Condensed tannin biosynthesis genes are regulated separately from other flavonoid biosynthesis genes...

Condensed tannin biosynthesis genes are regulated separately

from other flavonoid biosynthesis genes in apple fruit skin

Adam Matthew Takos, Benjamin Ewa Ubi 1, Simon Piers Robinson, Amanda Ruth Walker *

Commonwealth Scientific and Industrial Research Organisation, Division of Plant Industry, Adelaide Laboratory,

PO Box 350, Glen Osmond, South Australia 5064, Australia

Received 16 June 2005; accepted 29 September 2005

Available online 25 October 2005

www.elsevier.com/locate/plantsci

Plant Science 170 (2006) 487–499

Abstract

Although the molecular basis of anthocyanin biosynthesis has been studied in several types of fruit, little is known about how structural flavonoid

genes are regulated to balance the requirement for condensed tannin (CT) and flavonol synthesis.We cloned three genes encoding enzymes involved in

CT synthesis from cDNA of skin of the red apple varietyMalus � domesticaBorkh. cv. ‘Cripps Red’; two leucoanthocyanidin reductases (MdLARs)

and an anthocyanidin reductase (MdANR).Wemeasured steady-state transcript levels of the CT genes and the other structural genes of the flavonoid

pathway by Real Time PCR and correlated this with flavonoid accumulation in skin throughout early fruit growth and during ripening. Transcripts of

theMdANR gene were abundant in both green and red skin sectors early in development which correlated with accumulation of CTs in these tissues.

TheMdLAR1 gene transcripts were detected in green skin early in development but transcripts ofMdLAR2were present only in juvenile fruit. All the

CT transcriptsweremuch less abundant during fruit ripeningwhen themajority of anthocyanin accumulated and transcripts of the other pathway genes

were at a high level. The results indicated that transcription of the genes for synthesis of CTs in apple fruit skin was differentially regulated from the

other flavonoid pathway genes which were regulated in a coordinate fashion to control synthesis of anthocyanins.

# 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Anthocyanin; Tannin; Flavonoid; Regulation; Apple; Proanthocyanidin

1. Introduction

Anthocyanins, condensed tannins (CTs) and flavonols are

secondary metabolites called flavonoids that are found in most

higher plants and are synthesized from common precursor

compounds. Anthocyanins are responsible for most of the red

and purple colours in flowers and fruits and also occur in leaves.

During fruit development anthocyanin acts as a signal of

ripening to birds and animals and therefore assists in seed

dispersal [1,2]. CTs, also referred to as proanthocyanidins, are

polymers of flavonoid molecules which, when oxidised, cause

brown pigmentation of plant seeds. CTs may act as feeding

deterrents in reproductive tissues and developing fruit [3,4] and

also impart astringency to fresh fruit, fruit juices and wine.

* Corresponding author.

E-mail address: [email protected] (A.R. Walker).1 Current address: Department of Genetics and Biotechnology, Faculty of

Science, University of Calabar, P.M.B. 1115-Calabar, Nigeria.

0168-9452/$ – see front matter # 2005 Elsevier Ireland Ltd. All rights reserved.

doi:10.1016/j.plantsci.2005.10.001

Flavonols, although colourless, can behave as co-pigments to

anthocyanins in vivo [5], are required for pollen tube formation

in some plants [6] and may also function as UV-B-protectants

[7]. Anthocyanins, CTs and flavonols are all antioxidants and

may have beneficial effects for human health when incorpo-

rated in the diet [8].

Biochemical and genetic analysis in a range of plants has

enabled the isolation of the structural genes of the flavonoid

pathway (shown in Fig. 1) and ordering of the enzymes that

they encode [9]. The pathway can be described as consisting of

‘common flavonoid’ genes required for synthesis of precursors

of the different classes of flavonoids and ‘branch-specific

flavonoid’ genes for each flavonoid class. It has been

demonstrated recently that there are two possible branch

pathways to formation of CTs in plant cells: (i) leucoantho-

cyanidin reductase (LAR) synthesizing the 2,3-trans-flavan-3-

ol [10] and (ii) a reaction catalysed by the product of the

Arabidopsis BANYULS gene [11] which has been demonstrated

to encode anthocyanidin reductase (ANR) to synthesize the 2,3-

cis-flavan-3-ol [12]. In apple fruit (Malus � domestica Borkh.)

A.M. Takos et al. / Plant Science 170 (2006) 487–499488

Fig. 1. A schematic representation of the flavonoid biosynthetic pathway in

apple. Genes encoding enzymes for each step are shown in bold italics. The

shared genes for anthocyanin and CT synthesis: CHS, chalcone synthase; CHI,

chalcone isomerase; F3H, flavanone-3b-hydroxylase; DFR, dihydroflavonol-4-

reductase; LDOX, leucoanthocyanidin dioxygenase. The branch genes: FLS,

flavonol synthase for flavonol synthesis; LAR, leucoanthocyanidin reductase

and ANR, anthocyanidin reductase, for synthesis of the CT initiating units

catechin and epicatechin respectively, UFGT, UDP-glycose:flavonoid-3-O-

glycosyltransferase for anthocyanin synthesis. The unidentified gene encoding

a glycosyl transferase for flavonol synthesis is referred to as GT. The flavonoid-

30-hydroxylase (F30H) gene has been omitted for clarity and the enzyme it

encodes may hydroxylate several of the intermediates from the CHI step

onwards.

the trans and cis flavan-3-ols are catechin and epicatechin,

respectively, and can act as initiating units for synthesis of CT

polymers with the extension units of the polymers probably

derived from leucocyanidin [13].

In apple fruit the flavonoid biosynthetic pathway is most

active in skin [14]. Many external environmental factors can

moderate anthocyanin synthesis in mature apple skin such as

temperature, soil nitrogen content, crop load and chemical

spraying of growth regulators; however the most important is the

dependence upon light [15]. Fruit of many varieties such as

‘Cripps Pink’ marketed as ‘Pink LadyTM’ have red and green

sectors and the shaded sides are green compared to the red skin of

the exposed parts of the fruit where direct sunlight has induced

the biosynthesis of anthocyanin. The recent cloning of flavonoid

structural genes fromMalus sp. has allowed researchers to probe

the molecular basis of anthocyanin synthesis in apple [16]. A

number of the structural genes were not transcribed in fruit of the

red variety ‘Fuji’ covered with bags to exclude light but

transcription of these genes was strongly induced after bag

removal [16], and therefore dependant on light.

Genetic factors also affect anthocyanin synthesis in apple

fruit skin; for example the enzyme activities of chalcone

isomerase (MdCHI) and UDP-glycose:flavonoid-3-O-glyco-

syltransferase (MdUFGT) in the green variety ‘Granny Smith’

were less than half that in the red variety ‘Splendour’ throughout

a growing season [17]. Transcripts of chalcone synthase

(MdCHS), flavanone-3b-hydroxylase (MdF3H), dihydroflavo-

nol-4-reductase (MdDFR), leucoanthocyanidin dioxygenase

(MdLDOX) and MdUFGT were reduced during fruit ripening

in RNA from the yellow variety ‘Orin’ compared to the red

varieties ‘Fuji’ and ‘Jonathon’ [18]. In the skin of the green

variety ‘Mutsu’ transcripts ofMdLDOX andMdUFGTwere not

detectable during fruit development; however, when fruit were

grown in paper bags to exclude light and then uncovered and

exposed to sunlight for several weeks late in fruit development,

transcription of these geneswas induced resulting in anthocyanin

synthesis [19]. These results suggest that the difference between

red and green/yellow varietiesmay not reside in themutation of a

structural gene of the flavonoid pathway but could be at the level

of transcriptional regulators which control expression of

different subsets of the structural genes.

