Absence of donor Th17 leads to augmented Th1 differentiation and exacerbated acute graft-versus-host...

doi:10.1182/blood-2007-12-126987Prepublished online July 2, 2008;

LeBon, Fouad Kandeel, Stephen Forman and Defu ZengTangsheng Yi, Dongchang Zhao, Chia-Lei Lin, Chunyan Zhang, Ying Chen, Ivan Todorov, Thomas exacerbated acute graft versus host diseaseAbsence of donor Th17 leads to augmented Th1 differentiation and

(1880 articles)Transplantation � (5020 articles)Immunobiology �

Articles on similar topics can be found in the following Blood collections

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#repub_requestsInformation about reproducing this article in parts or in its entirety may be found online at:

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#reprintsInformation about ordering reprints may be found online at:

http://bloodjournal.hematologylibrary.org/site/subscriptions/index.xhtmlInformation about subscriptions and ASH membership may be found online at:

digital object identifier (DOIs) and date of initial publication. theindexed by PubMed from initial publication. Citations to Advance online articles must include

final publication). Advance online articles are citable and establish publication priority; they areappeared in the paper journal (edited, typeset versions may be posted when available prior to Advance online articles have been peer reviewed and accepted for publication but have not yet

Copyright 2011 by The American Society of Hematology; all rights reserved.20036.the American Society of Hematology, 2021 L St, NW, Suite 900, Washington DC Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by

For personal use only. by guest on June 4, 2013. bloodjournal.hematologylibrary.orgFrom

http://bloodjournal.hematologylibrary.org/cgi/collection/immunobiology

http://bloodjournal.hematologylibrary.org/cgi/collection/transplantation

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#repub_requests

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#reprints

http://bloodjournal.hematologylibrary.org/site/subscriptions/index.xhtml

http://bloodjournal.hematologylibrary.org/subscriptions/ToS.dtl

http://bloodjournal.hematologylibrary.org/


1

Absence of Donor Th17 Leads to Augmented Th1 Differentiation and Exacerbated

Acute Graft versus Host Disease

Tangsheng Yi1, 2, 3, Dongchang Zhao2, 3, Chia-Lei Lin2, 3,Chunyan Zhang2, 3, Ying Chen2,3,

Ivan Todorov2, Thomas LeBon1, Fouad Kandeel2, Stephen Forman3 and Defu Zeng1, 2, 3

1. Graduate School of Biological Science

2. Department of Diabetes, Endocrinology & Metabolism

3. Division of Hematology & Hematopoietic Cell Transplantation

The Beckman Research Institute, City of Hope National Medical Center

Running title: Absence of donor Th17 exacerbates acute GVHD

Grant support: This work was supported by a grant from the National Institutes of Health (RO1 AI066008 to D. Zeng)

Correspondence: Defu Zeng, MD

The Beckman Research Institute

Gonda Building, R2017

City of Hope National Medical Center

1500 East Duarte Rd, Duarte, CA 91010

Tel: 626-359-8111 x 62587; Fax: 626-301-8136;

Email: [email protected]

Scientific Heading: Transplantation.

Key Words: Acute Graft Versus Host Disease; Th17; Th1; IL-17; IFN-γ

Blood First Edition Paper, prepublished online July 2, 2008; DOI 10.1182/blood-2007-12-126987

Copyright © 2008 American Society of Hematology




2

Abstract

Th17 is a newly identified T cell lineage that secretes proinflammatory cytokine IL-17.

Th17 cells have been shown to play a critical role in mediating autoimmune diseases

such as EAE, colitis, and arthritis, but their role in the pathogenesis of GVHD is still

unknown. Here we showed that, in an acute GVHD model of C57BL/6 (H-2b) donor to

BALB/c (H-2d) recipient, IL-17-/- donor T cells manifested an augmented Th1

differentiation and IFN-γ production and induced exacerbated acute GVHD. Severe

tissue damage mediated by IL-17-/- donor T cells was associated with increased Th1

infiltration, upregulation of chemokine receptors by donor T cells, and enhanced tissue

expression of inflammatory chemokines. Administration of recombinant IL-17 and

neutralizing IFN-γ in the recipients given IL-17-/- donor cells ameliorated the acute GVHD.

Furthermore, the regulation of Th1 differentiation by IL-17 or Th17 may be through its

influence on host DCs. Our results indicate that donor Th17 cells can downregulate Th1

differentiation and ameliorate acute GVHD in allogeneic recipients, and that treatments

neutralizing proinflammatory cytokine IL-17 may augment acute GVHD as well as other

inflammatory autoimmune diseases.




3

Introduction

Acute graft versus host disease (GVHD), the leading cause of morbidity and mortality of

allogeneic hematopoietic cell transplantation (HCT), is a complex process involving

dysregulation of inflammatory cytokine cascades and distorted donor cellular response

against host alloantigens 1. Activation of alloreactive donor T cells is initiated by host

APCs, especially dendritic cells2-5. Much effort has been devoted to understand how

the polarization of donor T cells to the Th1 or Th2 phenotype contributes to acute GVHD.

In some experimental models, it has been shown that Th1 cells augment, and Th2 cells

ameliorate acute GVHD 1,6-8. However, it was also reported that the absence of Th1

cytokine IFN-γ augments acute GVHD but loss of the Th2 cytokine IL-4 reduces acute

GVHD 9,10. Furthermore, donor T cells deficient in either Th1 or Th2 differentiation were

shown to be able to mediate acute GVHD 11. Therefore, the role of donor T cell subsets

in GVHD pathogenesis is still controversial. It is likely that T cell subsets other than Th1

or Th2 play a role in mediating acute GVHD.

Th17 is a newly identified T cell lineage that secretes the proinflammatory cytokine IL-17

12. Naïve CD4+ T cells differentiate into Th17 cells in the presence of IL-6 and TGF-β 13-

15. Th17 cells express IL-23 receptor, and IL-23, an IL-12 family member, is critical for

their survival and proliferation 16-18. Orphan nuclear receptor RORγt is the key

transcription factor that orchestrates differentiation of the Th17 lineage 19. Interestingly,

it has been shown that naïve CD8+ T cells can also differentiate into IL-17 producing T

cells in the same culture condition as CD4+ T cells 20.

One of the important functions of IL-17 is to coordinate local tissue inflammation through

the upregulation of proinflammatory cytokines and chemokines 21. Thus, IL-17 has been

implicated to play a critical role in the host defense against a series of extracellular




4

pathogens, such as Klebsiella pneumoniae and Candida albicans 22,23. However,

uncontrolled Th17 cells have been reported to be involved in autoimmune diseases,

such as rheumatoid arthritis, inflammatory bowel disease, and experimental autoimmune

encephalomyelitis (EAE) 24-27. In contrast, IL-17 has also been shown to have some

regulatory effect in mediating tissue inflammation. It was reported that IL-17 inhibited

CD4+ T cell activation 28, suppressed the tissue expression of chemokines (e.g. CCL5

and CCL27) 29,30, and downregulated VCAM-1 expression on epithelial cells31.

