G

Y

Ko

Va

b

c

g

a

ARRA

KNRKKRX

p

1d

ARTICLE IN PRESS Model

PHRS-2348; No. of Pages 13

Pharmacological Research xxx (2011) xxx– xxx

Contents lists available at ScienceDirect

Pharmacological Research

jo ur n al hom epage: www.elsev ier .com/ locate /yphrs

V7 channels regulate muscle tone and nonadrenergic noncholinergic relaxationf the rat gastric fundus

. Ipaveca, M. Martirea, V. Barreseb, M. Taglialatelab,c, D. Curròa,∗

Institute of Pharmacology, School of Medicine, Catholic University of the Sacred Heart, L.go F. Vito 1, 00168 Rome, ItalyDivision of Pharmacology, Department of Neuroscience, School of Medicine, University of Naples “Federico II”, Ed. 19, Via Pansini 5, 80131 Naples, ItalyDepartment of Health Sciences, University of Molise, Via De Sanctis, 86100 Campobasso, Italy

r a p h i c a l a b s t r a c t

r t i c l e i n f o

rticle history:eceived 28 February 2011eceived in revised form 14 June 2011ccepted 21 June 2011

eywords:onadrenergic noncholinergic relaxationat gastric fundusV7 channelsCNQ channelsetigabine

a b s t r a c t

Voltage-dependent type 7 K+ (KV7) channels play important physiological roles in neurons and musclecells. The aims of the present study were to investigate the motor effects of KV7 channel modulators inthe rat gastric fundus and the expression of KV7 channels in this tissue.

Muscle tone and electrical field stimulation (EFS)-evoked relaxations of precontracted longitudinalmuscle strips of the rat gastric fundus were investigated under nonadrenergic noncholinergic conditionsby organ bath studies. Gene expression was studied by real-time PCR and tissue localization of channelswas investigated by immunohistochemistry.

The KV7 channel blocker XE-991 induced concentration-dependent contractions, with mean pD2 andEmax of 5.4 and 48% of the maximal U46619-induced contraction, respectively. The KV7 channel activatorsretigabine and flupirtine concentration-dependently relaxed U46619-precontracted strips, with pD2s of

E-991 4.7 and 4.4 and Emax of 93% and 91% of the maximal relaxation induced by papaverine, respectively. XE-991concentration-dependently inhibited retigabine-induced relaxation with a pIC50 of 6.2. XE-991 and DMP-

Please cite this article in press as: Ipavec V, et al. KV7 channels regulate muscle tone and nonadrenergic noncholinergic relaxation of the ratgastric fundus. Pharmacol Res (2011), doi:10.1016/j.phrs.2011.06.016

543, another KV7 channel blocker, increased by 13–25% or reduced by 11–21% the relaxations evokedby low- or high-frequency EFS, respectively. XE-991 also reduced the relaxation induced by vasoactiveintestinal polypeptide (VIP) by 33% of controls. Transcripts encoded by all KV7 genes were detected in thefundus, with 7.4 and 7.5 showing the highest expression levels. KV7.4 and 7.5 channels were visualizedby confocal immunofluorescence in both circular and longitudinal muscle layers.

Abbreviations: TTX, tetrodotoxin; CTX GVIA, �-conotoxin GVIA; ICC, interstitial cells of Cajal; FLC, fibroblast-like cells; SMC, smooth muscle cells; TP, thromboxanerostanoid; VIP, vasoactive intestinal polypeptide.∗ Corresponding author. Tel.: +39 06 30154367/531; fax: +39 06 3050159.

E-mail address: dcurro@rm.unicatt.it (D. Currò).

043-6618/$ – see front matter © 2011 Elsevier Ltd. All rights reserved.oi:10.1016/j.phrs.2011.06.016

ARTICLE IN PRESSG Model

YPHRS-2348; No. of Pages 13

2 V. Ipavec et al. / Pharmacological Research xxx (2011) xxx– xxx

In conclusion, in the rat proximal stomach, KV7 channels appear to contribute to the resting muscle toneand to VIP- and high-frequency EFS-induced relaxation. KV7 channel activators could be useful relaxantagents of the gastric smooth muscle.

1

ombhegsatstlmia2si

eciomtmhabscotpmsaohKbscatf

tifdIppIge

and bubbled with a 95/5 O2/CO2 mixture inside 5-ml organ baths.

. Introduction

In mammalian cells, K+ channels are involved in several physi-logical processes, such as neurotransmitter and hormone release,otor activity of muscle cells, regulation of water-electrolyte

alance and epithelial secretion [1]. Opening of K+ channelsyperpolarizes the resting membrane potential and decreases cellxcitability. Many K+ channel subtypes in different cell types of theastrointestinal tract (epithelial, smooth muscle cells [SMC], inter-titial cells of Cajal [ICC], fibroblast-like cells [FLC] and neurons)re involved in gut secretory and motor activities. By differen-ially controlling the membrane resting potential of SMC–ICC–FLCyncytial apparatus in the various gut segments, K+ channels par-icipate to the region-dependent differences in basal muscle toneevels [2]. Opening of K+ channels is among the signal transduction

echanisms activated by the neurotransmitters released from thenhibitory motor neurons [2]. Voltage-dependent K+ (KV) channelsre particularly expressed in the GI tract; indeed, KV1.2, 1.5, 1.6,.2, 4.1, 4.3, 7, 11.1 and 12.1 transcripts and/or proteins have beenhown in the GI tract, with KV1.2 and 2.2 playing a dominant rolen regulating SMC contractility [2].

The KV7 channel subfamily includes 5 members (KV7.1–7.5),ach with distinct expression pattern and functional roles. KV7.1hannels mediate the slowly activating K+ current (IKs) involvedn the late repolarizing phase of the action potential in cardiomy-cytes [3]. In neuronal cells, KV7.2, 7.3 and 7.5 represent theolecular basis of the M current (IKM), a slowly activating and deac-

ivating current inhibited by muscarinic receptors stimulation, thatodulates cell excitability and firing pattern [4,5]. KV7.4 channels

ave been first described in the inner ear and auditory neurons [6]nd more recently in skeletal muscle cells [7]. KV7 channels haveeen shown to regulate vascular, gastrointestinal and genitourinarymooth muscle activity [8–11]. In the gastrointestinal tract, acetyl-holine has been long known to increase the membrane excitabilityf toad [12] and guinea-pig [13] gastric SMC through the inhibi-ion of a voltage-dependent K+ current active at resting membraneotential, having properties similar to neuronal IKM. This evidenceight suggest that KV7 channels are expressed in the SMC–ICC–FLC

yncytial apparatus of the stomach and their inhibition mediatecetylcholine-induced electrophysiological effects. The expressionf KV7 channels and the motor effects of KV7 channel modulatorsave been investigated in the mouse colon [9]. In the same study, allV7 channel gene transcripts have been shown to be expressed inoth gastric fundus and antrum in the mouse, with KV7.4 and 7.5howing the highest levels [9]. Only the expression of KV7.1–7.3hannel genes has been investigated in the rat stomach [14]. KV7.1nd 7.3 channel mRNAs were detected in the whole stomach andheir levels were relatively high in the antrum but very low in theundus [14].

The proximal stomach plays an important “reservoir” func-ion, i.e. it accommodates high volumes of food bolus with smallncreases in intraluminal pressure. The accommodative gastricunction occurs mostly through the active reflex neural nona-renergic noncholinergic (NANC) relaxation of the smooth muscle.

n vitro preparations of the rat proximal stomach passively androgressively relax under a constant load during the equilibrationeriod and generally stabilize on a very low basal muscle tone.

Please cite this article in press as: Ipavec V, et al. KV7 channels regulate mgastric fundus. Pharmacol Res (2011), doi:10.1016/j.phrs.2011.06.016

n addition, they show a very low phasic muscle activity. In vivo,astric tone appears to be maintained by vagally mediated cholin-rgic input [15]. The most probable neurotransmitters released by

© 2011 Elsevier Ltd. All rights reserved.

the inhibitory motor neurons are nitric oxide (NO) and vasoactiveintestinal polypeptide (VIP). NO is mainly responsible for the rapidbeginning and the high speed of the initial phase of the relaxation,whereas VIP and its related peptide, peptide histidine isoleucine(PHI), are mainly involved in the long duration of the inhibitoryresponse evoked by high-frequency neuronal activation [16]. Atleast a third component, probably produced by a non-purinergicneurotransmitter acting via apamin-sensitive mechanisms, seemsalso to be present [17]. It is well known that NO and VIP mainlyact through the activation of soluble guanylate cyclase and VPAC2receptors followed by stimulation of adenylate cyclase throughGs protein, respectively. However, the final molecular mecha-nisms linked to the relaxation have not been fully elucidated inthe rat gastric fundus. In addition, the ion channels contributingto the membrane resting potential of the SMC–ICC–FLC syncy-tial apparatus of the rat gastric fundus have not been definitivelycharacterized. In particular, a characterization of the role of KV7channels in the motor activity of rat proximal stomach has neverbeen performed. In this study, we investigated the effects of KV7channel modulators on the resting muscle tone and on the NANCrelaxation of the rat gastric fundus. The effects of KV7 channelblockade on the relaxations induced by NO and VIP were also eval-uated. The results of the present study indicate that KV7 channelsplay important roles in the maintenance of the low muscle tonein resting conditions and in the VIP-induced relaxation in the ratgastric fundus. Altogether, the results obtained provide the firstfunctional demonstration of a critical control exerted by KV7 chan-nels over rat proximal stomach motor activity, revealing a novelpharmacological target for therapeutic interventions against gas-tric motor disturbances.

2. Methods

2.1. Policy and ethics

This study was approved by the institutional Ethical Commit-tee for the Animal Experimentation of the Catholic University. Thework described in this article was carried out in accordance with theDirective 2010/63/EU of the European Parliament and of the Councilon the protection of animals used for scientific purposes. In addi-tion, this paper fulfils the Uniform Requirements for ManuscriptsSubmitted to Biomedical Journals of ICMJE.