Several of the pathway genes which are required for

anthocyanin synthesis are also required for the synthesis of CTs

and flavonols (Fig. 1), yet the transcriptional activity of the

pathway has not previously been investigated in terms of the

accumulation of these compounds in apple fruit. In order to

understand how the pathway is regulated to control the relative

amounts of each flavonoid compound made in skin at different

stages of fruit maturation we have: (i) cloned three genes,

MdLAR1,MdLAR2 andMdANR, from the variety ‘Cripps Red’,

which encode enzymes that initiate CT synthesis, (ii)

determined the steady-state transcript levels of the CT genes,

the flavonol synthase gene (MdFLS) required for flavonol

synthesis, the MdUFGT gene required for anthocyanin

synthesis and the common flavonoid genes, in the skin of

maturing fruit and (iii) measured anthocyanin, CTs and flavonol

accumulation throughout fruit development. From this data, we

have been able to contribute to the elucidation of some aspects

of the transcriptional regulation of common flavonoid and

branch-specific flavonoid genes to co-ordinate synthesis of

anthocyanins, CTs and flavonols in developing apple fruit.

2. Materials and methods

2.1. Plant material

Malus � domestica Borkh. cv. ‘Cripps Red’ fruit, commer-

cially sold as ‘SundownerTM’, were sampled at the Primary

Industries and Resources South Australia site at Lenswood in

the Adelaide Hills, South Australia from November 2002 until

April 2003. Red and green sectors from skin and flesh were

taken from at least 10–15 fruit between 10 a.m. and 12 noon at

two week intervals throughout the growing season. Skin

samples were taken using a potato peeler. Samples were

immediately frozen in liquid nitrogen and stored at �80 8C.

2.2. Preparation of nucleic acids

For extraction of nucleic acids, plant material was ground to

a fine powder under liquid nitrogen with a coffee blender

A.M. Takos et al. / Plant Science 170 (2006) 487–499 489

followed by grinding in a mortar and pestle. Total RNA was

isolated from 1 g apple tissue by a hot borate method [20]. The

final RNA pellet was resuspended in 200 ml of TE (pH 8.0) and

quantified by UV spectrometry. For storage, RNA was

precipitated with 20 ml 3 M Na-acetate (pH 6.0) and 1 ml

absolute ethanol and stored at �40 8C. Genomic DNA was

isolated from 1 g of young leaf material by a crude nuclei

preparation method [21] and stored at 4 8C.

2.3. Cloning of the MdLAR and MdANR genes

First strand cDNA was synthesized from 4 mg total RNA

from ‘Cripps Red’ immature fruit (<1 cm diameter) in a

reaction containing oligo dT(18), SuperScriptTM III RNase H-

Reverse Transcriptase and RNAseOUTTM (Invitrogen, Carls-

bad, CA, USA). Degenerate PCR primers for cloning of LAR

and ANR genes were designed from conserved regions of

known LAR and ANR protein sequences. Primers for LAR

were: LAR(F1): 50-GCIGTIAARMGITTYYTICCIWSIGART-

TYGGICAYGAY-30 and LAR(R1): 50-GRCANCCNTTDA-TRAADATRTCRTGNGT-30 and primers for ANR were:

ANR(F1): 50-GAYCCIGARAAIGAYATGATHAARCC-30 andANR(R1): 50-AAYTTIGCIARYTCIGGIACISWNGTRTT-30.Amplified PCR fragments were sequenced and nested primers

were designed for 30 RACE. Two variants of the MdLAR gene,

MdLAR1 and MdLAR2, and one MdANR sequence were

isolated by 30 RACE. Nested primers specific for each MdLAR

variant were designed for 50 RACE and the 50 fragment of

MdLAR1 was cloned using the 50 RACE System Kit, Version

2.0 (Invitrogen). Only a truncated 50 fragment of MdLAR2 was

isolated using this kit. To overcome this problem a

GeneRacerTM kit (Invitrogen) was used to clone 50 fragments

of MdLAR2 from cDNAs that were reverse transcribed only

from full-length mRNAs. The 50 fragment of MdANR was

cloned as described for MdLAR1.

Primers were designed for amplification of PCR fragments

containing the full-length coding sequences of MdLAR1,

Table 1

mRNA sequences analysed by Real Time PCR

Gene Accession number Approximate copy number in genomea

MdLDOX AF117269 1

MdLAR1 AY830131 3–4b

MdLAR2 AY830132 3–4b

MdANR AY830130 3

MdUFGTc AF117267 3

MdFLS AF119095 3

Msp.CHSd X68977 Several related sequences

Msp.CHId X68978 1–2

MdF3H AF117270 2

MdDFR AF117268 1

MdUBQ U74358 n.d.

n.d.: not determined. Oligonucleotide sequence located within coding region are ca Copy number determined by Southern analysis (data not shown).b Probe does not distinguish between MdLAR1 and MdLAR2 sequences.c Annotated as a glucosyltransferase in the Genbank database.d From Malus species.

MdLAR2 andMdANR. These fragments were obtained from the

fruit cDNA template used above using the proofreading DNA

polymerases PfuTurbo1 (Stratagene, LaJolla, CA, USA) for

the MdLAR genes and Platinum1 Pfx (Invitrogen) for MdANR

following the manufacturer’s reaction conditions. The PCR

fragments were tailed with dATP using a QIAGEN1 A-

Addition kit (QIAGEN, Hilden, Germany) and ligated to the

pDrive cloning vector (QIAGEN) or pGEM1-T Easy vector

(Promega, Madison, WI, USA). Several clones of each

construct were sequenced.

2.4. Southern analysis

Genomic DNA (2 mg) was digested with DraI, EcoRI,

EcoRV,HindIII, SacI and SphI. Electrophoresis, blotting by salt

transfer and hybridisation were performed according to the

manufacturers’ protocol using GeneScreen Plus hybridisation

membrane (NEN1 Life Sciences Products, Boston, MA). Gene

probes were labelled with [32P]-dCTP using a RediprimeTM II

DNA Labelling System (Amersham Biosciences, UK). Wash-

ing was done at 65 8C for 15 min in 0.1� SSC containing 0.1%

(w/v) SDS and was repeated twice. The accession numbers of

sequences from which probes were made and the estimated

copy number of related sequences in the apple genome for each

gene is shown in Table 1.

2.5. Northern analysis

Total RNA (2 mg) was denatured and resolved on a 1% (w/v)

agarose gel containing 1� MOPS (pH 7.5) and 5% (v/v)

formaldehyde. The RNA was blotted by salt transfer to

Nytran1SuPerCharge membrane using a TurboBlotterTM

system (Schleicher and Schuell, Dassel, Germany). A gene

probe for MdLDOX was labelled with [32P]-dCTP using a

RediprimeTM II Random Prime Labelling System following the

manufacturer’s protocol (Amersham). Hybridisation was at

65 8C in ULTRAhybTM solution (Ambion, Austin, TX, USA).

