Research Article

Ectopically hTERT expressing adult human mesenchymalstem cells are less radiosensitive than their telomerasenegative counterpart

Nedime Serakincia,b,!,1, Rikke Christensena,1, Jesper Graakjaerf, Claire J. Cairneyc,W. Nicol Keithc, Jan Alsnerd, Gabriele Saretzkie, Steen Kolvraaf

aDepartment of Human Genetics, University of Aarhus, Aarhus, DenmarkbInstitute of Medical Biology, Department of Anatomy and Neurobiology, Southern Denmark University, Odense, DenmarkcCentre for Oncology and Applied Pharmacology, University of Glasgow, Cancer Research UK, Beatson Laboratories,Garscube Estate, Glasgow, UKdDepartment of Experimental Clinical Oncology, Aarhus University Hospital, Aarhus, DenmarkeHenry Wellcome Laboratory for Biogerontology, Newcastle General Hospital, University of Newcastle upon Tyne, Newcastle, UKfDepartment of Clinical Genetics, Vejle County Hospital, Vejle, Denmark

A R T I C L E I N F O R M A T I O N A B S T R A C T

Article Chronology:Received 30 June 2006Revised version received21 December 2006Accepted 3 January 2007Available online 8 January 2007

During the past several years increasing evidence indicating that the proliferation capacityofmammalian cells is highly radiosensitive, regardless of the species and the tissue of originof the cells, has accumulated. It has also been shown that normal bonemarrow cells of micehave a similar radiosensitivity to other mammalian cells so far tested. In this study, weinvestigated the genetic effects of ionizing radiation (2.5–15 Gy) on normal humanmesenchymal stem cells and their telomerised counterpart hMSC-telo1. We evaluatedoverall genomic integrity, DNA damage/repair by applying a fluorescence-detected alkalineDNA unwinding assay together with Western blot analyses for phosphorylated H2AX andQ-FISH was applied for investigation of telomeric damage. Our results indicate that hMSCand TERT-immortalized hMSCs can cope with relatively high doses of !-rays and thatoverall DNA repair is similar in the two cell lines. The telomeres were extensively destroyedafter irradiation in both cell types suggesting that telomere caps are especially sensitive toradiation. The TERT-immortalized hMSCs showed higher stability at telomeric regions thanprimary hMSCs indicating that cells with long telomeres and high telomerase activity havethe advantage of re-establishing the telomeric caps.

© 2007 Elsevier Inc. All rights reserved.

Keywords:Telomere dysfunctionTelomeraseMesenchymal stem cellsIonizing radiationp16INK4a

Telomere cappingp21

Introduction

Lack of telomere maintenance is a genetic feature thatappears to be associated with multiple genetic defects, all

conferring radiosensitivity. Human radiosensitive cell lineshave thus been shown either to have short or dysfunctionaltelomeres and in a mouse model it has been shown directlythat mice with critically short telomeres are more

E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 1 0 5 6 – 1 0 6 7

! Corresponding author. Institute of Medical Biology, Department of Anatomy and Neurobiology, Southern Denmark University,Winsløvparken 21, 5000 Odense C, Denmark. Fax: +45 6590 6321.

E-mail addresses: nserakinci@health.sdu.dk, serakinci@hotmail.com (N. Serakinci).1 Authors equally contributed to the 1st authorship of the work.

0014-4827/$ – see front matter © 2007 Elsevier Inc. All rights reserved.doi:10.1016/j.yexcr.2007.01.002

ava i l ab l e a t www.sc i enced i r ec t . com

www.e l sev i e r. com/ loca te /yexc r

radiosensitive to ionizing radiation (gamma rays) and show anincreased chromosomal instability [1].

Telomeres are the physical ends of chromosomes and areresponsible for the maintenance of chromosome stability andtherefore dysfunctional telomeres affect genome stabilityand cell proliferative capacity. The most terminal region oftelomeres exists as a single-stranded 3" overhang of the G-richstrand that is believed to loop back and pair with the C-richstrand at an internal double-stranded location forming astable loop structure—a “telomere cap” [2]. It has been shownthat constitutive expression of the catalytic subunit oftelomerase, hTERT, prevents the onset of replicative senes-cence and crisis by maintaining telomere length and functionin several cell types including mesenchymal stem cells,fibroblasts and epithelial cells [3–7]. The telomere cap istherefore believed to be an important factor for cellularsenescence [8]. The telomere is a dynamic nucleoproteincomplex that can switch between capped and uncappedstates. When the telomeres are in a capped “protected”state, the cells are allowed to proliferate whereas uncappedtelomeres signal cell cycle arrest. Thus, the telomere cappingstatus and not only the telomere length is believed to beimportant for telomere function.

Ionizing radiation (IR) is a potent inducer of DNA double-strand breaks (DSB) and has been shown to induce cellulargrowth arrest [9–11]. This stress-induced growth arrest hasbeen suggested to be a premature form of senescence thatclosely resembles replicative senescence and has been termedstress-induced premature senescence (SIPS) [12]. It has beensuggested that SIPS is induced by a p53-dependent cell cyclearrest via generation of non-specific as well as telomere-specific DNA damage [12]. Several studies have, however,shown that ionizing radiation does not lead to telomereshortening [1,13,14] and overexpression of hTERT is not able toprotect the cells from SIPS [15].

In order to further study the role of telomere integrity andtelomerase expression in relation to radiosensitivity, theshort-term effect of ionizing radiation on human mesenchy-mal stem cells (MSC) derived from bone marrow stromal cells,stably transduced with the hTERT gene and their non-transduced counterpart has been investigated. Stem cells areunique in their ability to both self renew and to give rise todifferentiated tissues. Presumably, stem cells have a higherdegree of repair ability [16]. The human mesenchymal stemcells (MSCs) are multipotent precursors present in adult bonemarrow and can differentiate into osteoblasts, adipocytes andmyoblasts and play important roles in hematopoiesis. Many ofthese tissues of mesenchymal origin can give rise to cancer.Thus, these cells present a good model system for studyingradiosensitivity and the consequences of this.

In the present study, telomerase positive hMSCs with longtelomeres and telomerase negative primary hMSCs withshorter telomeres were treated with varying doses from 2.5 to15 Gy of !-rays. The overall repair capabilities were similar inthe primary and immortalized hMSCs. Upon IR, both cell typeslost their telomere profile although the mean telomere lengthwas unaltered. We interpret the loss of telomere profile as anindication of extensive telomeric damage, most likely indicat-ing the occurrence of many telomere-near double-strandedbreaks. We furthermore believe that cells with long telomeres

and high telomerase activity in spite of this telomeric damagehave an increased ability to rebuild the telomere cap as theyshowed lower frequency of anaphase bridges and lost telomericsignals than telomerase negative hMSCs.