2.2. Motor activity studies

2.2.1. General methodsWistar rats of either sex, weighing 180–320 g, were fasted

overnight with free access to water, afterwards killed by decapita-tion and exsanguinated. The gastric fundus was removed and twolongitudinal muscle strips (3 × 20 mm) were prepared according tothe method of Vane [18] in a Krebs solution of the following com-position (mM): NaCl 118.5, KCl 4.8, CaCl2 1.9, KH2PO4 1.2, MgSO41.2, NaHCO3 25 and glucose 10.1 (pH 7.4). The strips were mountedbetween parallel platinum electrodes (22 mm long, 4 mm wide and5.5 mm apart) and suspended in Krebs solution maintained at 37 ◦C

uscle tone and nonadrenergic noncholinergic relaxation of the rat

The strips were connected to isotonic transducers (model 7006;Ugo Basile Biological Research Apparatus, Comerio, Italy) undera 1-g load. Smooth muscle activity was recorded on a computer

ING Model

Y

gical R

uHpp6UMrKs(fai

2

c91ictspu

2

cAasi(baKwtwwa1

2a

towoi

t(s[tcOaaflrt

ARTICLEPHRS-2348; No. of Pages 13

V. Ipavec et al. / Pharmacolo

sing the PowerLab data acquisition system (ADInstruments, Castleill, Australia). Isolated EFSs, consisting of rectangular and bipolarulses of constant duration (1 ms) and amplitude (120 mA), wereerformed via platinum plate electrodes by a stimulator (model012; Palmer Bioscience, now Harvard Apparatus Ltd., Edenbridge,K) linked in series with a 4-channel constant-current unit (modelultiplexing Pulse Booster; Ugo Basile Biological Research Appa-

atus). Tissues were initially allowed to equilibrate for 40 min inrebs solution. After this period, in all experimental series, the batholution also contained atropine (1 �M) and guanethidine (5 �M)to achieve NANC conditions). Strips were allowed to equilibrateor 20 more min in this bath solution. The incubation medium waslways changed every 10 min (during the equilibration period andn between drug administration and/or periods of EFS).

.2.2. Study of the motor effects induced by U46619In a first series of experiments, the strips were exposed to

onsecutive 5-min incubations with increasing concentrations of,11-dideoxy-9�,11�-methanoepoxy prostaglandin F2� (U46619,

nM to 1 �M), a selective thromboxane receptor (TP) agonist, tonvestigate the concentration–response relationship for this mus-le contracting agent and set the maximal contractile capacity ofhe strips. Strips were allowed to recover to basal tone prior to theubsequent U46619 concentration. Contractions were expressed asercentages of the effect produced by the maximal concentrationsed (1 �M).

.2.3. Study of the motor effects induced by KV7 channel blockersIn a second series of experiments, the preparations were first

ontracted by a submaximal concentration (0.1 �M) of U46619.fter 10 min, U46619 was washed out from the incubation mediumnd the strips were allowed to return to basal tone. Then, thetrips were exposed to consecutive 5-min incubations with increas-ng concentrations of the selective KV7 channel blocker XE-9910.5–100 �M) [19]. XE-991 was added cumulatively to the incu-ation medium. In four strips, the effects of retigabine (1–30 �M),

substance considered to be a selective activator of neuronalV7 channels [4,20], added cumulatively to the bath medium,ere investigated at the top of the concentration-dependent con-

raction induced by XE-991 (0.5–100 �M). Then, the substance/sas/were washed out from the bath and strip motor activityas recorded for 30–60 min. At this time, U46619 (0.1 �M) was

dded to the medium for a second time and left in the bath for0 min.

.2.4. Study of the motor effects induced by KV7 channelctivators

In all following series of experiments, the bath solution also con-ained U46619 (0.1 �M) (to raise strip tone and so enable recordingf relaxant responses). Initially, the strips were stimulated twiceith EFS (2 Hz, 30 s) to evaluate the quality and the reproducibility

f relaxant responses. A 10-min period elapsed between these twonitial EFS.

After 10 more min, the strips were exposed to consecu-ive incubations with increasing concentrations of retigabine1–100 �M) or flupirtine (1–144 �M), another substance con-idered to be a selective activator of neuronal KV7 channels4]. Since in preliminary experiments the strips fully recoveredo basal tone after retigabine washout from the bath, isolatedoncentration–response curves were performed for this drug.n the contrary, the strips did not fully recover to basal tonefter flupirtine washout, so that this second KV7 activator was

Please cite this article in press as: Ipavec V, et al. KV7 channels regulate mgastric fundus. Pharmacol Res (2011), doi:10.1016/j.phrs.2011.06.016

dded cumulatively to the incubation medium. Retigabine andupirtine were left in the bath until peak relaxations wereeached, that required 5 or 10 min, respectively. In some strips,he concentration–response curve for flupirtine was studied

PRESSesearch xxx (2011) xxx– xxx 3

in the presence of the voltage-dependent Na+-channel blockertetrodotoxin (TTX, 1 �M; pre-incubation time: 10 min) or thevoltage-dependent N-type Ca2+-channel blocker �-conotoxin GVIA(CTX GVIA, 30 nM; 10 min). The effects of TTX (1 �M) and CTX GVIA(30 nM) on the relaxation induced by retigabine (100 �M) werealso studied. In separate preparations, the effect induced by reti-gabine (10 or 30 �M) and flupirtine (44 �M) were investigated inthe presence of XE-991 (20 �M). Subsequently, to better evaluatethe inhibitory effects of XE-991 on retigabine-induced relaxation,the concentration-dependent effects of XE-991 (0.5–20 �M) on thesubmaximal relaxation induced by retigabine (30 �M) were inves-tigated.

2.2.5. Effects of KV7 channel modulators on the relaxationsinduced by EFS, NO and VIP

The strips were subjected to two consecutive EFS (pulse trainduration: 2 min), at the frequency, respectively, of 2 and 13 Hz.At these parameters, EFS has been shown to induce submaximalresponses in the frequency–response curves based on the ampli-tude or the area under the curve (AUC) of relaxant responses,respectively [21,22]. On the contrary, the amplitude of EFS (13 Hz)-evoked relaxation is a nearly maximal response. Strips wereallowed to recover to basal tone prior to the second EFS (usu-ally, 10–15 min elapsed between 2 Hz EFS cessation and 13 Hz EFSbeginning). After the induction of these control relaxations andthe recovering to basal tone, the strips were exposed to a phar-macological agent and then EFS (2 and 13 Hz) were repeated in itspresence. The effects of XE-991 (10–50 �M) and DMP-543 (20 �M),another substance considered to be a selective KV7 channel blocker[4], were evaluated. Since KV7 channel blockers increased striptone, parallel control strips were studied in which the tone wasincreased to a similar level by a higher concentration (0.3 �M)of U46619 before the second series of EFS. The effects of XE-991(20 �M) on the submaximal relaxations produced by 2-min con-secutive incubations with NaNO2 (300 �M) in 0.1 N HCl, a toolused to study NO-induced effects, and VIP (10 nM) were alsoinvestigated. Pre-incubation time of drugs was 10 min. In somestrips, a low concentration (3 �M) of retigabine was added to thebath medium for 2 min just before 2 Hz and 13 Hz EFS and thenmaintained in the bath during EFS to investigate its effects onEFS-induced relaxations. A group of untreated strips was used atthe same time as the strips treated with the different reagents tocheck for possible effects due to the time elapsed between thetwo series of EFS or NaNO2 and VIP incubations. Each strip wasexposed to a single concentration of a pharmacological agent. Inseparate preparations, the effect of XE-991 (20 �M) on muscletone was evaluated with TTX (1 �M) or CTX GVIA (30 nM) in thebath.

At the end of each experiment, each strip was exposed for 5 minto papaverine (300 �M), which induced maximal relaxation. Inthe experiments in which the effects of flupirtine were investi-gated, papaverine was usually added to the medium 10 min afterflupirtine washout from the bath. In some experiments, however,20 or 30 min were waited before strip exposure to papaverineto better evaluate the recovery phase of muscle tone. Relaxantresponses induced by EFS (2 Hz), NaNO2 (300 �M) and KV7 channelactivators or contractions induced by KV7 channel blockers werecalculated as maximal amplitudes. Those induced by EFS (13 Hz)and VIP (10 nM) were calculated as both maximal amplitudes andAUCs, estimated using the software Chart (ADInstruments). Forthe analysis, amplitudes of relaxations or contractions and AUC ofrelaxant responses were normalized using some maximal ampli-

uscle tone and nonadrenergic noncholinergic relaxation of the rat

tude parameters. The amplitudes of relaxations or contractionsproduced by KV7 channel activators or blockers, respectively, wereexpressed as percentages of a maximal amplitude parameter mea-sured from the maximal U46619-induced contraction point (that

ING Model

Y

4 gical R

preiANraEabbatatt(erbtametapoei

2

ww((lRrt(ifpcatdgpwcm

fsSaguegf

ARTICLEPHRS-2348; No. of Pages 13

V. Ipavec et al. / Pharmacolo

roduced by the first addition of U46619 in the experiments car-ied out to investigate the concentration-dependent contractileffects induced by XE-991) to the maximal papaverine (300 �M)-nduced relaxation point reached at the end of each experiment.s for the relaxant effects induced by EFS or exogenous acidifiedaNO2 and VIP, since they can be differentiated as submaximal

esponses (amplitudes of relaxations induced by 2 Hz EFS andcidified NaNO2 and AUC of relaxant responses induced by 13 HzFS and VIP) and nearly maximal responses (amplitudes of relax-nt effects induced by 13 Hz EFS and VIP) and the KV7 channellockers significantly increase the muscle pre-contraction level, weelieved that it was not correct to normalize them with respect to

single parameter. Therefore, the submaximal relaxation ampli-udes induced by EFS (2 Hz) or acidified NaNO2 were expresseds percentages of a maximal amplitude parameter measured fromhe maximal U46619-induced contraction point reached beforehe addition of any test substance to the maximal papaverine300 �M)-induced relaxation point reached at the end of eachxperiment. Similarly, the submaximal AUCs (mm min) of theelaxant responses induced by 13 Hz EFS and VIP were dividedy the maximal amplitude parameter (mm) used to normalizehe submaximal relaxation amplitudes induced by EFS (2 Hz) andcidified NaNO2 and expressed as min [22]. On the contrary, eachaximal relaxation amplitude induced by EFS (13 Hz) or VIP was

xpressed as a percentage of its own maximal amplitude parame-er, measured from the U46619-induced contraction point reachedt the start of each EFS- or VIP-induced relaxation to the maximalapaverine (300 �M)-induced relaxation point reached at the endf each experiment. An example of the measurement of the differ-nt parameters used to normalize the relaxant responses is givenn Fig. 4A.