Moreover, neutralization of IL-17 was reported to aggravate dextran sulfate sodium-

induced colitis in mice32, and absence of IL-17 augmented allergic asthma 33.

The role of Th17 cells in GVHD pathogenesis is still unknown. In the current study, we

demonstrated that IL-17-/- donor T cells showed an augmented Th1 differentiation and

IFN-γ production and induced exacerbated acute GVHD. Our data also suggest that the

IL-17 regulation of donor T cell differentiation may be through its influence on host DCs.

Our results indicate that donor Th17 cells can downregulate donor Th1 differentiation

and ameliorate acute GVHD, and that neutralizing IL-17 may augment acute GVHD.




5

Materials and Methods

Mice: IL-17-/- mice in C57BL/6 background are kindly provided by Dr. Yoichiro Iwakura in

Tokyo University. C57BL/6 (H-2b) and (H-2d) mice at 6 to 8 weeks of age were

purchased from NCI Laboratories (Frederick, Maryland). Mice are maintained in a

pathogen-free room at City of Hope Research Animal Facilities (Duarte, CA). Mice at

age 8 to 12 weeks were used in the current studies. IRB approval was obtained from the

research animal care committee of The Beckman Research Institute of City of Hope for

these studies.

Induction and assessment of GVHD: HCT procedures for induction of acute GVHD

were described previously34,35. Briefly, BALB/c mice were given sublethally 800 rads

total body irradiation (TBI) from a 137Cs souse on day -1, and C57BL/6 donor

splenocytes with TCD-BM cells were injected intravenously on day 0. The experimental

and control groups were always set up at the same time and experiments were always

replicated 2-3 times. The recipients were monitored daily for survival and every 5 days

for body weight changes and clinical signs of GVHD.

The clinical scoring was based on six parameters as used by others36,37, including weight

loss, posture, activity, fur texture, skin integrity, and diarrhea. A severity scale from 0-2

was used for each parameter, and the maximum score is 12.

Cell preparation: Spleen T cells were purified by depletion of non-T cells with biotin

labeled mAbs including anti-B220, Gr-1, Mac-1, CD11c, and Ter119, using a magnetic

purification system from Miltenyi Biotec (Auburn, CA). The purity of CD3+ T cells was

more than 95%. TCD-BM cells were collected by depleting CD4+, CD8+, and TCRβ+

cells using the magnetic purification system.




6

Monoclonal antibodies and flow cytometric analysis: The fluorescein isothiocyanate

(FITC)–, phycoerythrin (PE)–, allophycocyanin (APC)–, Biotin-, cyanin 7 (Cy7), or

allophycocyanin (CY7-APC)–conjugated mAbs to mouse CD4, CD8, TCRβ, Mac-1, B220,

Gr-1, H-2b, CD11c, IL-17, IFN-γ were all purchased from BD Pharmingen (San Diego,

CA). Anti-CCR5 was purchased from Biolegend (San Diego, CA). Intracellular cytokine

staining was performed following the vendor’s instruction (BD Bioscience), as previously

described38. Briefly, cells were stimulated with 1ug/ml inomycin plus 0.1μg/ml PMA in

the presence of Golgi-Stop for 5 hours. Cells were harvested, washed, and stained with

anti-CD4 or CD8 in the presence of FcR-Block, anti-CD16/32. After wash, cells were

then fixed using CytoFix/CytoPerm buffer and stained with antibodies against

intracellular cytokines or isotype control on ice for 30 min. Multiple-color fluorescence-

activated cell sorter (FACS) analysis were performed at City of Hope FACS facility using

a 3-laser CyAn immunocytometry system (Dako Cytomation, Fort Collins, CO), and data

were analyzed using FLOWJO software (Tree Star, San Carlos, CA), as previously

described 35,38,39. In some experiments, dead cells were excluded by Fixable Aqua Dead

Cell Stain Kit (Invitrogen, CA), as indicated in figure legends.

Administration of IL-17 and in vivo neutralization of IFN-γ: Recipients were injected

with mouse recombinant IL-17 at a dose of 0.3μg/mouse on days 0, 3, 7 after HCT.

Anti-IFN-γ mAbs (R4-6A2) were purified from the culture supernatant using protein G

columns as described in our previous publication 35. Control rat IgG was obtained from

Jackson ImmunoResearch Laboratory (West Grove, PA). Recipients were injected with

anti-IFN-γ or rat IgG (0.5mg/mouse) on days 0, 5, 10, and 15 after HCT.

Quantification of chemokine expression by real-time RT-PCR: Isolation of total liver

RNA and synthesis of first strand cDNA were described previously 40. mRNA was

quantified by real-time quantitative PCR using Applied Biosystems 7300 Fast Real-Time




7

PCR System (Applied Biosystems, Forest City, CA). The following specific forward (F)

and reverse primers (R) were used: mCCL3F, AAGGATACAAGCAGCAGCGAGTA;

mCCL3R, TGCAGAGTGTCATGGTACAGAGAA; mCCL4F,

TGCAGAGTGTCATGGTACAGAGAA; mCCL4R,

CAACTCCAAGTCACTCATGTACTCAG; mCCL5F, CATATGGCTCGGACACCACT;

mCCL5R, ACACACTTGGCGGTTCCTTC; mGAPDHF, TCACCACCATGGAGAAGGC;

mGAPHDR, GCTAAGCAGTTGGTGGTGCA. Relative expression levels of genes were

normalized within each sample to the house keeping gene GAPDH and were presented

relative to the expression in syngeneic transplantation recipients.

Cell culture and measurement of cytokines in serum and culture supernatants:

Sorted donor C57BL/6 CD4+ T cells (2x105) were cultured with CD11c+ DCs (105) from

the spleen of BABL/c mice, which had been irradiated with 800 rad 2 hours before, in a

U-bottom 96-well plate for 4 days. CD4+ T cells were purified by magnetic sorting

system as described above. Cytokines (i.e. IFN-γ, TNF-α) in serum and culture

supernatants were measured using ELISA kit from R&D system (Minneapolis, MN).

Histopathology and Scoring: Liver, gut, and lung specimens of recipients were fixed in

formalin before embedding in paraffin blocks. Tissue sections were stained with H&E as

previously described 35,39. Assessment of tissue damage was peformed based on

scoring systems previously described36,41. In brief, liver GVHD was scored on the

number of involved tracts and severity of liver cell necrosis; the maximum score is 10.

Gut GVHD was scored on the basis of crypt apoptosis and lamina propria inflammation;

the maximum score is 8. Lung GVHD was scored on the periluminal infiltrates,

pneumonitis, and the severity of lung tissues involved; the maximum score is 9.

Mean±SE of the score of six recipients in each group is shown.




8

Statistical analysis: Body weight and survival in different groups were compared using

the log-rank test with program GraphPad Prism Version 4.0 (Graph Pad Software, San

Diego, CA). Comparison of two means was analyzed using unpaired two-tail Student t-

test.