Materials and methods

Cell culture

Primary hMSCs were aspirated from the bone marrow andisolated by centrifugation (700!g for 15min at 4 °C) over a FicollHypaque gradient (Sigma, St. Louis, MO, USA) as previouslydescribed [17]. The resulting cells were cultured as describedbelow. Human mesenchymal stem cells immortalized with thehTERT gene at population doubling level 4 (PDL4) (hMSC-telo1)were generated by using a standard retroviral transductionprotocol. In brief, the cDNA of the hTERT genewas inserted intothe GCsam retroviral vector in which the transgene expressionwas driven by a Moloney murine leukemia virus long-terminalrepeat. Thereafter, the construct was packaged in PG13 cells(American Type Culture Collection, Manassas, VA, USA) by atwo-step procedure as previously described [18]. Normal andimmortal hMSCs were cultivated in high glucose (4.5 g/l)Dulbecco's modified Eagle medium (D-MEM, GIBCO, Invitrogen,Carlsbad, CA, USA) supplemented with 10% fetal calf serum(GIBCO, Invitrogen), 100 U/ml of penicillin and streptomycin(GIBCO, Invitrogen) and 2 mM of L-glutamine.

Radiation of cells

Cells were plated with a confluency of 25% and 48 h laterirradiated by using a 137Cs radiator (Gammacelle 2000 RH, AEKRisø, Denmark) with varying doses from 2.5 to 15 Gy of ! raysdelivered at a rate of 2.5 Gy/min. Cells were analyzed atdifferent time points after irradiation. The culture mediumwas changed immediately after irradiation.

RNA extraction and RT-PCR analysis (hTERT, osteocalcin,alkaline phosphatase, collagen, !-actin)

RNAwas isolated fromcells using theHigh Pure RNATissueKit(Roche, Hvidovre, Denmark). cDNAwas synthesized from RNAusing the 1st Strand cDNA Synthesis Kit for RT-PCR (AMV)(Roche) according to manufacturer's instructions. Ectopicexpression of hTERT was analyzed using ectoTERT primers(sense: 5"-GGACCATCTCTAGACTGACG-3", antisense: 5"-GGAGCGCACGGCTCGGCAGC-3") and endogenous expressionof hTERT was analyzed using endoTERT primers (sense: 5"-CTGCTGCGCACTGGGAAGC-3", antisense: 5"-GGACACCT-GGCGGAAGGAG-3"). Expression of osteoblastic markers wasanalyzedusingosteocalcinprimers (sense: 5"-CATGAGAGCCCT-CACA-3", antisense: 5"-AGAGCGACACCCTAGAC-3"), alkalinephosphatase primers (sense: 5"-ACGTGGCTAAGAATGTCATC-3", antisense: 5"-CTGGTAGGCGATGTCCTTA-3") and Collagentype 1 primers (sense: 5"-TGACGAGACCAAGAACTG-3", anti-sense: 5"-CCATCCAAACCACTGAAACC-3"). "-Actin primers(sense: 5"-CTGTGCTGTCCCTGTATGCC-3", antisense: 5"-GTGGT-GGTGAAGCTGTAGCC-3") were used in parallel reactions as acontrol of the cDNA preparation. Furthermore, "-actin primers

1057E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 1 0 5 6 – 1 0 6 7

were used in a PCR reaction performed on RNA to verify that nocontaminating DNA was present in the RNA preparation.Amplification parameters for "-actin, ectoTERT, alkaline phos-phatase and collagen type I were as follows: After an initialdenaturation step at 94 °C for 3 min, amplification wasperformed for 30 cycles at 94 °C for 30 s, 59 °C for 30 s and72 °C for 1 min, followed by a final extension step at 72 °C for10 min. Osteocalcin primers used same conditions but anannealing temperature of 60 °C. Amplification parameters forendoTERT were as follows: After an initial denaturation step at95 °C for 15 min, amplification was performed for 40 cycles at94 °C for 30 s, 60 °C for 30 s and 72 °C for 1 min, followed by afinal extension step at 72 °C for 10 min.

RNA extraction and RT-PCR analysis (CDKN1A, CDKN2A,!-actin)

RNA was isolated from cells using the RNeasy Mini Kit(QIAGEN Nordic, Crawley, UK) and cDNA was synthesizedusing the High Capacity cDNA Archive Kit (Applied Biosys-tems, Foster City, CA, USA) according to manufacturer'sinstructions. CDKN1A and CDKN2A expression were analyzedusing pre-developed TaqMan® Gene Expression Assays(Hs00355782_m1 and Hs00233365_m1) and "-actin by theACTB TaqMan® Endogenous Controls Assay Kit on an ABI 7000(Applied Biosystems, Foster City, CA, USA).

TP53 mutation analysis

Coding exons (2–11) of TP53 were amplified for 40 cycles (95 °Cfor 30 s, 62 °C for 30 s and 72 °C for 30 s). Primers used were:Exon02se: GACCCAGGGTTGGAAGCGTCTC; Exon02as: GGGGT-CGGGGTGGTGGCC; Exon03se: CATGGGACTGACTTTCTGCT-CTTG; Exon03as: CGGGGACAGCATCAAATCATC; Exon04Nse:GCTGGGGGGCTGAGGACC; Exon04Nas: GCCGCCGGTGAAAA-TAGGAGCTG; Exon04Cse: AGCTCCTACACCGGCGG; Exon04Cas:GCCAGGCATTGAAGTCTCATGG; Exon05Nse: TTCAACTCTGTC-TCCTTCCTCTTCC; Exon05Nas: CAGCGCCTCACAACCTCCG;Exon05Cse: CGCGCCATGGCCATCTAC; Exon05Cas: CAGCGCCT-CACAACCTCCG; Exon06se: GTCCCCAGGCCTCTGATTCC; Exo-n06as: CGGAGGGCCACTGACAACC; Exon07se: CAGGTCTCCC-CAAGGCGCAC; Exon07as: GCAAGCAGAGGCTGGGGCAC;Exon08se: ACTGCCTCTTGCTTCTCTTTTCC; Exon08as: AATCT-GAGGCATAACTGCACCC; Exon09se: GGGTGCAGTTATGCCTCA-GATT; Exon09as: CGGCATTTTGAGTGTTAGACTGG; Exon10se:TGTATATACTTACTTCTCCCCCTCC; Exon10as: AGGGGAG-TAGGGCCAGTAAGG; Exon11se: TGGTCAGGGAAAAGGGGCAC;Exon11as: GAGAGATGGGGGAGGGAGGC. All primers wereextended at the 5' end with universal primer sequences;sense: CTCCTGTTCCGACCCTGCC and antisense: CGGAACAG-GAGAGCGCACG. PCR products were purified using the QIA-quick Gel Extraction Kit (Qiagen, West Sussex, UK), sequencedusing the universal sequence primers and the BigDye DyeTer-minator Cycle Sequencing Kit v. 1.1 and analyzed on anABI 310(Applied Biosystems).