Real Time PCR primers (50 to 30)

Forward Reverse

GAAGATCATCCTTAAGCCACTG ataatttagcacaacccgctTC

TAGAGCTACTGCAAGAGGAGG cctcgaagaaaccctagaaac

tctatcagaatcaggactgttga aatatccaacaaccacaagaaac

GCATCGAAGAAATATATGACCA aatttacggtaagccagacaat

AAGGTCTCTCCAATGTACGAAT AGGAGTTTGTTGACTTTGGACT

TTCTTACAGGGAAGCTAATGAA GAGGACATGGTGGGTAGTAGTT

GCAAGTGTTGTCAGATTACGG tgatactggtgtctTCAAGCAG

GCTACAAATGCGGTGATAGAA ccttggtttccaatttttcat

GAAGATGAGCAAGGATCTTGAG tccacaaagagctttcaagtg

CAAGTACAGCTTGGAGGACAT ccaagctggtaaatgtaaaaca

CTCCGTGGTGGTTTTTAAgt ggaggcagaaacagtaccat

apitalised and within 30 untranslated region of mRNA are in lower case.

genbank:AF117269

genbank:AY830131

genbank:AY830132

genbank:AY830130

genbank:AF117267

genbank:AF119095

genbank:X68977

genbank:X68978

genbank:AF117270

genbank:AF117268

genbank:U74358


Washing was at 65 8C for 15 min in 0.1� SSC containing 0.1%

(w/v) SDS and was repeated twice.

2.6. Real Time PCR

For Real Time PCR, cDNA was synthesized as described

above from 4 mg of total RNA for all samples except flesh

where 2 mg was used due to an inhibition of synthesis at higher

concentrations. Primers for Real Time PCR, listed in Table 1,

were designed to include at least one primer in the 30

untranslated regions of the genes where possible. For

experiments measuring transcript levels in different apple

tissues, the signal obtained for the gene of interest was

normalised against the signal from the 30 untranslated region ofthe apple UBIQUITIN gene (MdUBQ).

The cDNA templates were diluted 1:20 with H2O to provide

sufficient template for experiments and to increase specificity of

the reaction. Template cDNA (5 ml) was placed in each PCR

reaction in a final volume of 15 ml containing 266 nM of each

primer and 1� AbsoluteTM QPCR SYBR1 Green Buffer

(ABgene1, Surrey, UK). Thermocycling conditions were as

follows: an initial enzymeactivationof 15 min at 95 8C, followedby 30–35 cycles of denaturation for 30 s at 94 8C, annealing for30 s at 58 8C and extension for 30 s at 72 8C, followed by a melt

gradient starting from 50 8C and heating to 96 8C at a rate of

0.2 8C s�1. The PCR reactions were carried out in a Rotor-

GeneTM2000 Real Time PCR instrument (Corbett Research,

NSW, Australia). The fluorescence of reactions was measured

with an excitation wavelength of 470 nm and a detection

wavelength of 510 nm at the end of each extension step and at

each 1 8C increment of the melt profile.

The specificity of the PCR product generated for each set of

primerswas tested in threeways: (i) by themelt gradient inwhich

fluorescence decreases at a single discrete temperature indicating

separation of the two strands of a single DNA species, (ii) by

agarose gel electrophoresis showing a single PCR product of the

correct size and (iii) by obtaining the correct DNA sequence of

the gene from a PCR product extracted from an agarose gel. All

cDNA samples to be compared for gene expression levels were

analysed in a single batch for each primer pair. To ascribe a

relative gene copy number to each cDNA sample, a purified PCR

fragment of each gene sequence was serially diluted in 10-fold

steps to make template standards. Standards for the gene to be

analysed were included in the Real Time PCR assay of cDNA

samples. In each case, the dilution series of standards showed a

linear change in cycle threshold values and cDNA templates

were thus ascribed a gene copy number by comparing their cycle

threshold values with the standards.

2.7. Anthocyanin and flavonol analysis

For estimation of anthocyanin concentration, 0.05 g finely

ground plant material was extracted in 1 ml 1% (v/v) HCl–

methanol for 24 h at 4 8C on a rotating wheel in darkness.

Samples were clarified by centrifugation at 13,000 � g for

15 min at room temperature and absorbance was scanned

between 500 and 600 nm using a Shimadzu UV-1601

spectrophotometer (Shimadzu, Kyoto, Japan). The peak for

anthocyanin absorbance was �528 nm and concentration was

determined using a molar extinction co-efficient of 4.62 � 104

[22].

For high-performance liquid chromatography (HPLC)

analysis, anthocyanins and flavonols were extracted from

0.1 g finely ground plant material in 1 ml 1% (v/v) HCl–

methanol for 1 h at room temperature on a rotating wheel in

darkness. Samples were clarified by centrifugation at

13,000 � g for 15 min at room temperature and then 200 ml

of supernatant was transferred to autosampler vials. Analysis

was conducted on a Hewlett Packard HP 1100 HPLC with

Chemstation software using an SGE C18 RS 3 mm Wakosil

(150 mm � 4.6 mm) column protected by an SGE (Australia)

C-18 guard column. Solvent A was 10% (v/v) formic acid and

solvent B was methanol. The gradient of solvent B was: 0 min,

17%; 1 min, 17%; 15 min, 35%; 40 min, 37%; 42 min, 100%;

48 min, 100%; 50 min, 17%; 52 min, 17%. The gradient was

run at a flow rate of 1 ml min�1, at a column temperature of

40 8C and a 10 ml sample was injected. Absorbance was

measured at 520, 353, 320 and 280 nm. Standards were

cyanidin 3-galactoside, quercetin 3-galactoside, quercetin 3-

rhamnoside and quercetin 3-arabinoglucoside (Extrasynthese,

France). Flavonol concentration was calculated from a standard

curve of quercetin 3-galactoside by summing peak areas for all

flavonol species detected and expressing as quercetin 3-

galactoside equivalents.

2.8. Condensed tannin analysis

Finely ground plant material (0.1 g) was extracted in 1 ml

70% (v/v) acetone containing 0.1% (w/v) ascorbate for 24 h at

room temperature on a rotating wheel in darkness. Samples

were centrifuged at 13,000 � g for 15 min at room

temperature and then two 200 ml aliquots of the supernatant

were transferred to fresh tubes and dried under vacuum at

35 8C for 60 min. One aliquot was resuspended in 100 ml 1%

(v/v) HCl–methanol then neutralised with 100 ml sodium

acetate (200 mM, pH 7.5) for the analysis of free monomers.

The other aliquot was resuspended in 100 ml phloroglucinol

buffer (0.25 g ascorbate, 1.25 g phloroglucinol, 215 ml conc.

HCl, 25 ml methanol) and incubated at 50 8C for 20 min, then

neutralised with 100 ml sodium acetate (200 mM, pH 7.5) for

the analysis of initiating and extension units. Separate reverse-

phase-HPLC methods were used for the cleaved and

uncleaved CTs as described by Downey et al. [23]. Identity

and concentration of free monomers and initiating units were

determined from standard curves of epicatechin and catechin

(Extrasynthese). Initiating units were calculated by subtract-

ing value of epicatechin obtained from uncleaved CT analysis

(free monomers) from epicatechin value obtained from the

cleaved CT analysis. The concentration of extension unit

phloroglucinol adducts was calculated from published molar

extinction coefficients [24]. Polymer length was calculated by

summation of initiating and extension units and then dividing

by initiating units.


Fig. 2. Alignment of apple LAR and ANR deduced amino acid sequences. (a) Alignment of apple MdLAR1, MdLAR2 and D. uncinatum DuLAR sequences. (b)

Alignment of appleMdANR,Arabidopsis thalianaAtANR andM. truncatulaMtANR sequences. Peptide sequences were alignedwith the CLUSTALWprogram and

displayed using GeneDoc Version 2.6.002 program.