9

Results

IL-17-/- donor T cells induced more severe acute GVHD than wild-type donor T

cells

Since Th17 cells mediate autoimmune diseases, we studied the role of IL-17 in the

pathogenesis of acute GVHD, using an MHC-mismatched HCT model of C57BL/6 (H-2b)

donor to BALB/c (H-2d) recipient. IL-17-/- (referred to IL-17A-/-)12 mice have been used to

study the role of IL-17 in various diseases models such as contact hypersensitivity

response, experimental autoimmune encephalomyelitis, and airway hypersensitivity

response26,42. In addition, we observed that, compared with wide-type (WT) C57BL/6

mice, IL-17-/- C57BL/6 showed no significant difference in total spleen mononuclear cells,

percentage of T cells, ratio of CD4+ T versus CD8+ T, percentage of CD62LhiCD44lo

naïve CD4+ or CD8+ T cells, or percentage of Foxp3+CD25hiCD4+ regulatory T cells as

well as their suppressor function (Supplemental Fig 1). Therefore, graded numbers

(1.25-2.5x106) of spleen cells and T cell depleted (TCD) bone marrow cells (2.5x106)

from IL-17-/- or WT control C57BL/6 donors were injected into sublethally irradiated

BALB/c recipients. The spleen and the TCD-BM cells were from same donors. GVHD

was assessed by clinical signs of GVHD such as weight loss, diarrhea, and death, as

well as histopathology of GVHD target tissues including liver, colon, and lung.

Surprisingly, we observed that the recipients given 1.25 or 2.5 x 106 IL-17-/- donor spleen

cells showed more severe diarrhea and weight-loss as compared with the recipients

given the same number of WT donor cells (P<0.01, Fig.1A). While 75% or 100% of the

recipients given 1.25 or 2.5x106 IL-17-/- donor spleen cells died before day 30, more than

70% of the recipients given the same number of WT donor spleen cells survived for

more than 50 days (P<0.01, Fig.1B). The recipients given TCD-BM cells alone from IL-




10

17-/- or WT donors all survived for more than 50 days without any signs of GVHD (Fig.

1A and B).

Additionally, we compared the histopathology of GVHD target tissues 13 days after HCT.

We observed much more severe tissue damage and higher histopathology scores in the

liver, colon, and lung tissues of the recipients given 2.5x106 IL-17-/- donor spleen cells as

compared to recipients given 2.5x106 WT donor spleen cells (P<0.05, Fig. 1B and C). In

addition, areas of necrosis in liver tissues and inflammatory ulcers in colon tissues were

with the former recipients. The more severe tissue damage was correlated with more

severe clinical GVHD and higher mortality in recipients given IL-17-/- donor cells (Fig. 1A-

C). These results indicate that IL-17-/- donor cells induce exacerbated acute GVHD.

To address whether IL-17 from donor T cells plays an important role in regulating acute

GVHD, purified T cells including CD4+ and CD8+ T cells (0.5x106) from IL-17-/- or WT

donors were co-injected with WT TCD-BM cells into BALB/c recipients. The purity of T

cells (~96%) and the ratio of CD4+ T/CD8+ T (~1.6) was not significantly different

between WT and IL-17-/- donors (P>0.5, supplemental Fig. 1B). We found that recipients

given T cells from IL-17-/- donors showed a much higher clinical score of acute GVHD by

20 days after HCT than the recipients given WT donor T cells (P<0.01, Fig. 1D). While

80% of the former recipients died of acute GVHD within 50 days after HCT, all of the

latter recipients survived for more than 50 days (P<0.01, Fig. 1E). Furthermore, we

observed that a small percentage (0.5~1%) of the donor CD4+ and CD8+ T cells in the

recipients given WT T cells were IL-17-secreting T cells, but IL-17-secreting T cells were

not detectable in the recipients given IL-17-/- T cells (Fig. 1F). Taken together, our

results indicate that IL-17 deficiency in donor T cells leads to exacerbated acute GVHD,




11

and that IL-17 from donor T cells may play a negative feedback role in donor T cell-

mediated acute GVHD.

IL-17-/- donor T cells showed enhanced differentiation into Th1 cells in GVHD

recipients

Next, we explored how IL-17-/- donor spleen cells exacerbated acute GVHD. Since

inflammatory cytokines (e.g. IFN-γ and TNF-α) were shown to play a critical role in

mediating acute GVHD 1,43, we compared serum levels of IFN-γ and TNF-α in the

recipients. Five days after HCT, we found that the serum levels of both IFN-γ and TNF-

α were significantly elevated in the recipients given IL-17-/- donor cells as compared to

recipients given WT donor cells (P<0.05, Fig. 2A and B). Furthermore, we observed

that the percentage of donor IFN-γ-secreting CD4+ and CD8+ T cells increased more

than 10-fold in mesenteric lymph nodes (MLN) and increased about 2-fold in spleen of

recipients given IL-17-/- donor cells, as compared to that of recipients given WT donor

cells (P<0.01, Fig. 2 C-E). These results indicate that the accelerated acute GVHD

mediated by IL-17-/- donor T cells is associated with enhanced Th1 differentiation.

Severe GVHD target tissue damage mediated by IL-17-/- donor cells was

associated with increased Th1 cell infiltration, upregulation of chemokine

receptors by donor T cells, and enhanced tissue expression of inflammatory

chemokines.

Since we observed enhanced Th1 differentiation of donor T cells in host lymphoid

tissues and much more severe GVHD target tissue infiltration and tissue damage in the

recipients given IL-17-/- donor cells, as compared to recipients given WT donor cells (Fig.

1 and 2), we tested whether more severe GVHD target tissue damage was associated

with increased Th1 infiltration. Taking liver as an example, we found that the




12

percentage of IFN-γ secreting CD4+ and CD8+ donor T cells in the liver of recipients

given IL-17-/- donor cells was more than 2-fold higher than that in recipients given WT

donor cells; the yield of IFN-γ+ CD4+ or CD8+ T cells in the liver of the former recipients

was more than 6-fold higher than that in latter recipients (P<0.01, Fig. 3A and B).

It was reported that IFN-γ plays an important role in upregulating chemokine and

chemokine receptor expression, and chemokines from GVHD target tissues and

chemokine receptors expressed by donor T cells mediate donor T cell migration to

GVHD target tissues 35,44-47. CCR5 and its chemokine ligands CCL3-5 were shown to

play an important role in donor T cell migration to the liver48. Thus, we compared CCR5

expression by donor T cells in the spleen and CCL3-5 expression in the liver tissue of

recipients given IL-17-/- or WT donor cells. We found that, as compared to recipients

given WT donor cells, CCR5 expression by donor CD4+ and CD8+ T cells in recipients

given IL-17-/- donor cells increased about 2-fold (P<0.05, Fig. 3C); the liver tissue

expression of CCL3(MIP-1α) and CCL4(MIP-1β) in those recipients also increased about

2-fold (P<0.05, Fig 3D), although no significant difference was found in CCL5 (RANTES)

expression (Fig 3D). These results indicate that enhanced Th1 response of donor T

cells in recipients given IL-17-/- donor cells results in upregulation of chemokine

receptors on donor T cells and increased chemokine expression by GVHD target tissues,

which leads to more severe donor T cell infiltration in GVHD target tissues.