CDKN2A genomic integrity analysis

All exons of CDKN2A and exon 4 of ACTB ("-actin) wereamplified for 38 cycles (95 °C for 30 s, 58 °C (CDKN2A Exon1A:

61 °C) for 30 s and 72 °C for 30 s). Primers used were as follows:CDKN2A Exon1Ase: GAAGAAAGAGGAGGGGCTG; Exon1Aas:GCGCTACCTGATTCCAATTC; Exon1Bse: TCCCAGTCTGCAGT-TAAGG; Exon1Bas: GTCTAAGTCGTTGTAACCCG; Exon2se:GGAAATTGGAAACTGGAAGC; Exon2as: TCTGAGCTTTG-GAAGCTCT; Exon3se: GACCTGGAGCGCTTGAGCGGT; Exo-n3as: CTGTAGGACCTTCGGTGACTGATGA; ACTB Exon4se:ACCCCAGCACACTTAGCCG; Exon4as: CACGATGCCAGTGG-TACGG. Amplicons were analyzed on a 3% MetaPhor Agarosegel (Cambrex, East Rutherford, NJ, USA).

Osteoblast differentiation

Three days after irradiation part of the cells were incubatedwith a newmedium containing 5!10!9 M calcitriol, (1,25-(OH)2vitamin D3, Leo Pharma, Ballerup, Denmark) for 3 days.Afterwards, RNA was isolated from the cells for expressionanalysis as described above.

Proliferation, senescence and apoptosis assay

Cell proliferation studiesCells were expanded by consecutive subcultivations in D-MEMwith 10% FCS. Long-term cell growth in vitro was determinedby calculating population doubling levels (PDL). The initialseeding number (Nstart) and the 80% confluence harvested cellnumber (Nfinish) were used to calculate the populationdoubling level PD=ln[(Nfinish) / (Nstart)] / ln2. Thus, the cumula-tive population doubling level is the sum of PDs.

!-Galactosidase staining2500 cells were seeded in slide flasks and irradiated 2 dayslater with different doses of ! rays. At different time pointsafter irradiation (4, 7 and 10 days after), the cells were washedin PBS and fixed for 5 min at room temperature in 2%formaldehyde/0.2% glutaraldehyde. After washing, the cellswere incubated at 37 °C (no CO2) over night with fresh "-galsolution containing 1 mg of 5-bromo-4-chloro-3-indolyl "-D-galactoside (X-Gal, Sigma) per ml, 40 mM citric acid (pH 6.0),5 mM potassium ferrocyanide, 5 mM potassium ferricyanide,150mMNaCl, 2 mMMgCl2. From each slide flask, minimum of500 cells were counted under the microscope. The experimentwas repeated 3 times and the mean percent of "-galactosi-dase-positive cells was then calculated.

CFU assayCells were first exposed to varying doses of radiation thenwashed in PBS, trypsinized and plated in 100 mm dishes intriplicate. Primary hMSCswere plated at about 10 cells per cm2

whereas hMSC-telo1 cells were plated at about 7 cells per cm2.After incubation for 14 days at 37 °C in 5% humidified CO2, thecells were washed twice with PBS, stained with 0.5% CrystalViolet in methanol for 5–10 min at room temperature andwashed twice with PBS. Visible colonies were counted and thecolony forming efficiency calculated in percent of plated cells.

Apoptosis assay (TUNEL)Cells were seeded in 75 cm2 culture flasks and irradiated withdifferent doses of ! rays. At different time points (4, 24 and 96 hafter), cells were trypsinized, fixed in 4% paraformaldehyde

1058 E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 1 0 5 6 – 1 0 6 7

solution for 60 min on a shaker at room temperature andpermeabilised in0.1%TritonX-100/0.1%sodiumcitrate for5minat room temperature. Cells were stained using the In Situ CellDeath Detection Kit, Fluorescein (Roche) according to manufac-turer's instructions. Green (FITC) fluorescence after 488nmlaserexcitation wasmeasured on the flow cytometer (BS FACSAria™Cell Sorter, BD Biosciences, Erembodegem, Belgium).

DNA damage and repair assay (Fluorescence-DetectedAlkaline DNA unwinding)

DNA damage was measured as previously described [16]. Themethod detects single and double-strand breaks by their effecton the rate of DNA denaturation in alkali, monitored by thefluorescence intensity of an intercalating dye. The fluores-cence intensity is inversely correlated to the number of DNAstrand breaks present at the time of lysis. DNA damagepercentage was calculated as 100! (P0!Px) /P0, with P0: fluor-escence intensity of an unirradiated sample and Px: fluores-cence intensity of the irradiated cell sample. Repair capacitywas assayed by leaving the cells for the indicated time points(10" till 4h), lysing them thereafter and compare them to thevalues immediately after irradiation.

H2AX Western analysis

Cells were lysed in SDS lysis buffer (1% SDS, 10 mM EDTA,50 mM Tris–HCl, pH 8.1) 1 h, 4 h and 1 day after irradiation andsubjected to 2 rounds of freeze thawing on ethanol/dry ice.Following cell lysis, 40 #g protein was electrophoresed onNuPAGE 4–12% Bis-Tris polyacrylamide gels (Invitrogen) andtransferred to nitrocellulose membranes. Membranes wereincubated with mouse Anti-phospho-Histone H2A.X antibody(Upstate Biotechnology, Waltham, MA, USA) followed byincubation with goat anti-mouse HRP-conjugated secondaryantibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA).Immunoreactive bands were detected using the ECL detectionsystem (Amersham Bioscience/GE Healthcare Bio-Sciences,Little Chalfont, UK). To assess protein loading, strippedmembranes were re-probed using rabbit anti-Erk antibody(Santa Cruz Biotechnology).

Telomere profiles

The telomere profile was measured on chromosomes pre-pared as described below. A telomere FISH kit (DakoCytoma-tion, Glostrup, Denmark) was used for telomere stainingaccording to manufactures instructions. For subsequentkaryotyping, the DNA was stained with a DAPI solution(0.5 #g/ml) also containing antifade (0.11% phenylenediaminedihydrochloride).

Image acquisition and analysis

Fluorescent-specific signals were visualized by fluorescencemicroscopy and captured at 100! magnification with a cooledCCD camera using IpLab software (Scanalytics, Fairfax, VA,USA). For each sample, twenty metaphases were analyzed.Image acquisition and analysis were done as previouslydescribed in [19,20].

