van der Velden1, B.G. Loos1

1 Department of Periodontology, Academic Centre for Dentistry Amsterdam (ACTA), Universiteit van

Amsterdam and VU University Amsterdam 2 Department of Vascular Medicine, Academic Medical Center (AMC), Universiteit van Amsterdam

3 Department of Internal Medicine, Slotervaart Hospital, Amsterdam 4 Department of Clinical Chemistry, Academic Medical Center (AMC), Universiteit van Amsterdam, The

Netherlands

Atherosclerosis; in press 2008

¶ These authors contributed equally to the present study.

87


Abstract There is an epidemiological association between periodontitis and cardiovascular disease

(CVD). In periodontitis, low grade systemic inflammation and bacteremia occur regularly.

Such events may contribute to platelet activation and subsequent pro-coagulant state. This

study aimed to investigate platelet activation in periodontitis patients.

The study is composed of two parts. In the first part, plasma levels of soluble (s) P-selectin

and sCD40 ligand were measured as general markers of platelet activation in periodontitis

patients (n=85) and in healthy controls (n=35). In the second part, surface-exposed P-

selectin and the ligand-binding conformation of the glycoprotein IIb-IIIa complex (binding

of PAC-1 antibody) were determined on individual platelets in whole blood of

periodontitis patients (n=18) and controls (n=16). Patients had significantly elevated

plasma levels of sP-selectin (P<0.001) and increased binding of PAC-1 on isolated

platelets (P=0.033). Platelet activation was more pronounced in the patients with more

severe periodontal disease, showing a severity-dependence. The levels of sCD40 ligand

and of platelet-bound P-selectin were not increased.

Periodontitis is associated with increased platelet activation. Since platelet activation

contributes to a pro-coagulant state and constitutes a risk for atherothrombosis, platelet

activation in periodontitis may partly explain the epidemiological association between

periodontitis and CVD.

88

Chapter 5

Introduction Periodontitis is a chronic infectious disease of the supportive tissues of the teeth, which

may lead to loss of teeth. It is one of the most common infections in humans, affecting in

its most severe form, approximately 10% of the population (1). Inflammation of

periodontal tissues results in periodontal pocket formation and ulceration of the epithelial

lining. In this way, periodontal pockets form ports of entry, which may lead to transient

bacteremias (2,3). Regularly occurring bacteremias in periodontitis patients underlie

chronic production of pro-inflammatory mediators like interleukin (IL)-1β, IL-6, C-reactive

protein and tumor-necrosis factor (TNF)-α (4,5,6).

One of the features of systemic inflammation is an increase in the number of

platelets and platelet activation (7). Also periodontitis has been associated with elevated

numbers of platelets (8). Furthermore, platelet numbers decrease after periodontal therapy

(9). Interestingly, strains of the recognized periodontal pathogen Porphyromonas gingivalis

(P. gingivalis), but also other dental plaque bacteria, such as Streptococcus sanguis, induce

platelet activation and aggregation in vitro and in animal studies (10,11). Activation of

platelets leads to their release of pro-inflammatory mediators and exposure of pro-

inflammatory receptors, resulting in platelet binding to leukocytes and endothelial cells (7).

These functions make platelets essential participants in both thrombotic and inflammatory

reactions across the vasculature (12). Platelet activation has been implicated in the

development of atherosclerosis, atherothrombosis and subsequent coronary vascular and

cerebrovascular diseases (13).

Epidemiological and intervention studies have associated periodontitis with

atherosclerosis and cardiovascular diseases (CVD). The underlying mechanisms of this

relationship are still obscure (14,15). Nevertheless endotoxemia and in particular, systemic

exposure to P. gingivalis and the severity of periodontal disease seem be important risk

factors for CVD in periodontitis patients (16,17,18,19). We hypothesize that platelet

activation in periodontal patients may be an important link between periodontitis and CVD.

The aim of this study was to investigate whether periodontitis patients have a

higher state of platelet activation compared to healthy controls.

89



The present study consists of two parts. The study population of the first part has been

described previously (20) and included 85 consecutive periodontitis patients and 35 healthy

controls. On the basis of an extensive medical history by a written questionnaire and by

interview, the following subjects were not included in the study: pregnant women and

individuals who suffered from any given disease or chronic medical condition, apart from

periodontitis, or had trauma or tooth extractions in the last two weeks, or received

antibiotics within the last 3 months or any chronic medication. All background

characteristics are derived from the previous study (20).

Concentrations of soluble (s) sP-selectin (sCD62P) and sCD40 ligand were

determined in plasma samples collected from these periodontitis patients and controls. The

results suggested that platelet activation was present in periodontitis. Therefore, the second

study was initiated to further explore the possibility that platelets are activated in

periodontitis. This time the focus was laid on measurements of platelet-bound activation

markers, evaluated by means of flow cytometry of fresh platelets.

For this second study, a new study population was recruited, applying similar

inclusion and exclusion criteria as in the first study. Based on the P-selectin results in the

first study (mean ± SD: 58.1± 26.1 ng/mL for controls, 82.9 ± 34.7 ng/mL for patients) the

sample size for the second study was estimated using α=0.05 and β=0.20 (80% power). The

sample size needed was 18 participants for each of the control and patient groups. Subjects

with platelet counts of >350x109/ L (thrombocytosis) were excluded (13). Eighteen

consecutive periodontitis patients were included and for each patient an age-, gender-, race-

, and smoking status matched healthy control was recruited. After their initial inclusion,

two control subjects were excluded from analysis, because one subject had a platelet count

>350x109/L and the other subject appeared to suffer from mild periodontitis. Both platelet-

bound P-selectin and binding of PAC-1 on individual platelets were measured in this cohort

by whole-blood flow cytometry. All subjects were both verbally and written informed

about the purpose of the study and had signed an informed consent. The Medical Ethical

Committee of the Academic Medical Center of the University of Amsterdam approved the

study.

90

Chapter 5

Blood collection

In the first study, fasting venous blood samples were obtained without stasis by

venipuncture in the antecubital fossa between 8.30 and 11.30 AM. Blood, collected in

EDTA, was used to determine leukocyte counts. In addition, a second EDTA-blood tube

(10 mL) was centrifuged at 3000 rpm for 10 minutes at room temperature. EDTA plasma

was divided in aliquots and stored at -80°C until analysis.

In the second study, fasting venous blood samples were collected by venipuncture

of the antecubital fossa, through a 19G butterfly needle (Vygon Nederland BV,

Valkenswaard, The Netherlands) without venous stasis. For whole-blood flow cytometry,

0.32% citrate-anticoagulated blood was processed within 5 minutes after collection.

Soluble (s) P-selectin and sCD40 ligand

Plasma levels of sP-selectin and sCD40 ligand were determined by ELISA (R&D systems,

Abingdon, UK), according to the manufacturers instructions. EDTA plasma specimens

were diluted 1:20. For the sP-selectin ELISA, the diluted samples (in duplicate) together

with the peroxidase-conjugated polyclonal antibody against P-selectin were incubated for

1h in a 96-well plate precoated with the anti-human P-selectin monoclonal antibody. The

plate was washed three times with 300 µl “Wash buffer”. After washing, the “Substrate”

was added, followed by 30min incubation and the reaction was stopped adding “Stop

Solution” to each well.

For the sCD40 ligand ELISA, the samples were incubated in duplicate for 2h, at

room temperature in a 96-well plate precoated with the anti-human CD40 ligand

monoclonal antibody. The plate was washed four times with 400 µl “Wash buffer” and

incubated for another 2h with the polyclonal antibody against sCD40 ligand conjugated

with peroxidase. Absorbance values were measured at 450 nm with a multilabel counter

(Wallac Victor2 1420, Perkin-Elmer Life Sciences, Boston, MA). The concentration of each

sample was determined by extrapolation from a standard curve estimated from a panel of

standards of known concentrations. Reagents marked in quotes were all from the R&D

ELISA kits. The intra- and inter-assay coefficients of variation were 5.1 and 6.4%, for

sCD40 ligand and 5.1 and 9.9 % for sP-selectin, respectively.

91


Whole blood flow cytometry

Aliquots of blood (5 µL) were diluted in 30 µL HEPES buffer (137 mM NaCl, 2.7 mM

KCl, 1.0 mM MgCl2, 5.6 mM glucose, 20 mM HEPES, 1 mg/ml bovine serum albumin,

3.3 mM NaH2PO4, pH 7.4). In addition, the labeling tubes contained 4 µg/mL PerCP-

labeled anti-CD61 (5 µL), 4 µg/ml PE-labeled anti-CD62p (5 µL) and 4 µg/mL FITC-

labeled PAC-1 (5 µL). To set fluorescence thresholds, 4 µg/mL PE-IgG1 and 4 µg/mL

FITC-IgM isotype control antibodies were used. After mixing and 30 minutes incubation at

room temperature in the dark, 2.5 mL HEPES buffer containing formaldehyde (0.2% final

concentration) was added. CD61-PerCP and PAC-1 FITC were obtained from Becton

Dickinson Immunocytometry Systems (San Jose, CA, USA), PE-labeled CD62P from

Immunotech (Marseille, France), PE-labelled IgG1 from Sanquin Reagents (Amsterdam,

The Netherlands), and IgM-FITC from Beckman-Coulter (Fullerton, CA, USA). Flow

cytometry was performed as described previously (21,22). After fixation, blood samples

were analyzed in a FACScan flow cytometer with CellQuest software (Becton Dickinson).

Forward and side scatter were set at logarithmic gain. Platelets were identified by

characteristic forward and side scatter, and PerCP fluorescence. Exposure of platelet

activation markers was determined in 5000 platelets. The threshold for platelet activation

was arbitrarily set at 1% fluorescence-positive platelet activation with the appropriate

control antibody.


Means, standard deviations, medians and frequency distributions were calculated.

Differences in population background characteristics in both parts of the study were

analyzed by t-tests or χ 2 - test (or Fisher’s exact test, where needed). To correct for

differences in background that were statistically significant between patients and controls

in the first study, a general linear model (GLM) was constructed with periodontal condition

as factor, and age, educational level, systolic blood pressure, total cholesterol, and

triglycerides as co-variates. From the GLM, adjusted means, confidence intervals and

PGLM-values were obtained. In the first study, a χ2-test was performed to test the distribution

of controls and periodontitis patients with sP-selectin and sCD40 ligand levels below and

above the respective population medians. Partial correlation coefficients between sP-

selectin and sCD40 ligand were calculated, both within patients and control groups,

correcting for the same co-variates included in the GLM. To analyze a possible effect of

periodontal disease severity on the soluble platelet parameters, a stepwise linear regression

92

Chapter 5

analysis was conducted, within the patient group in the first study, using sP-selectin or

sCD40 ligand as dependent variables and severity of periodontal disease (severe patients

were those with ≥7 teeth with ≥50% bone loss), age, gender, ethnicity, smoking status,

educational level, body mass index (BMI), systolic blood pressure, total cholesterol, and

triglycerides as predictors.

In the second study, the % of cells exposing P-selectin and the % of cells binding

PAC-1 showed a skewed distribution (Kolmogorov-Smirnov goodness of fit test P<0.05).

These data were log transformed before statistical analysis. Subsequently, t-tests were

employed for the analysis of platelet activation data. To explore the potential confounding

of the non-matched background characteristics on platelet-bound P-selectin and PAC-1

binding, a GLM was constructed using periodontal condition as factor and educational

level, BMI, systolic blood pressure, total cholesterol and triglycerides as co-variates. Also

for the patients in the second part of the study, correlation coefficients between platelet

activation markers and periodontitis severity (number of teeth with ≥50% bone loss) were

computed. P-values <0.05 were considered statistically significant.

Results Study population

Tables 5.1 and 5.2 summarize the background characteristics of the study populations of

the first and second study, respectively. As shown in Table 5.1, several differences were

present in the first study between groups, including age, educational level, systolic blood

pressure, cholesterol, and triglycerides. As defined before (20), in the first study patients

suffering from moderate (n=51) or severe (n=34) periodontitis were included. In the second

part of our study, again moderate (n=10) as well as severe (n=8) periodontitis patients were

included. Patients had significantly higher fibrinogen and platelet counts than controls

(Table 5.2).

93


Control Periodontitis

n=35 n=85 P-value

Background characteristics

Age 37.6 ± 9.1 44.7 ± 8.8 0.0001

Gender (males) 12 (34%) 41 (48%) 0.225

Ethnicity (Caucasian) 30 (86%) 70 (82%) 0.791

Smoking (smokers) 12 (34%) 40 (47%) 0.228

Education (<high school) 11 (31%) 46 (54%) 0.028

BMI (kg/m2) 24.0 ± 3.5 25.4 ± 4.3 0.088

Blood Pressure (mmHg)

Systolic 114.3 ± 13.1 122.1 ± 19.1 0.034

Diastolic 73.6 ± 11.5 75.3 ± 11.5 0.465

Total cholesterol (mmol/L) 5.0 ± 0.9 5.5 ± 1.1 0.042

HDL (mmol/L) 1.5 ± 0.3 1.3 ± 0.4 0.106

LDL (mmol/L) 3.0 ± 0.9 3.5 ± 1.0 0.022

Triglycerides (mmol/L) 1.2 ± 0.6 1.5 ± 0.8 0.034

Systemic inflammatory markers

Leukocytes (x109 /L)

Total 5.7 ± 1.2 7.1 ± 2.5 0.003

Neutrophils 3.2 ± 1.0 4.1 ± 1.6 0.001

Lymphocytes 1.9 ± 0.4 2.3 ± 0.7 0.005

Fibrinogen (g/L) 2.8 ± 0.5 3.1 ± 0.7 0.012

C-reactive protein (mg/L) 1.8 ± 1.8 2.9 ± 3.4 0.078

Dental characteristics

No. of teeth present 28.2 ± 1.8 26.0 ± 3.4 0.001

No. of teeth with bone loss

≥ 30% 0.0 ± 0.2 16.2 ± 6.6

≥ 50% 0.0 ± 0.0 5.6 ± 5.0

Table 5.1 Characteristics of the subjects participating in the first study. Values are means ± SD or numbers (%) of subjects; P-values are from t-test or χ2-test (or Fisher’s exact test, where needed). BMI indicates Body Mass Index.

94

Chapter 5


n=16 n=18 P-value

Background characteristics

Age 40.8 ± 10.8 42.8 ± 9.5 0.565

Gender (males) 5 (31%) 6 (33%) 1.000


Smoking (smokers) 4 (25%) 6 (33%) 0.715


BMI (kg/m2) 25.9 ± 6.1 25.7 ± 2.9 0.886


Systolic 130.6 ± 18.5 127.6 ± 14.5 0.606

Diastolic 86.2 ± 10.0 86.5 ± 10.3 0.929

Total cholesterol (mmol/L) 4.9 ± 1.0 5.2 ± 1.2 0.486

HDL (mmol/L) 1.3 ± 0.3 1.2 ± 0.4 0.563

LDL (mmol/L) 3.2 ± 0.9 3.2 ± 0.8 0.903

Triglycerides (mmol/L) 0.9 ± 0.7 1.7 ± 2.5 0.194

Systemic inflammatory markers

Leukocytes (x109/L)

Total 5.7 ± 1.6 6.7 ± 2.0 0.123

Neutrophils 3.2 ± 1.1 3.9 ± 1.4 0.140

Lymphocytes 1.9 ± 0.6 2.1 ± 0.5 0.262

Fibrinogen (g/L) 3.0 ± 0.5 3.6 ± 0.5 0.002

C-reactive protein (mg/L) 2.4 ± 4.2 3.8 ± 5.2 0.397

Platelet count (x109/L) 241 ± 44 279 ± 52 0.029

Dental characteristics

No. of teeth present 28.6 ± 1.4 26.6 ± 2.9 0.021

No. of teeth with

≥ 30% bone loss 0.0 ± 0.0 17.1 ± 5.2

≥ 50% bone loss 0.0 ± 0.0 6.2 ± 3.7

Soluble platelet activation markers

sP-selectin (ng/mL) 49.5 ± 13.6 56.9 ± 17.5 0.182

sCD40 ligand (pg/mL) 155 ± 114 217 ± 134 0.159

Table 5.2 Characteristics of the subjects participating in the second study. Values are means ± SD or numbers (%) of subjects; P-values are from t-test or χ2-test (or Fisher’s exact test, where needed). BMI indicates Body Mass Index.