Neutralizing IFN-γ reversed exacerbated acute GVHD in recipients given IL-17-/-

donor cells.

To further test whether augmented donor Th1 differentiation and IFN-γ production in

recipients given IL-17-/- donor cells was responsible for the exacerbated acute GVHD,

anti-IFN-γ mAb was used to neutralize IFN-γ in the recipients given IL-17-/- donor cells,




13

as described previously 9. The control recipients were treated with rat IgG. We

observed that anti-IFN-γ treatment markedly reduced clinical signs of acute GVHD early

after HCT, and none of the recipients developed diarrhea. Anti-IFN-γ treatment also

significantly increased body weight and prolonged survival of the recipients as compared

to control recipients (P<0.01, Fig. 4A and B). In addition, anti-IFN-γ treatment reduced

serum levels of IFN-γ by 20 fold and TNF-α by 3 fold (P<0.01, Fig. 4C) and reduced

donor T cell infiltration in liver tissues by about 2 fold (P<0.05, Fig. 4D). The reduced

infiltration after anti-IFN-γ treatment was associated with significantly reduced

expression of CCR5 by donor T cells and reduced expression of chemokine CCL3,

CCL4 and CCL5 by liver tissues (P<0.05, Fig. 4E and F). These results indicate that

augmented IFN-γ production plays an important role in the exacerbation of acute GVHD

mediated by IL-17-/- donor T cells.

Administration of IL-17 early after HCT inhibited Th1 differentiation and

ameliorated acute GVHD in recipients given IL-17-/- donor cells

To directly test whether IL-17 downregulates acute GVHD, recipients given IL-17-/- donor

cells were i.p. injected with recombinant IL-17 at a dose of 0.3μg/mouse or PBS on days

0, 3, and 7 after HCT. We found that IL-17 treatment ameliorated clinical signs of

GVHD such as diarrhea, significantly increased body weight 10-20 days after HCT

(P<0.01, Fig. 5A), and prolonged survival (P<0.01, Fig. 5B); IL-17 treatment also

reduced GVHD target tissue infiltration and histopathology scores (P<0.05, Fig. 5C and

D) and significantly reduced the percentage of IFN-γ-secreting CD4+ and CD8+ T cells in

host MLN, spleen, and liver tissues (Fig. 5 E). It is noteworthy that, in contrast to IL-17

treatment of recipients given IL-17-/- donor cells, this low-dose IL-17 treatment of

recipients given WT donor cells showed no significant impact on GVHD severity (data

not shown). These results indicate that administration of a low dose of IL-17 early after




14

HCT to recipients given IL-17-/- donor cells inhibits donor Th1 cell differentiation and

ameliorate acute GVHD. This is consistent with our observation that the presence of a

small percentage of IL-17-secreting CD4+ and CD8+ donor T cells in recipients given WT

donor cells was associated with reduced GVHD as compared to recipients given IL-17-/-

donor cells (Fig. 1).

IL-17 inhibition of Th1 cell differentiation may be not through direct interaction

with CD4+ T cells, but via its influence on host DCs.

Since we observed that administration of low doses of IL-17 inhibited Th1 differentiation

and ameliorated acute GVHD (Fig. 5), we next explored the target cells of IL-17

regulation. It was reported that activated CD4+ T cells expressed IL-17 receptor 49, thus

we first tested whether IL-17 could inhibit Th1 differentiation via direct interaction with

CD4+ T cells. Accordingly, CD4+ T cells were induced to differentiate into IFN-γ-

secreting Th1 cells via plate-bound anti-CD3/CD28 stimulation and IL-12 in culture

medium, as described previously26. We found that, a similar percentage of IFN-γ+ cells

were present among WT CD4+ T cells and IL-17-/- CD4+ T cells, and the addition of IL-17

to the culture did not lead to significant changes in the percentage of IFN-γ+ cells (Fig.

6A and B). Furthermore, the IFN-γ concentration in culture supernatants of the three

groups was similar (Fig. 6C). These results are consistent with a previous report and

indicate that IL-17 may not directly inhibit Th1 differentiation50.

In contrast, when CD4+ T cells were stimulated with enriched host DCs, IL-17-/- CD4+ T

cells had approximately a 2-fold higher percentage of IFN-γ+ cells as compared to WT

CD4+ T cells (P<0.01), and adding back of IL-17 to the culture reversed the

augmentation (Fig. 6D and E). The same difference was observed with the IFN-γ

concentration in the culture supernatants of the three groups (P<0.01, Fig. 6F). In order




15

to exclude the possible influence of memory CD4+ T cells, CD44loCD4+ naïve T cells

were sorted (as described in supplemental Fig. 2) and used to replace the total CD4+ T

cells in the culture. We found that the percentage of IFN-γ+ cells and the concentration

of IFN-γ in supernatant in the culture of IL-17-/- CD4+ T cells was still significantly higher

than that in the culture of WT CD4+ T cells (P<0.05, Fig. 6G-I). In addition, we found that,

after neutralization of IL-12, the concentration of IFN-γ in the culture of WT or IL-17-/-

naïve CD4+ T cells become similar (Fig. 6J). Furthermore, although IL-17 inhibited IFN-γ

production of IL-17-/- CD4+ T cells (P<0.05), Fig 6K), addition of mouse recombinant IL-

12 completely reverse the inhibition by IL-17, and markedly increased the IFN-γ

production (P<0.01). These results indicate that IL-17 regulation of Th1 differentiation

may be through its influence on host DCs early after HCT, and the effect is IL-12

dependent.




16

Discussion

We have demonstrated that IL-17-/- donor T cells induced exacerbated acute GVHD,

which was associated with augmented Th1 differentiation and IFN-γ production of donor

T cells, and that the enhanced Th1 differentiation resulted from a lack of IL-17-mediated

downregulation of host DCs.

First, the enhanced Th1 differentiation and IFN-γ production play a critical role in the

augmentation of acute GVHD by IL-17-/- donor T cells. Acute GVHD is initiated by the

interactions between host APCs (especially DCs) and naïve alloreactive donor T cells 3,4.

The subsequent Th1 differentiation leads to the generation of cytotoxic T cells and large

amounts of inflammatory cytokines that damage host tissues1. Although the role of IFN-

γ in mediating acute GVHD is controversial, augmented Th1 differentiation and IFN-γ

production was clearly associated with exacerbated acute GVHD 51,52. In the current

study, we observed that, compared to WT donor T cells, IL-17-/- donor T cells induced

more severe clinical signs of acute GVHD and earlier death of the recipients. The

exacerbated GVHD was associated with augmented Th1 differentiation and IFN-γ

production, which was manifested by elevated serum levels of IFN-γ and TNF-α,

increased IFN-γ-secreting T cells in lymphoid tissues and GVHD target tissues, and

upregulation of proinflammatory chemokines in GVHD target tissues and chemokine

receptors on donor T cells.

