doi:10.1182/blood-2007-05-090514Prepublished online September 12, 2007;2007 110: 4445-4454   

 Sreekumar, Rong Zhou, Alexey Nesvizhskii, Arul Chinnaiyan, Jay L. Hess and Robert K. SlanyDorothee Mueller, Christian Bach, Deniz Zeisig, Maria-Paz Garcia-Cuellar, Sara Monroe, Arun chromatin modificationA role for the MLL fusion partner ENL in transcriptional elongation and

http://bloodjournal.hematologylibrary.org/content/110/13/4445.full.htmlUpdated information and services can be found at:

(795 articles)Oncogenes and Tumor Suppressors   � (4217 articles)Neoplasia   �

(1086 articles)Gene Expression   �Articles on similar topics can be found in the following Blood collections

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#repub_requestsInformation about reproducing this article in parts or in its entirety may be found online at:

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#reprintsInformation about ordering reprints may be found online at:

http://bloodjournal.hematologylibrary.org/site/subscriptions/index.xhtmlInformation about subscriptions and ASH membership may be found online at:

Copyright 2011 by The American Society of Hematology; all rights reserved.Washington DC 20036.by the American Society of Hematology, 2021 L St, NW, Suite 900, Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly    

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

NEOPLASIA

A role for the MLL fusion partner ENL in transcriptional elongation andchromatin modificationDorothee Mueller,1 Christian Bach,1 Deniz Zeisig,1 Maria-Paz Garcia-Cuellar,1,3 Sara Monroe,2 Arun Sreekumar,2

Rong Zhou,2 Alexey Nesvizhskii,2 Arul Chinnaiyan,2 Jay L. Hess,2 and Robert K. Slany1

1Department of Genetics, University Erlangen, Erlangen, Germany; 2Department of Pathology, University of Michigan Medical School, Ann Arbor; and3Department of Hematology and Oncology, Dr. von Haunersches Kinderspital, Munich, Germany

Chimeric proteins joining the histone meth-yltransferase MLL with various fusion part-ners trigger distinctive lymphoid and my-eloid leukemias. Here, we immunopurifiedproteins associated with ENL, a protein com-monly fused to MLL. Identification of theseENL-associated proteins (EAPs) by massspectrometry revealed enzymes with aknown role in transcriptional elongation(RNA polymerase II C-terminal domain ki-nase [RNAPolII CTD] positive transcriptionelongation factor b [pTEFb]), and in chroma-tin modification (histone-H3 methyltrans-

ferase DOT1L) as well as other frequent MLLpartners (AF4,AF5q31, and LAF4), and poly-comb group members (RING1, CBX8, andBCoR). The composition of EAP was furtherverified by coimmunoprecipitation, 2-hybridanalysis, pull-down, and colocalization ex-periments. Purified EAP showed a histoneH3 lysine 79–specific methylase activity, dis-played a robust RNAPolII CTD kinase func-tion, and counteracted the effect of thepTEFb inhibitor 5,6-dichloro-benzimidazole-riboside. In vivo, an ENL knock-down dimin-ished genome-wide as well as gene-specific

H3K79 dimethylation, reduced global run-onelongation, and inhibited transient transcrip-tional reporter activity. According tostructure-function data, DOT1L recruitmentwas important for transformation by theMLL-ENL fusion derivative. These resultssuggest a function of ENL in histone modifi-cation and transcriptional elongation.(Blood. 2007;110:4445-4454)

© 2007 by The American Society of Hematology

Introduction

Hematopoietic development is controlled by an intricate network offinely tuned transcriptional programs. Consequently, a perturbation ofthe transcription factors involved can block differentiation. This develop-mental roadblock cooperates with mutations in pathways that signalgrowth and/or survival to cause acute leukemias.1 A prime example forsuch a mechanism is mixed lineage leukemia. In this disease, the genefor the histone methyltransferase MLL participates in chromosomaltranslocations that eventually create maturation-blocking and thereforeleukemogenic MLL fusion proteins.2,3 These protein chimeras consist ofN-terminal portions of MLL joined to a variety of mostly unrelatedfusion partners that replace the original MLL C-terminus, including themethyltransferase domain (http://atlasgeneticsoncology.org/Genes/MLL.html). MLL fusion proteins are aberrant transcription factors thatectopically activate genes important for hematopoietic development likethe abdominal-type Hox genes Hoxa7 and Hoxa9 and their dimerizationpartner Meis1.4-7

Despite intensive study, little is known about the biologicalfunction of MLL fusion partners in normal cells, and it is mostlyunclear how these proteins activate the oncogenic potential ofMLL. In the rare cases where MLL is joined to a cytoplasmaticprotein, domains introduced by the partner force a dimerization ofthe fusion that is crucial for oncogenic activity.8,9 The overwhelm-ing majority of leukemias with MLL rearrangement, however,involves nuclear proteins as translocation partners. The dataavailable seem to indicate a role of some nuclear MLL partners intranscriptional control and histone modification. Support for thisspeculation comes from the detection of direct protein-protein

interactions of the homologous MLL fusion partners AF4 andAF5q31 that both bind to ENL and the closely related AF9.10,11

ENL in turn interacts with histone H3.11 In addition, another MLLfusion partner, AF10, recruits the histone H3 lysine 79–specificmethyltransferase DOT1L that introduces a dimethyl mark duringtranscriptional elongation.12 The same modification is also ahallmark of genes activated by MLL-ENL.13 Finally, the proteinsCBX8 (chromobox 8) and BCoR (BCL6 corepressor) that areinvolved in chromatin-dependent gene repression have also beenfound to associate with ENL and AF9.14-16

In order to learn more about the biological function of a classicalMLL fusion partner, we identified proteins associated with the “ElevenNineteen Leukemia” protein (ENL) originally discovered as an MLLfusion partner in the recurrent translocation t(11;19). Here, we describethe purification and analysis of ENL-associated proteins (EAPs) bytandem immunoprecipitation of ENL. This protein assembly containsseveral other MLL fusion partners, positive transcription elongationfactor b (pTEFb), DOT1L, and polycomb group proteins. The composi-tion of EAP suggests that ENL works in a new unit of transcriptionalregulation that coordinates transcriptional elongation with chromatinmodification.