Normalization of telomere length values and Statisticalanalysis

Telomere length values were normalized for each metaphaseusing the following equation:

Z ! X=l

where Z=normalized telomere length value; X=raw telomerelength value; "=mean telomere length of all telomeres in themetaphase.

The rationale and normalization procedures were done aspreviously described in [19,20].

Telomere restriction fragment assay (TRF)

Telomere lengths were determined using the Telo TAGGGTelomere Length Assay (Roche). Briefly, genomic DNA wasembedded in 1% agarose plugs and a plug containing 3 #g ofgenomic DNA was digested with the restriction enzymes HinfIand RsaI. Plugs were analyzed in a 1% agarose gel at 14 °C bypulsed field gel electrophoresis (CHEF-DRII-SYSTEM, Biorad,Herlev, Denmark) at 3.5 V/cm for 17 h at a ramp pulse of 2–10 s.The DNA was Southern-blotted to charged nylon membranes(Hybond-N+, Amersham Bioscience) and hybridized with adigoxenin (DIG)-labelled TTAGGGprobe. The averageTRF lengthsweredeterminedby comparing the signals relative to amolecularweight standard.

Chromosome analysis

The cellswere cultured in slide flasks (Nunc, Rochester, NY, USA).Beforeharvest, 10mg/mlColcemid (GIBCO, Invitrogen)wasaddedto a final concentration of 0.2 #g/ml and culturing continued foranother 35 min. The cells were lysed by adding 60 mM KCl andthereafter standard harvesting took place including the Carnoy'sfixative. Giemsa bands were produced with Wright's stain. Fromeach cell type and dose 45 metaphases were analyzed.

Results

Experimental system

To explore the roles of telomeres and telomerase activity inrelation to radiosensitivity, we investigated the effect ofionizing radiation on normal primary human mesenchymalstem cells (hMSC) and telomerase-immortalized hMSCs (hMSC-telo1) established by transducing normal primary hMSCswith aretrovirus carrying the hTERT gene. Analysis of the endogenousand ectopic expression of hTERT showed that neither primaryhMSC nor the hMSC-telo1 line expressed endogenous hTERT;however, the immortalized hMSC-telo1 cells expressed highlevels of ectopic hTERT that resulted in an increased meantelomere length of 21 kb already at PDL 43 while the meantelomere length of the primary cells was 8 kb (Fig. 1A).

Radiation of hMSC and hMSC-telo1 cells

Normal primary (hMSC) and immortal hMSCs (hMSC-telo1) atPDL 114 were treated with varying doses from 2.5 to 15 Gy of !

1059E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 1 0 5 6 – 1 0 6 7

rays. Irradiation of normal hMSC and hMSC-telo1 cells did notlead to immediate cell death, not even at the highest dose.

Endogenous and ectopic hTERT expression

The endogenous and ectopic expression of hTERTwas analyzedafter irradiation of the cells by standard RT-PCR analysis.Irradiation did not induce expression of endogenous TERT in

either hMSC or hMSC-telo1 cells (data not shown) ormodulatedthe expression of ectopic hTERT in hMSC-telo1 cells (Fig. 1B).

Expression of differentiation markers

It has previously been shown that introduction of hTERT intoprimary hMSCs does not change the ability of the cells todifferentiate into various cell types [3,21]. After irradiation, the

Fig. 1 – (A) TRF analysis of primary hMSC and telomerase-immortalized hMSC (hMSC-telo1 cells) at the indicated PD levels. TRFlengthswere determined as described inMaterials andmethods.Molecular sizemarkers (kb) are indicated to the left of the blot.(B, C) Standard RT-PCR analysis of hMSC and hMSC-telo1 cells. (B) The figure illustrates non-irradiated cells and cells irradiatedwith 2.5 and 5 Gy of !-rays. RNA was isolated from the cells and subjected to RT-PCR using primers amplifying the ectopichTERT gene and the "-actin gene. A sample without template was included as a negative control. (C) The figure shows cellsirradiated with a 5-Gy dose (+) or non-irradiated (!). Three days after IR, some of the cells were treated with VitD3 (+). RNA wasisolated from the cells and subjected to RT-PCR using primers amplifying a region in the osteocalcin gene (Ost), the alkalinephosphatase gene (AP), the collagen type I gene (Col-1) and in the "-actin gene. A sample without template was included as anegative control. PCR was performed on RNA to verify that no DNA was present in the RNA preparation (data not shown).(D) Induction of p21CIP1 (CDKN1A) expression following irradiation. RNA was isolated from the cells and subjected to real-timeRT-PCR. Expression was measured relative to "-actin before (Control) and 4 h after irradiation in hMSC (light gray) andhMSC-telo1 cells (dark gray) with doses from 2.5 to 15 Gy. Data shown are mean±SEM for three independent experiments.(E) PCR analysis on genomic DNA for CDKN2A copy number analysis. Figure shows pooled PCR products from each of thedifferent cell lines and passages.

1060 E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 1 0 5 6 – 1 0 6 7

cells were incubated in medium containing 1,25-(OH)2-vitaminD3 (vitamin D3) that induces differentiation along the osteo-genic pathway. The expression of different osteoblasticmarkers(osteocalcin (Ost), alkaline phosphatase (AP) and collagen type I(Col-1)) was analyzed by standard RT-PCR analysis. As seen inFig. 1C, presence of vitamin D3 in the culture medium leads toincreased expression of osteocalcin in both primary hMSC andhMSC-telo1 cells before irradiation. The expression levels of APand Col-1 were at the same level with or without vitamin D3.Irradiation of the cells did not change the ability of the cells toexpress these markers (Fig. 1C).

Wild-type p53 but inactivation of p16Ink4A and p14ARF

DNA sequence analysis of the coding regions of the p53 gene,TP53, was wild type in both hMSC and hMSC-telo1 (data notshown). Four hours after irradiation, CDKN1A (p21CIP1) expres-sion was induced in hMSC and hMSC-telo1, indicating that thep53 protein was functioning normally in both cell lines (Fig.1D). CDKN2A (p16Ink4A) expression could not be detected inhMSC-telo1 (data not shown) and DNA copy number analysisshowed deletion of both copies of CDKN2A (Fig. 1E). Thus,p16Ink4A and p14ARF are fully inactivated in hMSC-telo1,whereas active in hMSC.