95


Soluble (s) P-selectin and CD40 ligand

The data in Table 5.3 are presented both as measured values (mean ± SD) and after

correction by GLM (adjusted means and confidence intervals). Plasma levels of sP-selectin

were significantly elevated in periodontitis patients (Table 5.3). Also after adjusting for

potential confounders (age, educational level, systolic blood pressure, cholesterol, and

triglycerides), this differences remained highly significant. The median value of sP-selectin

(68 ng/mL) for the total study population was selected as cut-off point for the frequency

distribution analysis. There were more periodontitis patients with sP-selectin above the

median than controls.

Plasma levels of sCD40 ligand were somewhat higher in periodontitis patients, but

not significantly different from controls (Table 5.3). The study population median for

CD40 ligand was 609 pg/mL, which was used as cut-off point for the frequency

distribution analysis. The distribution of subjects with sCD40 ligand values above the

population median was not different between periodontitis patients and controls.

Overall, the plasma concentrations of sP-selectin and sCD40 ligand were highly

associated (Fig. 5.1). Also after adjusting for the same covariates as in the GLM, the


n=35 n=85 P-value

sP-selectin (ng/mL)

Mean ± SD* 58.1 ± 26.1 82.9 ± 34.7 0.0002

Adj. mean (CI)† 61.2 (49.6-72.8) 81.6 (74.5-88.7) 0.005

# subjects ≥68 ng/mL‡ 11 (31.4%) 50 (58.8%) 0.009

sCD40 ligand (pg/mL)

Mean ± SD* 624 ± 564 794 ± 647 0.180

Adj. mean (CI)† 639 (408-863) 789 (648-930) 0.278

# subjects ≥609 pg/mL‡ 15 (42.8%) 46 (54.1%) 0.317

Table 5.3 Plasma levels of the soluble platelet activation markers sP-selectin and sCD40 ligand in the subjects in the first study. * Raw data and P-value from t-test. † Adjusted (Adj.) means, confidence intervals (CI) and PGLM from a general linear model (GLM) correcting for age, educational level, systolic blood pressure, total cholesterol and triglycerides. ‡ Tested with χ2-test and the Pχ2 -values are given.

96

Chapter 5

correlation remained strong (overall partial correlation coefficient radj=0.496, Padj<0.001);

this correlation was not found within the control subjects (radj=0.352, Padj=0.056), but was

very strong within periodontitis patients (radj=0.566, Padj<0.001).

In a stepwise linear regression analysis, the severity of periodontitis (i.e. moderate

or severe) was the strongest predictor of sP-selectin levels, with severe periodontitis

patients having higher sP-selectin than moderate periodontitis patients (β=0.258, P=0.010),

while all of the background characteristics were not significantly contributing to the sP-

selectin. sCD40 ligand values were not predicted by disease severity or by any of the

background characteristics of the patients.

Fig. 5.1 sP-selectin and sCD40 ligand plasma levels in the first study in patients (closed triangles) and controls (open circles). Each symbol represents one subject. There was an overall correlation between sP-selectin and sCD40 ligand (continuous line, Pearson’s correlation coefficient r=0.500, P<0.001), originating mainly from patients (dotted line, r=0.547, P<0.001) and not from controls (dashed-dotted line, r=0.281, P=0.102).

97


Platelet-bound P-selectin and binding of PAC-1

In the second study the fraction (%) of platelets binding anti-P-selectin was not

significantly different between patients and controls (Fig. 5.2A). The % of platelets

expressing P-selectin was not significantly correlated with the number of teeth with ≥50%

bone loss (r=0.293, P=0.093). Furthermore, the amount of surface expressed P-selectin, as

reflected by the mean fluorescence intensity (MFI), was comparable in patients and

controls (Fig. 5.2B). The P-selectin MFI was not correlated with the number of teeth with

≥50% bone loss (r=0.168, P=0.342).

In contrast, the fraction of platelets binding PAC-1, i.e. the antibody specifically

binding to the fibrinogen-binding (activated) conformation of the platelet glycoprotein IIb-

IIIa complex, was elevated in periodontitis patients compared to controls (Fig. 5.2C,

P=0.033). This % of PAC-1 binding platelets remained elevated (PGLM= 0.030) in patients

after correcting for non-matched background characteristics (educational level, BMI,

systolic blood pressure, cholesterol, triglycerides). Moreover, in patients, the fraction of

platelets binding PAC-1 was significantly correlated with the number of teeth with ≥50%

bone loss (r=0.388, P=0.023). Also the extent of binding of PAC-1, as reflected by MFI,

Fig. 5.2 Flow cytometric determination of platelets exposing P-selectin and binding of PAC-1. (A) % of positive cells and (B) mean fluorescence intensity (MFI) of P-selectin, (C) % of positive cells and (D) MFI of PAC-1, in patients (n=18) and controls (n=16) in the second study. Bar graphs represent mean ± SD.

98

Chapter 5

was increased in patients compared to controls (Fig. 5.2D, P=0.039) and showed a severity-

dependence (number of teeth with ≥50% bone loss, r=0.377, P=0.028). The PAC-1 MFI

was still significantly increased in periodontitis patients after correcting for non-matched

background characteristics (PGLM= 0.032).

Discussion The present study investigated whether periodontitis is associated with increased activation

of platelets. The results of our study indicated for the first time increased platelet activation

in periodontitis patients compared to healthy controls. This was based on elevated levels of

sP-selectin, which we found to be positively associated with periodontitis severity. These

results were for us the first indication that human periodontitis in vivo may indeed be

associated with platelet activation. In the second study, using flow cytometry, and thus

enabling the direct detection of single activated platelets in whole blood, increased platelet

activation was demonstrated, confirming the results of the first study.

Although the levels of sCD40 ligand showed a tendency to be elevated in

periodontitis patients and also correlated with the levels of sP-selectin, this increase did not

reach statistical significance. CD40 ligand is a glycoprotein found on a large variety of

cells including B-cells, T-cells, basophiles, eosinophiles, and epithelial cells (23). Platelets

carry preformed CD40 ligand that becomes exposed on the cell surface during platelet

activation (24). In a subsequent cleavage step, the soluble form sCD40 ligand is generated.

It has been estimated that 95% of the circulating sCD40 ligand is of platelet origin. (25)

Nevertheless, throughout the literature differences have been reported with regard to the

extent of various platelet activation markers, which is due to the relative contributions of

activation and inactivation pathways that differ between clinical conditions (26).

We demonstrated for the first time that binding of PAC-1, a recognized measure of

platelet activation, was increased in periodontitis. Not only did patients have an increased

fraction of platelets binding PAC-1, but also the extent of binding of PAC-1 to individual

platelets was increased compared to controls. Moreover, the proportion of platelets binding

PAC-1 correlated with the periodontal disease severity, indicating a severity dependent

relationship. These results further suggest that platelet activation indeed occurs in

periodontitis. PAC-1 binds to the ligand-binding conformation of the (activated)

glycoprotein (GP) IIb/IIIa, the most abundant receptor on the platelet surface. It has been

shown that binding of fibrinogen to (activated) GP IIb/IIIa can be a more sensitive marker

99


of platelet activation than exposure of P-selectin (26). Furhermore, it has been

demonstrated in an animal study that activated platelets, expressing membrane-bound P-

selectin, become P-selectin negative in a proportion >95% within two hours after activation

(27), but continue to circulate in blood and be responsive to platelet-activating agents. The

P-selectin released from activated platelets is found in plasma as sP-selectin. Possibly, this

latter phenomenon explains why in periodontitis patients we found increased sP-selectin,

while platelet-bound P-selectin was not increased.

It should be recognized that not only platelets but also endothelial cells are a

potential source of sP-selectin (28). However, there are reasons to assume that in the

present cohort elevation of sP-selectin originates mainly from platelets: I) Plasma levels of

von Willebrand factor (20), a marker of endothelial activation, were not associated with sP-

selectin (r=-0.005, p=0.953). II) We found a significant association between plasma levels

of sP-selectin and sCD40 ligand, i.e. two markers of platelet activation, in the present

study. III) FACS analyses performed in the second study showed platelet activation. IV)

The Michelson et al study showed that activated platelets shed their membrane-bound P-

selectin, which is to be found in plasma as sP-selectin (27). We suggest that these

observations support our notion that the elevated sP-selectin plasma levels in the present

study are of platelet, rather than of endothelial origin, and therefore are likely to represent

platelet activation.

We speculate that a higher incidence of bacteremias and dissemination of bacterial

products and inflammatory cytokines in periodontal patients compared to healthy controls

provide an explanation for the current findings (4,3,5,6). Activated platelets release an

arsenal of potent inflammatory and mitogenic substances into the local microenvironment,

thereby altering chemotactic and adhesive properties of endothelial cells (29,30). These

molecules acting together, accelerate inflammatory processes, enhance cell recruitment,

and make platelets crucial participants in activation and proliferation of the endothelium.

The higher number of platelets as well as activated platelets may contribute also to the pro-

coagulant state in periodontitis, a condition reported in periodontitis on the basis of

elevated PAI-1(20). We believe that the subtle platelet activation occurring in periodontitis

helps explaining the epidemiological observations of increased risk for coronary heart

disease in subjects with periodontal disease compared to subjects with no periodontal

disease (14). A similar association is found between periodontitis and stroke, especially in

individuals younger than 65 years of age (14). In subjects at risk for myocardial infarction

or stroke due to an extensive atherosclerosis process, a pre-existent state of platelet

100

Chapter 5

activation and a pro-coagulant state will add to the blood clot formation at time of

atherosclerotic plaque rupture (31,32).

Randomized controlled clinical trials studying the effects of treatment of

periodontitis on platelet activation may provide further insight on the contribution of this

chronic infectious condition to atherothrombosis. One intervention study showed that

treatment of patients with periodontitis is followed by an improvement of endothelial

function (15). Although the biological basis of this improvement is unknown, one may

speculate that reduced platelet activation and its concurrent pro-coagulant phenotype may

be part of the explanation. Within our department, a study has been initiated to evaluate

whether periodontal therapy indeed affects platelet activation and pro-thrombotic

phenotype in periodontitis patients.

In conclusion, we provide evidence that periodontitis is associated with increased

platelet activation. Our findings suggest that also via platelet activation, periodontitis may

constitute a risk for CVD.

Acknowledgments The present study was supported by The Netherlands Institute for Dental Sciences and

Philips Oral Healthcare EMEA.

We thank Marianne Schaap for expert technical assistance.

REFERENCES


366:1809-1820.







101

https://www.researchgate.net/publication/7470839_The_Periodontal_diseases?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/7470839_The_Periodontal_diseases?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=


4 D'Aiuto F, Parkar M, Nibali L, Suvan J, Lessem J, Tonetti MS. 2006. Periodontal

infections cause changes in traditional and novel cardiovascular risk factors: results

from a randomized controlled clinical trial. Am Heart J 151:977-984.


76:2106-2115.


on C-reactive protein in relation to periodontitis. J Clin Periodontol



8 Wakai K, Kawamura T, Umemura O, Hara Y, Machida J, Anno T, Ichihara Y,

Mizuno Y, Tamakoshi A, Lin Y, Nakayama T, Ohno Y. 1999. Associations of

medical status and physical fitness with periodontal disease. J Clin Periodontol

26:664-672.

9 Christan C, Dietrich T, Hagewald S, Kage A, Bernimoulin JP. 2002. White blood

cell count in generalized aggressive periodontitis after non-surgical therapy. J Clin


10 Herzberg MC and Weyer MW. 1998. Dental plaque, platelets, and cardiovascular

diseases. Ann Periodontol 3:151-160.

11 Lourbakos A, Yuan Y, Jenkins AL, Travis J, Andrade-Gordon P, Santulli R,

Potempa J, Pike RN. 2001. Activation of protease-activated receptors by gingipains

from Porphyromonas gingivalis leads to platelet aggregation: a new trait in microbial

pathogenicity. Blood 97:3790-3797.

12 Weyrich AS, Lindemann S, Tolley ND, Kraiss LW, Dixon DA, Mahoney TM,

Prescott SP, McIntyre TM, Zimmerman GA. 2004. Change in protein phenotype

without a nucleus: translational control in platelets. Semin Thromb Hemost 30:491-

498.

13 Kamath S, Blann AD, Lip GY. 2001. Platelet activation: assessment and

quantification. Eur Heart J 22:1561-1571.

102

Chapter 5




15 Tonetti MS, D'Aiuto F, Nibali L, Donald A, Storry C, Parkar M, Suvan J,

Hingorani AD, Vallance P, Deanfield J. 2007. Treatment of periodontitis and

endothelial function. N Engl J Med 356:911-920.





17 Pussinen PJ, Alfthan G, Jousilahti P, Paju S, Tuomilehto J. 2007. Systemic

exposure to Porphyromonas gingivalis predicts incident stroke. Atherosclerosis

193:222-228.

18 Holmlund A, Holm G, Lind L. 2006. Severity of periodontal disease and number of

remaining teeth are related to the prevalence of myocardial infarction and hypertension

in a study based on 4,254 subjects. J Periodontol 77:1173-1178.

19 Mustapha IZ, Debrey S, Oladubu M, Ugarte R. 2007. Markers of systemic bacterial

exposure in periodontal disease and cardiovascular disease risk: a systematic review

and meta-analysis. J Periodontol 78:2289-2302.



by elevated PAI-1 activity. J Clin Periodontol 34:574-580.

21 Shattil SJ, Motulsky HJ, Insel PA, Flaherty L, Brass LF. 1986. Expression of

fibrinogen receptors during activation and subsequent desensitization of human

platelets by epinephrine. Blood 68:1224-1231.

22 Shattil SJ, Cunningham M, Hoxie JA. 1987. Detection of activated platelets in

whole blood using activation-dependent monoclonal antibodies and flow cytometry.

Blood 70:307-315.

103

https://www.researchgate.net/publication/6301301_Periodontitis_is_characterized_by_elevated_PAI-1_activity?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/6913057_Systemic_exposure_to_Porphyromonas_gingivalis_predicts_incident_stroke?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/5794812_Markers_of_Systemic_Bacterial_Exposure_in_Periodontal_Disease_and_Cardiovascular_Disease_Risk_A_Systematic_Review_and_Meta-Analysis?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/6978370_Severity_of_Periodontal_Disease_and_Number_of_Remaining_Teeth_Are_Related_to_the_Prevalence_of_Myocardial_Infarction_and_Hypertension_in_a_Study_Based_on_4254_Subjects?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/19383036_Expression_of_fibrinogen_receptors_during_activation_and_subsequent_desensitization_of_human_platelets_by_epinephrine?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=




23 Schonbeck U, Mach F, Libby P. 2000. CD154 (CD40 ligand). Int J Biochem Cell

Biol 32:687-693.