Materials and methods

Plasmids, cells, antibodies, and software

The cDNA for flagENL (GenBank accession no. NM_00593417), MLL-ENL, and mutants thereof were inserted into the retroviral vector

Submitted May 14, 2007; accepted August 29, 2007. Prepublished online asBlood First Edition paper, September 12, 2007; DOI 10.1182/blood-2007-05-090514.

The publication costs of this article were defrayed in part by page charge

payment. Therefore, and solely to indicate this fact, this article is herebymarked ‘‘advertisement’’ in accordance with 18 USC section 1734.

© 2007 by The American Society of Hematology

4445BLOOD, 15 DECEMBER 2007 � VOLUME 110, NUMBER 13

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

pMSCVneo. For production of anti-ENL small inhibitory (si) RNA, anoligonucleotide corresponding to ENL positions 489 to 509 (aattccactctctgc-cttctc) was introduced into the “self-inactivating” retroviral vectorpSIRENretroQ (Clontech, Palo Alto, CA). This construct provides a sourceof small hairpin (sh) RNA for intracellular production of specific siRNA.Derivatives of ENL and mouse Dot1l (a generous gift of B. C. Kone,Houston, TX) for 2-hybrid experiments were cloned either into pGBKT7 asbait construct or pGADT7 for target clones. Fusions with enhanced greenfluorescent protein (EGFP) or red fluorescent protein (RFP) were done inpEGFP and pRedExpress (all vectors from Clontech). The luciferasereporter plasmids have been described.4 Primer sequences for qPCR ofHOXA9 sequences are available on request.

The 293fENL producer cell line was generated from HEK293 cells byamphotropic transduction with pMSCVneo-fENL viruses.

Anti-flag (M2) agarose and anti-flag antibody were from SIGMA(Taufkirchen, Germany). Monoclonal antibodies against ENL (clones3.1, 4.1, and 33.1) were produced in-house. Other antibodies were fromAbCam (Cambridge, United Kingdom), Santa Cruz Biotech (SantaCruz, CA), or AbGent (San Diego, CA). Quantification of Western blotswas done densitometrically with QuantityOne software (BioRad,Munchen, Germany).

Purification of EAP, chromatography, and mass spectrometry

ENL affinity resin was produced by coupling monoclonal anti-ENLantibodies 3.1, 4.1, and 33.1 to a solid support with SEIZE primaryimmunoprecipitation reagents (Pierce, Rockford, IL). Extracts from approxi-mately 5 � 108 cells (293fENL or HEK293) were prepared by lysis withbufferP (300 mM NaCl, 20 mM HEPES [pH 7.5], 0.5 mM EDTA, 0.1%Triton X-100, 0.5 mM sodium vanadate, 2 mM NaF, 2 mM DTT, 0.2 mMPMSF, 20 �g/mL leupeptin, 0.4�g/mL aprotinin, and 40 �g/mL pepstatinA). After preclearing with protein A/G agarose (Santa Cruz Biotech) theextracts were incubated overnight with flagM2 agarose. The anti-flag beadswere washed in bufferP supplemented with 0.25% bovine serum albumin.Immobilized proteins were eluted with 150 �g/mL flag-peptide (SIGMA)followed by a second precipitation with anti-ENL resin, a wash step inbufferP, and elution by low pH (100 mM glycine [pH 2.7]) and neutraliza-tion. Proteins were analyzed by SDS-PAGE and Coomassie and silverstaining (ProteoSilver plus; SIGMA). Nucleases were added at 5 U/mL(benzonase) and 0.5 �g/mL (RNAseA).

Gel filtration was done with primary extracts in bufferP (without TritonX-100) on a calibrated Sephacryl S300 column (GE Healthcare, Munich,Germany).

Silver-stained bands were excised from polyacrylamide gels andproteins in each band were digested with trypsin, and the resulting peptidemixtures were analyzed by reverse-phase liquid chromatography–tandemmass spectrometry (LC-MS/MS) using a Thermo Electron (Waltham, MA)linear ion trap (LTQ) mass spectrometer. Peptides were identified bysearching acquired MS/MS spectra using Mascot18 against the HumanInternational Protein Index (IPI) protein sequence database version 3.16with the following search parameters: monoisotopic precursor ion masswith 3 Da mass tolerance, unconstrained search, and allowing for methio-nine oxidation as a variable modification. Peptide assignments to spectrawere statistically validated using PeptideProphet,19 which computes foreach peptide assignment in the dataset a probability of being correct givenits database search score, the number of tryptic termini and missedcleavages, and other properties. Peptide identifications were assembled intoproteins using the protein inference tool ProteinProphet,20 and the probabili-ties were recomputed at the protein level. All proteins with a probability ofbeing correct greater than 0.9 were retained, which corresponds to the falsediscovery error rate of less than 1% as estimated by ProteinProphet. Inaddition, several proteins with lower initial probability were added to thelist based on the manual validation of the corresponding peptide assign-ments to MS/MS spectra. In order to eliminate nonspecific binding proteins,the analysis of ENL-expressing cells was performed in parallel with control293 cells. Those proteins that were also identified in the control gels weresubtracted to create the final list of proteins that interact with ENL.

Yeast procedures, 2-hybrid system, and GST pull-down

For the yeast 2-hybrid experiments, the baits and target plasmids werecotransfected into the yeast strain AH109 (Clontech) according to themanufacturer’s instructions. GST pull-down was done with eitherpurified GST or GST fused to full-length ENL and 35S-labeled Dot1lproduced by in vitro transcription/translation using TNT reagents fromPromega (Madison, WI).