3. Results

3.1. Isolation of apple MdLAR and MdANR sequences

Since the CT genes, LAR and ANR, had not previously been

identified from apple, the complete coding regions of these

genes were cloned by PCR from cDNA made from ‘Cripps

Red’ immature fruit (<1 cm diameter). Two LAR genes,

MdLAR1 and MdLAR2, were isolated. Their deduced protein

sequences are 354 and 349 amino acid residues in length,

respectively, and have 93% similarity and 90% identity with

each other. The significant difference is located between

residues 328 and 336 of MdLAR1 which contains the motif

LLQEEEDQK whilst MdLAR2 contains PVHEEN in this

region (Fig. 2a). These sequences are close to the C-terminal

end of the proteins and are not conserved between apple and

Desmodium uncinatum LARs. This region is not known to be

critical for substrate recognition or activity [10]. Both variants

contain sequence motifs common to the Reductase–Epimer-

ase–Dehydrogenase family of proteins, which are also found in

the D. uncinatum LAR sequence. These include the Rossmann

dinucleotide-binding domain [25] characterised by the motif

GXXGXXG starting from Gly19, which may interact with

NAD(P), and three residues, Ser120, Tyr139 and Lys142, critical

to the catalytic site. The apple LAR proteins lack the D.

uncinatum LAR C-terminal extension of about 65 amino acids,

the function of which is unknown. Over the remainder of the

protein sequence MdLAR1 has 78% similarity and 67%

identity to the LAR of D. uncinatum, for which the activity of

the recombinant enzyme has been demonstrated [10]. Southern

analysis indicates that there are three or four sequences similar

to the MdLAR genes in the apple genome (Table 1).


Fig. 3. Validation of the Real Time PCR assay against Northern hybridisation.

(a) Northern blot analysis of RNA extracted from red peel of ‘Cripps Red’ taken

at time points during fruit maturation. Total RNA was hybridised with a 32P-

labeled probe ofMdLDOX gene fragment as described in materials and methods

(upper panel). The amount of RNA loaded on each lane is shown by ethidium

bromide staining of ribosomal RNA (lower panel). (b) Real Time PCR analysis

ofMdLDOX. The cDNA samples were synthesized from the total RNA samples

shown in a. Data were plotted relative to the sample in which maximum

transcript was detected and given a value of 1. For each cDNA sample n = 3

determinations by Real Time PCR, error bars indicate standard deviation.

A single apple ANR gene was cloned and the predicted

protein, MdANR, has 72% similarity and 64% identity with

the AtANR protein encoded by the Arabidopsis BANYULS

gene. This is greater than the homology between MtANR

from Medicago truncatula and AtANR, for which the

activities of the recombinant enzymes have been demon-

strated [26]. In comparison, MdANR shows only 57%

similarity and 49% identity with the MdDFR protein. The

MdANR protein also contains a Rossmann dinucleotide-

binding domain motif GXGXXA starting from Gly16 and has

a Phe20 residue which is also found in DFR proteins and

MtANR at this position but, as with the other ANRs, lacks a

Gly22 which is found in the equivalent position in DFR

proteins (Fig. 2b). Southern analysis indicates there are

probably three sequences similar to the MdANR gene in the

apple genome (Table 1).

3.2. Development of the Real Time PCR assay

As several of the flavonoid genes show multiple hybridising

bands by Southern analysis (Table 1), Northern hybridisation

would not enable the presence of transcripts from similar genes

to be distinguished. A Real Time PCR assay was therefore

developed using gene-specific primers designed to amplify a

single mRNA species.

Transcript levels were assayed in red and green skin sectors

of ‘Cripps Red’ apples at time points throughout fruit

development and maturation. Because the MdLDOX gene is

present as a single copy in the apple genome, this gene

sequence was used to validate the Real Time PCR assay by

comparing the results of the assay with those of a Northern blot

of total RNA hybridised with an MdLDOX gene probe. The

Northern blot using the MdLDOX gene probe shows two peaks

of hybridisation in red skin, at 48 days after full bloom (DAFB)

and at 147 DAFB (Fig. 3a). An equivalent amount of RNA,

based on UV spectrophotometric determination, was used for

cDNA synthesis. These cDNAs were analysed by Real Time

PCR (Fig. 3b) and the transcript levels ofMdLDOX were found

to be highest in red skin at 48 DAFB and all other samples were

plotted relative to this sample which was given a value of 1. The

next highest transcript level was at 147 DAFB, and between

these points transcript levels were reduced. This is similar to the

pattern observed for the hybridisation ofMdLDOX probe in the

Northern blot (Fig. 3a). The transcript levels in green skin, as

determined by Real Time PCR, were less than 10% of the

maximum red skin levels, except at 48 DAFB when the level

was at about 25% of red skin (Fig. 3b).

Typically the signal obtained for a gene by Real Time PCR

is normalised against a signal obtained for a housekeeping

gene from the same cDNA sample [27]. In practice, we have

found that, given the moderate changes in flavonoid gene

transcript levels in apple skin during fruit development,

correction with a housekeeping gene induced a greater error

than directly processing the raw signal in the manner described

forMdLDOX in Fig. 3b. For this reason, we used the same bank

of cDNAs for the Real Time PCR assay of transcript levels of

the other flavonoid pathway genes as described for MdLDOX

and which showed a correlation between the MdLDOX

Northern blot and Real Time PCR data.

3.3. Analysis of the CT branch

The pattern of transcript accumulation of the branch-

specific flavonoid genes required for initiating synthesis of

CTs, MdLAR1 and MdANR, is shown in Fig. 4a and b, using

RNA extracted from apple fruit red and green skin sectors

during fruit maturation. The MdLAR1 gene transcripts were

most abundant in green skin sectors at 48 and 62 DAFB and

then transcript levels declined in subsequent samples from

the remainder of development and fruit ripening (Fig. 4a). In

red skin sectors, the level of MdLAR1 transcript measured

was relatively unchanged throughout fruit maturation and

was at about half the maximum level measured in green skin.

The MdANR gene transcripts were measured at the highest

level at 48 DAFB and at an equal level in red and green skin

sectors; thereafter levels declined to about half the maximum

(Fig. 4b). Transcript levels of the MdLAR2 gene were

relatively low in all skin samples assayed (data not shown).

The earliest skin samples analysed for CTs, at 32 DAFB,

contained twice the level of CTs in red skin sectors

(990 ng mg�1) than in green skin sectors (467 ng mg�1);


Fig. 4. Analysis of the CT pathway. (a)MdLAR1 transcript levels. (b)MdANR transcript levels. (c) Accumulation of CTs as measured by HPLC. (d) Growth curve of

apples during fruit maturation. Details of transcript analysis are as described in Fig. 3b.

however in red skin CTs decreased by about 50% in the

sample at 48 DAFB to 528 ng mg�1 and then the decline in

concentration was slower in subsequent samples to reach

325 ng mg�1 at 105 DAFB (Fig. 4c). This decline in the

concentration of CTs is probably due to a dilution effect

because of the rapid growth phase during this period

(Fig. 4d). In green skin sectors the concentration of CTs was

relatively stable at between �400 and 500 ng mg�1 between

successive samples at 32, 48, 62 and 94 DAFB which, given

the growth rate during this period, would indicate net

synthesis of CTs. By the ripening stage the concentration of

CTs was similar in red and green skin sectors, at �120–

200 ng mg�1. Tannins were also detected in flesh; however

there was about 10-fold less CT per mg of tissue compared to

skin. Concentrations of CTs in flesh declined during fruit

maturation from 100 ng mg�1 at 48 DAFB to 15 ng mg�1 at

147 DAFB (data not shown).

The composition of the CTs is shown in Table 2 and the

identity of species was determined by HPLC by spiking

samples with standards. The free monomer and initiating units

were found to be almost exclusively epicatechin. Only trace

amounts of catechin free monomers could be detected by

HPLC, which were below the level of quantitation. Free

monomers were more concentrated in green skin in all samples

from 48 to 147 DAFB. The extension units detected were a

mixture of epicatechin and catechin phloroglucinol adducts that

could not be completely resolved from each other by HPLC.