24 Gawaz M. 2004. Role of platelets in coronary thrombosis and reperfusion of ischemic

myocardium. Cardiovasc Res 61:498-511.

25 Freedman JE. 2003. CD40-CD40L and platelet function: beyond hemostasis. Circ

Res 92:944-946.

26 Holmes MB, Sobel BE, Howard DB, Schneider DJ. 1999. Differences between

activation thresholds for platelet P-selectin and glycoprotein IIb-IIIa expression and

their clinical implications. Thromb Res 95:75-82.

27 Michelson AD, Barnard MR, Hechtman HB, MacGregor H, Connolly RJ,

Loscalzo J, Valeri CR. 1996. In vivo tracking of platelets: circulating degranulated

platelets rapidly lose surface P-selectin but continue to circulate and function. PNAS

93:11877-11882.

28 Burger PC and Wagner DD. 2003. Platelet P-selectin facilitates atherosclerotic

lesion development. Blood 101:2661-2666.

29 Huo Y and Ley KF. 2004. Role of platelets in the development of atherosclerosis.

Trends Cardiovasc Med 14:18-22.

30 Gawaz M. 2003. Do platelets trigger atherosclerosis? Thromb Haemost 90:971-972.

31 Sakariassen KS and Barstad RM. 1993. Mechanisms of thromboembolism at arterial

plaques. Blood Coagul Fibrinolysis 4:615-625.

32 Holvoet P and Collen D. 1997. Thrombosis and atherosclerosis. Curr Opin Lipidol

8:320-328.

104

Chapter 6

Elevated platelet and leukocyte response to oral bacteria in

periodontitis

E.A. Nicu1, U. van der Velden1, R. Nieuwland2, V. Everts3, B.G. Loos1

Departments of 1 Periodontology and 3 Oral Cell Biology, Academic Centre for Dentistry Amsterdam

(ACTA), University of Amsterdam and VU University Amsterdam, The Netherlands

2 Department of Clini cal Chemistry, Academic Medical Center (AMC), University of Amsterdam, The

Netherlands

Journal of Thrombosis and Haemostasis; in press 2008

105

Chapter 6

Abstract Periodontitis is associated with an increased risk for cardiovascular diseases (CVD), but

the underlying mechanisms are poorly understood. Recently, we showed that platelets

from periodontitis patients are more activated than those from controls. Given the

regularly occurring bacteremic episodes in periodontitis patients, we hypothesized that

platelets and/or leukocytes from periodontitis patients are more sensitive to stimulation by

oral bacteria, in particular the known periodontal pathogens, than platelets from control

subjects. Three-color flow cytometry analysis was performed to quantify activation of

platelets (P-selectin, PAC-1, CD63) and leukocytes (CD11b) in whole blood from patients

with periodontitis (n=19) and controls (n=18), with and without stimulation by oral

bacteria. Phagocytosis was assessed by using green-fluorescent protein (GFP)-expressing

Aggregatibacter actinomycetemcomitans. Neutrophils and monocytes were activated by

all species of oral bacteria tested, but no differences were observed between patients and

controls. In response to several species of oral bacteria, platelets from periodontitis

patients showed –compared to controls– increased exposure of P-selectin (P=0.027) and

increased formation of platelet-monocyte complexes (P=0.040). Platelet-leukocyte

complexes bound and/or phagocytosed more GFP-A. actinomycetemcomitans than

platelet-free leukocytes (for neutrophils and monocytes, in both patients and controls

P<0.001). In periodontitis, increased platelet response to oral bacteria is paralleled by

increased formation of platelet-leukocyte complexes with elevated capacity of bacterial

clearance. We speculate that activated platelets and leukocytes might contribute to

increased atherothrombotic activity.

106

Elevated platelet and leukocyte response to oral bacteria in periodontitis

Introduction Systemic inflammation may have an atherogenic effect at different levels (1). In addition

to induced endothelial dysfunction and induced secondary dyslipidemia, systemic

inflammation can activate the coagulation cascade (2), a process mainly mediated by

tissue factor (3). Platelets also contribute to activation of coagulation when they are

primed during systemic inflammation; this process is closely related to atherothrombosis

(4). Activated platelets release chemokines and cytokines, and expose pro-inflammatory

receptors, facilitating their binding to leukocytes and endothelial cells (5). Platelet-

leukocyte (i.e. platelet-neutrophil and platelet-monocyte) complexes are a sensitive

marker for platelet activation and have a proposed role in plaque instability, thrombosis

and inflammation (6). Increased numbers of circulating complexes have been reported in

patients with unstable angina, myocardial infarction and stroke (7,8,9). The correlation

between systemic inflammation and atherothrombosis is sustained by an increased

incidence of cardiovascular disease (CVD) in patients with systemic lupus erythematosus,

rheumatoid arthritis, inflammatory bowel disease or periodontitis as compared to subjects

without an inflammatory disease (2,10).

Periodontitis is an infectious disease of the supportive tissues of the teeth,

characterized by gradual loss of tooth supporting alveolar bone, and affects up to 10% of

the population in its most severe form (11). The primary etiologic factor of periodontitis is

the subgingival infection with a group of Gram-negative pathogens. The major bacterial

species associated with periodontitis are Aggregatibacter actinomycetemcomitans (A.

actinomycetemcomitans), Porphyromonas gingivalis (P. gingivalis) and Tannerella

forsythia (T. forsythia) (12). Inflammation in the periodontal tissues results in areas of

ulceration of the epithelium in the periodontal pocket, which leads to dissemination of oral

bacteria into the circulation during mastication (13). Transient bacteremias in periodontitis

patients underlie chronic production and systemic increases of various pro-inflammatory

mediators, including interleukin (IL)-1β, IL-6, C-reactive protein and tumor-necrosis

factor (TNF)-α (14,15).

In a previous study, we have shown that platelets from periodontitis patients have

an increased activation status compared to platelets from healthy controls (16). Strains of

the periodontal pathogen P. gingivalis, but also species of the oral commensal microflora,

such as Streptococcus sanguis (S. sanguis), induce platelet activation in vitro and in

animal studies (17,18). Given the regularly occurring bacteremic episodes in periodontitis

107

Chapter 6

patients, we hypothesized that platelets and/or leukocytes from periodontitis patients are

more sensitive to stimulation by oral bacteria, in particular the known periodontal

pathogens, than platelets from control subjects. If true, the association between platelet

activation and oral bacteria improves our understanding of the underlying mechanisms

contributing to the higher risk of CVD in periodontitis patients. Therefore, the aim of the

present study was to investigate whether platelets and/or leukocytes from periodontitis

patients are more sensitive to stimulation by oral bacteria than platelets from matched

controls.

Materials and methods Chemicals and antibodies

All chemicals were from Sigma Chemical Co. (St. Louis, MO, USA). CD61-PerCP and

PAC-1 FITC were obtained from Becton Dickinson Immunocytometry Systems (San

Jose, CA, USA), PE-labeled CD62P from Immunotech (Marseille, France), CD14-PE,

CD11b-FITC and PE-labelled IgG1 from Sanquin (Amsterdam, the Netherlands) and IgM-

FITC from Beckman-Coulter (Fullerton, CA, USA).

Patients

We selected a consecutive series of periodontitis patients who were referred to the

Department of Periodontology of the Academic Centre for Dentistry Amsterdam for

diagnosis and treatment of severe periodontitis, who met the inclusion criteria and who

consented to participate. Inclusion criteria were generalized gingival inflammation,

deepened periodontal pockets and ≥8 teeth with radiographic bone loss ≥ 30% of the root

length. Age-, gender-, race- and smoking status-matched controls were recruited among

subjects registered for restorative dental procedures or who visited the dental school for

regular dental check-ups. Inclusion criteria for control subjects were (i) missing ≤1 tooth

per quadrant (3rd molar excluded), and (ii) showed on <1 year old dental bitewing

radiographs a distance of ≤3 mm between the cemento-enamel junction and the alveolar

bone crest. After initial inclusion, one control subject was excluded from analysis because

subgingival calculus masked initially the presence of minor loss of periodontal attachment

(mild periodontitis). Exclusion criteria for patients and controls were: the presence of

systemic disease (especially cardiovascular disorders, diabetes mellitus, and allergies), a

recent history or the presence of any acute or chronic infection, systemic antibiotic

108


treatment within the last 3 months or usage of any medication (including sporadic

NSAID’s), pregnancy. Subgingival microbiological samples were taken from all subjects

to determine the presence of the periodontal pathogens A. actinomycetemcomitans, P.

gingivalis and T. forsythia; sampling, laboratory procedures, and identification of A.

actinomycetemcomitans, P. gingivalis and T. forsythia were performed as previously

described (12). All subjects were informed verbally and written about the purposes of the

study and had signed an informed consent. The Medical Ethical Committee of the

Academic Medical Center of the University of Amsterdam approved the study.

Bacterial cultures used in the stimulation assays

A. actinomycetemcomitans (Y4) was grown aerobically in enriched brain-heart infusion

broth (enriched BHI; hemin 5 mg/L, menadione 1 mg/L). P. gingivalis (W83) was grown

anaerobically in enriched BHI. For the anaerobic culturing of T. forsythia (ATCC 43037),

the enriched BHI was supplemented with 5% v/v fetal calf serum, 1 g/L L-cysteine and

15 mg/L N-acetylmuramic acid. S. sanguis (HG1470) was grown aerobically in BHI. The

bacterial suspensions were washed by centrifugation, reduced to an optical density of 1 at

600 nm (corresponding to 5*108 cells/µL) in HEPES buffer (137 mM NaCl, 2.7 mM KCl,

1.0 mM MgCl2, 5.6 mM glucose, 20 mM HEPES, 1 mg/mL bovine serum albumin, 3.3

mM NaH2PO4; pH 7.4), and stored in aliquots at -20°C.

Platelet activation

Fasting venous blood samples were collected as previously described (19). For whole-

blood flow cytometry, 0.32% citrate-anticoagulated blood was processed within 5 minutes

after collection. Aliquots of blood (5 µL) were diluted in 30 µL HEPES buffer. Platelets

were incubated with and without 30 µL of A. actinomycetemcomitans, P. gingivalis, T.

forsythia or S. sanguis for 30 minutes at room temperature. Adenosine diphosphate (ADP,

10 µM) was used as a positive control. The reaction vials contained PerCP-labeled anti-

CD61, FITC-labeled PAC-1 and PE-labeled anti-CD62p (4 µg/mL of each monoclonal

antibody, final concentration) or PerCP-labeled anti-CD61 (4 µg/mL) and PE-labeled anti-

CD63 (10 µg/mL). To set fluorescence thresholds, 4 µg/mL PE-IgG1 and 4 µg/mL FITC-

IgM isotype control antibodies were used. After mixing and 30 minutes incubation at

room temperature in the dark, HEPES buffer containing 0.2% paraformaldehyde (PFA;

2.5 mL) was added. Flow cytometry was performed as described previously and the

109

Chapter 6

geometric mean fluorescence intensity (MFI) was recorded (19). After fixation, blood

samples were analyzed in a FACScan flow cytometer with CellQuest software (Becton

Dickinson). Forward and side scatter were set at logarithmic gain. Platelets were identified

by characteristic forward and side scatter, and binding of anti-CD61. Exposure of platelet

activation markers was determined on 5000 platelets. The threshold for platelet activation

was set at 1% of the appropriate isotype control-antibody. Platelet activation was

expressed as the ratio between the MFI of the indicated activation marker after stimulation

and the MFI of the same marker in the absence of stimulation (cells in HEPES buffer).

Platelet-leukocyte interaction and leukocyte activation

Fresh citrated blood (25 µL) was incubated with and without bacteria or ADP as described

above (see Platelet activation). The samples contained 4 µg/mL (final concentration) of

each CD14-PE, CD11b-FITC and CD61-PerCP. The mix was incubated for 60 min at

room temperature. In the control tubes, whole blood was incubated with HEPES buffer

containing no bacteria. After incubation, 1 mL of ice-cold lysis solution (155 mM NH4Cl,

10 mM KHCO3, 0.1 mM EDTA; pH 7.4) was added to the samples, thoroughly mixed and

placed on ice for 15 min. After lysis, the cells were fixed by addition of 1 mL of HEPES

containing 0.3% PFA. Neutrophils and monocytes were identified on their characteristic

light scatter patterns and extent of CD14-PE expression (see Fig. 6.2A). Dim CD14 and

90° light scatter define neutrophils. Bright CD14 and 90° light scatter define monocytes.

At least 5000 neutrophils and 1000 monocytes were gated within each measurement. In

turn, of the gated neutrophils and monocytes, the extent of binding of anti-CD61 was

determined, reflecting platelet binding. Based on control antibody binding, a fluorescence

threshold was set and neutrophils and monocytes were considered to be CD61-positive

when fluorescence was above this threshold. The CD61-positive neutrophils/monocytes

are the platelet-neutrophil complexes (PNCs) and the platelet-monocyte complexes

(PMCs), respectively (see Fig. 6.2B and 2C). The results are plotted as the % PNCs/ %

PMCs from the total neutrophil/ monocyte population.

Leukocyte activation in response to oral bacteria or ADP was monitored by

measuring the exposure of CD11b on neutrophils, monocytes, PNCs and PMCs. CD11b

or integrin αm is part of MAC-1 (macrophage-1 antigen), a receptor implicated in

leukocyte adhesion to other cells, phagocytosis and cellular activation (20).

110


Phagocytosis

Green fluorescent protein (GFP)-A. actinomycetemcomitans strain ATCC29522,

containing plasmid pNP3M, a kind gift of Dr. D. Galli, was grown in TSBYE (3%

trypticase soy broth, 0.6% yeast extract) with 100 µg/mL ampicillin at 37°C in humidified

5% CO2; the construct pNP3M is a slight modification of the previously described pNP3

(21). The GFP-containing bacteria allowed us to identify phagocytosing neutrophils and

monocytes by flow cytometry. The GFP-A. actinomycetemcomitans suspension was

washed, reduced to an optical density of 1 at 600 nm in HEPES buffer, and stored in

aliquots at -20°C. Fresh citrate-anticoagulated blood (25 µL) was added to a mixture

containing no bacteria, GFP-A. actinomycetemcomitans (35 µL) or GFP-A.

actinomycetemcomitans (35 µL) plus 10 µL ADP (final concentration 10 µM). The

samples contained 4 µg/mL CD61-PerCP and CD14-PE. Mixtures were incubated for 60

min at room temperature. After incubation, 1 mL of lysis solution was added to the

samples, thoroughly mixed and placed on ice for 15 min. The cells were fixed by addition

of 1 mL of HEPES containing 0.3% PFA. The same flow cytometry settings and the same

gating logic as described above were applied for defining neutrophils, monocytes, PNCs

and PMCs.


Differences in background characteristics between patients and controls were compared

by t-tests or χ2-test (or Fisher-exact test, where needed). Our results of the stimulation

assays showed a non-normal distribution and were rank-transformed for subsequent

statistical analysis. To analyze the effects of periodontitis and of the different stimulants

used, results were compared using repeated-measures analysis of variance (ANOVA). In

case of the existence of an overall effect, differences between cells from patients and

controls using the different stimulants were analyzed using an ANOVA followed by

Bonferroni correction. Data are presented as means ± standard errors of the mean (SEM).