IFN-γ was reported to play an important role in the upregulation of proinflammatory

cytokines, chemokines, and chemokine receptors that mediate donor T cell migration to

inflammatory GVHD target tissues53,54. We observed that neutralizing IFN-γ in recipients

given IL-17-/- donor cells markedly reduced serum levels of TNF-α, donor T cell

expression of chemokine receptors such as CCR5, GVHD target tissue expression of




17

chemokines such as CCL3 and CCL4, and infiltration in GVHD target tissues, resulting

in markedly reduced GVHD severity. Therefore, augmented Th1 differentiation and IFN-

γ production predominantly contribute to the exacerbation of acute GVHD in recipients

given IL-17-/- donor cells. However, we should point out that neutralizing IFN-γ did not

completely prevent acute GVHD in recipients given IL-17-/- donor cells. This could be

due to the incomplete neutralization of IFN-γ by anti-IFN-γ mAb. T cells from IFN-γ-/-IL-

17-/- donor will be used to address this question in the future studies.

Second, the augmented Th1 differentiation was due to the lack of negative feedback

mediated by Th17. We observed that administration of a low dose of IL-17 to recipients

given IL-17-/- donor cells markedly reduced IFN-γ-producing T cells in host lymphoid and

GVHD target tissues, donor T cell expression of inflammatory chemokine receptors, and

GVHD target tissue expression of inflammatory chemokines, resulting in significantly

ameliorated acute GVHD. Therefore, donor T cell deficiency in IL-17 leads to

augmentation of Th1 differentiation and exacerbation of acute GVHD.

Third, the negative regulation of Th1 differentiation by Th17 may not be through direct

impact of IL-17 on donor CD4+ T cells but via IL-17 influence of host DCs. Host DCs

were shown to initiate the activation and differentiation of alloreactive donor T cells after

HCT3-5, and cytokines from DCs dictate T cell differentiation during T-DC interaction 55.

IL-12 induces Th1; IL-4 induces Th2; and TGF-β and IL-6 induce Th17 12,55. We

observed that WT and IL-17-/- donor CD4+ T cells showed similar levels of differentiation

into IFN-γ-secreting Th1 cells in a culture with plate-bound anti-CD3/CD28 and IL-12,

and addition of IL-17 to the culture had no impact on the Th1 differentiation. This is

consistent with a previous report 50. In contrast, when stimulated with host DCs without

exogenous IL-12, IL-17-/- donor CD4+ T cells showed markedly augmented differentiation




18

into Th1 cells compared to WT CD4+ T cells, and adding back of IL-17 or addition of

neutralizing anti-IL-12 to the culture of IL-17-/- donor CD4+ T cells inhibited the

augmentation. These results indicate that, during the initial phase of donor T cell

activation and differentiation, donor Th17 may influence donor Th1 differentiation

through IL-17 influence on host DCs. However, it is not yet clear how donor Th17 cells

influence host DCs.

A reciprocal regulation among Th1 and Th17 has been proposed with autoimmune

disease models 56. It was shown that IFN-γ inhibited the generation of Th1757, and IL-23

downregulated IL-12 by inhibition of IL-12 p35 and p40 expression58, but it is unknown

whether IL-17 can directly downregulate DC secretion of IL-12. It is possible that IL-17

may decrease IL-12 secretion by direct interaction with DCs, since DCs expressed IL-17

receptors 49. Consistently, in acute GVHD, we observed that augmentation of donor Th1

differentiation resulted from loss of IL-17 was IL-12 dependent. Therefore, we also

hypothesize that there is a reciprocal regulation of donor Th1 and Th17 in allogeneic

recipients. When donor T cells interact with activated host APCs, donor T cells

simultaneously differentiate into Th1 and Th17 cells, but Th1 is dominant. This is

supported by our observation that there were15-fold higher percentage of IFN-γ-

secreting donor T cells than IL-17-secreting ones in the liver of recipients given WT

donor T cells early after HCT (Fig. 1 and Fig. 2). IFN-γ from Th1 cells can downregulate

Th17 and IL-17 from Th17 cells can downregulate Th1. Loss of IL-17 leads to

augmented Th1 differentiation and exacerbated GVHD as described in the current report.

Loss of IFN-γ may lead to augmented Th17 differentiation and exacerbated GVHD

(Supplemental data Fig. 3). Therefore, we theorize that both Th1 and Th17 can mediate

acute GVHD, but they reciprocally regulate each other. We are aware that exacerbation

of acute GVHD by IFN-γ-/- donor T cells has been found to be associated with reduced




19

apoptosis of alloreactive donor T cells 59 and augmented idiopathic pneumonia

syndrome 60. Therefore, the role of augmented Th17 differentiation in the GVHD

pathogenesis in the recipients given IFN-γ-/- donor T cells needs to be further

investigated. In addition, the interaction between Th17 and Th2 in GVHD recipients

needs to be investigated also.

In conclusion, this is the first demonstration that absence of Th17 or IL-17 leads to

augmented Th1 differentiation and exacerbated GVHD. This is of clinical interest,

because our studies indicate that treatment neutralizing proinflammatory cytokine IL-17

may lead to exacerbation of acute GVHD as well as other inflammatory autoimmune

diseases.




20

Acknowledgements

The authors declare no competing financial conflict of interest. This research was

supported by a NIH R01-AI66008 (D.Z.). We gratefully thank Dr. Yoichiro Iwakura in

Tokyo University for his kindly providing IL-17A deficient C57BL/6 mice. We thank

James Young for critical reading of the manuscript, Lucy Brown and her staff at COH

Flow Cytometry Facility, and Sofia Loera and her staff at COH Anatomic Pathology

Laboratory for their excellent technical assistance, and thank Dr. Richard Ermel and his

staff at COH Research Animal Facility for providing excellent animal care.

Contribution

T. Yi designed and performed research, analyzed data and wrote the manuscript; D.

Zhao performed research, reviewed histology scores, C. Lin, C. Zhang, Y. Chen, and I.

Todorov performed research; T. LeBon, F. Kandeel, and S. Forman reviewed

manuscript; D. Zeng designed research, interpreted data, and wrote the manuscript.