.3. Gene expression studies

The gastric fundus was removed from male Wistar rats,eighing 280–320 g and fasted overnight with free access toater, and total RNA was isolated by use of the TRI-Reagent

Sigma–Aldrich, Milan, Italy). RNA was treated with DNase-I1 U �l−1; Sigma–Aldrich) for 15 min at room temperature, fol-owed by spectrophotometric quantification. Final preparation ofNA was considered DNA- and protein-free if the ratio betweeneadings at 260/280 nm was >1.7. Isolated mRNA was reverse-ranscribed by use of MuLV high-capacity reverse transcriptase50 U �l−1; Applied Biosystems, Monza, Italy) in a buffer contain-ng 4 mM dNTP, Random Primers, 1 �l of RNase Inhibitor at 37 ◦Cor 120 min. The cDNA was amplified in reverse transcription-olymerase chain reaction (RT-PCR) using PCR gold buffer, alsoontaining 2 mM MgCl2, 0.8 mM dNTP mix, 0.001 mM forwardnd reverse primers and 1 U �l−1 Amplitaq Gold (Applied Biosys-ems). The protocol used for PCR amplification was the following:enaturation at 95 ◦C for 30 s, annealing at 57 ◦C for 30 s, and elon-ation at 72 ◦C for 30 s (40 cycles). To test the ability of the KV7rimers to specifically recognize the mRNA target for which theyere designed, RT-PCR experiments were performed with use of

DNA templates from adult rat brain (KV7.2–7.5) and heart (KV7.1)RNAs.Real-time quantitative PCR (qPCR) was carried out by a 7500

ast real-time PCR system (Applied Biosystems) with primerspecific for the KV7 channel genes and SYBR Green detection.amples were amplified simultaneously in a triplicate in one-ssay run and the cycle threshold (ct) value for each experimentalroup was determined. Data normalization was performed by

Please cite this article in press as: Ipavec V, et al. KV7 channels regulate mgastric fundus. Pharmacol Res (2011), doi:10.1016/j.phrs.2011.06.016

sing the ct for the amplification of GAPDH gene, a constitutivelyxpressed gene, as a control. Differences in mRNA content betweenroups were calculated as normalized values by use of the 2−�ct

ormula.

PRESSesearch xxx (2011) xxx– xxx

2.4. Immunohistochemistry

The rat gastric fundus was fixed in cold paraformaldehyde for2 h at 4 ◦C. The preparations were then washed several times inphosphate-buffered saline (PBS) and incubated in sucrose 10%-PBSat 4 ◦C for cryopreservation. Tissue was subsequently embeddedin Tissue-tek OCT compound and frozen at −80 ◦C. Frozen sections(20 �m) were cut using a cryostat, collected on super-frost glassesand stored at −20 ◦C for further processing. Slices were washedin PBS and incubated at 4 ◦C with the following primary antibod-ies: (i) rabbit anti KV7.1 (1:50, Alomone Labs, Jerusalem, Israel);(ii) rabbit anti KV7.4 (1:100, Abcam, Cambridge, UK); (iii) rabbitanti KV7.5 (1:100, Millipore, Temecula, CA, USA). Sections werewashed three times in PBS for 10 min and subsequently incubatedfor 1 h at RT with an anti-rabbit conjugated to Cy3 (1:100, Jack-son Immunoresearch, Suffolk, UK) and chromomycin A3 (1:1000,Sigma, St. Louis, MO, USA), used as a nuclear marker. All antibodiesand chromomycin were diluted in PBS containing 10% FBS and 0.1%Triton X-100. Subsequently, sections were washed in PBS, allowedto air dry and then mounted in SlowFade Antifade (Invitrogen –Molecular Probes, Carlsbad, CA, USA) before coverslipping. Cov-erslips were analyzed using a Zeiss LSM 510 Meta argon/kryptonlaser scanning confocal microscope. Images were acquired usingthe multitrack system to avoid crosstalk among channels. The exci-tation/emission settings were 430/505–550 nm for chromomycin,and 543/560–615 nm for CY3. Images were confocally captured byuse of 10X, 20X or 63X-oil immersion objective (PlanApochromat;numerical aperture 1.4), with a maximal confocal zoom factor of3, fixed box sizes of 512 × 512 pixels, and pinhole below 1 Airyunit. Each image was acquired four times, and the signal was aver-aged to improve the signal to noise ratio. The colour scheme usedwas green for chromomycin A3, and red for Cy3-labelled struc-tures.

2.5. Data analysis and statistical procedures

The results were evaluated by means of Student’s paired andunpaired t-test (results within and between tissues, respectively).When more than two groups had to be compared, analysis ofvariance (ANOVA) followed by Bonferroni’s test for multiple com-parison was performed. All values are presented as means ± SEM.P < 0.05 was considered statistically significant. The GraphPadPrism program (GraphPad Software, San Diego, CA, USA) was usedfor fitting the concentration–response curves and calculating EC50sand maximal effects.

2.6. Drugs, chemicals reagents and other materials

The following drugs were used: atropine sulphate, �-conotoxinGVIA, guanethidine sulphate, NaNO2, tetrodotoxin, VIP (Sigma,St. Louis, MO, USA); XE-991 dihydrochloride (Tocris, Bristol, UK;Ascent Scientific, Bristol, UK); flupirtine maleate, DMP-543 (Tocris);papaverine hydrochloride (Merck, Darmstadt, Germany); U46619(Cayman Chemical, Ann Arbor, MI, USA). Retigabine was kindlyprovided by ASTA Medica (Radebeul, Germany). Substances weredissolved with bidistilled water, except for flupirtine, retiga-bine, DMP-543 and U46619, that were dissolved with DMSO at10 mM, 100 mM and 20 mM, and methanol at 1 mM, respectively.Flupirtine was then diluted with bidistilled water. Retigabine andDMP-543 precipitated if they were then diluted with bidistilledwater to 10 mM and 2 mM, respectively. Consequently, retiga-

uscle tone and nonadrenergic noncholinergic relaxation of the rat

bine was then diluted at 10 mM and 3 mM with 33% and 25%DMSO, respectively. DMP-543 was then diluted at 2 mM with50% DMSO. Putative motor effects of DMSO were also investi-gated.

ARTICLE ING Model

YPHRS-2348; No. of Pages 13

V. Ipavec et al. / Pharmacological R

Fig. 1. Motor effects induced by XE-991 on longitudinal muscle strips of the ratgastric fundus under NANC conditions. (A) Representative tracings showing theconcentration-dependent contracting effects of XE-991 (0.5–100 �M). (B) Meanconcentration–response curve for contractions induced by XE-991 (0.5–100 �M).Contractions were measured as peak amplitudes. Peak amplitudes are expressedas percentages of a maximal amplitude parameter measured from the maximalU46619-induced contraction point reached before the addition of any test substancetoi

3

3

3

cToatpe7

3

ta5tm

o the maximal papaverine (300 �M)-induced relaxation point reached at the endf each experiment. Each point represents the mean ± s.e.m. of responses observedn nine strips.

. Results

.1. Motor activity studies

.1.1. Motor effects of U46619The selective TP agonist U46619 (1 nM–1 �M) induced

oncentration-dependent contractions of the gastric fundus strips.he mean pD2 (−log EC50) and maximal peak amplitude (Emax)f U46619-induced concentration–response curve were 7.51 ± 0.1nd 102.9 ± 1.7% of U46619 (1 �M)-induced contraction, respec-ively (n = 6). U46619 (0.1 �M), the concentration chosen torecontract the strips in the experiments in which the relaxantffects of KV7 modulators were studied, contracted the strips by5.8 ± 3.2% of the maximum.

.1.2. Motor effects of KV7 channel blockersXE-991 (0.5–100 �M) produced concentration-dependent con-

ractions of the gastric fundus strips (Fig. 1A). The mean pD2

Please cite this article in press as: Ipavec V, et al. KV7 channels regulate mgastric fundus. Pharmacol Res (2011), doi:10.1016/j.phrs.2011.06.016

nd Emax of XE-991-induced concentration-response curve were.40 ± 0.06 and 64.0 ± 2.5% of U46619 (0.1 �M)-induced contrac-ion, respectively (n = 13, Fig. 1B). Retigabine, added to the bath

edium at the top of XE-991-induced concentration–response

PRESSesearch xxx (2011) xxx– xxx 5

curve, did not induce any effect up to 10 �M (n = 4). At theconcentration of 30 �M, retigabine reverted XE-991-producedcontraction by 13.1 ± 1.9% (n = 4). After XE-991 washout fromthe bath, the strips recovered to 53.1 ± 4.7% of the maximalcontraction induced by XE-991 (Fig. 1A). Including this higherstarting tone level remaining after XE-991 washout from the bathmedium (i.e. measuring the contraction from the beginning ofthe concentration–response curve to XE-991), the contraction pro-duced by the second addition of U46619 (0.1 �M) to the mediumwas 121.0 ± 1.8% of the first one (109.3 ± 3.8% vs. 88.3 ± 3.0%,P < 0.001).

3.1.3. Motor effects of KV7 channel activatorsSince retigabine and flupirtine were dissolved with DMSO,

the putative motor effects of this solvent were investigated.DMSO induced reversible relaxations of U46619-precontractedfundus strips. The relaxations produced by DMSO at the con-centrations (0.33% and 1.44%) obtained in the bath mediumwhen the effects of retigabine and flupirtine at the maxi-mal concentrations tested (100 and 144 �M, respectively) wereinvestigated were 7.4 ± 1.4% and 22.0 ± 2.7% (n = 4), respec-tively.