Data analyses were performed with the SPSS package, version 14.0 (SPSS Inc.,

Chicago, IL, USA) and GraphPad Prism, version 4.00 for Windows (GraphPad Software,

San Diego, California, USA); P-values<0.05 were considered statistically significant.

111

Chapter 6

Results

Study population characteristics are summarized in Table 6.1. Periodontitis patients were

more often colonized with A. actinomycetemcomitans, P. gingivalis, and T. forsythia and

had increased plasma levels of fibrinogen and increased platelet counts.

Table 6.1 Summary of characteristics of the study population. BMI = body mass index; Aa = A. actinomycetemcomitans, Pg = P. gingivalis, Tf = T. forsythia Values are means (95% confidence intervals) or numbers (%) of subjects. *P-values calculated by t-test or χ2-test, where appropriate.

Parameter a

Control

Control

Periodontitis

Periodontitis

n=18 n=19 P-value *

Age 40.8 (36.1-45.4)

4)

42.0 (37.5-46.4) 0.713

Gender (males) 6 (33%) 7 (37%) 0.823


Smoking (smokers) 5 (28%) 6 (32%) 0.800


BMI (kg/m2) 24.4 (22.7-26.0) 25.5 (24.2-26.8) 0.293

Leukocytes (x 109/L) 5.8 (5.1-6.5) 6.5 (5.6-7.5) 0.217

Neutrophils (x 109/L) 3.3 (2.8-3.8) 3.8 (3.1-4.4) 0.300

Monocytes (x 109/L) 0.4 (0.4-0.5) 0.5 (0.4-0.6) 0.166

Lymphocytes (x 109/L) 1.9 (1.6-2.2) 2.1 (1.8-2.3) 0.333

Platelets (x 109/L) 240.3 (216.5-264.2) 276.6 (253.4-299.8) 0.040


Systolic 130.2 (121.2-139.2) 127.4 (121.0-133.7) 0.611

Diastolic 84.4 (79.6-89.1) 85.9 (81.3-90.6) 0.649

Total cholesterol (mmol/L) 4.8 (4.4-5.3) 5.1 (4.5-5.6) 0.605

Triglycerides (mmol/L) 0.9 (0.6-1.2) 1.7 (0.6-2.8) 0.171

Fibrinogen (g/L) 3.0 (2.8-3.2) 3.6 (3.4-3.9) 0.001

C-reactive protein (mg/L) 2.2 (0.4-4.1) 3.6 (1.3-5.9) 0.363

Subgingival colonization

Aa-positive 3 (17%) 9 (47%) 0.046

Pg-positive 1 (5%) 9 (47%) 0.004

Tf-positive 6 (33%) 17 (89%) 0.0001

Number of teeth

Total 28.7 (28.0-29.5) 27.2 (26.0-28.3) 0.033

With bone loss ≥30 %

0

17.1 (14.8-19.4)

-

With bone loss ≥50 % 0 6.7 (4.8-8.6) -

112


Platelet activation by oral bacteria

From Figure 6.1 it is evident that the various species of bacteria differently affected

platelet activation, as assessed by exposure of P-selectin, CD63 and binding of PAC-1 (i.e.

binding of an antibody specifically directed against the activated, fibrinogen-binding

conformation of glycoprotein IIb-IIIa) on platelets from patients and controls (overall P-

values <0.001 for the within-group analysis for all three markers, Fig. 6.1A, B, C). When

blood from periodontitis patients was incubated with oral bacteria, the exposure of P-

selectin was increased compared to controls (overall P=0.027, Fig. 6.1A). In particular,

the response to S. sanguis was increased (post-hoc P=0.003). The same tendency was

observed in response to A. actinomycetemcomitans and P. gingivalis in periodontitis

patients (post-hoc P=0.075 and P=0.066, respectively). PAC-1 binding was comparable

between controls and patients (the between-groups overall P=0.410, Fig. 6.1B). The

overall effects of bacterial stimulation on exposure of CD63 were also comparable

between controls and patients (the between-groups overall P=0.169, Fig. 6.1C). In

contrast to stimulation with A. actinomycetemcomitans or P. gingivalis, stimulation with

T. forsythia hardly changed the activation status of platelets.

Fig. 6.1 Platelet activation in response to stimulation with Aggregatibacter actinomycetemcomitans (Aa), Porphyromonas gingivalis (Pg), Tannerella forsythia (Tf), Streptococcus sanguis (Ss) or adenosine diphosphate (ADP). Graphs represent the increase in mean fluorescence intensity (MFI) of A) P-selectin, B) PAC-1, and C) CD63 expressed as ratio [MFI after stimulation] / [MFI of unstimulated cells]. Data are means ± SEM. Data analyzed by repeated-measures ANOVA and the overall P-values of the comparison between patients and controls are provided in graphs; overall P-values of the different stimulations both within the patient group and the control group were <0.001. **P<0.01 after Bonferroni correction in post-hoc testing.

113

Chapter 6

Platelet-neutrophil- (PNCs) and platelet-monocyte- (PMCs) complexes

All bacterial species induced significant formation of PNCs and PMCs, both in controls

and patients (overall P-values <0.001). PNC formation was comparable in patients and

controls (Fig. 6.2D, P=0.223). In the presence of oral bacteria, overall more PMCs were

formed in patients’ blood than in blood from control subjects (Fig. 6.2E, P=0.040). The

most marked difference was observed in response to A. actinomycetemcomitans and S.

sanguis (P=0.024 and P=0.034, respectively), whereas the response to P. gingivalis

followed a similar trend (P=0.061). As expected, activation of platelets in whole blood

with ADP resulted in strong, about 4-5-fold, increase in the numbers of PMCs (Fig. 6.2E),

but formation of PNCs was unaffected (Fig. 6.2D).

Fig. 6.2 Formation of platelet-neutrophil (PNCs) and platelet-monocyte complexes (PMCs) in response to oral bacteria or ADP. A) Identification of neutrophils and monocytes by whole blood cytometry as outlined in Methods; B, C) Identification of PNCs and PMCs (above threshold on Y-axis); D, E) Percentage of (D) PNCs or (E) PMCs as fraction of the total population of neutrophils or monocytes, respectively. Abbreviations for stimulation conditions are as in Fig. 6.1. Data are means ± SEM. After transformation, data were analyzed by repeated-measures ANOVA and the overall P-values for the comparison between patients and controls are provided in the graphs; overall P-values of the different stimulations both within the patient group and within the control group were <0.001. *P<0.05 after Bonferroni correction in post-hoc testing.

114


Leukocyte activation

A. actinomycetemcomitans, P. gingivalis, T. forsythia, and S. sanguis triggered significant

increases in exposure of CD11b on both neutrophils (Fig. 6.3A) and monocytes (Fig.

6.3C) of both patients and controls (overall P-values <0.001). Exposure of CD11b showed

a similar pattern in patients and controls (overall P=0.450 for neutrophils and P=0.909 for

monocytes). The exposure of CD11b on PNCs (Fig. 6.3B) was consistently lower

compared to platelet-free neutrophils in response to oral bacteria or ADP. In contrast,

exposure of CD11b on PMCs was roughly comparable to its exposure on platelet-free

monocytes (Fig. 6.3D).

Phagocytosis

PNCs bound and/or phagocytosed more GFP-A. actinomycetemcomitans as based on the

GFP-fluorescence than uncomplexed neutrophils (Fig. 6.4C). Also PMCs showed

increased GPF-fluorescence compared to uncomplexed monocytes (Fig. 6.4D), albeit on

average less prominent than was observed for PNCs and uncomplexed neutrophils. GFP-

Fig. 6.3 Leukocyte activation. Graphs represent the MFI of A) CD11b on neutrophils or C) monocytes, B) the ratio [CD11b MFI of PNCs] / [CD11b of neutrophils] or D) the ratio [CD11b MFI of PMCs] / [CD11b of monocytes]. Abbreviations for stimulation conditions are as in Fig. 6.1. Data are means ± SEM. After transformation, data were analyzed by repeated-measures ANOVA and the overall P-values of the comparison between patients and controls are provided in the graphs; overall P-values of the different stimulations both within the patient group and within the control group were <0.001.

115

Chapter 6

fluorescence of PNCs and PMCs was similar in patients and controls, indicating that

comparable numbers of GFP-A. actinomycetemcomitans were bound and/or phagocytosed

irrespective of disease status (P=0.549 and P=0.838, respectively).

Discussion

Low grade, transient bacteremia is a common feature in periodontitis patients, occurring

daily during activities like tooth brushing and chewing (22). Well established assays (23)

were employed to test the possibility that oral bacteria activate platelets and leukocytes in

whole blood of periodontitis patients. Neutrophils and monocytes were activated by all

species of oral bacteria tested, but no differences were observed between patients and

controls. Interestingly, we found that platelets from periodontitis patients have an

increased sensitivity to activation by oral bacteria. Furthermore, platelets in complexes

with neutrophils (PNCs) or with monocytes (PMCs) bound more oral bacteria than

Fig. 6.4 Binding and/or phagocytosis of green fluorescent-protein labeled (GFP)-Aa in PNCs and neutrophils (N) or in PMCs and monocytes (M). A, B) Extent of binding and/or phagocytosis of GFP-Aa to PNCs/ PMCs (above fluorescence threshold on the Y-axis) and neutrophils/ monocytes (below threshold). C, D) MFI of the GFP-associated fluorescence of C) PNCs and neutrophils or D) PMCs and monocytes from controls and patients after stimulation with GFP-Aa alone or in combination with ADP. Data are means ± SEM. After transformation, data were analyzed by repeated-measures ANOVA and the overall P-values for the comparison between patients and controls are provided in the graphs; overall P-values of the different stimulations both within the patient group and within the control group were <0.001. **P<0.01, ***P<0.001 after Bonferroni correction in post-hoc testing.

116


uncomplexed neutrophils/monocytes. Since more PMCs were formed in blood from

periodontitis patients compared to healthy control subjects, the total inflammatory

response in periodontitis is, on average, larger than in healthy individuals. These findings

were not influenced whether a given individual was colonized with A.

actinomycetemcomitans, P. gingivalis, T. forsythia as determined by culture techniques

(data not shown).

Previous studies showed that endotoxin-treated platelets activate neutrophils,

which then release proteases capable of damaging the underlying endothelium, resulting in

increased exposure of subendothelial tissues to platelets (24). Platelet adhesion to the

damaged vessel wall is known to contribute to the pathogenesis of atherosclerosis (25).

Similarly, such a mechanism is conceivable in periodontitis patients, where Gram-negative

bacteria and their products enter the circulation directly, thereby activating platelets and

leukocytes (Figure 6.5). Platelet-monocyte complexes are of importance, not only in

homing to inflammatory sites, but also for functional alterations of these cells. Formed

PMCs produce monocyte chemotactic protein-1 (MCP-1) and IL-8 in larger amounts that

uncomplexed monocytes, both these pro-inflammatory cytokines being related to

progression of atherosclerosis (26,27). Moreover, platelets provide cholesterol to

monocytes for cholesteryl ester synthesis (28), and these monocytes may then differentiate

into foam cells seen in atherosclerotic lesions (29).

Fig. 6.5 Bacteremias with oral pathogens as a link between periodontitis, platelet and leukocyte activation. A) Periodontitis is associated with regularly occuring bacteremias with oral pathogens. B) Enhanced activation of platelets and leukocytes (neutrophils and monocytes) in response to these bacteria is concurrent with enhanced formation of platelet-leukocyte complexes in patients with periodontitis. C) On the one hand platelet-leukocyte complexes are capable of better bacterial clearance; on the other hand they contain activated platelets and leukocytes that may contribute to atherothrombosis.

117

Chapter 6

It is very interesting to interpret the behavior of activated platelets in the platelet-

leukocyte interaction assays. Activated platelets preferentially adhere to monocytes, rather

than to neutrophils (30). This was also observed in our assays. The platelet agonist ADP

induced increased formation of PMCs and essentially did not induce formation of PNCs.

Moreover, platelet activation by ADP induced monocyte activation rather than neutrophil

activation. Although activated platelets bind to leukocytes, this seems not the only

mechanism for platelet-leukocyte complex formation in our experiments. Stimulation with

oral bacteria induced increased formation of PNCs preferentially via activation of

neutrophils rather than platelets. This phenomenon is similar to PNC formation in

response to stimulation with the bacterial peptide fMLP, which also induces formation of

PNCs more efficiently than ADP (31).

In addition to P. gingivalis and S. sanguis that were shown to promote platelet

aggregation in vitro and in animal studies (32,18), A. actinomycetemcomitans emerged for

the first time as a potent platelet activator in a human ex vivo study. The different species

of oral bacteria, however, induced distinct activation patterns, which are most likely

related to activation of different intracellular signalling pathways (33). At this point it is

unclear which bacterial components are responsible for the platelet activation. This

requires additional experimentation to reach a mechanistical explanation. Especially with

regard to A. actinomycetemcomitans, a marked increase in the exposure of CD63 and

binding of PAC-1 were observed on activated platelets, whereas exposure of P-selectin

was hardly affected. This seemingly discrepant finding is explained by the rapid binding

of P-selectin-exposing platelets to monocytes. Indeed, concurrently an increased number

of PMCs was observed in A. actinomycetemcomitans-treated blood samples.

Randomized controlled clinical trials studying the effects of treatment of

periodontitis on platelet activation may provide further insight on the contribution of this

chronic infectious condition to atherothrombosis. One intervention study showed that

treatment of patients with periodontitis is followed by an improvement of endothelial

function (34). Although the biological basis of this improvement is unknown, one may

speculate that reduced platelet activation and its concurrent pro-coagulant phenotype may

be part of the explanation. Within our department, a study has been initiated to evaluate

whether periodontal therapy indeed affects platelet activation and pro-thrombotic

phenotype in periodontitis patients.

In summary, our data show that not only monocytes but also platelets from

periodontitis patients are more sensitive to stimulation with oral bacteria than cells from

118


controls. Since oral bacteria regularly get disseminated in blood of periodontitis patients,

this increased cellular sensitivity may contribute to more inflammation and thrombosis at

atherosclerotic sites (Fig. 6.5). Since both processes are involved in the development of

CVD, our findings may in part explain the increased relative risk for cardiovascular events

in periodontitis patients.

Aknowledgements

The present study was supported by The Netherlands Institute for Dental Sciences and

Philips Oral Healthcare EMEA. We thank C. Tijhof, H. de Soet and J. Brunner for

providing the bacterial strains used in the stimulation assays. The GFP-expressing A.

actinomycetemcomitans strain was a gift of Dr. D. Galli (School of Dentistry, Department

of Oral Biology, Indiana University, Indianapolis, USA) and we thank I. Sliepen and Prof.

Dr. W. Teughels for their support in obtaining this strain.

REFERENCES

1 Libby P, Ridker PM, Maseri A. 2002. Inflammation and atherosclerosis. Circulation

105:1135-1143.

2 van Leuven SI, Franssen R, Kastelein JJ, Levi M, Stroes ESG, Tak PP. 2008.

Systemic inflammation as a risk factor for atherothrombosis. Rheumatology (Oxford)

47:3-7.

3 Levi M, Nieuwdorp M, Poll T, Stroes E. 2008. Metabolic modulation of

inflammation-induced activation of coagulation. Semin Thromb Hemost 34:26-32.