21

Reference:

1. Ferrara J, Antin.J. The Pathophysiology of Graft-vs.-Host Disease. In: Blume KG, Forman, S. J., and Appelbaum, F. R., ed. Thomas` Hematopoietic cell transplantation. Malden, MA: Blackwell Publishing Ltd; 2004:353-368. 2. Chakraverty R, Sykes M. The role of antigen-presenting cells in triggering graft-versus-host disease and graft-versus-leukemia. Blood. 2007;110:9-17. 3. Teshima T, Ordemann R, Reddy P, et al. Acute graft-versus-host disease does not require alloantigen expression on host epithelium. Nat Med. 2002;8:575-581. 4. Shlomchik WD, Couzens MS, Tang CB, et al. Prevention of graft versus host disease by inactivation of host antigen-presenting cells. Science. 1999;285:412-415. 5. Duffner UA, Maeda Y, Cooke KR, et al. Host dendritic cells alone are sufficient to initiate acute graft-versus-host disease. J Immunol. 2004;172:7393-7398. 6. Blazar BR, Korngold R, Vallera DA. Recent advances in graft-versus-host disease (GVHD) prevention. Immunol Rev. 1997;157:79-109. 7. Fowler DH, Kurasawa K, Smith R, Eckhaus MA, Gress RE. Donor CD4-enriched cells of Th2 cytokine phenotype regulate graft-versus-host disease without impairing allogeneic engraftment in sublethally irradiated mice. Blood. 1994;84:3540-3549. 8. Pan L, Delmonte J, Jr., Jalonen CK, Ferrara JL. Pretreatment of donor mice with granulocyte colony-stimulating factor polarizes donor T lymphocytes toward type-2 cytokine production and reduces severity of experimental graft-versus-host disease. Blood. 1995;86:4422-4429. 9. Murphy WJ, Welniak LA, Taub DD, et al. Differential effects of the absence of interferon-gamma and IL-4 in acute graft-versus-host disease after allogeneic bone marrow transplantation in mice. J Clin Invest. 1998;102:1742-1748. 10. Yang YG, Dey BR, Sergio JJ, Pearson DA, Sykes M. Donor-derived interferon gamma is required for inhibition of acute graft-versus-host disease by interleukin 12. J Clin Invest. 1998;102:2126-2135. 11. Nikolic B, Lee S, Bronson RT, Grusby MJ, Sykes M. Th1 and Th2 mediate acute graft-versus-host disease, each with distinct end-organ targets. J Clin Invest. 2000;105:1289-1298. 12. Weaver CT, Hatton RD, Mangan PR, Harrington LE. IL-17 family cytokines and the expanding diversity of effector T cell lineages. Annu Rev Immunol. 2007;25:821-852. 13. Bettelli E, Carrier Y, Gao W, et al. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature. 2006;441:235-238. 14. Mangan PR, Harrington LE, O'Quinn DB, et al. Transforming growth factor-beta induces development of the T(H)17 lineage. Nature. 2006;441:231-234. 15. Veldhoen M, Hocking RJ, Atkins CJ, Locksley RM, Stockinger B. TGFbeta in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells. Immunity. 2006;24:179-189. 16. Kastelein RA, Hunter CA, Cua DJ. Discovery and biology of IL-23 and IL-27: related but functionally distinct regulators of inflammation. Annu Rev Immunol. 2007;25:221-242. 17. Langrish CL, Chen Y, Blumenschein WM, et al. IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J Exp Med. 2005;201:233-240.




22

18. Aggarwal S, Ghilardi N, Xie MH, de Sauvage FJ, Gurney AL. Interleukin-23 promotes a distinct CD4 T cell activation state characterized by the production of interleukin-17. J Biol Chem. 2003;278:1910-1914. 19. Ivanov, II, McKenzie BS, Zhou L, et al. The orphan nuclear receptor RORgammat directs the differentiation program of proinflammatory IL-17+ T helper cells. Cell. 2006;126:1121-1133. 20. Liu SJ, Tsai JP, Shen CR, et al. Induction of a distinct CD8 Tnc17 subset by transforming growth factor-beta and interleukin-6. J Leukoc Biol. 2007;82:354-360. 21. Park H, Li Z, Yang XO, et al. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat Immunol. 2005;6:1133-1141. 22. Ye P, Rodriguez FH, Kanaly S, et al. Requirement of interleukin 17 receptor signaling for lung CXC chemokine and granulocyte colony-stimulating factor expression, neutrophil recruitment, and host defense. J Exp Med. 2001;194:519-527. 23. Huang W, Na L, Fidel PL, Schwarzenberger P. Requirement of interleukin-17A for systemic anti-Candida albicans host defense in mice. J Infect Dis. 2004;190:624-631. 24. Hirota K, Hashimoto M, Yoshitomi H, et al. T cell self-reactivity forms a cytokine milieu for spontaneous development of IL-17+ Th cells that cause autoimmune arthritis. J Exp Med. 2007;204:41-47. 25. Hue S, Ahern P, Buonocore S, et al. Interleukin-23 drives innate and T cell-mediated intestinal inflammation. J Exp Med. 2006;203:2473-2483. 26. Komiyama Y, Nakae S, Matsuki T, et al. IL-17 plays an important role in the development of experimental autoimmune encephalomyelitis. J Immunol. 2006;177:566-573. 27. Chen Y, Langrish CL, McKenzie B, et al. Anti-IL-23 therapy inhibits multiple inflammatory pathways and ameliorates autoimmune encephalomyelitis. J Clin Invest. 2006;116:1317-1326. 28. Tsaknaridis L, Spencer L, Culbertson N, et al. Functional assay for human CD4+CD25+ Treg cells reveals an age-dependent loss of suppressive activity. J Neurosci Res. 2003;74:296-308. 29. Andoh A, Fujino S, Bamba S, et al. IL-17 selectively down-regulates TNF-alpha-induced RANTES gene expression in human colonic subepithelial myofibroblasts. J Immunol. 2002;169:1683-1687. 30. Kanda N, Koike S, Watanabe S. IL-17 suppresses TNF-alpha-induced CCL27 production through induction of COX-2 in human keratinocytes. J Allergy Clin Immunol. 2005;116:1144-1150. 31. Schnyder B, Schnyder-Candrian S, Pansky A, et al. IL-17 reduces TNF-induced Rantes and VCAM-1 expression. Cytokine. 2005;31:191-202. 32. Ogawa A, Andoh A, Araki Y, Bamba T, Fujiyama Y. Neutralization of interleukin-17 aggravates dextran sulfate sodium-induced colitis in mice. Clin Immunol. 2004;110:55-62. 33. Schnyder-Candrian S, Togbe D, Couillin I, et al. Interleukin-17 is a negative regulator of established allergic asthma. J Exp Med. 2006;203:2715-2725. 34. Liang Y, Huang T, Zhang C, et al. Donor CD8+ T cells facilitate induction of chimerism and tolerance without GVHD in autoimmune NOD mice conditioned with anti-CD3 mAb. Blood. 2005;105:2180-2188.