Retigabine (1–100 �M) (Fig. 2A) and flupirtine (4–144 �M)(Fig. 2B) induced concentration-dependent relaxations of U46619-precontracted strips. Flupirtine-induced relaxations displayed aslower progression than those induced by retigabine (Fig. 2Aand B). In addition, since in preliminary experiments the stripsdid not recover to basal tone after flupirtine washout from thebath, the concentration-response relationship for the relaxanteffects induced by flupirtine was studied by adding this drugcumulatively to the incubation medium. On the contrary, thestrips fully recovered to basal tone after retigabine washout,so that isolated concentration–response curves were performed.The maximal amplitude of the relaxations induced by retiga-bine and flupirtine, calculated by non linear regression analysisof the concentration–response curves, were 93.6 ± 2.3% (n = 6) and90.9 ± 2.1% (n = 6) of the maximal amplitude parameter, respec-tively (Fig. 2C). Thus, the relaxant effects produced by retigabineand flupirtine were much higher than those produced by DMSO.The pD2s (−log EC50) of the concentration-response curves forthe relaxations produced by retigabine and flupirtine and were4.73 ± 0.05 and 4.41 ± 0.06, respectively (Fig. 2C). The strips recov-ered to 93.1 ± 1.6% (n = 6), 91.1 ± 4.6% (n = 4) and 79.3 ± 0.5% (n = 2)of the maximal relaxation induced by flupirtine 10, 20 and 30 minafter flupirtine washout from the bath, respectively (Fig. 2B).XE-991 (20 �M) fully blocked retigabine (10 �M)-induced relax-ant effects (n = 4) and almost abolished the relaxations inducedby retigabine (30 �M) and flupirtine (44 �M) (7.0 ± 1.3%, n = 4,and 4.1 ± 2.0%, n = 4, respectively). Concentration-response exper-iments performed to better evaluate the inhibitory effects ofXE-991 on retigabine-induced relaxation revealed that XE-991(0.5–20 �M) concentration-dependently inhibited the relaxantresponse induced by retigabine (30 �M), with a pIC50 and amaximal inhibitory effect of 6.22 ± 0.05 and 90.1 ± 2.0% of con-trols (n = 3), respectively (Fig. 3). When re-evaluated 30 minafter XE-991 (20 �M) washout from the bath, the relaxationproduced by retigabine (30 �M) was 9.4 ± 1.0% of controls.Neither TTX (1 �M) nor CTX GVIA (30 nM) affected the Emax

and the pD2 of the flupirtine-induced concentration–responsecurve (86.3 ± 2.2% and 4.40 ± 0.02, n = 3, with TTX, respectively;87.3 ± 0.3% and 4.47 ± 0.19, n = 3, with CTX GVIA, respectively).

uscle tone and nonadrenergic noncholinergic relaxation of the rat

Similarly, the relaxations produced by retigabine (100 �M) werenot modified by TTX (1 �M) or CTX GVIA (30 nM, Fig. 2A)(103.6 ± 2.7%, n = 3, and 102.4 ± 3.0%, n = 3, of controls, respec-tively).

ARTICLE IN PRESSG Model

YPHRS-2348; No. of Pages 13

6 V. Ipavec et al. / Pharmacological Research xxx (2011) xxx– xxx

Fig. 2. Motor effects induced by retigabine and flupirtine on U46619 (0.1 �M)-precontracted longitudinal muscle strips of the rat gastric fundus under NANCconditions. (A) and (B) Representative tracings showing the concentration-dependent relaxant effects of retigabine (1–100 �M) and flupirtine (1–100 �M),respectively. The effect of �-conotoxin GVIA (30 nM) on retigabine (100 �M)-induced relaxation is also shown. (C) Mean concentration–response curves forrelaxations induced by retigabine (1–100 �M) and flupirtine (4–100 �M). Relax-ations were measured as peak amplitudes. Peak amplitudes are expressed aspercentages of a maximal amplitude parameter measured from the maximalU46619-induced contraction point reached before the addition of any test substancetoi

3s

Kas5((

Fig. 3. Effects of XE-991 (0.5–20 �M) on retigabine (30 �M)-induced submaxi-mal relaxation of U46619 (0.1 �M)-precontracted longitudinal muscle strips of therat gastric fundus. Mean retigabine (30 �M)-induced relaxations observed in theabsence (0 XE-991, controls) or presence of XE-991 (0.5–20 �M). Relaxations weremeasured as peak amplitudes. Peak amplitudes are expressed as percentages of amaximal amplitude parameter measured from the maximal U46619-induced con-traction point reached before the addition of any test substance to the maximal

o the maximal papaverine (300 �M)-induced relaxation point reached at the endf each experiment. Each point represents the mean ± s.e.m. of responses observedn six strips.

.1.4. Motor effects of KV7 channel blockers on precontractedtrips

In the experiments performed to investigate the effects of+ channel blockers on the relaxations induced by EFS, XE-991nd DMP-543 further contracted U46619 (0.1 �M)-precontracted

Please cite this article in press as: Ipavec V, et al. KV7 channels regulate mgastric fundus. Pharmacol Res (2011), doi:10.1016/j.phrs.2011.06.016

trips (Fig. 4A). The contractions produced by XE-991 (10, 20 and0 �M) and DMP-543 (20 �M) were 14.2 ± 1.7% (n = 8), 24.2 ± 2.3%n = 8), 23.9 ± 1.9% (n = 9) and 17.3 ± 4.4% (n = 7), respectively. TTX1 �M) and CTX GVIA (30 nM) did not significantly affect XE-991

papaverine (300 �M)-induced relaxation point reached at the end of each experi-ment. Each point represents the mean ± s.e.m. of responses observed in three strips.Significant differences between test and control responses: ***P < 0.001.

(20 �M)-induced contraction of U46619 (0.1 �M)-precontractedstrips (27.8 ± 4.1%, n = 6, and 25.3 ± 3.0%, n = 6, in the presence ofTTX and CTX GVIA, respectively).

3.1.5. Effects of KV7 channel modulators on EFS-evoked NANCrelaxations

The amplitudes of EFS (2 and 13 Hz)-induced relaxations were61.4 ± 1.4% and 88.9 ± 1.2% of the maximal amplitude parame-ter, respectively (n = 52). The AUC of EFS (13 Hz)-evoked relaxantresponse, divided by the maximal amplitude parameter, was17.1 ± 0.6 min.

In the untreated strips that served for checking possible effectsdue to the time elapsed between the two series of EFS, the ampli-tude of the second EFS (2 Hz)-induced relaxation and amplitudeand AUC of the second EFS (13 Hz)-evoked relaxant response werenot significantly different from those of the first ones (Fig. 4B).

XE-991 (10 �M) significantly increased the amplitude of 2 HzEFS-induced relaxation (by 12.7 ± 2.1%, n = 8, P < 0.001, of con-trols; amplitudes before and during strip incubation with XE-991:56.3 ± 2.8% and 63.4 ± 3.3%, respectively). Higher concentrations(20 and 50 �M) of XE-991 produced similar significant increases(Fig. 4A and B, left graph). XE-991 (10, 20 and 50 �M) signifi-cantly inhibited the amplitude of EFS (13 Hz)-evoked relaxation(by 13.9 ± 2.6%, n = 8, P < 0.001, 10.8 ± 2.5%, n = 8, P < 0.01, and18.2 ± 1.3%, n = 9, P < 0.001, of controls, respectively; P = 0.071, one-way ANOVA, Fig. 4A and B, middle graph). XE-991 (10 �M) didnot significantly affect the AUC of 13 Hz EFS-induced relaxation.However, at higher concentrations, XE-991 significantly reducedthe AUC of EFS (13 Hz)-evoked relaxant response (by 15.6 ± 2.9%,n = 8, P < 0.01, and 15.8 ± 3.6%, n = 9, P < 0.01, of controls with 20and 50 �M XE-991, respectively, Fig. 4A and B, right graph). TheAUCs of relaxations induced by EFS (13 Hz) in the absence and in thepresence of XE-991 (20 �M) were 19.7 ± 1.8 min and 16.4 ± 1.4 min,n = 8, P < 0.01, respectively; those measured before and during incu-

uscle tone and nonadrenergic noncholinergic relaxation of the rat

bation with XE (50 �M) were 15.8 ± 0.8 min and 13.3 ± 0.9 min,n = 9, P < 0.01, respectively.

DMP-543 (20 �M) significantly increased the amplitude of EFS(2 Hz)-induced relaxation (by 24.8 ± 3.3%, n = 7, P < 0.001, of con-

ARTICLE IN PRESSG Model

YPHRS-2348; No. of Pages 13

V. Ipavec et al. / Pharmacological Research xxx (2011) xxx– xxx 7

Fig. 4. Effects of XE-991 on the NANC relaxant responses induced by EFS (2 or 13 Hz, 120 mA, 1 ms, pulse trains of 2 min) of U46619 (0.1 �M)-precontracted longitudinalmuscle strips of the rat gastric fundus. (A) Representative tracings showing the effects of XE-991 (20 �M). The submaximal relaxation amplitudes induced by EFS (2 Hz) wereexpressed as percentages of a maximal amplitude parameter measured from the maximal U46619-induced contraction point reached before the addition of any test substanceto the maximal papaverine (300 �M)-induced relaxation point reached at the end of each experiment (parameter indicated with a in the panel). Similarly, the submaximalAUCs (mm min) of the relaxant responses induced by EFS (13 Hz) were divided by this same maximal amplitude parameter (mm) and expressed as min. On the contrary,each maximal relaxation amplitude induced by EFS (13 Hz) was expressed as a percentage of its own maximal amplitude parameter, measured from the U46619-inducedcontraction point reached at the start of each EFS-induced relaxation to the maximal papaverine (300 �M)-induced relaxation point reached at the end of each experiment(parameters indicated with b and c in the panel, respectively). (B) Mean NANC relaxations evoked by 2 Hz (left graph) or 13 Hz EFS (middle and right graphs) observed inthe absence (0 XE-991, time controls) or presence of XE-991 (10–50 �M). Relaxations were measured as peak amplitudes (left and middle graphs) or AUCs (right graph) anda s.e.ms 1,***P

t(ow(b5oa1nmb

ecar

re expressed as percentages of control responses. Each point represents the mean ±trips. Significant differences between test and control responses: *P < 0.05, **P < 0.0

rols) and reduced the AUC of EFS (13 Hz)-evoked relaxant effectby 21.2 ± 4.1%, P < 0.01, of controls). The increase in the amplitudef EFS (2 Hz)-evoked relaxation produced by DMP-543 (20 �M)as significantly greater than that observed with XE-991 (20 �M)