Proliferation and survival

Irradiation of primary hMSC and hMSC-telo1 cells resulted in adose-dependent growth arrest (Figs. 2A and B). At the highdoses (10 and 15 Gy), many cells, both hMSC and hMSC-telo1,acquired an enlarged flat morphology typical of senescentcells after 3–5 days. Analysis of the colony forming ability (CFUassay) after irradiation demonstrated that both primaryhMSCs and hMSC-telo1 cells showed a decrease in the CFUsalready at 2.5 Gy and at the high dose (15 Gy) no colonies wereformed within 14 days in either of the cell types (Fig. 2C)meaning that both primary hMSCs and hMSC-telo1 cellsalready showed considerable cell cycle arrest at the low dose2.5 Gy. hMSCs irradiated with the higher doses (10–15 Gy) didnot start to divide within 3 months following irradiationwhereas few dividing cells were observed 1–2 weeks afterirradiation with the 2.5-Gy dose as demonstrated by the CFUassay after 2 weeks. hMSC-telo1 cells that received the highdoses (10–15 Gy) started to divide 2–3 weeks after irradiation.Thus, hMSC-telo1 cells required shorter time (days in culture)to return to cell cycle than hMSCs.

DNA-damage and phosphorylation of H2AX

Irradiation-induced DNA damage/repair was analyzed byFluorescence-detected alkaline DNA unwinding and it wasfound that irradiation induced the same extent of DNAdamage in both cell types (Figs. 3A and B) and the amount ofdamage increased with the dose. After 4 h, the DNA damagepercentage in hMSC and hMSC-telo1 cells receiving both thelow (2.5 Gy) and the high (15 Gy) doses had decreased to a levelof 20% damage indicating that the two cell types did not differin their overall genomic repair capabilities.

DNA damage was furthermore investigated by measuringthe kinetics of H2AX phosphorylation after subjecting the cells

to IR. For both hMSC and hMSC-telo1 cells the phosphorylationof H2AX increased in a dose-dependent way upon irradiationwith doses from 2.5 to 15 Gy of !-rays (Fig. 3C). In hMSC-telo1cells, the level of H2AX phosphorylation was decreased

Fig. 2 – Growth curve of primary hMSC (A) and thetelomerase-immortalized hMSC-telo1 cells (B) afterirradiation. Cells were plated and treatedwith different dosesof !-rays: 2.5 Gy (!), 5 Gy ("), 10 Gy (!) and 15 Gy (#) ornon-treated cells (O). The cells were irradiated at theindicated time point and the cumulative PD levels followed.(C) CFU assay of primary hMSC (#) and hMSC-telo1 cells (!).Cells were irradiated with 2.5 or 15 Gy of !-rays, plated in 100mm dishes and scored for colony formation after 14 days.Data shown are mean±SD.

1061E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 1 0 5 6 – 1 0 6 7

considerable 4 h after irradiation, whereas in hMSCs this wasnot the case. One day after, no phosphorylation could bedetected in either of the cell types (data not shown). This findingwas in accordance with the DNA damage/repair analysisperformed by fluorescence activated DNA unwinding (FADU).

Senescence-associated !-galactosidase and TUNEL assays

The proportion of senescent cells after irradiation was analyzedby staining the cells for senescence-associated "-galactosidase(SA "-gal). Before irradiation, 12%±0.8% of normal hMSCs and2%±0.4% of hMSC-telo1 cells showed positive staining for SA "-gal (Fig. 4). Irradiation increased the proportion of SA "-galpositive cells in a dose-dependentway in both hMSCandhMSC-telo1 cells. Ten days after irradiation, a proportion of 91%±0.6%and 97%±0.4% of the hMSCs stained positive for SA "-gal at thelow (2.5 Gy) and high (15 Gy) doses, respectively. However, inhMSC-telo1 cells only 30%±1% and 76%±1% of the cells showedSA "-gal positive staining 10 days after irradiation with 2.5 Gyand 15 Gy of !-rays, respectively (Fig. 4).

The TUNEL assay was used to measure the proportion ofapoptotic cells in the cell cultures. Before irradiation, 0.25%±0.14% (n=3) and 0.10%±0.03% (n=3) apoptotic cells wereobserved in hMSC and hMSC-telo1 cell cultures, respectively.IrradiationofhMSCandhMSC-telo1 cellswith 2.5 and15Gyof!-rays did not lead to increased apoptotic cell death whenmeasured 4, 24 and 96 h after irradiation by TUNEL assay (datanot shown).

Telomere length and profile

To investigate the effect of irradiation on the telomere length,we performed a TRF analysis. Neither hMSC nor hMSC-telo1cells irradiated with doses from 2.5 to 15 Gy exhibited detect-able telomere shortening when measured up to 10 days afterirradiation (Fig. 5A).

Fig. 3 –DNA damage in primary hMSC (A) andtelomerase-immortalized hMSC-telo1 cells (B) afterirradiation. DNA damage and repair was measured by afluorescence-detected alkaline DNA unwinding assay in 3independent experiments. The cells were trypsinized andirradiated with doses from 2.5 to 15 Gy of !-rays. At differenttime points, the initial and the remaining damage (remdam)in the cells were analyzed. Error bars are standard errors.(C) Western blot analysis of induction of H2AXphosphorylation in irradiated hMSC and hMSC-telo1 cells.Protein extracts were prepared from non-irradiated cells orcells irradiated with doses from 2.5 to 15 Gy of !-rays. Sizemarkers are indicated to the left of the blot. ERK staining ofthe same samples was used as loading control.

Fig. 4 – Beta-galactosidase-associated senescence inirradiated primary hMSC (grey lines) andtelomerase-immortalized hMSC-telo1 cells (black lines). Cellswere irradiated with 2.5 (dotted line) or 15 Gy (broken line) of!-rays and stainedwith X-gal substrate 4, 7 and 10 days afterirradiation. Control cells were not irradiated (full line). Thepercentage of blue cells is given in the figure. The data shownaremean percent±SD estimated from a binomial distributionfor three experiments.

1062 E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 1 0 5 6 – 1 0 6 7

Fig. 5 – Telomere length and profile analysis. (A) The TRF length was determined in primary hMSC (lanes 2–14) andtelomerase-immortalized hMSC-telo1 cells (lanes 15–27) 1, 4 and 10 days after irradiation of the cells with doses from 2.5 to15 Gy of !-rays. TRF lengths were determined as described inMaterials andmethods. Molecular sizemarkers (kb) are indicatedto the left of the blot. (B) Comparison of the telomere profiles in two different unirradiated hMSC-telo1 samples at PDL 128.(C) Comparison of the telomere profiles in twodifferent hMSC-telo1 samples irradiatedwith 15 Gy. (D, E) The telomere profiles ofhMSC-telo1 cells irradiated with 2.5 Gy (D) and 15 Gy (E) of !-rays were compared to the telomere profile of non-irradiatedhMSC-telo1 cells. The mean values of normalized telomere lengths from 20 metaphases are assigned to the y-axis. Error barsdescribe the 95% confidence limits for the mean.