However, since both these species have the same molar

absorptivity [24], it was possible to sum their peak areas and

express the extension units as epicatechin equivalents. By

measuring peak heights we were able to estimate that extension

units were composed of approximately 30% catechin-adduct

and the remainder epicatechin-adduct. The mean degree of

polymerisation (mDP) was not significantly different between

red and green skin sectors throughout development. The mDP

declined steadily from about 13–16 early in development to

about 7.5 during fruit ripening.

3.4. Analysis of the anthocyanin and flavonol branches

Transcripts of MdUFGT, the branch-specific flavonoid

gene required for anthocyanin synthesis, were most abundant

in red skin sectors at 48 DAFB and this level changed with a

slight downward trend in RNA samples throughout the

remainder of fruit maturation (Fig. 5a). Transcripts were much

less abundant in RNA samples from green skin sectors with


Table 2

Details of analysis of CTs

DAFB Free monomer (ng mg�1)a Initiating units (ng mg�1)a Extension units

(ng mg�1)bTotal CT (ng mg�1)c Mean degree of polymer-

isation

Red skin Green skin Red skin Green skin Red skin Green skin Red skin Green skin Red skin Green skin

32 42.6 � 1.3 40.5 � 0.3 76.4 � 9.7 41.8 � 1.3 913 � 37 426 � 52 990 � 42 467 � 52 13.1 � 1.5 11.2 � 1.3

48 34.5 � 1.6 46.0 � 0.7 35.4 � 13.6 45.9 � 13.4 492 � 71 491 � 6 528 � 84 537 � 17 16.2 � 4.9 12.2 � 2.8

62 19.7 � 0.6 30.6 � 2.4 52.0 � 8.9 36.2 � 18.7 419 � 30 362 � 70 471 � 41 398 � 89 9.2 � 0.9 11.9 � 2.9

94 17.3 � 1.2 49.0 � 5.4 30.1 � 6.6 38.4 � 12.6 261 � 30 469 � 37 292 � 37 508 � 49 9.8 � 0.9 13.8 � 2.8

105 16.1 � 2.7 22.2 � 1.0 34.9 � 3.6 29.7 � 4.3 290 � 30 259 � 28 325 � 32 289 � 32 9.3 � 0.5 9.8 � 0.6

134 14.5 � 0.9 16.6 � 0.5 27.0 � 1.9 24.1 � 1.0 183 � 1 165 � 13 210 � 3 190 � 13 7.8 � 0.4 7.9 � 0.7

147 10.7 � 1.8 13.4 � 0.4 22.2 � 4.2 30.1 � 0.4 140 � 26 196 � 1 163 � 31 226 � 1 7.3 � 0.4 7.5 � 0.1

160 18.7 � 0.6 9.9 � 0.9 27.8 � 7.3 14.3 � 4.0 178 � 21 103 � 14 206 � 29 118 � 18 7.6 � 1.1 8.5 � 1.5

n = 3 determinations for each sample, � indicates standard deviation.a Free monomer and initiating units were epicatechin. Initiating units calculated by subtracting free monomer values from phloroglucinol cleaved values of free

epicatechin.b Extension units were a mixture of catechin and epicatechin adducts. The HPLC peak areas of these were summed and calculated as epicatechin equivalents since

both compounds have the same molar absorptivity [24].c Total CT was initiating units + extension units.

the exception of 48 DAFB when the level was about 30% of

that of red skin at the same stage.

There were two distinct phases of anthocyanin synthesis

during fruit development, a moderate accumulation early in

Fig. 5. Analysis of the anthocyanin and flavonol pathways. (a)MdUFGT transcript

MdFLS transcript levels. (d) Accumulation of flavonols as measured by HPLC. D

development and a far more significant level of accumulation at

fruit ripening (Fig. 5b). The initial synthesis of anthocyanin was

between 18 and 48 DAFB when the concentration reached

97 ng mg�1 of red skin and this is referred to as phase I

levels. (b) Accumulation of anthocyanin as measured by spectrophotometry. (c)

etails of transcript analysis are as described in Fig. 3b.


synthesis. Subsequently anthocyanin concentration decreased

to 34 ng mg�1 of red skin at 105 DAFB probably due to the

dilution effect of fruit growth as was noted for the synthesis of

CTs (Fig. 4d). At fruit ripening anthocyanin concentration in

red skin increased from 47 ng mg�1 of skin at 134 DAFB to

186 ng mg�1 at 160 DAFB, during the period referred to as

phase II synthesis. Less than 15 ng mg�1 of anthocyanin was

measured in green skin sectors at any point in fruit

development. The major anthocyanin species in apple skin

had previously been identified as cyanidin 3-galactoside by

HPLC [18,28]. We confirmed that this was only major species

in ‘Cripps Red’ by HPLC analysis of several samples spiked

with a standard of this compound. Anthocyanin was not

detected in flesh.

Transcripts of the MdFLS gene, required for synthesis of

flavonols, were far more abundant in red skin sectors compared

with green skin (Fig. 5c). There were two peaks in transcript

levels in red skin, at 48 and 147 DAFB.

Flavonols were probably synthesized very early in fruit

development because the first red skin sector sample analysed

at 32 DAFB had the highest concentration. Flavonols

Fig. 6. Analysis of the common pathway. (a)MdCHS transcript levels. (b)MdCHI tra

of transcript analysis are as described in Fig. 3b.

accumulated predominantly in red skin, and the concentration

at 32 DAFB was 508 ng mg�1 declining throughout fruit

maturation to 100 ng mg�1 in ripe fruit (Fig. 5d). There was

also a significant concentration of flavonols in green skin,

measured at 30–55 ng mg�1 at ripening.

The analysis of flavonols by HPLC revealed a more complex

profile than for anthocyanin with several species of flavonols

detected. Quercetin 3-galactoside and quercetin 3-rhamnoside

were identified by spiking HPLC-analysed samples with

standards of these compounds. The four other flavonol species

that were present were not identified; however spectral analysis

confirmed they were flavonol glycosides. The major flavonol

species, quercetin 3-galactoside, accounted for approximately

55% of total flavonols in red skin. Other flavonol species were

each present at 15% or less of the total flavonol content. The

relative concentrations of all of the species of flavonols

remained constant throughout maturation; however the

composition differed markedly between red and green skin.

While total flavonols in red skin were comprised of about 55%

quercetin 3-galactoside, in green skin this species was present

only at about 20% (data not shown). Therefore the difference in

nscript levels. (c)MdF3H transcript levels. (d)MdDFR transcript levels. Details


Fig. 7. Analysis of transcript levels in apple tissues. (a) Transcript levels of the

CT genes MdLAR1, MdLAR2 and MdANR. (b) Transcript levels of the branch

genes MdUFGT and MdFLS and the shared gene MdDFR. Data were normal-

ised against a reference of the apple UBIQUITIN gene and each sample was

plotted relative to the sample in which the maximum expression was detected

which was given a value of 1. For each cDNA sample n = 3 determinations by

Real Time PCR, error bars indicate standard deviation.

concentration of total flavonols between red and green skin can

be accounted for mainly by the decreased levels of quercetin 3-

galactoside. Flavonols were not detected in flesh.