P < 0.05, unpaired t-test). The amplitudes of relaxations evokedy EFS (2 Hz) without or with DMP-543 (20 �M) in the bath were9.9 ± 2.3% and 74.4 ± 2.2%, n = 7, P < 0.001, respectively. The AUCsf the relaxant responses induced by EFS (13 Hz) in the absencend in the presence of DMP-543 (20 �M) were 16.1 ± 0.8 min and2.7 ± 0.9 min, P < 0.01, respectively. DMP-543 (20 �M) did not sig-ificantly affect the amplitude of EFS (13 Hz)-evoked inhibitoryotor response (99.7 ± 1.7% of controls; 86.2 ± 2.6% and 85.7 ± 1.8%

efore and during incubation with DMP-543, respectively).Since XE-991 and DMP-543 increased strip tone, control

Please cite this article in press as: Ipavec V, et al. KV7 channels regulate mgastric fundus. Pharmacol Res (2011), doi:10.1016/j.phrs.2011.06.016

xperiments were performed in which some strips were furtherontracted by a higher concentration (0.3 �M) of U46619 to evalu-te whether the higher muscle tone level could affect the relaxantesponses evoked by the second series of EFS (2 and 13 Hz). The

. of responses observed in eight (0, 10 and 20 �M XE-991) or nine (50 �M XE-991) < 0.001.

higher muscle tone produced by U46619 (0.3 �M) (by 23.1 ± 4.6%,n = 6), however, did not significantly affect the relaxant responsesinduced by EFS (2 and 13 Hz). The responses measured beforeand after incubation with U46619 (0.3 �M) were 67.1 ± 5.2% and70.6 ± 6.8%, n = 6, respectively, for the amplitude of EFS (2 Hz)-evoked relaxation, 90.7 ± 4.2% and 87.8 ± 3.5%, respectively, forthe amplitude of EFS (13 Hz)-evoked relaxation, and 19.0 ± 1.8 minand 19.1 ± 2.3 min, respectively, for the AUC of EFS (13 Hz)-evokedrelaxation.

Retigabine (3 �M) significantly reduced the amplitude of EFS(2 Hz)-induced relaxation (by 13.6 ± 2.3%, P < 0.001, n = 6, P < 0.01,of controls) and increased the AUC of EFS (13 Hz)-evoked relax-ation (by 11.1 ± 2.8%, P < 0.05, of controls). However, when theamplitudes of EFS (2 Hz)-induced relaxations were measured from

uscle tone and nonadrenergic noncholinergic relaxation of the rat

the point at which retigabine (3 �M) was added to the bathmedium, they were not anymore significantly different fromcontrol relaxations (105.8 ± 2.9%). Retigabine (3 �M) did not signif-icantly affect the amplitude of the relaxation induced by EFS (13 Hz)

ARTICLE IN PRESSG Model

YPHRS-2348; No. of Pages 13

8 V. Ipavec et al. / Pharmacological Research xxx (2011) xxx– xxx

Fig. 5. Effects of XE-991 on the relaxant responses induced by NaNO2 (300 �M) in 0.1 N HCl or VIP (10 nM) of U46619 (0.1 �M)-precontracted longitudinal muscle strips ofthe rat gastric fundus. (A) Representative tracings showing the effects of XE-991 (20 �M). (B) Mean relaxations evoked by NaNO2 (left graph) or VIP (middle and right graphs)observed in the absence (0 XE-991, time controls) or presence of XE-991 (20 �M). Relaxations were measured as peak amplitudes (left and middle graphs) or AUCs (rightg of Fig.m me co*

(pt

3r

N(prw

diNad4tiiPFi

raph), normalized for the analysis in a similar way to that described in the legend

ean ± s.e.m. of responses observed in seven (20 �M XE-991) or nine (0 XE-991, ti*P < 0.01, ***P < 0.001. ###P < 0.001 vs. time controls.

101.6 ± 2.3% of controls). In these experiments, the relaxationsroduced by the first and the second addition of retigabine (3 �M)o the bath medium were 11.3 ± 1.3% and 12.6 ± 1.5%, respectively.

.1.6. Effects of KV7 channel blockers on NO- and VIP-inducedelaxations

The amplitudes of the relaxant effects produced by acidifiedaNO2 (300 �M), a tool used to study NO-induced effects, and VIP

10 nM) were 50.4 ± 2.2% and 89.3 ± 1.9% of the maximal amplitudearameter, respectively (n = 16). The AUC of VIP (10 nM)-evokedelaxant response, divided by the maximal amplitude parameter,as 15.0 ± 0.6 min.

In the untreated strips that served for checking possible effectsue to the time elapsed between the two series of consecutive

ncubations with acidified NaNO2 (300 �M), a tool used to studyO-induced effects, and VIP (10 nM), the amplitude of the secondcidified NaNO2 (300 �M)-induced relaxation was not significantlyifferent from that of the first one (90.9 ± 5.7%, n = 9, of controls;8.3 ± 3.0% and 42.6 ± 1.8%, respectively, Fig. 5B, left graph). Onhe contrary, the amplitude and the AUC of the relaxant responsenduced by the second incubation with VIP (10 nM) were signif-

Please cite this article in press as: Ipavec V, et al. KV7 channels regulate mgastric fundus. Pharmacol Res (2011), doi:10.1016/j.phrs.2011.06.016

cantly different from those of the first one (96.2 ± 1.6%, n = 9, < 0.05, and 89.8 ± 2.5%, n = 9, P < 0.01, of controls, respectively,ig. 5B, middle and right graphs). XE-991 (20 �M) did not signif-cantly affect the amplitude of the relaxation induced by acidified

3 and are expressed as percentages of control responses. Each point represents thentrols) strips. Significant differences between test and control responses: *P < 0.05,

NaNO2 (300 �M) (98.7 ± 5.4%, n = 7, of controls; 53.1 ± 3.1% and52.2 ± 4.0%, respectively, Fig. 5A and B, left graph). However, XE-991 (20 �M) significantly reduced the amplitude and the AUC ofthe relaxant response produced by VIP (10 nM) (to 76.9 ± 1.7%, n = 7,P < 0.001, and 60.3 ± 3.6%, n = 7, P < 0.001, of controls; both P < 0.001vs. time controls, unpaired Student’s t-test, Fig. 5A and B, middleand right graphs). The amplitudes of relaxations evoked by VIP(10 nM) before and during incubation with XE-991 (20 �M) were94.4 ± 3.0% and 72.5 ± 2.2%, n = 7, P < 0.001, respectively. The AUCsof the relaxant responses induced by VIP (10 nM) without and withXE-991 (20 �M) in the bath were 14.9 ± 1.0 min and 8.9 ± 0.5 min,P < 0.001, respectively. In this experimental series, the contractionproduced by XE-991 (20 �M) was 19.5 ± 1.9%.

3.2. Gene expression studies

To evaluate the expression of the mRNAs encoding for the vari-ous subtypes of KV7 channels and estimate their relative expressionlevels in the rat gastric fundus, the total RNA isolated from the fun-dus was amplified in RT-PCR and real-time qPCR experiments usingprimers specifically designed to recognize all mRNA splicing vari-

uscle tone and nonadrenergic noncholinergic relaxation of the rat

ants from each KV7 channel gene (Table 1). Transcripts from allknown KV7 channel genes were detected in the rat gastric fundusby RT-PCR with 40 cycles (Fig. 6A). However, it is well known thatRT-PCR experiments with a high fixed number of cycles can only

ARTICLE IN PRESSG Model

YPHRS-2348; No. of Pages 13

V. Ipavec et al. / Pharmacological Research xxx (2011) xxx– xxx 9

Table 1Sequences of oligonucleotide primers used for PCR.

Amplified gene Primer orientation and sequence (5′ → 3′) Amplicon size (bp) Reference

KV7.1 Forward: GGCTCTGGGTTTGCACTG 106 Joshi et al. [31]Reverse: CATAGCACCTCCATGCAGTC

KV7.2 Forward: GCTTTCCGTATCAAGGGCG 139 Lan et al. [54]Reverse: TGCTGACTTTGAGGCCAGG

KV7.3 Forward: ACACACCACTGTCCCTCATGTC 80 Hadley et al. [55]Reverse: TCTGTCTTGGGAGATGCTGAAG

KV7.4 Forward: CCCCGCTGCTCTACTGAG 86 Joshi et al. [31]Reverse: ATGACATCATCCACCGTGAG

KV7.5 Forward: CGAGACAACGACAGATGACC 77 Joshi et al. [31]

gfgs3r7rtKn

FefsgteE

Reverse: TGGATTCAATGGATTGTACCTGGAPDH Forward: CACCAGCATCACCCCATTT

Reverse: CCATCAAGGACCCCTTCATT

ive qualitative results. Consequently, qPCR experiments were per-ormed to quantify the relative expression levels of KV7 channelenes. KV7.4 and 7.5 channel subtypes showed the highest expres-ion levels (Fig. 6B). The mean cycle thresholds were 27.8, 28.3,1.5, 32.4, and 34.5 for KV7.4, 7.5, 7.1, 7.3, and 7.2 channel cDNA,espectively. Relative to KV7.4, transcript levels of KV7.1, 7.2, 7.3 and.5 channel genes were approximately 8.1%, 1.7%, 5.2% and 58.4%,espectively. In addition to those listed in Table 1, at least one addi-

Please cite this article in press as: Ipavec V, et al. KV7 channels regulate mgastric fundus. Pharmacol Res (2011), doi:10.1016/j.phrs.2011.06.016

ional set of primer pairs was used to test the expression of eachV7 transcript, with results similar to those shown in Fig. 6A (dataot shown).

ig. 6. Expression of KV7 channel genes in the rat gastric fundus. (A) Agarose gellectrophoresis of RT-PCR products obtained from cDNA amplification of rat gastricundus mRNA using KV7-selective primers. Amplicon sizes and primer sequences arehown in Table 1. For a comparison, the expression of KV7.1 and KV7.2–7.5 channelenes in rat heart and brain, respectively, was also studied. (B) Quantification ofranscripts for KV7 channel subtypes by use of real-time quantitative PCR. Data arexpressed as 2−�ct relative to GAPDH gene expression, as described in Section 2.ach bar is the mean ± s.e.m. of four separate determinations.