1063E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 1 0 5 6 – 1 0 6 7

The effect of irradiation on the cells telomere profile wasmeasured by using a PNA-FISH method and computer-assistedtelomere quantifier software. Analysis of hMSCs after irradia-tion was hampered by the difficulties of obtaining metaphasesdue to low cell cycling. As previously shown by our group, thehMSC and hMSC-telo1 cells have a telomere profile as firstdescribed in lymphocytes (Graakjær et al, submitted work). Ahigh and significant correlation is obtained when the telomereprofiles of two hMSC-telo1 samples from the same passage (PDL128: correlation=0.71, p<0.001, Fig. 5B) or from differentpassages (PDL 43 compared to PDL 167: correlation=0.62,p<0.001) are compared indicating that the telomere profiles ofun-irradiated samples are stable even after long-term cellgrowth. However, no significant correlation is found whencomparing the telomere profiles of two samples irradiated withthe same dose (hMSC-telo1 irradiated with 15 Gy: correlation=!0.06, p=0.63, Fig. 5C) indicating that the telomere lengthpattern is not reproducible after irradiation. Comparison of thetelomere profiles before and after irradiation show that thetelomere profile is lost in hMSC-telo1 cells at both low (2.5 Gy)and high doses (15 Gy) (Figs. 5D and E). The difference in profilechanges between 2.5 and 15Gy can be explained by the fact thatirradiation destroys the telomere length pattern in a randommanner and the cells that establish the cell culture afterirradiation have different telomere profiles.

Chromosome analyses

After irradiation, random chromosomal aberrations havebeen observed but no clonal aberration except in 15 Gy

irradiated hMSC-telo1 cells. hMSCs could only be analyzed atthe low dose 2.5 Gy because cells receiving higher doses didnot proliferate after irradiation. After irradiation with a 2.5-Gy dose, hMSCs showed a 3-to 4-fold increase in anaphasebridge/micronuclei formation, while hMSC-telo1 cells onlyshowed a 0- to 1-fold increase. In addition, it was observedthat the frequency of lost telomeric signals after irradiationwith a 2.5-Gy dose had increased 2- to 3-fold in hMSCs butonly 0- to 1-fold in hMSC-telo1 cells. Overall, these resultsindicate that cells with long telomeres due to high telomer-ase expression show higher stability at telomeric regionsthan cells with shorter telomeres and no telomeraseexpression.

Discussion

In this study, we have investigated the radiosensitivity oftelomerase-immortalized hMSCs versus normal primaryhMSCs. The hMSC-telo1 cells have high telomerase activityand long telomeres compared to their normal counterparthMSCs that have shorter telomeres and no telomeraseactivity. Irradiation of both cell types resulted in a dose-dependent growth arrest, indicating that both cell types haveat least one intact DNA damage control pathway. Thisassumption is further supported by the finding that both celltypes had functional p53, although telomerase-transducedcells as expected contained inactivating mutations in theCDKN2A gene, resulting in lack of p16 and p14 protein. It seemslikely that compromising the p16-checkpoint increased the

Fig. 5 (continued).

1064 E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 1 0 5 6 – 1 0 6 7

ability to extend cellular life span while maintaining thediploid status of telomerase-immortalized cells. hMSC-telo1cells returned to cell cycle within a few weeks after irradiationeven after subjected to the high dose (15 Gy). In contrast,primary hMSCs receiving the same high dose did not return tocell cycle within 3 months of radiation. The faster recoveryafter irradiation of telomerase-immortalized cells might beexplained by the fact that these cells do not express p16 sincethis may result in these cells returning to cell cycle in spite ofremaining DNA damage. A number of other observationspoint, however, towards telomeres as a central player in theinduction and subsequent release from cell cycle arrest. It iswell established that radiation using ! rays induces single-strand and double-strand breaks (DSB) in the DNAand that thecell cycle machinery arrests the cells until the damage hasbeen repaired [9–11]. Our data show that the level of overallDNA damage/repair did not differ between hMSC and hMSC-telo1 cells after irradiation with the same doses and theamount of damage remaining after 4 h was the same in thetwo cell types indicating that the cells had similar repaircapabilities. This result was confirmed by analysis of phos-phorylation of histone H2AX. Upon irradiation, H2AX imme-

diately becomes phosphorylated on Ser-139 and is believed torecruit DNA repair factors to the site of DNA double-strandbreaks [22]. Hence, the return of H2AX to its non-phosphory-lated state within a day also suggests that overall DNA repairin both cell systems are finalized within a day. Thus, DNArepair is not dependent on telomere length and/or telomeraseexpression in our cell system. Likewise, it has been shownthat double-strand break repair induced by !-radiation isidentical in normal and telomerase-immortalized humanforeskin fibroblasts [23] and furthermore that repair ofpyrimidine dimers and dimethylsulfate damage inducedby ultraviolet radiation or dimethylsulfate is identical intelomerase-immortalized human skin fibroblasts and normalskin fibroblasts [24].

In spite that overall DNA repair was finalized within a dayeven with the high doses of !-rays both cell types remained incell cycle arrest for weeks tomonths. Since all the hallmarks ofstress-induced senescence are present in the cells, this findingvery strongly suggests that part of the DNA was not repairedwithin these first hours and that this remaining damagemaintains the cells in cell cycle arrest. We have in thisconnection obtained results indicating that radiation leads to

Fig. 6 – Illustration of our current hypothesis on p53 and p16 pathways in our cell system.

1065E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 1 0 5 6 – 1 0 6 7

extensive damage of the telomeres. Since in general telomericDNA is less efficiently repaired than other parts of the genome[25], it can therefore be imagined that the remaining DNAdamage is associated with the telomeres. The loss of telomereprofile indicates telomere damage, namely suggesting pri-mary occurrence of double-strand breaks in the telomericregions. At first glance it may seempuzzling that the relativelyfew damaged/dysfunctional telomeres per cell can cause suchan extensive loss of profile. We hypothesize that the extensiveprofile loss is a consequence of not only the initial telomeredamage, but also of subsequent fusion–break–fusion cycles,occurring after the cells have re-entered the cell cycle,resulting in substantial re-shuffling of telomeric regions,until finally all chromosome ends have achieved stabletelomere coverage, at which point fully normal cell prolifera-tion is established, but with a different profile. It should bepointed out, as also previously stated [26], that full develop-ment of this cascade of events require that cells have nottotally left the cell cycle, since fusion–break–fusion cyclesrequire at least some degree of cell division. This condition is,however, fulfilled for the cells where we analyzed telomereprofiles, simply because these cells go into mitosis, whichmeans that they are cycling.