3.5. Analysis of common flavonoid genes

The transcript levels of the common flavonoid genes,

MdCHS, MdCHI, MdF3H, and MdDFR (Fig. 6a–d), had very

similar patterns during fruit maturation. There were two peaks

of transcript abundance in red skin sectors, at 48 DAFB and at

147 DAFB, which correspond to phase I and II of anthocyanin

synthesis (Fig. 5b). For the peak at 48 DAFB, transcripts were

relatively abundant in both red and green skin, while at 147

DAFB transcripts were abundant only in red skin. At 48 DAFB,

the level of MdCHS and MdCHI transcripts in green skin was

about 30–40% of the level in red skin while levels of MdF3H

and MdDFR transcripts were almost identical in red and green

skin at this stage. ForMdCHS andMdCHI the peaks in red skin

at 48 and 147 DAFB were of similar magnitude while for

MdF3H and MdDFR the peak at 147 DAFB was about 30%

larger.

The transcript levels of MdLDOX (Fig. 3b) followed a

similar pattern to that of the other common flavonoid genes of

the pathway and were described above.

3.6. Transcript abundance in various apple tissues

The transcript levels of the branch-specific flavonoid genes

were analysed in young leaves, flower buds, immature fruit

<0.5 and <1 cm diameter and in the skin and flesh of maturing

fruit. These samples were compared with the level in red skin at

48 DAFB, which was typically the tissue with a high level of

transcripts of most of the pathway genes.

Transcripts of the CT genes were abundant in immature

fruit, particularly for MdLAR2 and MdANR, which correlates

with the early synthesis of CTs (Fig. 7a). The MdLAR1

transcripts were at the highest level in flesh at 48 DAFB, whilst

MdANR transcripts were at a lower level in this tissue in

comparison to immature fruit and red skin. The two LAR genes

showed different patterns of transcript accumulation with

MdLAR2 transcripts abundant in young leaves and immature

fruit <0.5 and <1 cm diameter, but not in mature fruit or flesh

whilstMdLAR1 transcripts were most abundant in flower buds,

skin and flesh.

The MdUFGT transcripts were most abundant in red skin

which is expected from the role of MdUFGT enzyme as the

terminal step for anthocyanin synthesis (Fig. 7b). The MdFLS

transcripts were most abundant in young leaf tissue but were

also at relatively high levels in red skin and flower buds.

Transcripts of all the common flavonoid genes were most

abundant in skin and there was also a relatively low level in

flesh but data are shown for MdDFR only (Fig. 7b).

4. Discussion

Transcriptional analysis of the genes encoding enzymes of

the apple flavonoid pathway has only been studied in relation to

anthocyanin accumulation [16,18,19,28]. A biphasic pattern

of anthocyanin synthesis has been well documented in apple

fruit skin [14,15], and most studies have concentrated on the

second phase of synthesis late in the season, which is

commercially important. Since anthocyanin biosynthesis in

apple fruit is induced by sunlight [15,29], we collected

samples of red and green skin sectors which correspond to fruit

surfaces exposed to sunlight and shaded from direct sunlight,

respectively. We have addressed the question of how gene

transcription is regulated in red and green skin sectors

throughout apple fruit development to balance the requirement

to make anthocyanins, CTs and flavonols. Using Real Time


PCR we have been able to quantify relative changes in the

transcript levels of defined gene sequences for the whole

pathway including the genes specific for flavonol and CT

synthesis. This approach has several advantages over Northern

blotting the most important being a larger dynamic range of

linear measurement, typically spanning six orders of

magnitude, and more precise quantification of steady-state

transcript levels of specific mRNA sequences [30].

Similar to other findings [28], transcripts of the common

flavonoid genes of the pathway were most abundant at two

stages, early in development and at fruit ripening, and at a lower

level between these phases. At the early developmental stage,

transcripts of the common flavonoid genes were abundant in red

and green skin which is consistent with the synthesis of

flavonoids in both these skin sectors, while at fruit ripening

transcript levels were higher in red skin to support anthocyanin

synthesis. The data, we obtained using Real Time PCR showed

that the changes in transcript levels were about three to five-fold

between lowest and highest levels. This indicates that

phenotype can be affected by relatively moderate changes in

transcript levels.

CTs accumulate in the developing fruit structure, in which

they have been reported to play a role in preventing predation

by herbivores [4]. We found the highest concentration of CTs

measured in the early red skin samples, while both red and

green skin had similar amounts of CTs later in fruit

development. During the period of rapid growth early in fruit

development, CTs were synthesized in green skin to maintain a

similar concentration whereas anthocyanins and flavonols

decreased in red skin due to a dilution effect of fruit growth. At

fruit ripening, the concentration of CTs was about 80% less

than early in development suggesting there is little synthesis of

CTs late in development of the fruit. The early synthesis of CTs

and subsequent decrease in concentration during fruit devel-

opment has also been observed in ‘Fuji’ and ‘Oorin’ apples [31]

and also other fruits such as cranberry [32], bilberry [33] and

grape [23].

The pattern of abundance of MdLAR1 and MdANR

transcripts was consistent with their roles in the synthesis of

CTs as gene transcripts were at the highest levels early in

fruit development and were abundant in both red and green

skin. Since the major initiating unit for synthesis of CTs

detected was epicatechin, the product of the MdANR enzyme

reaction [26], this would suggest that the initiation of

synthesis of CTs was mainly due to flux through the ANR

branch of the pathway rather than the LAR branch, which

would produce catechin.

The relative transcript levels of the MdANR and MdUFGT

genes during phase I of anthocyanin biosynthesis together with

the decrease in CTs in red skin suggest the possibility of

substrate competition. Although transcript levels of MdANR

appear similar in red and green skin at this stage, CTs are

synthesized in green skin where anthocyanins are not being

synthesized. In comparison, the MdUFGT transcripts were

more abundant in red skin at this stage. Therefore, if

transcription of these genes reflects the protein levels, the

competition between MdANR and MdUFGT enzymes could

favour diversion of substrate into the anthocyanin pathway in

red skin, while in green skin there is less competition for

substrates of the CT pathway. There is some evidence for

substrate competition between the anthocyanin and CT

branches in other systems; for example the Arabidopsis

banyuls mutant, which is deficient in the ANR enzyme activity

and does not have the alternative LAR pathway to initiate

synthesis of CTs, accumulates anthocyanin rather than CTs in

the seed coat [34].

The MdUFGT transcript levels peak mainly during phase I

and are lower later when the majority of anthocyanin is

synthesized; this is puzzling considering the putative role of the

UFGT enzyme for glycosylation of cyanidin. It cannot be

discounted that there may be either an alternative or dual

activity of the enzyme for glycosylation of flavonols [35]. If this

is the case this may argue against the possibility of substrate

competition between the anthocyanin and CT pathways based

upon the transcript levels of MdANR and MdUFGT.

A second variant of the LAR gene cloned from apple,

MdLAR2, had relatively high transcript levels only in immature

fruit. The MdLAR2 transcript may be located in the seed

component of these samples, as CTs are known to accumulate

in the seed coat in other plants [36,23].

Flavonols accumulated preferentially in red skin, initially

about five-fold more than green skin, and most synthesis

occurred before the earliest sample of skin analysed as we have

measured high levels of flavonols in flower buds (data not

shown). The relative abundance of MdFLS gene transcripts in

flower buds correlates with this observation (Fig. 7b). During

fruit development, flavonol concentration in red skin decreased

and at ripening was about four-fold lower than in immature

fruit. Similar observations have been made in several other

apple varieties [37–39]. Unlike other varieties, in ‘Red

Delicious’ apples MdFLS transcripts and quercetin 3-galacto-

side were found to accumulate at fruit ripening [40]; this

apparent discrepancy may be due to differences in genetic

background or environmental conditions between the studies.