157 Joshi et al. [31]

3.3. Immunohistochemistry

Since gene expression studies revealed that the transcript abun-dance for KV7.4 and KV7.5 appeared to be the highest among KV7members, confocal immunofluorescence experiments were carriedout using two polyclonal antibodies directed against KV7.4 andKV7.5 to gain insight into the cellular and subcellular localizationof KV7.4 and KV7.5 proteins in the rat gastric fundus. The speci-ficity of the antibodies against each target subunit was assessed inimmunocytochemical experiments in CHO cells expressing KV7.4or KV7.5 proteins (data not shown). In rat gastric fundus sections,both KV7.4 and KV7.5 antibodies showed a similar staining pattern,labelling both the epithelial and muscular compartments (Fig. 7A).In the latter, both the circular (internal) and the longitudinal (exter-nal) layers appeared to be labelled. KV7.5 staining in the muscularlayers appeared fainter than that observed in the epithelial layer.Moreover, in the muscular layers, KV7.4 staining appeared moreintense when compared to that for KV7.5. For comparison, stain-ing for KV7.1 was investigated and found to be predominantly, butnot exclusively, localized to the epithelial compartment (data notshown). Higher magnification images for both KV7.4 and KV7.5antibodies revealed that, in the muscular layers, these subunitswere mainly localized to the plasma membrane of spindle-shapedsmooth muscle cells, although we cannot exclude that part of theimmunofluorescence signal also corresponds to neuronal fibres orICC. No nuclear staining was revealed, as suggested by the lackof co-localization with the DNA-binding marker chromomycin A3(Fig. 7B). For both KV7.4 and KV7.5 antibodies, membrane stainingin smooth muscle cells appeared non-continuous, rather show-ing puncta of higher expression density, possibly correspondingto regions of subunit clustering.

4. Discussion

Several K+ channels are expressed in the SMC–ICC–FLC syncy-tial apparatus of the gastrointestinal tract. Functionally, the mostimportant of them are the delayed rectifier KV1, 2 and 4 channels,large- and small-conductance KCa (BK and SK) channels and ATP-dependent Kir (KATP) channels [2,23]. However, additional types ofK+ channels are present in the gastrointestinal SMC–ICC–FLC syncy-tial apparatus, including the delayed rectifier KV7 (KCNQ) channels[2]. These channels are mostly known for their involvement inthe physiology of cardiomyocytes and neurons. The activation ofKV7.1 channels produces slowly activating K+ currents (IKs) that areresponsible for the late repolarizing phase of the action potential incardiomyocytes. On the other hand, IKM mediated by KV7.2, 7.3 and7.5 channels regulates resting membrane potential, firing rate and

uscle tone and nonadrenergic noncholinergic relaxation of the rat

neurotransmitter release in sympathetic [19], sensory [5] and cen-tral [24–26] neurons. Studies on KV7 channels in the smooth musclewere mainly carried out in blood vessels. The first gene expressionanalysis of vascular KV7 channels was carried out by Ohya et al. [27]

ARTICLE IN PRESSG Model

YPHRS-2348; No. of Pages 13

10 V. Ipavec et al. / Pharmacological Research xxx (2011) xxx– xxx

Fig. 7. Expression of K 7.4 and K 7.5 channel subunits in the rat gastric fundus. Low (A) and high (B) magnification confocal images of rat gastric fundus cryosections stainedf ndicat( end, t

ielstom

V V

or the nuclear marker chromomycin A3 (in green), for KV7.4 or KV7.5 (in red), as iA), and 10 �m in (B). (For interpretation of the references to color in this figure leg

n murine portal vein. An extensive profiling of KV7 channel genexpression throughout the murine vasculature followed a few yearsater [28]. Recently, KV7 channel gene expression has been also

Please cite this article in press as: Ipavec V, et al. KV7 channels regulate mgastric fundus. Pharmacol Res (2011), doi:10.1016/j.phrs.2011.06.016

hown in human arteries [29]. Many studies evaluated the elec-rophysiological and functional effects of KV7 channel modulatorsn blood vessels. Retigabine and flupirtine activate K+ currents inyocytes of murine portal vein [30] and rat pulmonary artery [31]

ed; merged images are shown in the rightmost panels. The scale bar is 100 �m inhe reader is referred to the web version of the article.)

and retigabine-induced effects are prevented by pretreatment withXE991 [30]. Retigabine and flupirtine relax precontracted segmentsof various mouse blood vessels [28,32] and their effects are blocked

uscle tone and nonadrenergic noncholinergic relaxation of the rat

by XE-991 [28]. Retigabine and S-1, another KV7 channel activator,relax precontracted human arteries and their effects are reversedby XE-991 [29]. XE-991 and linopirdine, another non-selective KV7channel blocker, induce significant increases in spontaneous con-

ING Model

Y

gical R

toaooadvtAothtagbb

[ifsaocitovm9cUamaitabntiSotmt

flpaaXrKnafrcivfr

ARTICLEPHRS-2348; No. of Pages 13

V. Ipavec et al. / Pharmacolo

ractile activity in the mouse portal vein [33] and vasoconstrictionf different in vitro preparations of rat [31,34–36], mouse [28,34]nd human [29] blood vessels. Only a few studies are available onther smooth muscles. KV7 channel activators or blockers reducer increase the motor activity of rat urinary bladder [11] and mousend human myometrium, respectively [10,37]. In addition, evi-ence has been provided that guinea-pig bladder ICC have outwardoltage-dependent K+ currents inhibited by XE-991 with a role inhe regulation of resting membrane potential and excitability [38].s for the gastrointestinal smooth muscle, KV7 channel activatorsr blockers induce inhibitory or excitatory effects on colonic spon-aneous motor activity, respectively [9]. In addition, IKs currentsave been detected in gastric antrum SMC [14]. In the present study,he effects of KV7 channel modulators on muscle tone and relax-nt responses elicited by EFS, NO and VIP were evaluated in the ratastric fundus. Expression of the transcripts and subunits encodedy the different KV7 genes has been also investigated in this tissuey qPCR and immunohystochemistry, respectively.

At first, the effects of the selective KV7 channel blocker XE-99119] on non-precontracted strips of the rat gastric fundus werenvestigated. XE-991 concentration-dependently contracted theundus strips with a mean EC50 of approximately 4.6 �M. It has beenhown that IC50 values of XE-991 for KV7.1–7.4 and KV7.5 channelsre approximately 1–5 �M and 60 �M, respectively, and the actionsf this blocker appear to be selective for KV7 channels at these con-entrations [8]. Thus, the EC50 of XE-991 in the rat gastric fundus isn the low micromolar range at which this blocker has been showno inhibit KV7.1–7.4 channels. The mean Emax of XE-991 was 63.2%f the maximal amplitude parameter. Considering that this latteralue is similar to that observed with 0.1 �M U46619 (75.8% of theaximal U46619-induced contraction), the maximal effect of XE-

91 was approximately 47.9% (63.2% of 75.8%) of the strip maximalontractile potential. XE-991 and DMP-543 also further contracted46619-precontracted strips by approximately 24% of the maximalmplitude parameter (i.e., approximately 18.2% of the strip maxi-al contractile potential). Thus, when the muscle is contracted to

pproximately three quarters of the maximum, XE-991 can stillnduce a contraction of approximately 38% of that induced whenhe smooth muscle is relaxed. XE-991-induced contraction was notffected by TTX or CTX GVIA, indicating that it is not producedy neuronal activation or excitatory neurotransmitter release fromeuronal terminals. Thus, XE-991 acts very probably at the level ofhe SMC–ICC–FLC syncytial apparatus. Hypothesizing that XE-991s acting only on KV7 channels, these findings suggest that, in theMC–ICC–FLC syncytial apparatus of proximal stomach, a fractionf KV7 channels is in the open state at the membrane resting poten-ial and plays a crucial role in determining the low level of basal

uscle tone. This fraction would be higher in strips precontractedo submaximal levels, due to membrane depolarization.

The selective KV7.2–7.5 channel activators retigabine andupirtine [4,20] produced concentration-dependent relaxations ofrecontracted fundus strips with EC50 of approximately 19 �Mnd 40 �M, respectively. Retigabine- and flupirtine-induced relax-tions were inhibited in a concentration-dependent manner byE-991 and were not affected by TTX or CTX GVIA. Thus, theyelax the gastric fundus very probably by specifically activatingV7 channels located in the SMC–ICC–FLC syncytial apparatus andot by mechanisms involving non-specific neuronal effects, such asctivation of inhibitory motor neurons or neurotransmitter releaserom their terminals. Retigabine and flupirtine almost completelyelaxed the strips, indicating a very significant contribution of KV7hannels in regulating gastric smooth muscle contractility. XE-991-

Please cite this article in press as: Ipavec V, et al. KV7 channels regulate mgastric fundus. Pharmacol Res (2011), doi:10.1016/j.phrs.2011.06.016

nduced contractions and flupirtine-induced relaxations reversedery slowly, leading to a only partial recovery upon their washoutrom the bath. These results possibly suggest a slow dissociationate for these drugs from the channels, which would thus remain

PRESSesearch xxx (2011) xxx– xxx 11

stabilized in the closed or the open state, respectively, by the twoKV7 channel modulators. Retigabine, on the other hand, displayedfaster kinetics and its effects were entirely reversed.