Surprisingly, the overall telomere length did not decreaseafter irradiation. This might, however, be explained by theappearance of fusion breakage fusion cycles that would lead torearrangements, but not necessarily result in telomeric loss. Itmay thus be possible that irradiation causes destabilization ofthe telomeric loop and uncapping of telomeres without initialdouble-strand breaks. This then leads to fusion breakagefusion cycles without net loss of telomere sequences. Inagreement with this, it has previously been shown thatirradiation can induce senescence without reducing telomerelength [13–15] also suggesting that one or more aspects oftelomeres other than length per se contribute to the response.Furthermore, Ku86!/! mouse embryonic fibroblasts with longbut dysfunctional telomeres resulting from loss of their end-capping function showed a senescence-like arrest [27]. Ourresults thus support the hypothesis that telomere dysfunctioncan induce stress-induced premature senescence by a telo-mere-length-independent mechanism most likely involvingloss of the telomere capping function.

It has previously been shown that dysfunctional, uncappedtelomeres associate with !-H2AX [28]. In our study, when theirradiated cells were stained with antibodies against H2AXand TRF1 we also observed that there was a tendency of co-localization at the telomere sides. Furthermore, a smallproportion of the H2AX foci were remaining after a day.

The appearance of anaphase bridges can be used as ameasure of telomere dysfunction [29]. Based on the fact thatthe hMSC-telo1 cells have fewer cells positive for SA "-galstain and a lower frequency of anaphase bridges and losttelomeric signals, it can be suggested that cells with longtelomeres and high telomerase activity re-establish telomericfunction more efficiently than cells with shorter telomeresand no telomerase expression and that this ability isimportant for returning to cell cycle. This is in agreementwith previous reports, where it has been shown that telomer-ase has a protective effect on very short telomeres that, in itsabsence, would have caused cells to stop dividing. Thus, active

telomerase helps even very short telomeres to be functionallycapped [8,30,31]. Furthermore, it has been indicated thatlonger telomeres are more likely to rebuild the cap than areshorter telomeres [32,33].

It has recently been shown that fibroblasts expressinghTERT showed high level of stability even after exposure toionizing radiation [34]. In agreement with this, our cellsystems showed low sensitivity to radiation. Clearly, hMSC-telo1 cells showed a higher survival effect than hMSCs, whichmight be explained by a telomerase survival effect.

Overall, our data suggest that uncapping of telomeresinduced by irradiation plays a role in cell cycle depression.Furthermore, our results are compatible with the hypothesisthat the signaling pathway goes through p53 and not p16. Fig.6 illustrates our current hypothesis with regards to signalingpathways in our cell system. It is here illustrated, that we,like others [35–38] believe that p16 and p53 are located in twodifferent pathways, and that telomere damage is signaledthrough the pathway involving p53. Indirect support for thislatter notion comes from the fact that telomerase-immorta-lized cells often have inactivation of p16 suggesting thattelomere elongation and loss of p16 are two independentevents in the immortalization process [36–38]. In addition, wefind that irradiation does not change the differentiationability of mesenchymal stem cells. Overall, our observationspoint out some of the key properties of these cell populationsthat allow them to survive under high doses of !-rays.

Acknowledgments

The authors wish to thank Anette Thomsen, ChristianKnudsen, Bente Kierkegaard, Inger Marie Thuesen, AlanLeake and Sharon Burns for their excellent technical assis-tance. The work was supported by Danish Cancer Society,Cancer Research UK, Glasgow University and European Unioncontracts EC-FP5-FI6R-CT-2002-0021 (TELOSENS) and LSHC-CT-2004-502943 (MOL Cancer Med).

R E F E R E N C E S

[1] F.A. Goytisolo, E. Samper, J. Martin-Caballero, P. Finnon,E. Herrera, J.M. Flores, S.D. Bouffler, M.A. Blasco, Shorttelomeres result in organismal hypersensitivity to ionizingradiation in mammals, J. Exp. Med. 192 (2000) 1625–1636.

[2] J.D. Griffith, L. Comeau, S. Rosenfield, R.M. Stansel, A. Bianchi,H. Moss, T. de Lange, Mammalian telomeres end in a largeduplex loop, Cell 97 (1999) 503–514.

[3] J.L. Simonsen, C. Rosada, N. Serakinci, J. Justesen,K. Stenderup, S.I. Rattan, T.G. Jensen, M. Kassem, Telomeraseexpression extends the proliferative life-span and maintainsthe osteogenic potential of human bone marrow stromalcells, Nat. Biotechnol. 20 (2002) 592–596.

[4] A.G. Bodnar, M. Ouellette, M. Frolkis, S.E. Holt, C.P. Chiu,G.B. Morin, C.B. Harley, J.W. Shay, S. Lichtsteiner, W.E.Wright,Extension of life-span by introduction of telomerase intonormal human cells, Science 279 (1998) 349–352.

[5] H. Vaziri, S. Benchimol, Reconstitution of telomeraseactivity in normal human cells leads to elongation oftelomeres and extended replicative life span, Curr. Biol. 8(1998) 279–282.

1066 E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 1 0 5 6 – 1 0 6 7

[6] M.M. Ouellette, M. Liao, B.S. Herbert, M. Johnson, S.E. Holt,H.S. Liss, J.W. Shay, W.E. Wright, Subsenescent telomerelengths in fibroblasts immortalized by limiting amounts oftelomerase, J. Biol. Chem. 275 (2000) 10072–10076.

[7] L.D. Wood, T.L. Halvorsen, S. Dhar, J.A. Baur, R.K. Pandita,W.E. Wright, M.P. Hande, G. Calaf, T.K. Hei, F. Levine,J.W. Shay, J.J. Wang, T.K. Pandita, Characterization of ataxiatelangiectasia fibroblasts with extended life-span throughtelomerase expression, Oncogene 20 (2001) 278–288.

[8] E.H. Blackburn, Telomere states and cell fates, Nature 408(2000) 53–56.

[9] R. Datta, R. Hass, H. Gunji, R. Weichselbaum, D. Kufe,Down-regulation of cell cycle control genes by ionizingradiation, Cell Growth Differ. 3 (1992) 637–644.

[10] C. Herskind, H.P. Rodemann, Spontaneous andradiation-induced differentiation of fibroblasts, Exp.Gerontol. 35 (2000) 747–755.

[11] S.H. Kimura, M. Ikawa, A. Ito, M. Okabe, H. Nojima, Cyclin G1is involved in G2/M arrest in response to DNA damage and ingrowth control after damage recovery, Oncogene 20 (2001)3290–3300.

[12] O. Toussaint, E.E. Medrano, T. von Zglinicki, Cellular andmolecular mechanisms of stress-induced prematuresenescence (SIPS) of human diploid fibroblasts andmelanocytes, Exp. Gerontol. 35 (2000) 927–945.