In our study of the ‘Cripps Red’ variety, the pattern of MdFLS

transcript levels in skin correlates with the two peaks of

anthocyanin synthesis rather than with flavonol synthesis. The

absence of flavonol synthesis when MdFLS transcript levels

increased appears puzzling but may be due to several

possibilities. There may be a major point of regulation of

flavonol synthesis, either post-transcriptional or post-transla-

tional, so that the amount of mRNA present doesn’t accurately

reflect the amount of active enzyme. There could also be

competition for the substrate with the MdDFR enzyme

competing with the MdFLS enzyme (Fig. 1). In petunia flower

petals, reduction of FLS gene expression or increased

expression of the DFR gene can re-direct the flavonoid

pathway towards anthocyanin production [41].

The flavonoid pathway was also active in apple fruit flesh

to synthesise CTs, which accumulated in flesh at about a 10-

fold less concentration than in skin. The presence of

transcripts of the CT genes in flesh correlate with the

synthesis of CTs in this tissue. Transcripts of the MdUFGT

and MdFLS genes were far less abundant in flesh than in skin,


which would account for the absence of anthocyanins and

flavonols in flesh.

Fruit skin represents a complex tissue in which each of the

branches of the flavonoid pathway is active at some point

during the development of the fruit. In apple fruit the transcripts

of the common flavonoid genes were abundant at two phases,

early in development when some anthocyanin as well as CTs

and flavonols were synthesized and at fruit ripening when only

anthocyanin was synthesized. This pattern of common gene

transcript abundance and flavonoid synthesis has also been

observed in other fruits such as peach and nectarine [42],

bilberry [33] and grape [43]. In addition, in strawberry the CHI

and DFR gene transcripts levels also have early and late

developmental peaks but the PAL and CHS gene transcript

levels remained almost unchanged during fruit development

[44]. However, none of these studies measured the transcript

levels of CT or flavonol branch genes. We have made the first

analysis of the molecular basis of the flavonoid pathway in

terms of CT, flavonol and anthocyanin formation in the same

tissue type.

From this data it appears that there are at least two levels

of transcriptional regulation of flavonoid structural genes

in skin of maturing apple fruit. A developmental control

is apparent at the two phases of flavonoid accumulation

during fruit development and an environmental control by

light of anthocyanin synthesis in red skin during phase I of

synthesis and more predominately at the fruit ripening stage.

There is also an influence of light on CT and flavonol

biosynthesis as the concentration of these compound was

higher in red skin before the phase I of anthocyanin

synthesis. This synthesis could have occurred earlier in fruit

development than our analysis. Our data are consistent with

co-ordinate regulation of the common flavonoid genes of the

pathway both developmentally and in response to environ-

mental stimulus. The CT genes appear to be under a different

control mechanism than the rest of the flavonoid genes,

which are more sensitive to the presence of light at ripening

than early in development. It may be that a transcription

factor, that specifically regulates the CT genes, is only

expressed early in fruit development and not during ripening.

This would explain the reduced level of transcripts of

MdLAR and MdANR and reduction of CT biosynthesis at

ripening.

Acknowledgements

The authors thank the staff from the Primary Industries

and Resources South Australia for allowing us to sample

apple fruits at the Lenswood site in the Adelaide Hills. We

thank Dr. Anthony Ashton for the design of the degenerate

LAR primers, Karin Sefton and Justine Chambers for

excellent technical assistance and Dr. Mark Downey and

Nicole Cordon for the HPLC methods for analysing

anthocyanins, flavonols and tannins. We are grateful for

the support of this work by a grant from the Western

Australian Department of Agriculture under the auspices of

Horticultural Australia Ltd.

References

[1] N.J.Dominy, J.C.Svenning,W.H.Li,Historicalcontingencyin theevolution

of primate color vision, J. Hum. Evol. 44 (2003) 25– 45.

[2] K.D. Whitney, C.E. Lister, Fruit colour polymorphism in Acacia ligulata:

seed and seedling performance, clinal patterns, and chemical variation,

Evol. Ecol. 18 (2004) 165–186.

[3] R.W. Wrangham, N.L. Conklin-Brittain, K.D. Hunt, Dietary response of

chimpanzees and cercopithecines to seasonal variation in fruit abundance.

I. Antifeedants, Int. J. Primatol. 19 (1998) 949–970.

[4] R.E. Forkner, R.J. Marquis, J.T. Lill, Feeny revisited: condensed tannins as

anti-herbivore defences in leaf-chewing herbivore communities of Quer-

cus, Ecol. Entomol. 29 (2004) 174–187.

[5] S.J. Bloor, R. Falshaw, Covalently linked anthocyanin-flavonol pigments

from blue Agapanthus flowers, Phytochemistry 53 (2000) 575–579.

[6] J. Derksen, R. van Wezel, B. Knuiman, B. Ylstra, A.J. van Tunen, Pollen

tubes of flavonol-deficient Petunia show striking alterations in wall

structure leading to tube disruption, Planta 207 (1999) 575–581.

[7] A. Solovchenko, M. Schmitz-Eiberger, Significance of skin flavonoids for

UV-B-protection in apple fruits, J. Exp. Bot. 54 (2003) 1977– 1984.

[8] K. Wolfe, X.Z. Wu, R.H. Liu, Antioxidant activity of apple peels, J. Agric.

Food Chem. 51 (2003) 609–614.

[9] B. Winkel-Shirley, Flavonoid biosynthesis. A colorful model for genetics,

biochemistry, cell biology, and biotechnology, Plant Physiol. 126 (2001)

485–493.

[10] G.J. Tanner, K.T. Francki, S. Abrahams, J.M. Watson, P.J. Larkin, A.R.

Ashton, Proanthocyanidin biosynthesis in plants – purification of legume

leucoanthocyanidin reductase and molecular cloning of its cDNA, J. Biol.

Chem. 278 (2003) 31647–31656.

[11] M. Devic, J. Guilleminot, I. Debeaujon, N. Bechtold, E. Bensaude, M.

Koornneef, G. Pelletier, M. Delseny, The BANYULS gene encodes a DFR-

like protein and is a marker of early seed coat development, Plant J. 19

(1999) 387–398.

[12] D.-Y. Xie, S.B. Sharma, N.L. Paiva, D. Ferreira, R.A. Dixon, Role of

anthocyanidin reductase, encoded by BANYULS in plant flavonoid bio-

synthesis, Science 299 (2003) 396–399.

[13] J.A. Delcour, D. Ferreira, D.G. Roux, Synthesis of condensed tannins: IX.

The condensation sequence of leucocyanidin with (+) catechin and the

resultant procyanidin, J. Chem. Soc. Perk. T. 1 (1983) 1711–1717.

[14] C.E. Lister, J.E. Lancaster, K.H. Sutton, J.R.L. Walker, Developmental

changes in the concentration and composition of flavonoids in skin of a red

and a green skin apple cultivar, J. Sci. Food Agric. 64 (1994) 155–161.

[15] M.C. Saure, External control of anthocyanin formation in apple, Sci.

Hortic. 42 (1990) 181–218.

[16] S.H. Kim, J.R. Lee, S.T. Hong, Y.K. Yoo, G. An, S.R. Kim, Molecular

cloning and analysis of anthocyanin biosynthesis genes preferentially

expressed in apple skin, Plant Sci. 165 (2003) 403–413.