In vitro methylation assay, kinase assay, and in vitrotranscription

To test for histone methylation activity in immunoprecipitated materialfrom 293fENL or HEK293 cells, EAP-loaded beads were incubated with5 �g core histones (Upstate Biotechnology, Charlottesville, VA) and 1 �L3H-methyl S-adenosylmethionine (3.7 � 1010 Bq/mmol [10 Ci/mmol],stabilized in H2SO4/EtOH; Hartmann Analytik, Braunschweig, Germany)in a total of 40 �L TE plus 1 mM DTT for 1 hour at 30°C. The reactionproducts were separated on 18% SDS-PAGE gels stained with Coomassieblue and treated with EnHance fluorographic solution (GE Healthcare)before exposure. For immunologic detection of in vitro methylatedhistones, the reaction was performed in the presence of 32 �M nonradioac-tive S-adenosylmethionine. After separation and transfer, the modifiedhistones were detected by methylation-specific antibodies in an immuno-blot procedure.

To detect pTEFb kinase activity in EAP, the proteins bound to ENLresin were washed once in 20 mM Tris-acetate (pH 7.9), 10 mMmagnesium-acetate, 50 mM potassium-acetate, and 1 mM DTT. The beadswere incubated with 1 �g recombinant GST-CTD (Calbiochem/Merck,Darmstadt, Germany) and 1 MBq of �32PATP in the same buffer at 30°C for1 hour. Phosphorylated proteins were visualized by SDS gelelectrophoresis,followed by Coomassie staining and autoradiography.

In vitro transcription was done with the HeLa scribe system (Promega)according to the instruction of the manufacturer. Inhibition of CDK9 wasachieved by addition of 50 �M 5,6-dichloro-benzimidazole-riboside (DRB;SIGMA) as a 50-mM stock solution in DMSO. The run-off transcriptionwas directed by a linearized DNA template containing the first 244 bases ofthe mouse Hoxa9 coding sequence under control of the cytomegalovirus(CMV) immediate early promoter.

shRNA-mediated knock-down of ENL

ENL knock-down in HEK293 cells was achieved by serial transfectionwith pSIRENretroQ vectors capable of producing shRNA directedagainst ENL or luciferase as control. Cells were subjected at day 1 andagain at day 4 to standard Ca transfection (20 �g of pSIRENretroQvector per 6 � 106 HEK293 cells) before analysis at day 7. Forsubsequent experiments, equal numbers of living cells as determined bytrypan blue exclusion were applied.

ChIP and nuclear run-on assay

Chromatin immunoprecipitation (ChIP) was performed according to theUpstate Biotechnology technical protocol as available at www.upstate.com.Global elongation rates were measured with nuclear run-on experimentsaccording to Carey and Smale.21 In short, nuclei from 5 � 107 cells wereprepared by NP40 lysis (10 mM Tris/HCl [pH 7.4], 10 mM NaCl, 3 mMMgCl2, and 0.5% NP40) and centrifugation. The nuclei were resuspendedin 50 mM Tris/HCl (pH 8.3), 40% vol/vol glycerol, 5 mM MgCl2, and0.1 mM EDTA. Aliquots (26.5 �L) were mixed with 7 �L 5� run-on buffer(25 mM Tris/HCl [pH 8.0], 12.5 mM MgCl2, 750 mM KCl, and 1.25 mMeach of ATP, GTP, and CTP) and 1.5 �L of �32P-UTP (1.11 � 1014

Bq/mmol [3000 Ci/mmol]). After incubation at 37°C for 15 minutes, RNAwas isolated from the reaction mixtures by RNeasy column purification(Qiagen, Hilden, Germany). Purified RNA was spotted in dilutions ontonitrocellulose membranes and dried, and incorporated radioactivity wasdetermined by PhosphoImager quantification (BioRad). For normalization,18S stable RNA levels in the reaction mixtures were quantified by real-timereverse transcription–polymerase chain reaction (RT-PCR). Primers

4446 MUELLER et al BLOOD, 15 DECEMBER 2007 � VOLUME 110, NUMBER 13

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

used were: 18S reverse, cttccttggatgtggtagccg; and 18S forward,tatcaactttcgatggtagtcgc.

MLL fusion protein transformation assay

The transformation capacity of MLL fusion proteins was determined byserial replating assays as previously reported.22 In this experiment, transfor-mation can be visualized as colony formation after repeated replating insemisolid medium. Replating assays were performed at least 3 times perconstruct.

Results

Purification of EAP

For purification of EAPs, a stable producer cell line was estab-lished. In order to achieve low-level stable expression of flag-tagged ENL, the gene was introduced into HEK293 cells bytransduction with a pMSCV-based retrovirus (pMSCV-fENL).Immunoblotting with anti-flag and anti-ENL antibodies and densi-tometric quantification demonstrated successful expression offENL in 293fENL cells at approximately wild-type levels (Figure1A). In order to verify that ectopic fENL is incorporated into apotential wild-type ENL complex, extracts of 293fENL cells wereanalyzed by gel filtration. Elution fractions were probed for thepresence of flag-tagged proteins and ENL. In these experiments,the elution profile of ENL and fENL was nearly identical, and themajority of ENL/fENL protein was present in fractions correspond-

ing to a relative molecular weight of approximately 400 kDa(Figure 1B). No uncomplexed fENL could be detected. Comparedwith the elution profile of wild-type ENL from untransducedHEK293 cells, the peak of flag-ENL elution was shifted slightlytoward smaller molecular weights (Figure 1B). However, everyelution fraction containing ENL in untransduced cells was alsopositive for flag-ENL in 293fENL cell extracts. This suggested thatat least part of the ectopic fENL was incorporated into theappropriate endogenous complex or complexes.