23

35. Zhang C, Lou J, Li N, et al. Donor CD8+ T cells mediate graft-versus-leukemia activity without clinical signs of graft-versus-host disease in recipients conditioned with anti-CD3 monoclonal antibody. J Immunol. 2007;178:838-850. 36. Cooke KR, Kobzik L, Martin TR, et al. An experimental model of idiopathic pneumonia syndrome after bone marrow transplantation: I. The roles of minor H antigens and endotoxin. Blood. 1996;88:3230-3239. 37. Mapara MY, Leng C, Kim YM, et al. Expression of chemokines in GVHD target organs is influenced by conditioning and genetic factors and amplified by GVHR. Biol Blood Marrow Transplant. 2006;12:623-634. 38. Zhang C, Todorov I, Zhang Z, et al. Donor CD4+ T and B cells in transplants induce chronic graft-versus-host disease with autoimmune manifestations. Blood. 2006;107:2993-3001. 39. Zhang C, Todorov I, Lin CL, et al. Elimination of insulitis and augmentation of islet beta cell regeneration via induction of chimerism in overtly diabetic NOD mice. Proc Natl Acad Sci U S A. 2007;104:2337-2342. 40. Yang F, Huang X, Yi T, Yen Y, Moore DD, Huang W. Spontaneous development of liver tumors in the absence of the bile acid receptor farnesoid X receptor. Cancer Res. 2007;67:863-867. 41. Kaplan DH, Anderson BE, McNiff JM, Jain D, Shlomchik MJ, Shlomchik WD. Target antigens determine graft-versus-host disease phenotype. J Immunol. 2004;173:5467-5475. 42. Nakae S, Komiyama Y, Nambu A, et al. Antigen-specific T cell sensitization is impaired in IL-17-deficient mice, causing suppression of allergic cellular and humoral responses. Immunity. 2002;17:375-387. 43. Borsotti C, Franklin AR, Lu SX, et al. Absence of donor T-cell-derived soluble TNF decreases graft-versus-host disease without impairing graft-versus-tumor activity. Blood. 2007;110:783-786. 44. Zella D, Barabitskaja O, Burns JM, et al. Interferon-gamma increases expression of chemokine receptors CCR1, CCR3, and CCR5, but not CXCR4 in monocytoid U937 cells. Blood. 1998;91:4444-4450. 45. Kim JJ, Nottingham LK, Sin JI, et al. CD8 positive T cells influence antigen-specific immune responses through the expression of chemokines. J Clin Invest. 1998;102:1112-1124. 46. Wysocki CA, Jiang Q, Panoskaltsis-Mortari A, et al. Critical role for CCR5 in the function of donor CD4+CD25+ regulatory T cells during acute graft-versus-host disease. Blood. 2005;106:3300-3307. 47. Chakraverty R, Cote D, Buchli J, et al. An inflammatory checkpoint regulates recruitment of graft-versus-host reactive T cells to peripheral tissues. J Exp Med. 2006;203:2021-2031. 48. Murai M, Yoneyama H, Harada A, et al. Active participation of CCR5(+)CD8(+) T lymphocytes in the pathogenesis of liver injury in graft-versus-host disease. J Clin Invest. 1999;104:49-57. 49. Antonysamy MA, Fanslow WC, Fu F, et al. Evidence for a role of IL-17 in organ allograft rejection: IL-17 promotes the functional differentiation of dendritic cell progenitors. J Immunol. 1999;162:577-584.




24

50. Nakae S, Iwakura Y, Suto H, Galli SJ. Phenotypic differences between Th1 and Th17 cells and negative regulation of Th1 cell differentiation by IL-17. J Leukoc Biol. 2007;81:1258-1268. 51. Mowat AM. Antibodies to IFN-gamma prevent immunologically mediated intestinal damage in murine graft-versus-host reaction. Immunology. 1989;68:18-23. 52. Blazar BR, Carreno BM, Panoskaltsis-Mortari A, et al. Blockade of programmed death-1 engagement accelerates graft-versus-host disease lethality by an IFN-gamma-dependent mechanism. J Immunol. 2003;171:1272-1277. 53. Olson TS, Ley K. Chemokines and chemokine receptors in leukocyte trafficking. Am J Physiol Regul Integr Comp Physiol. 2002;283:R7-28. 54. Wysocki CA, Panoskaltsis-Mortari A, Blazar BR, Serody JS. Leukocyte migration and graft-versus-host disease. Blood. 2005;105:4191-4199. 55. Murphy KM, Reiner SL. The lineage decisions of helper T cells. Nat Rev Immunol. 2002;2:933-944. 56. Bettelli E, Oukka M, Kuchroo VK. T(H)-17 cells in the circle of immunity and autoimmunity. Nat Immunol. 2007;8:345-350. 57. Harrington LE, Hatton RD, Mangan PR, et al. Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat Immunol. 2005;6:1123-1132. 58. Becker C, Dornhoff H, Neufert C, et al. Cutting edge: IL-23 cross-regulates IL-12 production in T cell-dependent experimental colitis. J Immunol. 2006;177:2760-2764. 59. Asavaroengchai W, Wang H, Wang S, et al. An essential role for IFN-gamma in regulation of alloreactive CD8 T cells following allogeneic hematopoietic cell transplantation. Biol Blood Marrow Transplant. 2007;13:46-55. 60. Burman AC, Banovic T, Kuns RD, et al. IFNgamma differentially controls the development of idiopathic pneumonia syndrome and GVHD of the gastrointestinal tract. Blood. 2007;110:1064-1072.




25

Figure Legends Fig. 1. IL-17-/- donor cells induced exacerbated acute GVHD. A, Sublethally

irradiated BALB/c recipients were transplanted with graded numbers (1.25~2.5x106)

spleen cells and 2.5x106 TCD-BM cells from wild-type (WT) or IL-17-/- C57BL/6 donors.

The recipients were checked for clinical signs of GVHD and body weight every 5 days

and monitored for survival daily. Body weight change and survival curves are shown.

There were 12 mice in each group, and three replicated experiments were combined,

except the group given TCD-BM alone had 4 recipients. B and C, histopathology of liver,

gut, and lung of recipients given TCD-BM alone or TCD-BM and spleen cells (2.5x106)

from WT or IL-17-/- donor 13 days after HCT. One representative histopathology and

Mean±SE of histological score of 6 examined recipients in each group are shown. D

and E, Sublethally irradiated BALB/c recipients were transplanted with sorted T cells

(0.5x106) from WT or IL-17-/- donors. Clinical score and survival curves are shown.

There were 8 recipients in each group. Two replicated experiments were combined. F,

Liver mononuclear cells of the recipients were stained for H-2b (donor marker), CD4,

CD8, and intracellular IL-17, 10 days after HCT. Gated H-2b+ cells are shown in IL-17

versus CD4 or CD8. The percentage of IL-17 CD4+ or CD8+ T cells is shown beside the

gating boxes. The Mean±SE of the IL-17+CD4+ or CD8+ T cells in the liver of recipients

given WT donor T cells are 0.69±0.02 or 0.77±0.08. IL-17+ T cells in the spleen of the

recipients given IL-17-/- donor T cells were not detectable (<0.05%).

Fig. 2. Augmented Th1 differentiation in recipients given IL-17-/- donor cells. A

and B, Serum levels of IFN-γ and TNF-α of recipients given WT or IL-17-/- donor spleen

cells 5 days after HCT. C, Mesenteric lymph nodes (MLN) and spleen cells of the

recipients given WT or IL-17-/- donor cells were stained for H-2b, CD4, CD8, and

intracellular IFN-γ, 13 days after HCT. Gated H-2b+ cells are shown in IFN-γ versus




26

CD4 or CD8. The percentage of IFN-γ+ cells is shown beside the gating boxes. One

representative of 4 recipients in each group is shown. D and E, Show the Mean±SE of

the percentage of IFN-γ+ CD4+ or CD8+ donor T cells in MLN and spleen.