4 Wagner DD and Burger PC. 2003. Platelets in inflammation and thrombosis.

Arterioscler Thromb Vasc Biol 23:2131-2137.



6 Freedman JE and Loscalzo J. 2002. Platelet-monocyte aggregates: bridging

thrombosis and inflammation. Circulation 105:2130-2132.

119

https://www.researchgate.net/publication/282093157_Inflammation_and_Atherosclerosis?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/282093157_Inflammation_and_Atherosclerosis?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/5459786_Metabolic_Modulation_of_Inflammation-Induced_Activation_of_Coagulation?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/5459786_Metabolic_Modulation_of_Inflammation-Induced_Activation_of_Coagulation?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/5992599_Platelets_in_Inflammation_and_Thrombosis?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/5992599_Platelets_in_Inflammation_and_Thrombosis?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/11376772_Platelet-monocyte_aggregates_bridging_thrombosis_and_inflammation?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/11376772_Platelet-monocyte_aggregates_bridging_thrombosis_and_inflammation?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

Chapter 6

7 McCabe DJ, Harrison P, Mackie IJ, Sidhu PS, Purdy G, Lawrie AS, Watt H,

Brown MM, Machin SJ. 2004. Platelet degranulation and monocyte-platelet complex

formation are increased in the acute and convalescent phases after ischaemic stroke or

transient ischaemic attack. Br J Haematol 125:777-787.

8 McEver RP. 2001. Adhesive interactions of leukocytes, platelets, and the vessel wall

during hemostasis and inflammation. Thromb Haemost 86:746-756.

9 Sarma J, Laan CA, Alam S, Jha A, Fox KA, Dransfield I. 2002. Increased platelet

binding to circulating monocytes in acute coronary syndromes. Circulation 105:2166-

2171.





366:1809-1820.




29:1023-1028.





76:2106-2115.



16 Papapanagiotou D, Nicu EA, Bizzarro S, Gerdes VE, Meijers JC, Nieuwland R,

van der Velden U, Loos BG. 2008. Periodontitis is associated with platelet activation.

Atherosclerosis; in press

120

https://www.researchgate.net/publication/11766795_Adhesive_interactions_of_leukocytes_platelets_and_the_vessel_wall_during_hemostasis_and_inflammation?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/11766795_Adhesive_interactions_of_leukocytes_platelets_and_the_vessel_wall_during_hemostasis_and_inflammation?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/8525805_Platelet_degranulation_and_monocyte-platelet_complex_formation_are_increased_in_the_acute_and_convalescent_phases_after_ischaemic_stroke_or_TIA?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=




https://www.researchgate.net/publication/11376780_Increased_Platelet_Binding_to_Circulating_Monocytes_in_Acute_Coronary_Syndromes?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=




17 Herzberg MC and Weyer MW. 1998. Dental plaque, platelets, and cardiovascular

diseases. Ann Periodontol 3:151-160.

18 Lourbakos A, Yuan Y, Jenkins AL, Travis J, Andrade-Gordon P, Santulli R,

Potempa J, Pike RN. 2001. Activation of protease-activated receptors by gingipains

from Porphyromonas gingivalis leads to platelet aggregation: a new trait in microbial

pathogenicity. Blood 97:3790-3797.

19 Konijnenberg A, van der Post JA, Mol BW, Schaap MC, Lazarov R, Bleker OP,

Boer K, Sturk A. 1997. Can flow cytometric detection of platelet activation early in

pregnancy predict the occurrence of preeclampsia? A prospective study. Am J Obstet

Gynecol 177:434-442.

20 Solovjov DA, Pluskota E, Plow EF. 2005. Distinct roles for the alpha and beta

subunits in the functions of integrin alphaMbeta2. J Biol Chem 280:1336-1345.

21 Permpanich P, Kowolik MJ, Galli DM. 2006. Resistance of fluorescent-labelled

Actinobacillus actinomycetemcomitans strains to phagocytosis and killing by human

neutrophils. Cell Microbiol 8:72-84.




23 Matzdorff A. 2005. Platelet function tests and flow cytometry to monitor antiplatelet

therapy. Semin Thromb Hemost 31:393-399.

24 Clark SR, Ma AC, Tavener SA, McDonald B, Goodarzi Z, Kelly MM, Patel KD,

Chakrabarti S, McAvoy E, Sinclair GD, Keys EM, len-Vercoe E, Devinney R,

Doig CJ, Green FH, Kubes P. 2007. Platelet TLR4 activates neutrophil extracellular

traps to ensnare bacteria in septic blood. Nat Med 13:463-469.

25 Davi G and Patrono C. 2007. Platelet activation and atherothrombosis. N Engl J Med

357:2482-2494.

26 Weyrich AS, McIntyre TM, McEver RP, Prescott SM, Zimmerman GA. 1995.

Monocyte tethering by P-selectin regulates monocyte chemotactic protein-1 and tumor

121

https://www.researchgate.net/publication/11950309_Activation_of_protease-activated_receptors_by_gingipains_from_Porphyromonas_gingivalis_leads_to_platelet_aggregation_A_new_trait_in_microbial_pathogenicity?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=




https://www.researchgate.net/publication/13562251_Dental_Plaque_Platelets_and_Cardiovascular_Diseases?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/13562251_Dental_Plaque_Platelets_and_Cardiovascular_Diseases?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/246037403_Can_flow_cytometric_detection_of_platelet_activation_earlyin_pregnancy_predict_the_occurrence_of_preeclampsiaA_prospective_study?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=




https://www.researchgate.net/publication/7613021_Platelet_Function_Tests_and_Flow_Cytometry_to_Monitor_Antiplatelet_Therapy?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/7613021_Platelet_Function_Tests_and_Flow_Cytometry_to_Monitor_Antiplatelet_Therapy?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/6422181_Platelet_TLR4_activates_neutrophil_extracellular_traps_to_ensnare_bacteria_in_septic_blood?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=




https://www.researchgate.net/publication/7402740_Resistance_of_fluorescent-labelled_Actinobacillus_actinomycetemcomitans_strains_to_phagocytosis_and_killing_by_human_neutrophils?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/5770399_Platelet_Activation_and_Atherothrombosis?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/5770399_Platelet_Activation_and_Atherothrombosis?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

Chapter 6

necrosis factor-alpha secretion. Signal integration and NF-kappa B translocation. J

Clin Invest 95:2297-2303.

27 Neumann FJ, Marx N, Gawaz M, Brand K, Ott I, Rokitta C, Sticherling C, Meinl

C, May A, Schomig A. 1997. Induction of cytokine expression in leukocytes by

binding of thrombin-stimulated platelets. Circulation 95:2387-2394.

28 Mendelsohn ME and Loscalzo J. 1988. Role of platelets in cholesteryl ester

formation by U-937 cells. J Clin Invest 81:62-68.

29 Curtiss LK, Black AS, Takagi Y, Plow EF. 1987. New mechanism for foam cell

generation in atherosclerotic lesions. J Clin Invest 80:367-373.

30 Ahn KC, Jun AJ, Pawar P, Jadhav S, Napier S, McCarty OJ, Konstantopoulos K.

2005. Preferential binding of platelets to monocytes over neutrophils under flow.

Biochem Biophys Res Commun 329:345-355.

31 Hu H, Varon D, Hjemdahl P, Savion N, Schulman S, Li N. 2003. Platelet-leukocyte

aggregation under shear stress: differential involvement of selectins and integrins.

Thromb Haemost 90:679-687.

32 McNicol A, Zhu R, Pesun R, Pampolina C, Jackson EC, Bowden GH, Zelinski T.

2006. A role for immunoglobulin G in donor-specific Streptococcus sanguis-induced

platelet aggregation. Thromb Haemost 95:288-293.

33 Holmes MB, Sobel BE, Howard DB, Schneider DJ. 1999. Differences between

activation thresholds for platelet P-selectin and glycoprotein IIb-IIIa expression and

their clinical implications. Thromb Res 95:75-82.




122

https://www.researchgate.net/publication/12880343_Differences_between_Activation_Thresholds_for_Platelet_P-Selectin_and_Glycoprotein_IIb-IIIa_Expression_and_Their_Clinical_Implications?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/7284752_A_role_for_immunoglobulin_G_in_donor-specific_Streptococcus_sanguis-induced_platelet_aggregation?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/19819958_Role_of_platelets_in_cholesteryl_ester_formation_by_U-937_cells?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/19819958_Role_of_platelets_in_cholesteryl_ester_formation_by_U-937_cells?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/9075867_Platelet-leukocyte_aggregation_under_shear_stress_Differential_involvement_of_selectins_and_integrins?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/20200539_New_mechanism_for_foam_cell_generation_in_atherosclerotic_lesions?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/20200539_New_mechanism_for_foam_cell_generation_in_atherosclerotic_lesions?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/14049122_Induction_of_Cytokine_Expression_in_Leukocytes_by_Binding_of_Thrombin-Stimulated_Platelets?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



Chapter 7

Summary and discussion

123


Periodontitis is a chronic infectious condition in the tooth-supporting tissues, which

eventually leads to loss of teeth if left untreated. The host response to bacterial insults

leads to chronic inflammation; the features of periodontal inflammation are gingival

bleeding, formation of deepened periodontal pockets, and progressive destruction of

periodontal ligaments and alveolar bone. While bacteria are essential for the initiation and

progression of periodontitis, genetic and lifestyle factors appear to strongly influence the

severity of the disease and the response to treatment. New models of how to apply this

knowledge for individualized patient care are necessary. An important step forward would

be the identification of individuals with heightened susceptibility for periodontitis. They

would ultimately require more intensive prevention and treatment strategies.

Since bacteria are central in the initiation and progression of periodontitis, one

approach in the direction of identifying modifying factors for susceptibility of

periodontitis, is analyzing the immune response to periodontal pathogens. In this thesis we

analyzed the importance of phagocytes, i.e. PMNs and monocytes in the defense against

periodontal pathogens, and in particular we investigated the function of the receptors in

charge with bacterial recognition. In Chapter 2 we analyzed the FcγRIIa on PMNs, with a

closer look at one single nucleotide polymorphism in the FcγRIIa-gene (FCG2A). FcγRIIa

(one of the types of receptors for the Fc part of immunoglobulins, IgG) mediates

phagocytosis and cell activation. Previous studies showed that one of the genetic variants

of the FcγRIIa, the FcγRIIa131H/H, is capable of efficiently binding human IgG2, whereas

the other two variants, FcγRIIa131H/R or FcγRIIa131R/R do so with reduced affinity. IgG2 is

the predominant IgG subclass against periodontal pathogens and opsonization (with IgG,

complement, or other plasma proteins) is a pre-requisite for efficient recognition of

bacteria by phagocytes. Therefore, we hypothesized that this polymorphism in the FCG2A

is modifying the PMN reactivity in response to periodontal pathogens. Our results

demonstrate that in response to stimulation with the periodontal pathogen A.

actinomycetemcomitans, PMNs from FcγRIIa131H/H carriers phagocytosed more bacteria.

During this phagocytosis step, the FcγRIIa131H/H-PMNs released more granular content and

more active elastase than the FcγRIIa131R/R-PMNs, suggesting a hyper-reactive phenotype

of the FcγRIIa131H/H-PMNs. In addition to the reactive oxygen-species produced during the

respiratory burst, the PMN degranulation products (matrix metallo-proteinases, elastase)

may be responsible for a large part of the PMN-induced collateral damage in periodontitis

(1,2,3). Therefore, the hyper-reactivity of the FcγRIIa131H/H-PMNs resulting in increased

124

Chapter 7

degranulation might be one of the mechanisms by which periodontitis patients with the

FcγRIIa131H/H genotype acquire more severe periodontal destruction compared to patients

with the FcγRIIa131H/R or FcγRIIa131R/R genotypes. Indeed, our results give a mechanistic

explanation for previous observations of an increased severity of periodontal breakdown in

periodontitis patients with the FcγRIIa131H/H genotype (4,5).

The hyper-reactivity of PMNs in periodontitis might result not only from

genetically-encoded affinity of their receptors, but also from differential expression of

these receptors when compared to periodontally-healthy controls. In Chapter 3 we

investigated the cellular expression of IgG-receptors (FcγRI, FcγRIIa, FcγRIIIa and

FcγRIIIb), complement-receptor CR3 and the LPS-co-receptor CD14 on PMNs and

monocytes, as well as activation of these cells in response to two periodontal pathogens, A.

actinomycetemcomitans and P. gingivalis.

Our results demonstrate a similar expression of the analyzed receptors on PMNs in

periodontitis patients and healthy controls, suggesting that the chronic inflammatory

reaction accompanying periodontitis does not affect the PMNs during their formation in

the bone marrow, or in their short-lived blood circulation. The monocytes, on the contrary,

demonstrated a decreased membrane-bound CD14 (mCD14) expression with concomitant

increase in the FcγRIII. These CD14lowFcγRIII+ monocytes have been described in the

literature as precursors of a dendritic cell-type; this cell population is expanding in

inflammatory conditions such as rheumatoid arthritis (6,7), sepsis (8) or Kawasaki disease

(9). The dendritic cells formed from CD14lowFcγRIII+ monocytes have phagocytic and

oxidative capacity, but fail to efficiently stimulate T-cells for a definitive resolution of

inflammation (10). Therefore, we propose a role for the CD14lowFcγRIII+ monocytes in the

chronicization of periodontal inflammation.

Furthermore, our results showed that the subjects culture-positive for A.

actinomycetemcomitans had significantly lower expression of monocytic FcγRI and

FcγRIIa than P. gingivalis-infected subjects. This lower FcγRs expression by monocytes

might be related to a higher susceptibility of a subject to become infected with A.

actinomycetemcomitans or to an adaptation to this particular infection. Indeed, PMNs from

A. actinomycetemcomitans -infected subjects responded in a hyper-reactive manner in

response to bacterial stimulation, in particular when stimulated with A.

actinomycetemcomitans. Taken together, these results suggest a hyper-reactivity of the

PMNs in A. actinomycetemcomitans –infected individuals for which the immune system

125


tries to account for by lowering the FcγRs expression on monocytes. Nevertheless, the

hyper-reactive PMNs might contribute to the severe and relatively rapid periodontal

destruction reported in early-onset periodontitis patients sub-gingivally colonized with A.

actinomycetemcomitans (11).

Nevertheless, we believe that the origin of the PMN hyper-reactivity in subjects

colonized with A. actinomycetemcomitans is not clarified yet. We hypothesize that a

certain genetic background could make these individuals more prone for A.

actinomycetemcomitans infection. This scenario has been observed for subjects with

certain genetic variations in the genes coding mannose-binding lectin, vitamin D receptor,

mannose-associated serine-protease-2, and Toll-like receptors; these subjects had a greater

risk of infection with Mycobacterium tuberculosis, meningococci or gram-negative

bacteria (12,13,14,15,16). On the other hand, it could be the infection with A.

actinomycetemcomitans itself responsible for the phenotypic changes of the PMNs. Future

intervention studies that would eliminate A. actinomycetemcomitans from the sub-gingival

microflora might offer the answer to this question.