EAPs were purified by a double immunoprecipitation strat-egy (Figure 2A). Triton/salt extracts from approximately5 � 108 293fENL cells were precipitated with anti-flag agarose.After washing, bound material was selectively eluted with flagpeptide and subjected to a second round of immunoprecipitationwith a mixture of 3 bead-immobilized monoclonal antibodiestargeted against ENL. Beads were washed again and residualmaterial was released by low pH. For controls, the purificationprocedure was performed with extracts from nontransducedHEK293 cells, or mock precipitations were done with 293fENLcells using unliganded agarose. The final purified product wasseparated alongside controls by SDS-PAGE, followed by Coomas-sie and silver staining. This immunopurification reproduciblyyielded a preparation of 9 major proteins detectable by Coomassiedye with approximately twice as many bands discernible aftersilver staining (Figure 2B). An identical pattern of EAPs was alsoobtained in the presence of nucleases (Figure 2C), excluding thepossibility that EAP constituents were inadvertently copurifyingdue to an affinity for nucleic acids present in the cell extracts.

A total of 3 independent EAP preparations and the correspond-ing controls were subjected to mass spectrometry. The silver-stained gels were cut into slices, and proteins in each fragment weredigested by trypsin. The resulting peptide mixtures were analyzedby reverse-phase LC-MS/MS using a linear ion trap mass spectrom-eter. In total, 15 proteins represented by more than 1 peptide couldbe unambiguously identified in the EAP samples (Table 1). Allproteins (AF5q31, AF4, BCoR, and CBX8) that had been previ-ously found in various 2-hybrid screens as interaction partners ofENL or the homologous AF9 were present also in the EAPpreparations. In addition, EAP contained pTEFb, DOT1L, the AF4homolog LAF4, and RING1, which is known to complex withCBX8, as well as the proteins BCoR, p52RO, TUB6, andPIP5K2C. Surprisingly, pTEFb was exclusively detected in theminor isoform as dimer of CDK9 with CYCT2, whereas approxi-mately 80% of cellular pTEFb consists of CDK9 and CYCT1.23

Also, HSP70, which is known to copurify with CDK9,24 was part ofEAP. Identities for individual silver-stained bands could be as-signed for most proteins by the expected molecular weight andband-intensity/peptide-frequency correlations. Compared with ENL,the accompanying proteins were present in reproducible butnonequimolar stoichometries, implying that EAP is not a singlecomplex but rather a mixture of different subcomplexes, with ENLas common unit. This assumption was corroborated by the fact thatthe sum of the calculated molecular weights of all identified EAPcomponents exceeded 1.4 MDa, whereas ENL eluted duringgel-filtration at approximately 400 kDa. Alternatively, it cannot beexcluded that the conditions applied during size separation mighthave caused the disruption of a potentially larger complex.

To independently confirm the association of ENL with themajor components of EAP, coimmunoprecipitations from unalteredHEK293 cells were performed (Figure 2D). To this end, Triton/saltextracts from native HEK293 cells were incubated either with ENLresin or with flag-agarose as control. The presence of DOT1L and

Figure 1. Characterization of an fENL producer cell line. (A) Detection of flagENLexpression by immunoblot. Extracts from transduced 293fENL and HEK293 parentalcells were tested for endogenous and ectopic ENL expression by probing withanti-ENL and anti-flag antibodies. Actin served as loading control. A densitometricquantification of the relative expression levels is shown in the bar graph. (B) Gelfiltration on Sephacryl S300. Extracts from 293fENL cells were separated by gelfiltration on a precalibrated column as indicated. Individual eluate fractions weretested by immunoblotting with antibodies against ENL and flag. The elution profile ofENL from the parental HEK293 cells is shown in the bottom panel.

PURIFICATION OF ENL-ASSOCIATED PROTEINS 4447BLOOD, 15 DECEMBER 2007 � VOLUME 110, NUMBER 13

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

all expected subunits of pTEFb (CDK9, CYCT2, and HSP70)could be successfully proven by immunoblotting. Interestingly,2 CYCT2 immunoreactive bands were detected that correspondedexactly to the expected molecular weight of the known splice formsof CYCT2 (CYCT2B, 81 kDa; CYCT2A, 73.5 kDa). Massspectrometry did not pick up the splice variants in purified EAPbecause no discriminatory peptides were present; however, bothCYCT2 isoforms could be detected in EAP by immunoblotting(data not shown). Control blots did not detect any CYCT1 in EAPpreparations (data not shown). In addition, the coprecipitation ofendogenous ENL with AF4 also could be demonstrated. Suitableantibodies recognizing the AF4 homologs LAF4 and AF5q31 werenot available.

ENL interacts directly with Dot1l

The presence of DOT1L in EAP and the apparent important role forH3K79 methylation in MLL fusion protein mediated transforma-tion12,13 prompted us to analyze the DOT1L-ENL interaction more

in detail. Because we were not able to obtain a full-length humanDOT1L cDNA, the highly homologous mouse Dot1l was used inthese experiments. Yeast 2-hybrid experiments were consistentwith a direct association of the 2 full-length proteins (Figure 3A).A deletion analysis localized the ENL-binding domain within theDot1l C-terminus between amino acids 826 and 1095, a regionwithout any recognizable motif or homology. In contrast, the Dot1linteraction domain in ENL coincided with the highly conservedhydrophobic C-terminus that had been shown to be necessary andsufficient for transformation by MLL-ENL.25 Interestingly, a smalldeletion of the ultimate 15 amino acids of ENL, a mutation thatdestroys ENL-dependent transactivation and MLL-ENL–mediatedtransformation, also precluded binding to Dot1l (Figure 3B,C).A direct interaction between ENL and Dot1l was also supported byGST pull-down experiments. In vitro transcribed and translatedDot1l could be coprecipitated with GST-ENL but not by GST alone(Figure 3D). Finally, EGFP-Dot1l and RFP-ENL fusions colocal-ized in the nuclei of living cells in a speckled distribution typical