The partial reversibility or irreversibility of XE-991-inducedeffects has been reported in a number of previous studies [33,39].It is also known that the specific effects of XE-991 on KV7 channelsare likely to be maximal at concentrations of 10–20 �M and, whenXE-991 concentration is increased above these values, the drug isno longer selective for KV7 channels [8,36,39,40]. Thus, as far as XE-991 is concerned, the following alternative hypothesis may be putforward: on washout of 100 �M XE-991, the recovery to approxi-mately 53% of its maximal contraction may represent reversal of thenon-specific effects (and perhaps part of specific effects), with theremaining sustained contraction reflecting its irreversible action onKV7 channels. This hypothesis may be supported by the observa-tion that, 30 min after XE-991 washout from the bath, the relaxanteffect of retigabine was still almost fully blocked. In addition, thefact that application of U46619 (0.1 �M) after treatment with XE-991 induced a contraction significantly higher than that producedbefore XE-991 treatment, is also consistent with this hypothesis.In fact, U46619, when applied for the second time at submaximalconcentrations, would be acting on a membrane partially depolar-ized by the XE-991-produced irreversible KV7 channel blockade.XE-991 was approximately as potent in contracting the rat gastricfundus as in inhibiting the voltage-dependent outward K+ currentsin mouse portal vein SMC [33] and enhancing the depolarization-evoked [3H]dopamine release from rat striatal synaptosomes [25].XE-991 blocks cloned KV7.2, 7.2/7.3, 7.4 and 7.5 channels expressedin Xenopus oocytes, Chinese hamster ovary (CHO) or human embryokidney (HEK) cells with IC50 of 0.7 �M [19], 0.6 �M [19], 5.5 �M [41]and 65–75 �M [42,43], respectively. Thus, XE-991 EC50 for con-tracting the rat gastric fundus is very close to its IC50 on clonedKV7.4 channels. Retigabine and flupirtine relax the rat gastric fun-dus with potencies similar to those found in precontracted ringsof rat pulmonary artery (EC50s: 13 �M and 62 �M, respectively)[31]. Retigabine activates cloned KV7.2, 7.3, 7.2/7.3, 7.4, 7.5 and7.5/7.3 channels expressed in either Xenopus oocytes, CHO or HEKcells with EC50 of 2.5 �M [44], 0.6 �M [44], 1.6 �M [45], 1.4–5.2 �M[44,46], 2–6.4 �M [47] and 1.4 �M [48], respectively. So, retiga-bine EC50 for relaxing the rat gastric fundus appears closer to itsEC50s for activating cloned KV7.4 or 7.5 channels than to those foractivating KV7.2 or 7.3 channel subtypes. In our study, gene expres-sion experiments showed that KV7.4 and 7.5 channel genes havethe highest expression levels. Compared to the expression level ofKV7.4 channel gene, that of KV7.5 channel gene was approximately60%, whereas those of KV7.1, 7.2 and 7.3 channel genes resultedlower than 10%. A similar scenario has been described in bloodvessels [8] and mouse stomach [9]. Very low levels of KV7.1–7.3channel mRNAs have been detected in the rat gastric fundus alsoby Ohya et al. [14]. Immunohistochemical studies carried out byconfocal immunofluorescence methods showed that KV7.4 and 7.5channels are localized within the epithelial and muscular layersof the rat proximal stomach. In the muscular layers, both channelsubtypes appeared to be mainly localized to the plasma membraneof spindle-shaped smooth muscle cells and the staining for KV7.4channels appeared more intense when compared to that for KV7.5channels. Although the present results cannot exclude that partof the immunofluorescence signal within the muscular layers alsocorresponds to neuronal fibres or ICCs, the fact that TTX or CTX GVIAdid not interfere with the effects of XE-991 and retigabine suggeststhat KV7 channel activators and blockers exert their direct motoreffects in the rat gastric fundus by acting preferentially on muscle

uscle tone and nonadrenergic noncholinergic relaxation of the rat

KV7.4 channels.XE-991 and DMP-543 produced small but significant increases

in the relaxation induced by low-frequency neuronal activation.On the contrary, retigabine, at a concentration (3 �M) that induced

ING Model

Y

1 gical R

apattrrdtHatsSTrtrdsnecrttiiohai

5

twKtaarnficng

A

t(2MSh

R

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

ARTICLEPHRS-2348; No. of Pages 13

2 V. Ipavec et al. / Pharmacolo

very small relaxation (approximately 11–13% of the maximalarameter), significantly reduced low-frequency EFS-evoked relax-tion. These findings seem to suggest that KV7 channels, in additiono their effects on SMC contractility, may also be involved inhe repolarization mechanisms of the inhibitory motor neuronsesponsible for this relaxation, that are mainly nitrergic neu-ons. We could hypothesize that KV7 channel blockade wouldelay membrane repolarization, thus increasing the duration ofhe action potential and consequently neurotransmitter release.owever, in the absence of any direct measurement of neuronalction potential, we must acknowledge the speculative nature ofhe proposed mechanism. On the contrary, XE-991 and DMP-543ignificantly reduced the relaxation induced by high-frequency EFS.uch an effect could be generated by pre- or post-junctional actions.o clarify that, the effects of XE-991 were also evaluated on theelaxation induced by the main neurotransmitter responsible forhe long duration of high-frequency EFS-induced proximal stomachelaxation, i.e. VIP. XE-991 also reduced VIP-induced relaxation, butid not affect the relaxation induced by NO. These results seem touggest that KV7 channel activation is a signal transduction mecha-ism of VIP in the SMC of the proximal stomach and the inhibitoryffect of XE-991 on the relaxation evoked by high-frequency EFSan be attributed to the blockade of KV7 channel activation by VIPeleased from the inhibitory motor neurons. VIP relaxes the rat gas-ric fundus by activating VPAC2 receptors [49]. It is well knownhat the main signal transduction mechanism of VPAC2 receptorss the activation of adenylate cyclase through Gs proteins [50]. Thencrease in intracellular cAMP levels and the consequent activationf protein kinase A (PKA), in turn, might activate KV7 channels. Thisypothesis is supported by the fact that IKs or IKM activation by �-drenergic receptor agonists, cAMP analogs or PKA has been shownn cardiomyocytes and SMC [51–53].

. Conclusions

Our results seem to indicate that the pharmacological modula-ion of KV7 channels affects the motility of the rat gastric fundus,ith KV7 channels activators evoking significant relaxation, and

V7 channel inhibitors increasing gastric tone in resting condi-ions. Moreover, KV7 channels also appear to play important roless mediators of VIP-induced relaxation of the rat gastric fundus,nd to participate to the repolarization of the inhibitory motor neu-ons responsible for the gastric relaxation evoked by low-frequencyeuronal activation. Altogether, the results obtained provide therst functional demonstration of a critical control exerted by KV7hannels over rat proximal stomach motor activity, thus revealing aovel pharmacological target for therapeutic interventions againstastric motor disturbances.

cknowledgements

Supported by Fondi Ateneo of the Catholic University ofhe Sacred Heart, Rome, and the Fondazione Telethon ItalyGGP07125), the Fondazione San Paolo, Program in Neuroscience008, and Regione Molise (Convenzione AIFA/Regione Molise) toT. The technical help of Dr. Davide Viggiano (Dept. of Health

cience, University of Molise, Campobasso, Italy) with the immuno-istochemistry experiments is deeply acknowledged.

eferences

[1] Gutman GA, Chandy KG, Grissmer S, Lazdunsky M, McKinnon D, Pardo

Please cite this article in press as: Ipavec V, et al. KV7 channels regulate mgastric fundus. Pharmacol Res (2011), doi:10.1016/j.phrs.2011.06.016

LA, et al. International Union of Pharmacology. LIII. Nomenclature andmolecular relationships of voltage-gated potassium channels. Pharmacol Rev2005;57:473–508.

[2] Sanders KM. Regulation of smooth muscle excitation and contraction. Neuro-gastroenterol Motil 2008;20(Suppl 1):39–53.

[

PRESSesearch xxx (2011) xxx– xxx

[3] Peroz D, Rodriguez N, Choveau F, Baró I, Mérot J, Loussouarn G. KV7.1 (KCNQ1)properties and channelopathies. J Physiol 2008;586.7:1785–9.

[4] Miceli FM, Soldovieri MV, Martire M, Tagliatatela M. Molecular pharmacol-ogy and therapeutic potential of neuronal KV7-modulating drugs. Curr OpinPharmacol 2008;8:65–74.

[5] Brown DA, Passmore GM. Neural KCNQ (KV7) channels. Br J Pharmacol2009;156:1185–95.

[6] Kharkovets T, Hardelin J-P, Safieddine S, Schweizer M, El-Amraoui A, Petit C,et al. KCNQ4, a K+ channel mutated in a form of dominant deafness, is expressedin the inner ear and the central auditory pathway. Proc Natl Acad Sci USA2000;97:4333–8.

[7] Iannotti FA, Panza E, Barrese V, Viggiano D, Soldovieri MV, Taglialatela M.Expression, localization, and pharmacological role of KV7 potassium channelsin skeletal muscle proliferation, differentiation, and survival after myotoxicinsults. J Pharmacol Exp Ther 2010;332:811–20.

[8] Greenwood IA, Ohya S. New tricks for old dogs: KCNQ expression and role insmooth muscle. Br J Pharmacol 2009;156:1196–203.

[9] Jepps TA, Greenwood IA, Moffatt JD, Sanders KM, Ohya S. Molecular and func-tional characterization of KV7 K+ channel in murine gastrointestinal smoothmuscles. Am J Physiol Gastrointest Liver Physiol 2009;297:G107–15.

10] McCallum LA, Greenwood IA, Tribe RM. Expression and function of KV7 chan-nels in murine myometrium throughout oestrous cycle. Pflugers Arch Eur JPhysiol 2009;457:1111–20.

11] Rode F, Svalø J, Sheykhzade M, Rønn LCB. Functional effects of the KCNQmodulators retigabine and XE991 in the rat urinary bladder. Eur J Pharmacol2010;638:121–7.

12] Sims SM, Singer JJ, Walsh Jr JV. Cholinergic agonists suppress a potassiumcurrent in freshly dissociated smooth muscle cells of the toad. J Physiol1985;367:503–29.