In addition to the cellular expression of phagocytic receptors, in Chapter 4 we

analyzed the plasmatic levels of the soluble form of CD14 (sCD14) in periodontitis

patients and healthy controls. sCD14 can be the result of shedding / cleavage of mCD14

from monocytes / macrophages or be produced in the liver. Acting as a soluble LPS-

receptor, sCD14 helps inducing responses in cells that naturally lack CD14, such as

endothelial, epithelial and smooth muscle cells (17). Another role is the neutralization of

LPS in Gram-negative infectious states. Acting as a decoy receptor for serum LPS, sCD14

prevents extreme pro-inflammatory responses from monocytes/macrophages (18). Also

periodontitis is a condition associated with Gram-negative pathogens that gain access to

the systemic blood circulation and are responsible for endotoxemia in periodontitis

patients (19). Our results demonstrated an increase in sCD14 plasma levels that positively

correlated with severity of periodontal destruction. This association points into the

direction that the sCD14 increases with the need to remove LPS from circulation. Given

the results from Chapter 3, where we demonstrated a decreased membrane-bound CD14

expression on monocytes from periodontitis patients, the increase in sCD14 might be

partially attributable to the shedding of the membrane-bound form of CD14 from

monocytes. However, we also showed that the increase in sCD14 was positively correlated

with systemic inflammatory markers, such as CRP and numbers of leukocytes. Therefore,

126

Chapter 7

we can assume that also an increased sCD14 production by the liver is accompanying

periodontitis. Interestingly, cleavage of mCD14 by bacterial proteases like the P.

gingivalis gingipains has been described in vitro (20). However, our results do not support

the hypothesis of a direct proteolytic cleavage of mCD14 by gingipains since in our

bacterial stimulation assays A. actinomycetemcomitans and P. gingivalis were similarly

able to induce upregulation of mCD14 on monocytes (Chapter 3). In a future study, an

assay distinguishing between the three forms of sCD14 (resulting from shedding, cleavage

or liver-produced) might bring more insight in the periodontitis-associated increase in

sCD14.

It has been shown that several inflammatory markers predict future vascular events

(21,22,23). C-reactive protein (CRP) and number of leukocytes have been identified as

markers for cardio-vascular disease (CVD) (24,25). Elevated levels of CRP and leukocytes

in patients with CVD may be the result of chronic infectious and inflammatory processes

(26,27,28). Periodontitis is one of the chronic infectious processes that has been associated

with CVD in several epidemiologic studies (29) and elevated blood levels of CRP and

leukocytes have been found in patients with periodontitis (30,31). The underlying

mechanism of CVD is atherosclerosis. CD14 binds LPS in conjunction with LPS-binding-

protein (LBP); the CD14-LPS-LBP complex can directly activate endothelial and smooth

muscle cells (32,33), leading to elevated expression of cell adhesion molecules, thereby

increasing procoagulant activity, and exacerbating inflammation in atherosclerotic lesions

(34). Based on our results in Chapter 4 that showed increased sCD14 levels in

periodontitis, concomitant with elevated CRP and leukocyte levels, we propose a role for

sCD14 in the recurrent episodes of accelerated activity within atherosclerotic plaques in

patients at risk for CVD. We hypothesize that sCD14-mediated signaling is one of the

pathways leading to increased atherogenic activity, and thus, increased risk for CVD in

periodontitis patients.

Not only PMNs and monocytes are capable of interacting with bacteria, also

platelets respond to bacteria by releasing anti-microbial peptides (35), and exposing pro-

inflammatory receptors (36). In Chapters 5 and 6 we analyzed the activation status of

circulating platelets in periodontitis patients, as well as the platelet response to periodontal

pathogens and the interplay between platelets, PMNs and monocytes during stimulation

with bacteria. Periodontitis patients demonstrated increased platelet activation, as revealed

by elevated plasma levels of sP-selectin and increased expression of the glycoprotein IIb-

IIIa, both abundantly expressed receptors, and responsible for adhesive properties of

127


platelets. P-selectin is released from platelets within minutes after activation and is found

in plasma as soluble (s)P-selectin (37). Platelet activation was more pronounced in the

patients with more severe periodontal disease, showing a severity-dependence. Moreover,

in Chapter 6 we showed that platelets from periodontitis patients are more sensitive to

oral bacteria than cells from periodontally healthy controls. In response to A.

actinomycetemcomitans, P. gingivalis, and S. sanguis, but not T. forsythia, platelets from

patients expressed more P-selectin than those from controls. Moreover, more platelet-

monocyte complexes were formed in blood from patients in response to oral bacteria than

in blood from controls. In a phagocytosis assay, platelet-PMN and platelet-monocyte

complexes phagocytosed more bacteria than platelet-free cells, suggesting that the

complexes contain primed cells.

Periodontitis is a condition in which due to breaching of the epithelial lining,

small-scale, frequent bacteremias occur during regular activities like chewing or tooth

brushing (38,39). These bacteremic episodes underlie endotoxemia and a chronic systemic

inflammatory reaction in periodontitis patients (40,31,19). In epidemiologic studies,

periodontitis has been associated with increased risk for myocardial infarction and stroke

(29), but the responsible mechanisms are still obscure. Based on our results, we suggest

that the pathologic processes in periodontitis induce platelet and monocyte priming, a

repeatable process with virtually every bacteremic episode of periodontal origin. Activated

platelets produce vast amounts of proinflammatory mediators stored in their α-granules

and dense body systems. Promptly released upon platelet activation, the pro-inflammatory

mediators and receptors induce platelet binding to endothelial cells lining vessel walls

(36). Once adhered, platelets create a platform onto which monocytes can roll and adhere

firmly, leading to increased monocyte recruitment. Monocytes in the subendothelial space

will excessively accumulate intracellular low density lipoprotein leading to accumulation

of intracellular lipid droplets and formation of the foam cells. These functions make

activated platelets and monocytes essential participants in both thrombosis and

atherogenesis and we hypothesize that they explain, at least partially, the

epidemiologically-increased risk for CVD in periodontitis patients.

It is currently unclear whether the increased platelet reactivity in periodontitis

patients is intrinsic, the result of a specific genetic make-up, or extrinsic, the result of

priming by bacterial products streaming from periodontal lesions or by the cytokines

produced as a part of the systemic inflammatory reaction in periodontitis. Future studies,

assessing platelet activation status and reactivity after successful treatment of periodontitis

128

Chapter 7

will shed light on this matter. One published intervention study showed that treatment of

patients with periodontitis is followed by an improvement of endothelial function (41); the

biological basis of this improvement of the vascular condition is as yet unknown.

However, a reduction in the state of platelet activation and in the pro-coagulant state may

be part of the explanation.

Concluding remarks

In this thesis we have investigated the reactivity of PMNs, monocytes and platelets in

periodontitis patients. Individuals at higher risk for periodontal breakdown were

represented by the subjects with the FcγRIIa131H/H genotype and the subjects sub-

gingivally colonized with A. actinomycetemcomitans. These groups of subjects

demonstrated hyper-reactive PMNs in functional assays using periodontal pathogenic

bacteria as stimuli. Whereas for the FcγRIIa genotypic variants, the origin is evidently

genetic and the therapeutic approach goes more in the direction of better prevention of

periodontitis, for the subjects colonized with A. actinomycetemcomitans the answer is not

so straightforward. Future intervention studies that would eliminate A.

actinomycetemcomitans from the sub-gingival microflora might offer the answer to this

question.

Furthermore, we have demonstrated that platelets and monocytes from

periodontitis patients are more sensitive to activation by oral bacterial species, such as A.

actinomycetemcomitans, P. gingivalis, and S. sanguis than cells from healthy controls.

Periodontal therapy results in a reduction of the bacterial burden from the periodontal

pockets, as well as in a reduction of the systemic inflammatory reaction (40). Given the

roles of platelets and monocytes in thrombosis and atherosclerosis, periodontal therapy

might have an added value not only in improving the patients’ oral health, but also as

prevention measure to reduce their overall risk for myocardial infarction and stroke.

129


REFERENCES









Immunol 147:255-264.



30:595-602.







7 Wijngaarden S, van Roon JAG, Bijlsma JWJ, van de Winkel JGJ, Lafeber FPJG.

2003. Fc{gamma} receptor expression levels on monocytes are elevated in rheumatoid

arthritis patients with high erythrocyte sedimentation rate who do not use anti-

rheumatic drugs. Rheumatology (Oxford) 42:681-688.




130

https://www.researchgate.net/publication/13075847_Increased_release_of_elastase_from_in_vitro_activated_peripheral_neutrophils_in_patients_with_adult_periodontitis?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/11076187_Kawanaka_N_et_al_CD14CD16_blood_monocytes_and_joint_inflammation_in_rheumatoid_arthritis_Arthritis_Rheum_46_2578-2586?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/14565016_Increased_release_of_free_oxygen_radicals_from_peripheral_neutrophils_in_adult_periodontitis_after_Fcg-receptor_stimulation?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/6578209_Matthews_J_B_et_al_Hyperactivity_and_reactivity_of_peripheral_blood_neutrophils_in_chronic_periodontitis_Clin_Exp_Immunol_147_255-264?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/6896528_Fcg_receptor_polymorphisms_and_periodontal_status_A_prospective_follow-up_study?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/10791319_Fcg_receptor_expression_levels_on_monocytes_are_elevated_in_rheumatoid_arthritis_patients_with_high_erythrocyte_sedimentation_rate_who_do_not_use_anti-rheumatic_drugs?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=




https://www.researchgate.net/publication/6708425_Fcg_receptor_polymorphisms_in_relation_to_periodontitis?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



Chapter 7



121:566-570.
















1525.






21:125-131.



131

https://www.researchgate.net/publication/8589956_Porphyromonas_gingivalis_lipopolysaccharides_induce_maturation_of_dendritic_cells_with_CD14CD16_phenotype?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/8665975_Human_Toll-Like_Receptor_4_Mutations_but_Not_CD14_Polymorphisms_Are_Associated_with_an_Increased_Risk_of_Gram-Negative_Infections?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=




https://www.researchgate.net/publication/10624363_Inherited_Deficiency_of_Mannan-Binding_Lectin-Associated_Serine_Protease_2?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/13337682_Tuberculosis_and_Chronic_Hepatitis_B_Virus_Infection_in_Africans_and_Variation_in_the_Vitamin_D_Receptor_Gene?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/20554962_Prevalence_of_Periodontal_Breakdown_in_Adolescents_and_Presence_of_Actinobacillus_actinomycetemcomitans_in_Subjects_With_Attachment_Loss?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=




https://www.researchgate.net/publication/14119521_Dual_role_of_mannan-binding_protein_in_infections_Another_case_of_heterosis?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/15657124_Receptor-Dependent_Mechanisms_of_Cell_Stimulation_by_Bacterial_Endotoxin?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/15657124_Receptor-Dependent_Mechanisms_of_Cell_Stimulation_by_Bacterial_Endotoxin?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/12860120_Mannose-binding_lectin_and_meningococcal_disease?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/12860120_Mannose-binding_lectin_and_meningococcal_disease?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/12349637_CD14CD16_monocyte_subpopulation_in_Kawasaki_disease?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=





252:1321-1322.







Porphyromonas gingivalis outer membrane vesicles. Microbial Pathogenesis 36:319-

325.

21 Danesh J, Wheeler JG, Hirschfield GM, Eda S, Eiriksdottir G, Rumley A, Lowe

GD, Pepys MB, Gudnason V. 2004. C-reactive protein and other circulating markers

of inflammation in the prediction of coronary heart disease. N Engl J Med 350:1387-

1397.

22 Keaney JF, Jr. and Vita JA. 2002. The value of inflammation for predicting unstable

angina. N Engl J Med 347:55-57.

23 Lindahl B, Toss H, Siegbahn A, Venge P, Wallentin L. 2000. Markers of

myocardial damage and inflammation in relation to long-term mortality in unstable

coronary artery disease. FRISC Study Group. Fragmin during instability in coronary

artery disease. N Engl J Med 343:1139-1147.

24 Ikonomidis I, Stamatelopoulos K, Lekakis J, Vamvakou GD, Kremastinos DT.

2008. Inflammatory and non-invasive vascular markers: the multimarker approach for

risk stratification in coronary artery disease. Atherosclerosis 199:3-11.

25 Rana JS, Boekholdt SM, Ridker PM, Jukema JW, Luben R, Bingham SA, Day

NE, Wareham NJ, Kastelein JJ, Khaw KT. 2007. Differential leucocyte count and

the risk of future coronary artery disease in healthy men and women: the EPIC-

Norfolk Prospective Population Study. J Intern Med 262:678-689.



132

https://www.researchgate.net/publication/6442951_Endotoxemia_immune_response_to_periodontal_pathogens_and_systemic_inflammation_associate_with_incident_cardiovascular_disease_events?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=




https://www.researchgate.net/publication/5937185_Differential_leucocyte_count_and_the_risk_of_future_coronary_artery_disease_in_healthy_men_and_women_The_EPIC-Norfolk_Prospective_Population_Study?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=




https://www.researchgate.net/publication/11277648_The_Value_of_Inflammation_for_Predicting_Unstable_Angina?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/11277648_The_Value_of_Inflammation_for_Predicting_Unstable_Angina?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/239955196_Markers_of_Myocardial_Damage_and_Inflammation_in_Relation_to_Long-Term_Mortality_in_Unstable_Coronary_Artery_Disease_FRISC_Study_Group_Fragmin_During_Instability_in_Coronary_Artery_Disease?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=




https://www.researchgate.net/publication/8630560_Danesh_J_Wheeler_JG_Hirschfield_GM_et_al_C-Reactive_Protein_and_Other_Circulating_Markers_of_Inflammation_in_the_Prediction_of_Coronary_Heart_Disease_N_Engl_J_Med_35014_1387?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=




https://www.researchgate.net/publication/13959902_Chronic_infections_and_coronary_heart_disease_Is_there_a_link?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/13959902_Chronic_infections_and_coronary_heart_disease_Is_there_a_link?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/8585560_Loss_of_lipopolysaccharide_receptor_CD14_from_the_surface_of_human_macrophage-like_cells_mediated_by_Porphyromonas_gingivalis_outer_membrane_vesicles?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=




https://www.researchgate.net/publication/5474901_Inflammatory_and_non-invasive_vascular_markers_The_multimarker_approach_for_risk_stratification_in_coronary_artery_disease?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



Chapter 7

27 Lowe GD. 2001. The relationship between infection, inflammation, and cardiovascular

disease: an overview. Ann Periodontol 6:1-8.

28 Maseri A, Biasucci LM, Liuzzo G. 1996. Inflammation in ischaemic heart disease.

BMJ 312:1049-1050.







76:2106-2115.






1026.








Loscalzo J, Valeri CR. 1996. In vivo tracking of platelets: Circulating degranulated


93:11877-11882.