Figure 2. Purification of EAP. (A) Schematic flowchart of the purification procedure. (B) Composition ofEAP. EAP was purified from approximately 5 � 108

293fENL cells. As a mock control, the same purificationstrategy was performed using unliganded agarose inplace of flag-agarose for the first precipitation step(mock). Eluates were run on a 10% SDS-PAGE, stainedwith Coomassie (left panel) and subsequently withsilver (right panel). The bands were excised, digested,and analyzed by mass spectrometry. All proteins thatcould be uniquely identified by more than 1 peptide andat least in 2 independent experiments are listed. Whereindividual band identities could be assigned, they areindicated in the figure. (C) Left panel shows nucleicacid content of cellular extracts used for EAP purifica-tion. Nucleic acids from cellular extracts used for EAPpurification were isolated by phenol extraction, sepa-rated by agarose gel electrophoresis and stained byethidium bromide. Samples shown are from untreatedcellular extracts (extract) and from extracts after nucle-ase digestion (nuclease). Right panel shows purifica-tion of EAP from nuclease-treated cell extracts. EAPwas precipitated as described in panel B from cellularextracts after exhaustive nuclease digestion. The figureshows a silver stained gel of EAP proteins in com-parison to a mock control as described in panel B.(D) Coimmunoprecipitation of major EAP componentswith endogenous ENL. Immunoprecipitations fromHEK293 cell extracts were done either with agarosecoupled to anti-ENL antibodies (�-ENL) or flag-agarose(control). Coprecipitating proteins were analyzed byimmunoblot with antibodies against the pTEFb sub-units CDK9, CYCT2, and HSP70, as well as withantibodies specific for DOT1L and AF4. The 2 splicevariants of CYCT2 (CYCT2a, 2b) are indicated.

4448 MUELLER et al BLOOD, 15 DECEMBER 2007 � VOLUME 110, NUMBER 13

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

for ENL. An EGFP-Dot1l derivative with an internal 191–aminoacid deletion within the ENL-binding domain was distributedexclusively in the cytoplasm, indicating an important role of thisregion for nuclear import und function of Dot1l (Figure 3E). ENLand Dot1l localized exclusively in the nucleus as demonstrated incells counterstained with DAPI.

EAP has in vitro histone methylase and protein kinase activity

To test if the presence of DOT1L in EAP confers histonemethyltransferase activity, purified EAP or a mock preparationobtained by precipitation from 293fENL cells with unligandedagarose beads were incubated with core histones in the presence of3H-methyl-S-adenosylmethionine. The reaction mixture was sepa-rated by SDS-PAGE, stained with Coomassie, and treated with afluorographic enhancer to allow visualization of 3H-labeled com-pounds. This assay detected a robust histone H3–specific methyl-transferase activity associated with EAP (Figure 4A). In concor-dance with the known substrate specificity of DOT1L, freerecombinant histone H3 was not a substrate for methyl-transfer byEAP (not shown). A specific increase of histone H3 lysine 79dimethylation could be seen in core histone preparations afterincubation with EAP and S-adenosylmethionine, but not in con-trols. Since DOT1L is the only known methyltransferase able tocatalyze H3K79 dimethylation,26 it is highly likely that DOT1L isresponsible for the histone-methylating activity in EAP.

In an analogous approach, EAP was tested for pTEFb kinaseactivity in vitro. For this purpose, purified recombinant GST– RNApolymerase II C-terminal domain kinase (RNAPolII CTD) wasincubated with EAP or a mock control precipitate in a reactioncontaining �32P-ATP. Autoradiography revealed a robust kinaseactivity of EAP (Figure 4B). The influence of EAP on in vitrotranscription was assessed by run-off transcription from a templatecontaining the 5� portion of the Hoxa9 gene driven by the CMVimmediate early enhancer. For detection of transcripts, the reactionwas done in the presence of 32P-UTP. As expected, addition of thepTEFb inhibitor DRB caused a severe reduction in transcriptlevels. However, supplementation of the transcription reactionswith EAP partially relieved the inhibitory effect of DRB, suggest-ing that EAP supplies additional pTEFb activity (Figure 4B).

EAP is required for efficient global and gene-specific H3K79dimethylation and for efficient transcription

The impact of EAP inhibition on global H3K79 methylation wasexamined by knock-down of ENL. For this purpose, HEK293 cellswere transfected with constructs encoding shRNAs directed againstENL or luciferase as control. shRNAs are processed by cellularenzymes into inhibitory RNAs that trigger the destruction of theircomplementary mRNAs. The efficiency of ENL knock-down wascontrolled at the protein level by immunoblotting and densitomet-ric evaluation. Whereas stable knock-down clones with reducedENL levels could not be obtained (data not shown), transientshRNA transfection reduced endogenous ENL concentrations toapproximately 20% of controls after 7 days and did not causeincreased cell death compared with a luciferase knock-downcontrol (Figure 5A; data not shown). Correspondingly, globalH3K79 dimethylation also decreased to approximately 30% comparedwith the value obtained in control shRNA–treated cells (Figure 5A).Since it has been shown by independent laboratories that DOT1L isdirectly responsible for H3K79 dimethylation in HEK293 cells,26,27 it ishighly likely that perturbation of EAP and therefore DOT1Lfunction was the cause for the reduced modification levels. Thetransient knock-down of ENL did not significantly affect expres-sion of pTEFb components in the cells (data not shown).