[17] C.E. Lister, J.E. Lancaster, J.R.L. Walker, Developmental changes in

enzymes of flavonoid biosynthesis in the skins of red and green apple

cultivars, J. Sci. Food Agric. 71 (1996) 313–320.

[18] C. Honda, N. Kotoda, M. Wada, S. Kondo, S. Kobayashi, J. Soejima, Z.L.

Zhang, T. Tsuda, T. Moriguchi, Anthocyanin biosynthetic genes are

coordinately expressed during red coloration in apple skin, Plant Physiol.

Biochem. 40 (2002) 955–962.

[19] S. Kondo, M. Maeda, S. Kobayashi, C. Honda, Expression of anthocyanin

biosynthetic genes in Malus sylvestris L. ’Mutsu’ non-red apples, J.

Hortic. Sci. Biotech. 77 (2002) 718–723.

[20] C. Wan, T.A. Wilkins, A modified hot borate method significantly

enhances the yield of high quality RNA from Cotton (Gossypium hirsutum

L.), Anal. Biochem. 223 (1994) 7–12.

[21] M.R. Thomas, S. Matsumoto, P. Cain, N.S. Scott, Repetitive DNA of

grapevine – classes present and sequences suitable for cultivar identifica-

tion, Theor. Appl. Genet. 86 (1993) 173–180.


[22] S. Singha, T.A. Baugher, E.C. Townsend, M.C. D’Souza, Anthocyanin

distribution in ‘Delicious’ apples and the relationship between anthocya-

nin concentration and chromaticity values, J. Am. Soc. Hortic. Sci. 116

(1991) 497–499.

[23] M.O. Downey, J.S. Harvey, M.P. Robinson, Analysis of tannins in seeds

and skins of Shiraz grapes throughout berry development, Aust. J. Grape

Wine R. 9 (2003) 15–27.

[24] J.A. Kennedy, G.P. Jones, Analysis of proanthocyanidin cleavage products

following acid-catalysis in the presence of excess phloroglucinol, J. Agric.

Food Chem. 49 (2001) 1740–1746.

[25] C.A. Bottoms, P.E. Smith, J.J. Tanner, A structurally conserved water

molecule in Rossmann dinucleotide-binding domains, Protein Sci. 11

(2002) 2125–2137.

[26] D.-Y. Xie, S.B. Sharma, R.A. Dixon, Anthocyanin reductases from

Medicago truncatula and Arabidopsis thaliana, Arch. Biochem. Biophys.

422 (2004) 91–102.

[27] A. Bas, G. Forsberg, S. Hammarstrom, M.-L. Hammarstrom, Utility of

the housekeeping genes 18S rRNA, b-actin and glyceraldehyde-3-

phosphate-dehydrogenase for normalization in Real Time quantitative

Reverse Transcriptase – Polymerase Chain Reaction analysis of gene

expression in human T lymphocytes, Scand. J. Immunol. 59 (2004)

566–573.

[28] S. Kondo, K. Hiraoka, S. Kobayashi, C. Honda, N. Terahara, Changes in

the expression of anthocyanin biosynthetic genes during apple develop-

ment, J. Am. Soc. Hortic. Sci. 127 (2002) 971–976.

[29] O. Arakawa, Photoregulation of anthocyanin synthesis in apple fruit under

UV-B and red-light, Plant Cell Physiol. 29 (1988) 1385–1389.

[30] S. Schlavo, W.C. Yang, N.H.L. Chiu, I.S. Krull, Comparison of fluoro-

metric detection methods for quantitative polymerase chain reaction

(PCR), J. Immunoass. Immunoch. 26 (2005) 1–12.

[31] Z.H. Li, S. Sugaya, H. Gemma, S. Iwahori, Flavonoid biosynthesis and

accumulation and related enzyme activities in the skin of ‘Fuji’ and

‘Oorin’ apples during their development, J. Jpn. Soc. Hortic. Sci. 71

(2002) 317–321.

[32] I.O. Vvedenskaya, N. Vorsa, Flavonoid composition over fruit develop-

ment and maturation in American cranberry, Vaccinium macrocarpon Ait,

Plant Sci. 167 (2004) 1043–1054.

[33] L. Jaakola, K. Maatta, A.M. Pirttila, R. Torronen, S. Karenlampi, A.

Hohtola, Expression of genes involved in anthocyanin biosynthesis in

relation to anthocyanin, proanthocyanidin, and flavonol levels during

bilberry fruit development, Plant Physiol. 130 (2002) 729–739.

[34] S. Albert, M. Delseny, M. Devic, BANYULS, a novel negative regulator of

flavonoid biosynthesis in the Arabidopsis seed coat, Plant J. 11 (1997)

289–299.

[35] C.E. Lister, J.E. Lancaster, K.H. Sutton, J.R.L. Walker, Aglycone and

glycoside specificity of apple skin flavonoid glycosyltransferase, J. Agric.

Food Chem. 75 (2004) 378–382.

[36] S. Abrahams, G.J. Tanner, P.J. Larkin, A.R. Ashton, Identification and

biochemical characterisation of mutants in the proanthocyanidin pathway

in Arabidopsis, Plant Physiol. 130 (2002) 561–576.

[37] U. Mayr, D. Treutter, C. Santos-Buelga, H. Bauer, W. Feucht, Develop-

mental changes in the phenol concentrations of ‘Golden Delicious’ apple

fruits and leaves, Phytochemistry 38 (1995) 1151–1155.

[38] M.A. Awad, A. de Jager, L.H.W. van der Plas, A.R. van der Krol,

Flavonoid and chlorogenic acid changes in skin of ‘Elstar’ and ‘Jonagold’

apples during development and ripening, Sci. Hortic. 90 (2001) 69–83.

[39] R.F. Reay, J.E. Lancaster, Accumulation of anthocyanins and quercetin

glycosides in ‘Gala’ and ‘Royal Gala’ apple fruit skin with UV-B-visible

irradiation: modifying effects of fruit maturity, fruit side, and temperature,

Sci. Hortic. 90 (2001) 57–68.

[40] G. Ben-Yehudah, R. Korchinsky, G. Redel, R. Ovadya, M. Oren-Shamir,

Y. Cohen, Colour accumulation patterns and the anthocyanin biosynthetic

pathway in ‘Red Delicious’ apple variants, J. Hortic. Sci. Biotech. 80

(2005) 187–192.

[41] K.M. Davies, K.E. Schwinn, S.C. Deroles, D.G. Manson, D.H. Lewis, S.J.

Bloor, J.M. Bradley, Enhancing anthocyanin production by altering

competition for substrate between flavonol synthase and dihydroflavonol

4-reductase, Euphytica 131 (2003) 259–268.

[42] T. Tsuda, M. Yamaguchi, C. Honda, T. Moriguchi, Expression of antho-

cyanin biosynthesis genes in the skin of peach and nectarine fruit, J. Am.

Soc. Hortic. Sci. 129 (2004) 857–862.

[43] P.K. Boss, C. Davies, S.P. Robinson, Analysis of the expression of

anthocyanin pathway genes in developing Vitis vinifera L cv Shiraz grape

berries and the implications for pathway regulation, Plant Physiol. 111

(1996) 1059–1066.

[44] Y.J. Li, R. Sakiyama, H. Maruyama, S. Kawabata, Regulation of antho-

cyanin biosynthesis during fruit development in ‘Nyoho’ strawberry, J.

Jpn. Soc. Hortic. Sci. 70 (2001) 28–32.

Condensed tannin biosynthesis genes are regulated separately from other flavonoid biosynthesis genes...

Documents

Transcript of Condensed tannin biosynthesis genes are regulated separately from other flavonoid biosynthesis genes...