133

https://www.researchgate.net/publication/14331124_In_vivo_tracking_of_platelets_Circulating_degranulated_platelets_rapidly_lose_surface_P-selectin_but_continue_to_circulate_and_function?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=




https://www.researchgate.net/publication/10767029_Meta-analysis_of_periodontal_disease_and_risk_of_coronary_heart_disease_and_stroke?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/5558488_A_systemic_review_and_meta-analyses_on_C-reactive_protein_in_relation_to_periodontitis?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/5558488_A_systemic_review_and_meta-analyses_on_C-reactive_protein_in_relation_to_periodontitis?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/7489886_Loos_B_G_Systemic_markers_of_inflammation_in_periodontitis_J_Periodontol_76_2106-2115?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/7489886_Loos_B_G_Systemic_markers_of_inflammation_in_periodontitis_J_Periodontol_76_2106-2115?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/14675434_Activation_of_endothelial_cells_by_endotoxin_direct_versus_indirect_pathways_and_the_role_of_CD14?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/14675434_Activation_of_endothelial_cells_by_endotoxin_direct_versus_indirect_pathways_and_the_role_of_CD14?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/11476662_The_Relationship_Between_Infection_Inflammation_and_Cardiovascular_Disease_An_Overview?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/11476662_The_Relationship_Between_Infection_Inflammation_and_Cardiovascular_Disease_An_Overview?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/7072061_The_interaction_of_bacterial_pathogens_with_platelets?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/7072061_The_interaction_of_bacterial_pathogens_with_platelets?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/15661893_Induction_of_tissue_factor_on_monocytes_by_adhesion_to_endothelial_cells?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/15661893_Induction_of_tissue_factor_on_monocytes_by_adhesion_to_endothelial_cells?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/14584952_Inflammation_in_ischaemic_heart_disease_Br_Med_J?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/14584952_Inflammation_in_ischaemic_heart_disease_Br_Med_J?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/15665735_Endotoxin_Activates_Human_Vascular_Smooth_Muscle_Cells_despite_Lack_of_Expression_of_CD14_mRNA_or_Endogenous_Membrane_CD14?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=











40 D'Aiuto F, Parkar M, Andreou G, Suvan J, Brett PM, Ready D, Tonetti MS.

2004. Periodontitis and systemic inflammation: control of the local infection is

associated with a reduction in serum inflammatory markers. J Dent Res 83:156-160.




134

https://www.researchgate.net/publication/11515497_Systemic_Release_of_Endotoxins_Induced_by_Gentle_Mastication_Association_With_Periodontitis_Severity?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/6476317_Treatment_of_Periodontitis_and_Endothelial_Function?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/7104354_Incidence_of_bacteremia_after_chewing_tooth_brushing_and_scaling_in_individuals_with_periodontal_inflammation?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/8903138_Periodontitis_and_Systemic_Inflammation_Control_of_the_Local_Infection_is_Associated_with_a_Reduction_in_Serum_Inflammatory_Markers?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



Samenvatting

135

Samenvatting

Parodontitis is een chronische infectieuze aandoening van de tand ondersteunende

weefsels (het parodontium), die uiteindelijk leidt tot het verlies van tanden wanneer er niet

behandeld wordt. De reactie van de gastheer op bacteriële accumulatie op de

gebitselementen leidt tot chronische ontsteking van het parodontium. De kenmerken van

parodontale ontsteking zijn bloeding van de gingiva, vorming van diepe parodontale

pockets en progressieve afbraak van het parodontaal ligament en het alveolaire bot.

Hoewel bacteriën essentieel zijn voor het ontstaan en de progressie van parodontitis,

blijken ook genetische en lifestyle factoren een grote invloed te hebben op de vatbaarheid

voor en de ernst van de ziekte, alsmede de reactie op behandeling. Deze nieuwe inzichten

moeten nog geïmplementeerd worden bij geïndividualiseerde patiëntenzorg. Identificatie

van individuen met verhoogde vatbaarheid voor parodontitis zou een belangrijke stap

voorwaarts zijn. Zij zouden uiteindelijk intensievere preventie en behandelingsstrategieën

nodig hebben.

Het analyseren van de gastheerreactie op de parodontale bacteriële pathogenen is

één van de mogelijke benaderingen in de richting van het identificeren van modificerende

factoren voor de vatbaarheid voor parodontitis. In dit proefschrift hebben we het belang

van de polymorphonucleaire leukocyten (PMNs) en monocyten (deze cel typen zijn beiden

fagocyten), in de verdediging tegen parodontale pathogenen geanalyseerd, en in het

bijzonder hebben we de functie onderzocht van de receptoren die verantwoordelijk zijn

voor de herkenning van de bacteriën.

In Hoofdstuk 2 hebben we FcγRIIa op PMNs geanalyseerd, met een focus op een

single nucleotide polymorfisme in het FcγIIa gen (FCG2A). FcγIIa (één van de typen

receptoren voor het Fc gedeelte van immunoglobulines, IgG) stuurt fagocytose en cel

activering aan. Eerdere studies hebben aangetoond dat één van de genetische varianten van

FcγIIa, FcγIIa131H/H, in staat is om humaan IgG2 efficiënt te binden, terwijl de andere twee

varianten, FcγIIa131H/R of FcγIIa131R/R , dat ook wel kunnen, maar met een verminderde

affiniteit. IgG2 is de voornaamste IgG subklasse tegen parodontale pathogenen en

opsonisatie met IgG, en in parodontitis vooral met IgG2, helpt bij een efficiënte

herkenning van bacteriën door fagocyten. Wij hebben gehypothetiseerd dat dit

polymorfisme in het FCG2A gen, de reactiviteit verandert van PMNs in respons op

parodontale pathogenen. Onze resultaten laten zien dat PMNs van individuen met het

FcγIIa131H/H genotype meer bacteriën fagocyteren als reactie op de stimulatie met de

parodontale paropathogeen A. actinomycetemcomitans. Tijdens dit fagocytose proces

scheiden de granulen van FcγIIa131H/H PMNs meer enzymen uit waaronder meer actief

136

Samenvatting

elastase, dan FcγIIa131R/R PMNs, hetgeen een hyperactief fenotype van de FcγIIa131H/H

PMNs suggereert. Voor het ziekteproces parodontitis betekent dit dat naast de reactieve

zuurstof radicalen die geproduceerd worden tijdens de oxidatieve stress van de PMNs, ook

de degranulatie producten (matrix metallo proteinases, elastase) van de PMNs

verantwoordelijk zijn voor afbraak van binden steunweefsel bij parodontitis (1,2,3).

Derhalve zou de hyper-reactiviteit van de FcγIIa131H/H PMNs één van de mechanismen

kunnen zijn waardoor juist deze patiënten een ernstiger parodontale afbraak hebben in

vergelijking met de FcγIIa131H/R en FcγIIa131R/R genotypen. Onze resultaten geven dan ook

een mechanistische verklaring voor eerdere observaties van een toegenomen ernst van

parodontale afbraak bij patiënten met het FcγIIa131H/H genotype (4,5).

De hyperreactiviteit van PMNs bij parodontitis zou, naast de genetisch gecodeerde

sterkere of zwakkere affiniteit van hun receptoren, ook veroorzaakt kunnen worden door

een afwijkende expressie van deze receptoren in vergelijking met parodontaal gezonde

controles. In Hoofdstuk 3 hebben we zowel de cellulaire expressie van IgG receptoren

(FcγRI, FcγRIIa, FcγRIIIa en FcγIIIb), complement receptor CR3 en de LPS co-receptor

CD14 op PMNs en monocyten onderzocht, als ook de activatie van deze cellen in reactie

op de twee parodontale pathogenen A. actinomycetemcomitans en P. gingivalis. Onze

resultaten laten een vergelijkbare expressie zien van de onderzochte receptoren op PMNs

van parodontale patiënten en van gezonde controles. Wij suggereren dat de chronische

ontstekingsreactie die gepaard gaat met parodontitis blijkbaar geen effect heeft op de PMN

receptor expressie tijdens hun vorming in het beenmerg en tijdens hun kortstondige

circulatie in het bloed. De monocyten daarentegen, lieten een verlaagde expressie van

membraan-gebonden CD14 (mCD14) zien, in samenhang met een toename van FcγRIII

expressie. Deze CD14lowFcγRIII+ monocyten zijn in de literatuur beschreven als

voorlopers van een dendritisch celtype; deze celpopulatie neemt toe tijdens ontstekingen

zoals reumatoïde artritis (6,7), sepsis (8) of de Kawasaki ziekte (9). De dendritische cellen

die gevormd worden door de CD14lowFcγRIII+ monocyten hebben een fagocyterende en

oxiderende capaciteit, maar zijn niet in staat om T cellen efficiënt te stimuleren tot een

definitieve actie om de ontsteking te elimineren (10). Met deze bevindingen kennen wij

een rol toe aan de CD14lowFcγRIII+ monocyten, die mogelijk de chroniciteit van

parodontale ontsteking bevorderen dan wel in stand houden.

Daarnaast vonden wij dat personen die geïnfecteerd zijn met A.

actinomycetemcomitans, een significant lagere expressie van monocytaire FcγRI en

FcγRIIa hebben dan personen die met P. gingivalis geïnfecteerd zijn. Deze verlaagde

137

Samenvatting

FcγR expressie door monocyten kan gerelateerd zijn aan een verhoogde gevoeligheid voor

een A. acinomycetemcomitans infectie, of aan een aanpassing aan deze specifieke infectie.

Parallel aan deze bevinding zagen we ook dat PMNs van A. actinomycetemcomitans

geïnfecteerde personen inderdaad op een hyperactieve manier reageerden op een bacteriële

stimulans, in het bijzonder wanneer zij werden gestimuleerd met A.

actinomycetemcomitans. Samenvattend suggereren deze resultaten een hyperreactiviteit

van de PMNs bij A. actinomycetemcomitans geïnfecteerde personen, welke het

immuunsysteem probeert te compenseren door de verlaging van FcγRs expressie op

monocyten. Desondanks zouden de hyperactieve PMNs kunnen bijdragen aan de ernstige

en relatief snelle parodontale afbraak die gerapporteerd is in early-onset parodontitis

patiënten, die zeer frequent geïnfecteerd zijn met A. actinomycetemcomitans (11).

Ondanks deze bevindingen is het toch niet helemaal duidelijk waarom bij personen

die geïnfecteerd zijn met A. actinomycetemcomitans de PMN’s hyperactief zijn. Wij

veronderstellen dat een bepaalde genetische achtergrond deze personen meer vatbaar

maken voor A. actinomycetemcomitans infectie. Dit scenario is al beschreven bij personen

met genetische variaties in de genen coderend voor mannose-bindend lectine, vitamine D

receptor, mannose-geassocieerde serine protease 2 en toll-like receptoren; deze personen

hadden een groter risico op infectie met Mycobacterium tuberculosis, meningococci of

gram negatieve bacteriën (12,13,14,15,16). Aan de andere kant zou het de infectie met A.

actinomycetemcomitans zelf kunnen zijn die verantwoordelijk is voor de fenotypische

veranderingen van de PMNs. Dit dilemma zou verder onderzocht kunnen worden met

interventie studies, welke A. actinomycetemcomitans elimineren uit de subgingivale

microflora.

Naast de cellulaire expressie van receptoren op fagocyten, hebben we in

Hoofdstuk 4 de plasma spiegels van de oplosbare vorm van CD14 (sCD14) geanalyseerd

bij parodontitis patiënten en gezonde controles. sCD14 kan ontstaan door afscheiding /

afknippen van membraan-gebonden CD14 op monocyten / macrofagen of sCD14 kan

geproduceerd worden in de lever. Fungerend als een oplosbare LPS receptor, helpt sCD14

bij de activatie van cellen die van nature geen CD14 hebben, zoals endotheelcellen,

epitheelcellen en gladde spiercellen. Een andere rol is de neutralisatie van LPS tijdens

gram-negatieve infectieuze ziekteprocessen. Als neutraliserende factor voor serum LPS,

verhindert sCD14 extreme proinflammatoire reacties van monocyten / macrofagen (18).

Ook parodontitis is een ziekteproces waarbij gram-negatieve pathogenen de infectie

vormen. Deze pathogenen komen in de bloedcirculatie terecht en zijn verantwoordelijk

138

Samenvatting

voor endotoxemia bij parodontitis patiënten (19). Onze resultaten laten een toename in

sCD14 plasma waardes zien, welke positief correleren met de ernst van de parodontale

afbraak. Deze associatie suggereert dat het sCD14 toeneemt samen met de noodzaak om

LPS uit de circulatie te verwijderen. Gezien de resultaten uit Hoofdstuk 3, waar we een

verminderde membraan-gebonden CD14 expressie op monocyten van parodontitis

patiënten hebben laten zien, zou de toename van het sCD14 gedeeltelijk toegeschreven

kunnen worden aan de afscheiding van het membraan gebonden CD14 van monocyten.

We hebben echter ook aangetoond dat de toename in sCD14 een positieve correlatie laat

zien met de systemische ontstekingsmarker C-reactief proteïn (CRP) en met het aantal

leukocyten in de circulatie. Dus we veronderstellen dat naast CRP, ook een verhoogde

sCD14 productie in de lever bij de parodontitis patiënt plaatsvindt.

Het is aangetoond dat verschillende ontstekingmarkers toekomstige vasculaire

aandoeningen voorspellen (21,22,23). CRP en het aantal leukocyten, zijn o.a. aangewezen

als markers voor hart- en vaatziekten (HVZ) (24,25). Verhoogde waardes van CRP en

leukocyten in patiënten met HVZ worden tegenwoordig ook gezien als een mogelijk

gevolg van chronisch infectieuze processen en ontstekingsreacties (26,27,28). Parodontitis

is één van de chronische infectieuze aandoeningen die geassocieerd is met HVZ in

verschillende epidemiologische studies (29). Daarnaast zijn verhoogde bloedwaarden van

CRP en leukocyten gevonden bij patiënten met parodontitis (30,31). Het onderliggende

mechanisme van HVZ is atherosclerose. In dit verband is het bijzonder interessant dat

CD14 het mogelijk maakt dat LPS gebonden kan worden aan het LPS binding-eiwit

(LBP); het LPS-CD14-LBP complex kan endotheelcellen en gladde spiercellen direct

activeren (32,33), wat leidt tot verhoogde expressie van celadhesie moleculen. Hierdoor

wordt de procoagulante activiteit in bloedvaten verhoogd en de ontstekingreacties

binnenin en rondom de atherosclerotische laesies verergert (34). Gebaseerd op onze

resultaten uit Hoofdstuk 4, waar verhoogde sCD14 waardes bij parodontitis werden

aangetoond, in samenhang met verhoogde CRP waarden en aantallen leukocyten, zouden

verhoogde sCD14 spiegels in het bloed kunnen leiden tot een verhoogde activiteit

binnenin de atherosclerotische plak bij patiënten met een risico voor HVZ. Wij

veronderstellen dat sCD14-gemedieerde signalering één van de routes is die leidt tot

verhoogde atherogene activiteit en daardoor tot een verhoogd risico voor HVZ bij

parodontitis patiënten.

Niet alleen PMNs en monocyten zijn in staat tot interactie met bacteriën, maar ook

bloedplaatjes reageren op bacteriën door middel van uitscheiding van antimicrobiële

139

Samenvatting

eiwitten (35), en de expressie van proinflammatoire receptoren (36). In Hoofdstuk 5 en 6

hebben we de activeringsstatus van circulerende bloedplaatjes bij parodontitis patiënten

geanalyseerd, alsmede de reactie van de plaatjes op parodontale pathogenen en de

interactie tussen bloedplaatjes, PMNs en monocyten tijdens stimulatie met bacteriën.

Parodontitis patiënten lieten een verhoogde activering van de plaatjes zien, dat werd

aangetoond door de verhoogde plasma waardes van P-selectine en de verhoogde expressie

van de glycoproteïne IIb-IIIa. P-selectine en de glycoproteïne IIb-IIIa worden bij

activering van bloedplaatjes in hoge mate tot expressie gebracht en zijn verantwoordelijk

voor de hechtende en aggregerende eigenschappen van bloedplaatjes. P-selectine wordt

enkele minuten na activering uitgescheiden door bloedplaatjes en wordt in het plasma

teruggevonden als oplosbaar (s)P-selectine (37). Wij vonden dat de activering van de

bloedplaatjes intenser was bij parodontitis patiënten naarmate de ziekte ernstiger was, dus

“dosis” afhankelijk was.