The distribution of dimethyl-H3K79 was determined in ENLknock-down cells across the HOXA9 coding region by ChIP.HOXA9 is expressed in HEK293 cells and it is known that HOXAgenes are particularly sensitive to a loss of H2B ubiquitinylationand therefore also H3K79 methylation because the former is aprerequisite for the latter to occur.28 Gene-specific H3K79 dimethy-lation was moderately but significantly reduced after shRNA-mediated knock-down of ENL (Figure 5B). In contrast, H3K9 dimethy-lation did not change significantly across the HOXA9 coding regionafter ENL knock-down. Also, H3K4 di- and trimethylation was largelyunaffected except for a localized reduction around the start of the codingsequence. Overexpression of ENL did not increase global or localH3K79 methylation, indicating that ENL is not limiting under normalcellular conditions (data not shown).

Because DOT1L and pTEFb are enzymatic activities associatedwith elongation, we wanted to determine if a loss of EAP functionaffects transcription at this level. For that purpose, transcriptional

Table 1. Composition of EAP

Protein Accession no. Molecular weight, kDa Peptides, no.* Remarks

BCoR NP_060215 188 13 BCL-6–interacting corepressor

DOT1L NP_115871 165 11 Histone H3K79 methyltransferase

LAF4 NP_002276 133 26 MLL fusion partner, AF4 and AF5q31 homolog

AF4 NP_005926 131 110 MLL fusion partner, AF5q31 homolog

AF5q31 NP_055238 127 741 MLL fusion partner, AF4 homolog

CYCT2 NP_490595 81 52 Cyclin T2, subunit of pTEF-b

HSP70 NP_940833 70 169 Heat-shock protein

HSP70L NP_005336 70 6 Heat-shock protein–like

ENL NP_005925 62 167 MLL fusion partner, tagged for purification

p52 RO NP_003132 54 47 Ubiquitin ligase, E3 enzyme

TUB6 NP_997195 50 3 Tubulin variant

PIP5K2C NP_079055 47 2 Phosphatidylinositol-4-phosphate-5-kinase, type II, �

CBX8 NP_065700 43 3 Chromobox 8 protein

CDK9 NP_001252 43 55 Subunit of pTEF-b, RNAPol II CTD kinase

RING1 NP_002922 42 10 Member of polycomb repressive complex I

The table lists proteins that could be uniquely identified by more than 1 peptide and at least in 2 independent EAP samples. In addition, peptides specific for the MLL fusionpartners ELL (accession no. NP_006523), AF9 (accession no. NP_004520), and AF10 (accession no. NP_004632) were detected in single experiments. The given molecularweight corresponds to the theoretical calculated value of the prototypical protein as deposited in the database.

*All gene-specific peptides that could be unambigously identified by mass-spectrometry across all replicates.

PURIFICATION OF ENL-ASSOCIATED PROTEINS 4449BLOOD, 15 DECEMBER 2007 � VOLUME 110, NUMBER 13

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

elongation was quantified using a nuclear run-on assay, whichmeasures incorporation of radioactive nucleotides into nascentmRNAs produced in isolated nuclei. Under these conditions, newinitiation generally does not occur.21 Therefore, radioactive label-ing is proportional to elongation. Nuclei were prepared fromHEK293 cells depleted for ENL by shRNA and from control cellstransfected with luciferase shRNA. Identical numbers of nucleiwere incubated with 32P-�UTP. RNA was purified by spin columnsand spotted on membranes, and radioactivity was quantified byphosphoimaging. As a normalization control, the concentration ofstable 18S RNA was quantified by real-time RT-PCR. An approxi-mately 30% reduction in global elongation rates was detectable inENL knock-down cells compared with controls. To determine if theconsequences of ENL knock-down are gene specific, labeledrun-on RNA was hybridized to select cDNAs. As expected, theeffect on elongation varied widely depending on the gene exam-ined. Whereas run-on rates were reduced approximately 40% forAF4, 20% for AF5q31, and 10% for ENL, HOXA10 elongation wasnot sensitive to reduced ENL levels. Elongation rates for HOXA9were too low to be detected by a run-on/hybridization assay;however, a knockdown of ENL caused a significant reduction of

total HOXA9 mRNA abundance as determined by q-RTPCR(Figure 5C). A dose dependent inhibitory effect of ENL-specificshRNA was also observed in transient luciferase reporter experi-ments testing 3 different promoters of viral (simian virus 40[SV40], CMV) and cellular origin (Hoxa7; Figure 5D). In sum-mary, these results underscore an important role for EAP in generaltranscription in vivo also.

Transformation by MLL-ENL correlates with DOT1L binding

The 15 C-terminal amino acids of ENL are essential for binding ofENL to DOT1L. The same region also is responsible for a directinteraction between ENL and CBX8. In addition, this peptide hasbeen shown to be absolutely required for the transforming ability ofthe corresponding MLL-ENL fusion protein. The importance of theENL-DOT1L interaction for the transforming capacity of MLL-ENLwas examined by an alanine-scanning mutagenesis. A total of2 different amino acid triplets within the ENL C-terminus werereplaced by alanine. The mutant ENL sequences were introducedinto MLL-ENL and into a 2-hybrid bait construct (Figure 6A).Correct expression was demonstrated by immunoblotting of the