Fig. 3. Increased infiltration of Th1 cells in liver of recipients given IL-17-/- donor

cells. A, Liver mononuclear cells from recipients given WT or IL-17-/- donor cells were

stained for H-2b, CD4, CD8, and intracellular IFN-γ, 13 days after HCT. Gated H-2b+

cells are shown in IFN-γ versus CD4 or CD8. The percentage of IFN-γ+CD4+ or CD8+ T

cells is shown beside the gating boxes. One representative of 4 recipients in each

group is shown. B, The Mean±SE of the percentage of donor IFN-γ+ CD4+ or CD8+ T

cells of the 4 recipients, and the Mean±SE of the yield of IFN-γ+ CD4+ or CD8+ T cells of

the four recipients. C, MLN cells of the recipients were stained for H-2b, CD4, CD8, and

CCR5. Histogram of CCR5 (solid line) versus isotype control (shaded area) of H-2b+

CD4+ or CD8+ cells are shown. One representative of 4 recipients is shown. The

Mean±SE of the percentage of CCR5+ cells among CD4+ or CD8+ donor T cells are

43.1±3.9 % or 10.8±2.0% in recipients given WT donor cells and 67.6±2.8% or

23.3±1.6% in recipients given IL-17-/- donor cells. D, The Mean±SE of chemokine

expression levels by liver of the recipients given WT or IL-17-/- donor cells 5 days after

HCT. Relative gene expression levels were normalized within each sample to the house

keeping gene GAPDH and were presented relative to the expression in liver tissue of

syngeneic HCT recipients. There were 4 mice in each group.

Fig. 4. Neutralizing IFN-γ in recipients given IL-17-/- donor cells ameliorated acute

GVHD. A and B, BALB/c recipients given spleen cells (2.5x106) and TCD-BM cells

(2.5x106) from IL-17-/- donors were I.P. injected with anti-IFN-γ mAb or control rat IgG

(0.5mg/mouse) on days 0, 5, 10, and 15 after HCT. Bodyweight change and survival




27

curves are shown. There were 8 mice in each group. Two replicated experiments were

combined. C, Mean±SE of serum levels of IFN-γ and TNF-α of the above recipients 5

days after HCT. D, Mean±SE of donor T cell yield in liver of recipients treated with anti-

IFN-γ or rat IgG 5 days after HCT. There were 4 recipients in each group. E, MLN cells

of the recipients treated with anti-IFN-γ or rat IgG were stained for H-2b (donor marker),

CD4, CD8 and CCR5 or isotype control 5 days after HCT. Gated on H-2b+CD4+or CD8+

T cells, a histogram of anti-CCR5 (sold line) and isotype control (shaded area) is shown.

One representative of 4 recipients in each group is shown. The Mean±SE of the

CCR5+CD4+ T in recipients treated with anti-IFN-γ or rat IgG are 15.4±1.5% or 32.3±1.4.

The Mean±SE of the CCR5+CD8+ T in recipients treated with anti-IFN-γ or rat IgG are

28.4±1.1% or 65.3±5.2%. F. The Mean±SE of chemokine expression levels in liver of

the recipients treated with anti-IFN-γ or rat IgG 5 days after HCT. Relative gene

expression levels were normalized within each sample to the house keeping gene

GAPDH and were presented relative to the expression in synergic HCT recipients.

There were 4 mice in each group.

Fig. 5. Adding back of IL-17 to recipients given IL-17-/- donor cells ameliorated

acute GVHD. A and B, recipients given spleen (2.5x106) and TCD-BM cells (2.5x106)

from IL-17-/- donor cells were injected I. P. with recombinant IL-17 (0.3μg/mouse) on

days 0, 3, 7 after HCT. Body weight change and survival curves are shown. There

were 12 recipients in each group. Three replicated experiments were combined. C

and D, histopathology of liver, gut, and lung of recipients treated with PBS or IL-17 13

days after HCT, arrow points to the necrosis area in liver and infiltrated epithelial and

lamina propria areas in gut of recipients given PBS treatment only. One representative

of histopathology and Mean±SE of histology score of 6 examined recipients in each

group is shown. E, Mean±SE of the percentage of donor-type IFN-γ+CD4+ or CD8+ T




28

cells in MLN, spleen, and liver of recipients treated with IL-17 or PBS 13 days after HCT.

There were 4 recipients in each group.

Fig. 6. IL-17 downregulation of Th1 differentiation required host DCs. A –C,

Sorted CD4+ T cells (2x105) from WT or IL-17-/- donors were stimulated with plate-bound

anti-CD3 and anti-CD28 as well as IL-12 (10ng/ml) in culture for 72 hours. The

percentage of IFN-γ+ or IL-17+ cells among cultured donor CD4+ T cells were determined

by intracellular staining, and the IFN-γ concentration in culture supernatant was

measured by ELISA. One representative of 4 replicated intracellular staining

experiments, the Mean±SE of the percentage of IFN-γ+ cells among donor CD4+ T cells,

and the Mean±SE of the IFN-γ concentration in the culture supernatants are shown. D-

F, Sorted donor CD4+ T cells (2x105) from WT or IL-17-/- donors were co-cultured with

enriched DCs from irradiated host BALB/c mice for 96 hours. The percentage of IFN-γ+

or IL-17+ cells among cultured donor CD4+ T cells were determined by intracellular

staining, and the IFN-γ concentration in culture supernatant was measured by ELISA.

One representative of 4 replicated intracellular staining experiment, the Mean±SE of the

percentage of IFN-γ+ cells among donor CD4+ T cells, and the Mean±SE of the IFN-γ

concentration in the culture supernatants are shown. G-I, sorted naïve CD44loCD4+ T

cells from WT or IL-17-/- donors were co-cultured with enriched DCs from irradiated host

BALB/c mice for 5 days. The percentage of IFN-γ+ or IL-17+ cells among cultured donor

CD4+ T cells were determined by intracellular staining, and the IFN-γ concentration in

culture supernatant was measured by ELISA. Dead cells were excluded by Fixable

Aqua Dead Cell Stain Kit. One representative of 3 replicated experiments, the Mean±SE

of the percentage of IFN-γ+ cells among donor CD4+ T cells, and the Mean±SE of the

IFN-γ concentration in the culture supernatants of triplicates are shown. J, IFN-γ

concentration in the culture supernatants of naïve donor WT and IL-17-/- CD4+ T cells




29

and host DCs with or without the presence of neutralizing anti-IL-12 Antibody. K, IFN-γ

concentration in the culture supernatants of IL-17-/- donor CD4+ T cells and host DCs

with or without addition of IL-17 or IL-17 plus IL-12.




Figure 1




Figure 2




Figure 3




Figure 4




Figure 5




Figure 6




Absence of donor Th17 leads to augmented Th1 differentiation and exacerbated acute graft-versus-host...

Documents

Transcript of Absence of donor Th17 leads to augmented Th1 differentiation and exacerbated acute graft-versus-host...