[13] J.P. de Magalhaes, F. Chainiaux, J. Remacle, O. Toussaint,Stress-induced premature senescence in BJ and hTERT-BJ1human foreskin fibroblasts, FEBS Lett. 523 (2002) 157–162.

[14] K. Suzuki, I. Mori, Y. Nakayama, M. Miyakoda, S. Kodama,M. Watanabe, Radiation-induced senescence-like growtharrest requires TP53 function but not telomere shortening,Radiat. Res. 155 (2001) 248–253.

[15] V. Gorbunova, A. Seluanov, O.M. Pereira-Smith, Expression ofhuman telomerase (hTERT) does not prevent stress-inducedsenescence in normal human fibroblasts but protects thecells from stress-induced apoptosis and necrosis, J. Biol.Chem. 277 (2002) 38540–38549.

[16] G. Saretzki, L. Armstrong, A. Leake, M. Lako, T. von Zglinicki,Stress defense in murine embryonic stem cells is superior tothat of various differentiated murine cells, Stem Cells 22(2004) 962–971.

[17] M.F. Pittenger, A.M. Mackay, S.C. Beck, R.K. Jaiswal,R. Douglas, J.D. Mosca, M.A. Moorman, D.W. Simonetti,S. Craig, D.R. Marshak, Multilineage potential of adult humanmesenchymal stem cells, Science 284 (1999) 143–147.

[18] R. Christensen, S. Kolvraa, R.M. Blaese, T.G. Jensen,Development of a skin-based metabolic sink forphenylalanine by overexpression of phenylalaninehydroxylase and GTP cyclohydrolase in primary humankeratinocytes, Gene Ther. 7 (2000) 1971–1978.

[19] J.P. Pommier, L. Sabatier, Telomere length distribution. Digitalimage processing and statistical analysis, Methods Mol. Biol.191 (2002) 33–63.

[20] J. Graakjaer, C. Bischoff, L. Korsholm, S. Holstebroe, W. Vach,V.A. Bohr, K. Christensen, S. Kolvraa, The pattern ofchromosome-specific variations in telomere length inhumans is determined by inherited, telomere-near factorsand is maintained throughout life, Mech. Ageing Dev. 124(2003) 629–640.

[21] B.M. Abdallah, M. Haack-Sorensen, J.S. Burns, B. Elsnab, F.Jakob, P. Hokland, M. Kassem, Maintenance of differentiationpotential of human bone marrow mesenchymal stem cellsimmortalized by human telomerase reverse transcriptase

gene despite [corrected] extensive proliferation, Biochem.Biophys. Res. Commun. 326 (2005) 527–538.

[22] E.P. Rogakou, D.R. Pilch, A.H. Orr, V.S. Ivanova, W.M. Bonner,DNA double-stranded breaks induce histone H2AXphosphorylation on serine 139, J. Biol. Chem. 273 (1998)5858–5868.

[23] H.H. Kampinga, M.A. Van Waarde-Verhagen, A.J. VanAssen-Bolt, B. Nieuwenhuis, H.P. Rodemann, K.R. Prowse,M.H. Linskens, Reconstitution of active telomerase in primaryhuman foreskin fibroblasts: effects on proliferativecharacteristics and response to ionizing radiation, Int. J.Radiat. Biol. 80 (2004) 377–388.

[24] S.E. Bates, N.Y. Zhou, L.E. Federico, L. Xia, T.R. O'Connor,Repair of cyclobutane pyrimidine dimers or dimethylsulfatedamage in DNA is identical in normal ortelomerase-immortalized human skin fibroblasts, NucleicAcids Res. 33 (2005) 2475–2485.

[25] S. Petersen, G. Saretzki, T. von Zglinicki, Preferentialaccumulation of single-stranded regions in telomeres ofhuman fibroblasts, Exp. Cell Res. 239 (1998) 152–160.

[26] T. von Zglinicki, R. Pilger, N. Sitte, Accumulation ofsingle-strand breaks is the major cause of telomereshortening in human fibroblasts, Free Radic. Biol. Med. 28(2000) 64–74.

[27] S. Espejel, M.A. Blasco, Identification of telomere-dependent“senescence-like” arrest inmouse embryonic fibroblasts, Exp.Cell Res. 276 (2002) 242–248.

[28] H. Takai, A. Smogorzewska, T. de Lange, DNA damage foci atdysfunctional telomeres, Curr. Biol. 13 (2003) 1549–1556.

[29] K.E. Gordon, E.K. Parkinson, Analysis of telomerase activityand telomere function in cancer, MethodsMol. Biol. 281 (2004)333–348.

[30] J. Zhu, H. Wang, J.M. Bishop, E.H. Blackburn, Telomeraseextends the lifespan of virus-transformed human cellswithout net telomere lengthening, Proc. Natl. Acad. Sci.U. S. A. 96 (1999) 3723–3728.

[31] J. Yang, E. Chang, A.M. Cherry, C.D. Bangs, Y. Oei, A. Bodnar, A.Bronstein, C.P. Chiu, G.S. Herron, Human endothelial cell lifeextension by telomerase expression, J. Biol. Chem. 274 (1999)26141–26148.

[32] M.J. McEachern, E.H. Blackburn, Runaway telomereelongation caused by telomerase RNA gene mutations,Nature 376 (1995) 403–409.

[33] S. Marcand, E. Gilson, D. Shore, A protein-countingmechanism for telomere length regulation in yeast, Science275 (1997) 986–990.

[34] L.M. Pirzio, M.A. Freulet-Marriere, Y. Bai, B. Fouladi, J.P.Murnane, L. Sabatier, C. Desmaze, Human fibroblastsexpressing hTERT show remarkable karyotype stability evenafter exposure to ionizing radiation, Cytogenet. Genome Res.104 (2004) 87–94.

[35] N. Ohtani, K. Yamakoshi, A. Takahashi, E. Hara, Thep16INK4a-RB pathway: molecular link between cellularsenescence and tumor suppression, J. Med. InvestIG. 51 (2004)146–153.

[36] E.L. Duncan, R. Wadhwa, S.C. Kaul, Senescence andimmortalization of human cells, Biogerontology 1 (2000)103–121.

[37] A.S. Lundberg, W.C. Hahn, P. Gupta, R.A. Weinberg, Genesinvolved in senescence and immortalization, Curr. Opin. CellBiol. 12 (2000) 705–709.

[38] J. Campisi, Suppressing cancer: the importance of beingsenescent, Science 309 (2005) 886–887.

1067E X P E R I M E N T A L C E L L R E S E A R C H 3 1 3 ( 2 0 0 7 ) 1 0 5 6 – 1 0 6 7