Figure 3. ENL interacts directly with Dot1l.(A) Example of a 2-hybrid experiment using full-lengthENL as bait and full-length Dot1l as an interactiontarget. For comparison, yeast transformed with emptyvectors (�) or with plasmids encoding the interactingproteins SNF1 and SNF4 (�) was plated alongside.Growth is shown on control and selective plates.(B) Structure function analysis to determine the ENL-Dot1l association interface. A series of ENL mutantswas tested as bait for interaction with full-length Dot1land vice versa to delineate the respective interactiondomains in 2-hybrid experiments. Growth on selectivemedium is indicated with “�” or “�.” Conserved do-mains in ENL are labeled “YEATS” (a domain found inseveral other proteins associated with chromatin modi-fication) and “hydp” (hydrophobic C-terminal domainthat has been shown to mediate binding to CBX8).(C) Control for expression of Dot1l derivatives in yeastcells. The correct expression of the Dot1l mutants waschecked by immunoblotting with a GAL4-activationdomain–specific antibody. The lane designations corre-spond to the Dot1l mutants shown in panel B. Thecorrect expression of the indicated set of ENL mutantshas been published previously.14 (D) GST pull-downexperiment. Beads loaded with purified GST or GSTfused to full-length ENL were incubated with 35S-labeled Dot1l protein produced by in vitro transcription/translation. After washing, bound proteins were elutedwith SDS sample buffer, separated by SDS-PAGE, andvisualized by autoradiography. (E) In vivo colocaliza-tion of ENL and Dot1l. Top row: vectors encodingfusions of EGFP with Dot1l and RFP with ENL weretransfected into HEK293 cells. Fluorescent proteinswere detected by microscopy in a nuclear speckledpattern. Photographs in the green and red channelsand a software overlay are shown. Middle row: EGFPwas fused with a mutant of Dot1l deleting amino acids937 to 1095 within the ENL-binding domain. Theprotein was introduced into HEK293 cells (EGFP-Dot1l�ENLbdg), and the expression pattern was com-pared with wild-type EGFP-Dot1l (EGFP-Dot1l). Cor-rect expression of the respective fusion proteins wascontrolled by immunoblotting with a GFP-specific anti-body. Bottom row: colocalization of EGFP-Dot1l andRFP-ENL in Triton X-100–permeabilized cells to allowcounterstaining with the DNA stain DAPI. All micropho-tographs were taken at room temperature in tissueculture medium with a Canon Coolpix 990 (Krefeld,Germany) electronic camera attached to a Zeiss Axios-kop microscope (Oberkochen, Germany) with a ZeissNeofluar 63�/1.25 NA objective and processed withCorel Draw software (Unterschleißheim, Germany).

4450 MUELLER et al BLOOD, 15 DECEMBER 2007 � VOLUME 110, NUMBER 13

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

respective GAL4-DNABD and MLL fusion proteins. Importantly,the transforming capability of the MLL-ENL mutants was highlycorrelated with the binding affinity for DOT1L. Only ENL mutantA, which bound efficiently to DOT1L, was transforming in thecontext of MLL-ENL. In contrast, mutant B had significantlyreduced affinity for DOT1L and failed to transform when fused toMLL. No such relationship, however, was detected for the interac-tion of ENL with CBX8, as this parameter was comparable for bothmutants (Figure 6B-C). The transforming potential of the indi-vidual MLL fusion proteins was perfectly correlated with theirability to induce the expression of the known MLL-ENL targetgenes Hoxa7, Hoxa9, and Meis1 in primary hematopoietic cells(Figure 6D).

Discussion

A still largely unsolved question of MLL fusion biology pertains tothe biological activity contributed by the fusion partner. The resultspresented here help to answer this problem by suggesting afunction for 1 of the most common nuclear MLL fusion partners,the ENL protein. ENL associates with a set of proteins that can bepurified from cells as macromolecular assembly. The compositionof EAP as determined here is backed up by a number of previousresults, mainly from 2-hybrid screens that indicated a directinteraction of ENL and/or the homologous AF9 fusion partner withAF5q31 and AF410,11 as well as with CBX8 and BCoR.14,16 The factthat AF10 was not reproducibly found in EAP confirms our earlierresults that a direct interaction of ENL with AF10 occurs only ifAF10 is truncated.11 The internal ENL binding site probably is notaccessible under regular cellular conditions. In a similar direction,AF9 should not be a major constituent of EAP because ENL andAF9 occupy the identical binding site in AF4 and AF5q31,

respectively.10,11 Therefore, our purification strategy that selects forENL-bound AF4/AF5q31 should not simultaneously also bringdown AF9. Most probably the EAP proteins are not present in asingle protein complex. Structure function studies10,11 have shownthat AF5q31, AF4, and possibly also the highly homologous LAF4interact with the same C-terminal domain of ENL. It is veryunlikely that 3 proteins with individual molecular weights of morethan 130 kDa could simultaneously occupy the identical bindingsurface on the much smaller ENL protein. Likewise, CBX8 and, asshown in this report, DOT1L share the same interaction domain inENL, and therefore binding is expected to be mutually exclusive.Considering the stoichometry of the EAP constituents, we proposethat ENL and pTEFb are core components that associate dependingon context with a select set of the other EAP proteins. Although itcannot be excluded that gel filtration itself might disrupt a largerprotein complex, the presence of more than 1 complex that sharesENL as a common subunit would more likely explain the discrep-ancy of the apparent molecular weight of EAP in gel filtrationcompared with immunoprecipitation.

The presence of both pTEFb and DOT1L, 2 enzymatic activitiesnecessary for transcriptional elongation, suggests a function for theEAP assembly during this process. pTEFb is a dimer of thecyclin-dependent kinase 9 that, assisted by heat-shock proteins,associates with either cyclin T1 or cyclin T2 to form an activekinase that phosphorylates serine 2 in the heptad repeat of RNApolymerase II.24,29 This modification is necessary for productiveelongation during the transcription of many genes. The connectionof pTEFb with MLL partner proteins is also supported by a reportthat identified AF5q31 in affinity-purified pTEFb preparations.30

DOT1L is a non-SET methyltransferase with specificity for histoneH3 lysine79 and is the only known enzyme with this histonespecificity.26 Previously, we demonstrated that ENL interacts withhistone H3 via N-terminal sequences.11 Here, we show ENL also