Bovendien hebben we in Hoofdstuk 6 laten zien dat bloedplaatjes van parodontitis

patiënten gevoeliger zijn voor orale bacteriën dan bloedplaatjes van parodontaal gezonde

personen. Als reactie op A. actinomycetemcomitans, P. gingivalis en S. sanguis, maar niet

op T. forsythia, brachten de bloedplaatjes van patiënten meer P-selectine tot expressie dan

de bloedplaatjes van controles. Bovendien werden er, ex vivo, als reactie op de genoemde

paropathogene bacterië, meer bloedplaatjes-monocyt complexen gevormd met het bloed

van patiënten, dan met bloed van controles. In een fagocytose experiment, fagocyteerden

bloedplaatjes-PMN- en bloedplaatjes-monocyt complexen meer bacteriën dan

bloedplaatjes-vrije cellen, wat suggereert dat de complexen geactiveerde cellen bevatten.

Parodontitis is een aandoening waarbij, door ulceratie van het pocketepitheel,

beperkte, maar desalniettemin frequente bacteremiën voorkomen tijdens normale

activiteiten zoals kauwen of tanden poetsen (38,39). Deze bacteremiën zijn de oorzaak van

endotoxemia en een chronische systemische ontstekingsreactie bij parodontitis patiënten

(40,31,19). Uit epidemiologisch onderzoek is gebleken dat parodontitis geassocieerd is

met een verhoogd risico op hartinfarcten en beroerte (29), maar de hiervoor

verantwoordelijke mechanismen zijn nog onduidelijk. Gezien onze resultaten, denken wij

dat de pathologische processen bij parodontitis o.a. resulteren in de activering van

bloedplaatjes en monocyten, een steeds terugkerend proces tijdens elke bacteremie bij

parodontitis. Geactiveerde bloedplaatjes produceren grote hoeveelheden proinflammatoire

mediatoren afkomstig vanuit hun alfa-granules en “dense-body” systemen. Bovendien

komen meer receptoren tot expressie. Na activering van bloedplaatjes induceren de

140

Samenvatting

vrijgekomen proinflammatoire mediatoren en de receptoren, de hechting van plaatjes aan

de endotheelcellen die de bloedvatwand bekleden (36). Eenmaal gehecht, creëren de

bloedplaatjes een platform waarop monocyten kunnen rollen en sterk hechten, hetgeen

leidt tot een verhoogde monocyt rekrutering. Monocyten in de subendotheliale ruimte

gaan overmatig intracellulair lipoproteinen opnemen, wat leidt tot accumulatie van

intracellulaire vetdruppels en formatie van schuimcellen. Deze functionaliteit maken

geactiveerde bloedplaatjes en monocyten essentiële deelnemers in zowel trombose als

atherogenese en wij suggereren dan ook dat dit, in ieder geval gedeeltelijk, de

epidemiologische relatie tussen HVZ en parodontitis kan verklaren.

Het is tot op heden onduidelijk of de verhoogde bloedplaatjes reactiviteit bij

parodontitis patiënten intrinsiek is, het resultaat van een specifieke genetische opmaak, of

reactief is, dat wil zeggen het resultaat van priming door bacteriële producten afkomstig

uit de parodontale pockets of door de cytokines die geproduceerd worden als gevolg van

de systemische ontstekingsreactie in parodontitis. Verder onderzoek, waarbij de mate van

plaatjesactivering en de reactiviteit worden vastgesteld na succesvolle behandeling van

parodontitis, zal hier meer duidelijkheid over kunnen verschaffen. Belangrijk is in dit

verband dat een interventie studie liet zien dat de behandeling van patiënten met

parodontitis resulteert in een verbeterde endotheliale functie (41); de biologische basis van

deze verbetering van de vasculaire conditie is tot op heden nog onduidelijk. Een afname in

de mate van bloedplaatjes activering zou dit echter gedeeltelijk kunnen verklaren.

Tot slot

In dit proefschrift hebben we de reactiviteit van PMNs, monocyten en bloedplaatjes

onderzocht. Voorgaande studies hebben aangetoond dat early-onset parodontitis patiënten

o.a. gekarakteriseerd worden door het FcγRIIa131H/H genotype en door de subgingivale

kolonisatie met A. actinomycetemcomitans. In een studie in dit proefschrift vertoonden de

FcγRIIa131H/H genotype patiënten hyperactieve PMNs in functionele assays waarbij A.

actinomycetemcomitans bacteriën werden gebruikt als stimuli. Voor de FcγRIIa varianten

is de origine duidelijk genetisch en zal de therapeutische aanpak meer in de richting gaan

van preventie van parodontitis; pro-actief genetische screening op vatbaarheid voor

parodontitis ligt wellicht in het verschiet.

Daarnaast hebben we aangetoond dat bloedplaatjes en monocyten van parodontitis

patiënten gevoeliger zijn voor activering door orale bacteriële soorten, zoals A.

actinomycetemcomitans, P. gingivalis en S. sanguis, dan cellen van gezonde controles.

141

Samenvatting

Parodontale therapie resulteert zowel in een afname van de hoeveelheid bacteriën in de

parodontale pockets, als in een afname van de systemische ontstekingsreactie. Gegeven de

activiteit van bloedplaatjes en monocyten in trombotische processen en atherosclerose, kan

parodontale therapie een toegevoegde waarde hebben, waarbij niet alleen de mond

gezondheid van de patiënt verbetert, maar ook het algemene risico voor een myocard

infarct en beroerte wellicht afneemt.

REFERENTIES









Immunol 147:255-264.



30:595-602.







7 Wijngaarden S, van Roon JAG, Bijlsma JWJ, van de Winkel JGJ, Lafeber

FPJG. 2003. Fc{gamma} receptor expression levels on monocytes are elevated in

142

Samenvatting

rheumatoid arthritis patients with high erythrocyte sedimentation rate who do not use

anti-rheumatic drugs. Rheumatology (Oxford) 42:681-688.






121:566-570.
















1525.




143

Samenvatting



21:125-131.




252:1321-1322.







Porphyromonas gingivalis outer membrane vesicles. Microbial Pathogenesis 36:319-

325.

21 Danesh J, Wheeler JG, Hirschfield GM, Eda S, Eiriksdottir G, Rumley A, Lowe

GD, Pepys MB, Gudnason V. 2004. C-reactive protein and other circulating markers

of inflammation in the prediction of coronary heart disease. N Engl J Med 350:1387-

1397.

22 Keaney JF, Jr. and Vita JA. 2002. The value of inflammation for predicting unstable

angina. N Engl J Med 347:55-57.

23 Lindahl B, Toss H, Siegbahn A, Venge P, Wallentin L. 2000. Markers of

myocardial damage and inflammation in relation to long-term mortality in unstable

coronary artery disease. FRISC Study Group. Fragmin during instability in coronary

artery disease. N Engl J Med 343:1139-1147.

24 Ikonomidis I, Stamatelopoulos K, Lekakis J, Vamvakou GD, Kremastinos DT.

2008. Inflammatory and non-invasive vascular markers: the multimarker approach for

risk stratification in coronary artery disease. Atherosclerosis 199:3-11.

144

Samenvatting

25 Rana JS, Boekholdt SM, Ridker PM, Jukema JW, Luben R, Bingham SA, Day

NE, Wareham NJ, Kastelein JJ, Khaw KT. 2007. Differential leucocyte count and

the risk of future coronary artery disease in healthy men and women: the EPIC-

Norfolk Prospective Population Study. J Intern Med 262:678-689.



27 Lowe GD. 2001. The relationship between infection, inflammation, and cardiovascular

disease: an overview. Ann Periodontol 6:1-8.

28 Maseri A, Biasucci LM, Liuzzo G. 1996. Inflammation in ischaemic heart disease.

BMJ 312:1049-1050.







76:2106-2115.






1026.





145

Samenvatting




Loscalzo J, Valeri CR. 1996. In vivo tracking of platelets: Circulating degranulated


93:11877-11882.







40 D'Aiuto F, Parkar M, Andreou G, Suvan J, Brett PM, Ready D, Tonetti MS.

2004. Periodontitis and systemic inflammation: control of the local infection is

associated with a reduction in serum inflammatory markers. J Dent Res 83:156-160.




146

Acknowledgements

I have learned a lot in the past four years, not only about research and science, but also

about myself. For all this knowledge I want to thank the people who contributed directly

or indirectly.

Dear Bruno, you gave me the opportunity of doing research on one of the most

intriguing aspects of dentistry, periodontal immunology. I want to thank you for your trust

in my potential and for the freedom you gave me to implement my ideas in the research

design. I have also learned a lot from your way of motivating people to work

independently.

Dear Ubele, thanks for your clinician’s view in my articles and for your critical

eye, which spotted ambiguous sentences. Your input really sped up the last months of the

writing process.

Dear Vincent, you offered me the hospitality of the Oral Cell Biology Department

from my first days in Amsterdam. Your disbelief in biology dogma’s, sincere interest in

scientific findings and your personal way of turning apparently negative results into future

directions of research have inspired me a lot.

I have learned a lot also from people outside ACTA. Dear dr. Nieuwland, beste

Rienk, our collaboration resulted in two publications of which I am very proud. Thanks a

lot for all the time you have invested in our meetings and for your honest opinion about

things that had to be improved. In the beginning of my PhD-training, I spent time at

Sanquin Research Amsterdam, learning about phagocytosis, FcγR-blocking and FcγR-

genotyping. My gratitude goes to Nannette Brouwer, Anton Tool, Edwin van Mirre and

Judy Geissler for their help and to Prof. Dirk Roos for his interest in my research.

The platelet-project wouldn’t have been possible without the help of Dimitris

Papapanagiotou and Denise Duijster. Dear Dimitris, our very early mornings in ACTA

paid-off and I think you are, just like me, happy with the publication we have written

together. Dear Denise, without your motivational skills we could not have seen so many

patients and healthy controls in such a short time. Thanks a lot, also for the determination

of looking for three months for one 48 years old Caucasian control subject who smokes.

We found him in the end…I really hope you will follow your dream of doing research.

Who knows, maybe periodontitis in relation to allergies?

147

Acknowledgements

My studies would not have been possible without all the subjects, who accepted to

participate in the studies and donate blood for the project: periodontitis patients and

periodontally-healthy controls; many thanks to you all. I am grateful to my colleagues who

donated blood for the preliminary experiments, in particular to Cor, Teun and Veerle who

were victims of the Romanian vampire on multiple occasions. Thanks to Ingrid and Gaudy

who helped me with the blood collection for the first study.

The nature of my project obliged me to spend my time in-between ACTA and VU.

Thanks to the colleagues from the Department of Periodontology for their willingness to

help me in recruiting patients and for the good time spent on the days-out. Dinie, bedankt

voor het snel afhandelen van lesmaterial, artikelen en brieven. Thanks to the colleagues

from Medical & Oral Microbiology for their hospitality. Special thanks to Marja Laine,

who agreed to share her office with me for one year. Dear Marja and Servaas, I hope you

like the CD14 paper just as much as I do; I learned a lot about genetic studies from our

discussions around the paper. Dear colleagues from Oral Cell Biology, you have accepted

as one of yours from the very beginning; bedankt voor jullie bereidheid om met mij

Nederlands te praten, mijn fouten te verbeteren en voor de gezelligheid binnen de

afdeling. Teun, jij was mij dagelijkse taaladviseur, naast Ineke en Veerle die hebben voor

mij brieven en stukken tekst verbeterd. Bedankt voor alles! Beste Theo, ik heb jouw kennis

en goed humeur gemist in mijn laatste maanden in Amsterdam.

My friends, Veerle and Ton, thanks a lot for your help and agreeing to play the “

paranimfen”. Especially after my moving to Belgium, you made everything going

smoothly; many thanks for the help translating the Summary. Ton, you are the definition

of a citizen of the world, and your lack of preconceived ideas is genuine. Veerle, you have

helped me not only in Amsterdam, but also in Belgium, you made my transition here

easier. Je bent een echte vriendin, ik kan je het nog niet genoeg bedanken voor de dag-

poetsen-in-Antwerpen en voor de tips voor het overleven in België. Veel succes met het

afronden van jouw PhD!

Last but not least, I want to thank my family for supporting me throughout all these

years, especially to my parents, who found the strength to be happy for my steps-forward

here, although always missed me and wished we lived closer. Dragii mei Mami şi Tati, vă

mulţumesc pentru tot ce aţi făcut pentru mine, pentru că întotdeauna aţi avut încredere în

mine şi m-aţi învăţat şi pe mine să am. Vă iubesc tare!

If I have actually any thesis to defend is mainly Paul’s fault. Meeting him and

falling in love with him motivated me to find a way to be together, and I want to thank

148

Acknowledgements

him for all his love and patience. His unconditioned confidence got us through all the

rough patches inherent to a PhD-training. Dragul meu, sufletul tău cald şi iubitor e

singurul loc din lume unde mă simt acasă. Te iubesc din toată inima mea!

149

List of publications

1. Nicu EA, van der Velden U, Everts V, Van Winkelhoff AJ, Roos D, Loos BG.

Hyper-reactive PMNs in FcγRIIa 131H/H genotype periodontitis patients.

Journal of Clinical Periodontology 2007; 34: 938-945.

2. Nicu EA, van der Velden U, Everts V, Loos BG. Expression of FcγRs and

mCD14 on PMNs and monocytes may determine the periodontal infection.

Clinical and Experimental Immunology 2008; 154:177-186.

3. Papapanagiotou D, Nicu EA, Bizzarro S, Gerdes VEA, Meijers JC, Nieuwland R,

van der Velden U, Loos BG. Periodontitis is associated with platelet activation;

Atherosclerosis, in press, 2008.

4. Nicu EA, van der Velden U, Nieuwland R, Everts V, Loos BG. Elevated platelet

and leukocyte response to oral bacteria in periodontitis. Journal of Thrombosis

and Haemostasis, in press, 2008.

5. Nicu EA, Laine ML, Morré SA, van der Velden U, Loos BG. Soluble CD14 as a

possible molecular link between atherosclerosis and chronic infectious diseases:

periodontitis as model. Submitted to Innate Immunity.

6. van Wissen M, Nicu EA, Bizzarro S, Splint LJ, Meijers JCM, Gerdes VEA, Loos

BG. Periodontitis and systemic markers of inflammation and cardiovascular

disease. Submitted to Atherosclerosis.

Professional publications (non-ISI)

Nicu EA, Loos BG. De rol van PMNs bij parodontitis. ACTA-quality practice;

jaargang 3, september 2007.

151

https://www.researchgate.net/publication/5233817_Periodontitis_is_associated_with_platelet_activation?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/23450845_Elevated_platelet_and_leukocyte_response_to_oral_bacteria_in_periodontitis?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=



https://www.researchgate.net/publication/5964814_Hyper-reactive_PMNs_in_FcgRIIa_131_HH_genotype_periodontitis_patients?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

https://www.researchgate.net/publication/5964814_Hyper-reactive_PMNs_in_FcgRIIa_131_HH_genotype_periodontitis_patients?el=1_x_8&enrichId=rgreq-5c97dd27233370efb835bf9cfb2c6ad6-XXX&enrichSource=Y292ZXJQYWdlOzUyMzM4MTc7QVM6MTAzMDc0Njg5NDU0MDg2QDE0MDE1ODYzMjk4MjQ=

Periodontitis is associated with platelet activation

Documents

Transcript of Periodontitis is associated with platelet activation