13] Lammel E, Deitmer P, Noack T. Suppression of steady membrane currents byacetylcholine in single smooth muscle cells of the guinea-pig gastric fundus. JPhysiol 1991;432:259–82.

14] Ohya S, Asakura K, Muraki K, Watanabe M, Imaizumi Y. Molecular and func-tional characterization of ERG, KCNQ, and KCNE subtypes in rat stomachsmooth muscle. Am J Physiol Gastrointest Liver Physiol 2002;282:G277–87.

15] Azpiroz F, Malagelada JR. Importance of vagal input in maintaining gastric tonein the dog. J Physiol 1987;384:511–24.

16] Currò D, Ipavec V, Preziosi P. Neurotransmitters of the non-adrenergic non-cholinergic relaxation of proximal stomach. Eur Rev Med Pharmacol Sci2008;12(Suppl 1):53–62.

17] Currò D, De Marco T, Preziosi P. Evidence for an apamin-sensitive, but notpurinergic, component in the nonadrenergic noncholinergic relaxation of therat gastric fundus. Br J Pharmacol 2004;143:785–93.

18] Vane JR. A sensitive method for the assay of 5-hydroxytryptamine. Br J Phar-macol Chemother 1957;12:344–9.

19] Wang H-S, Pan Z, Shi W, Brown BS, Wymore RS, Cohen IS, et al. KCNQ2 andKCNQ3 potassium channel subunits: molecular correlates of the M-channel.Science 1998;282:1890–3.

20] Rundfeldt C, Netzer R. Investigations into the mechanism of action of the newanticonvulsant retigabine. Interaction with GABAergic and glutamatergic neu-rotransmission and with voltage gated ion channels. Arzneimittelforschung2000;50:1063–70.

21] Currò D, Volpe AR, Preziosi P. Nitric oxide synthase activity and non-adrenergic non-cholinergic relaxation in the rat gastric fundus. Br J Pharmacol1996;117:717–23.

22] Currò D, De Marco T, Preziosi P. Involvement of peptide histidine isoleucine innon-adrenergic non-cholinergic relaxation of the rat gastric fundus inducedby high-frequency neuronal firing. Naunyn Schmiedebergs Arch Pharmacol2002;366:578–86.

23] Vogalis F. Potassium channels in gastrointestinal smooth muscle. J Auton Phar-macol 2000;20:207–19.

24] Martire M, Castaldo P, D’Amico M, Preziosi P, Annunziato L, Taglialatela M. Mchannels containing KCNQ2 subunits modulate norepinephrine, aspartate, andGABA release from hippocampal nerve terminals. J Neurosci 2004;21:592–7.

25] Martire M, D’Amico M, Panza E, Miceli M, Viggiano D, Lavergata F, et al. Involve-ment of KCNQ2 subunits in [3H]dopamine release triggered by depolarizationand pre-synaptic muscarinic receptor activation from rat striatal synapto-somes. J Neurochem 2007;102:179–93.

26] Hansen HH, Waroux O, SeutinV, JentschTJ, Aznar S, Mikkelsen JD. KV7 channels:interaction with dopaminergic and serotonergic neurotransmission in the CNS.J Physiol 2008;586(7):1823–32.

27] Ohya S, Sergeant GP, Greenwood IA, Horowitz B. Molecular variants of KCNQchannels expressed in murine portal vein myocytes: a role in delayed rectifiercurrent. Circ Res 2003;92:1016–23.

28] Yeung SYM, Pucovsky V, Moffatt JD, Saldanha L, Schwake M, Ohya S, et al. Molec-ular expression and pharmacological identification of a role for KV7 channelsin murine vascular reactivity. Br J Pharmacol 2007;151:758–70.

29] Ng FL, Davis AJ, Jepps TA, Harhun MI, Yeung SY, Wan A, et al. Expression andfunction of the K+ channel KCNQ genes in human arteries. Br J Pharmacol2011;162:42–53.

30] Yeung SYM, Schwake M, Pucovsky V, Greenwood IA. Bimodal effects of the

uscle tone and nonadrenergic noncholinergic relaxation of the rat

KV7 channel activator retigabine on vascular K+ currents. Br J Pharmacol2008;155:62–72.

31] Joshi S, Sedivy V, Hodyc D, Herget J, Gurney AM. KCNQ modulators reveal akey role for KCNQ potassium channels in regulating the tone of rat pulmonaryartery smooth muscle. J Pharmacol Exp Ther 2009;329:368–76.

ING Model

Y

gical R

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

ARTICLEPHRS-2348; No. of Pages 13

V. Ipavec et al. / Pharmacolo

32] Morecroft I, Murray A, Nilsen M, Gurney AM, MacLean MR. Treatment with theKV7 potassium channel activator flupirtine is beneficial in two independentmouse models of pulmonary hypertension. Br J Pharmacol 2009;157:1241–9.

33] Yeung SYM, Greenwood IA. Electrophysiological and functional effects of theKCNQ channel blocker XE991 on murine portal vein SMC. Br J Pharmacol2005;146:585–95.

34] Joshi S, Balan P, Gurney AM. Pulmonary vasoconstrictor action of KCNQ potas-sium channel blockers. Respir Res 2006;7:31–40.

35] Mackie AR, Brueggemann LI, Henderson KK, Shiels AJ, Cribbs LL, Scrogin KE,et al. Vascular KCNQ potassium channels as novel targets for the control ofmesenteric artery constriction by vasopressin, based on studies in single cells,pressurized arteries, and in vivo measurements of mesenteric vascular resis-tance. J Pharmacol Exp Ther 2008;325:475–83.

36] Zhong XZ, Harhun MI, Olesen SP, Ohya S, Moffatt JD, Cole WC, et al. Participationof KCNQ (Kv7) potassium channels in myogenic control of cerebral arterialdiameter. J Physiol 2010;588:3277–93.

37] McCallum LA, Pierce SL, England SK, Greenwood IA, Tribe RM. The contributionof KV7 channels to pregnant mouse and human myometrial contractility. J CellMol Med 2011;15:577–86.

38] Anderson UA, Carson C, McCloskey KD. KCNQ currents and their contributionto resting membrane potential and the excitability of interstitial cells of Cajalfrom the guinea pig bladder. J Urol 2009;182:330–6.

39] Wladyka CL, Kunze DL. KCNQ/M-currents contribute to the resting membranepotential in rat visceral sensory neurons. J Physiol 2006;575:175–89.

40] Elmedyb P, Calloe K, Schmitt N, Schultz Hansen R, Grunnet M, Olesen S-P. Modulation of ERG Channels by XE991. Basic Clin Pharmacol Toxicol2007;100:316–22.

41] Søgaard R, Ljungstrøm T, Pedersen KA, Olesen S-P, Jensen BS. KCNQ4 channelsexpressed in mammalian cells: functional characteristics and pharmacology.Am J Physiol Cell Physiol 2001;280:859–66.

42] Schroeder BC, Hechenberger M, Weinreich F, Kubisch C, Jentsch TJ. KCNQ5, a

Please cite this article in press as: Ipavec V, et al. KV7 channels regulate mgastric fundus. Pharmacol Res (2011), doi:10.1016/j.phrs.2011.06.016

novel potassium channel broadly expressed in brain, mediates M-type currents.J Biol Chem 2000;275:24089–95.

43] Yeung SYM, Lange W, Schwake1 M, Greenwood IA. Expression profile andcharacterisation of a truncated KCNQ5 splice variant. Biochem Biophys ResCommun 2008;371:741–7.

[

PRESSesearch xxx (2011) xxx– xxx 13

44] Tatulian L, Delmas P, Abogadie FC, Brown DA. Activation of expressedKCNQ potassium currents and native neuronal M-type potassiumcurrents by the anti-convulsant drug retigabine. J Neurosci 2001;21:5535–45.

45] Wickenden AD, Yu W, Zou A, Jegla T, Wagoner PK. Retigabine, a novelanti-convulsant, enhances activation of KCNQ2/Q3 potassium channels. MolPharmacol 2000;58:591–600.

46] Schrøder RL, Jespersen T, Christophersen P, Strøbæk D, Jensen BS, Olesen S-P.KCNQ4 channel activation by BMS-204352 and retigabine. Neuropharmacology2001;40:888–98.

47] Jensen HS, Callø K, Jespersen T, Jensen BS, Olesen S-P. The KCNQ5 potassiumchannel from mouse: a broadly expressed M-current like potassium chan-nel modulated by zinc, pH, and volume changes. Mol Brain Res 2005;139:52–62.

48] Wickenden AD, Zou A, Wagoner PK, Jegla T. Characterization of KCNQ5/Q3potassium channels expressed in mammalian cells. Br J Pharmacol2001;132:381–4.

49] Robberecht P, De Neef P, Lefebvre RA. Influence of selective VIP receptor ago-nists in the rat gastric fundus. Eur J Pharmacol 1998;359:77–80.

50] Alexander SPH, Mathie A, Peters JA. Guide to receptors and channels (GRAC),4th ed. Br J Pharmacol 2009;158(Suppl 1):S1–254.

51] Sims SM, Singer JJ, Walsh Jr JV. Antagonistic adrenergic–muscarinicregulation of M current in smooth muscle cells. Science 1988;239:190–3.

52] Delmas P, Brown DA. Pathways modulating neural KCNQ/M (KV7) potassiumchannels. Nat Rev Neurosci 2005;6:850–62.

53] Dai S, Hall DD, Hell JW. Supramolecular assemblies and local-ized regulation of voltage-gated ion channels. Physiol Rev 2009;89:411–52.

54] Lan W-Z, Abbas H, Lemay A-M, Briggs MM, Hill CE. Electrophysiologicaland molecular identification of hepatocellular volume-activated K+ channels.

uscle tone and nonadrenergic noncholinergic relaxation of the rat

Biochim Biophys Acta 2005;1668:223–33.55] Hadley JK, Passmore GM, Tatulian L, Al-Qatari M, Ye F, Wickenden AD, et al.

Stoichiometry of expressed KCNQ2/KCNQ3 potassium channels and subunitcomposition of native ganglionic M channels deduced from block by tetraethy-lammonium. J Neurosci 2003;23:5012–9.