Figure 4. Analysis of EAP histone methyltransferase and CDK kinase activities in vitro. (A) EAP contains a H3K79 dimethylating activity. Left panel: an EAP preparationor a mock control that was done with unliganded agarose as precipitation agent were incubated with core histones and methyl-3H-S-adenosylmethionine. The reaction productsand a histone input sample (100% input) were separated on a 18% SDS gel, stained with Coomassie blue, and treated with a fluorographic enhancer solution before exposureto x-ray film (fluorography). Right panel: in an analogous experiment, core histones were incubated with EAP or a mock control as in panel A, and nonradioactiveS-adenosylmethionine. After separation of the reaction products by 18% SDS-PAGE, the proteins were blotted and analyzed by immunodetection first with a H3K79dimethyl–specific antibody and subsequently on the same membrane with a pan-H3–reactive antibody. As a further control, aliquots of the EAP and mock reactions wereprobed by Western blot for changes of dimethylation at H3K9. The densitometrically obtained concentration values are given underneath the respective lanes. (B) EAP hasRNAPolII CTD kinase and pTEFb activity in vitro. Left panel: EAP works as RNAPolII CTD kinase in vitro. Recombinant GST–RNAPolII CTD fusion protein was incubated in thepresence of �32P ATP and either an EAP preparation or a mock control as described. Reactions were separated by SDS-PAGE followed by Coomassie staining andautoradiography. Right panel: EAP supplies pTEFb activity for in vitro transcription. Standard run-off transcription reactions in HeLa nuclear extracts were primed with atemplate allowing the transcription of the first 244 bp of the Hoxa9 coding sequence under control of the CMV immediate early promoter. The reaction was carried out with�32P-UTP to allow labeling of the transcript. The reaction products were phenolized and separated on a denaturing 6 M urea 6% PAA gel followed by autoradiography. Thetranscription assays were supplemented either with a mock precipitate as described, or with an EAP preparation. Whereas transcript levels were reduced by addition of thepTEFb inhibitor DRB in unsupplemented samples (left), the presence of EAP rescues a significant amount of transcriptional activity under the same conditions (right).

PURIFICATION OF ENL-ASSOCIATED PROTEINS 4451BLOOD, 15 DECEMBER 2007 � VOLUME 110, NUMBER 13

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

interacts directly with DOT1L. ENL is therefore a prime candidatefor serving as an adaptor that tethers DOT1L to its substrate.During the preparation of this manuscript, a report becameavailable that lends further support to a role for EAP in elongationcontrol. Although done exclusively with transiently overexpressedproteins, Bitoun et al31 demonstrated that AF4 associates with AF9,ENL, and pTEFb to stimulate transcriptional elongation through arecruitment of DOT1L and stimulation of H3K79 dimethylation.The same group showed previously that the “robotic” mouse

harbors a mutant of AF4 that impairs proteasomal degradation ofthis protein.32 Robotic mice therefore overexpress AF4, and thisoverexpression is also accompanied by higher levels of H3K79dimethylation in the cerebellum, the organ responsible for the“robotic” phenotype. In these studies, CDK9 was expressed incombination with CYCT1, which most likely does not match theendogenous EAP composition, because we could not detect anyCYCT1 in our preparations. To our knowledge, EAP is the firstinstance where a combination of CDK9 with CYCT2a/CYCT2b

Figure 5. EAP function in vivo. (A) ENL is necessaryfor global H3K79 dimethylation. Endogenous ENL inHEK293 cells was knocked down by transfection with avector encoding an ENL-specific shRNA. As control, asimilar vector with a luciferase-specific shRNA insertwas used. Extracts from cells transfected as indicatedwere subjected to immunoblotting to detect dimethyl-H3K79, ENL, total histone H3, and actin. A densitomet-ric evaluation of 3 different experiments giving averagevalues and standard deviations is shown in the bargraphs. (B) ENL is necessary for gene-specific H3K79dimethylation. The distribution of dimethylated H3K79across the HOXA9 coding region was detected by ChIPin control HEK293 cells (�; - - -) transfected with aluciferase-specific shRNA vector or in ENL knock-downcells (f; ) after treatment with anti ENL shRNA. Ascontrol, H3K4 di/trimethylation and H3K9 dimethylationwas determined in analogous experiments. The local-ization of the primer pairs used for amplification ofHOXA9 sequences is shown. An external primer pairamplifying untranscribed genomic sequence was usedas control. Input and precipitate was quantified byquantitative PCR in triplicates. The percentage ofspecifically recovered material compared with input isplotted on the y-axis as average and standard devia-tion. (C) ENL knock-down affects global run-on elonga-tion and endogenous as well as transient gene expres-sion. Top panels: global elongation rates were measuredby nuclear run-on experiments in isolated nuclei. Radio-activity incorporated into nascent RNA during the elon-gation process was measured in control cells (lucif-erase specific shRNA) and after ENL knock-down byENL-specific shRNA as indicated. As control, theamount of stable 18S rRNA was determined in thesame samples by quantitative real-time RT-PCR. Aver-age and standard deviations of triplicate experimentsare given. Bottom panels: Left panel shows labeledrun-on RNA samples from ENL knock-down (sh) andcontrol (luci) cells hybridized to cDNAs of the indicatedgenes. For normalization, 18S cDNA was included.Right panel shows total HOXA9-specific mRNA in ENLknock-down and control cells determined by qRT-PCR.(D) ENL knock-down affects transient transcription.Luciferase reporter experiments testing the responseof 3 different promoters after transfection of increasingamounts of ENL specific shRNA vectors. Averagesand standard deviations of triplicate experimentsare plotted.

4452 MUELLER et al BLOOD, 15 DECEMBER 2007 � VOLUME 110, NUMBER 13

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

forms the active unit. EAP components are ubiquitously expressed,and a central role for ENL in cellular biochemistry is supported bygenetic ablation experiments in which ENL-deficient embryos dieextremely early in utero, even before implantation.33 In summary,all available evidence points clearly to a function of EAP as a majorcontrol instance for transcriptional elongation, and therefore EAPseems to be essential for efficient gene expression in all cells.

Surprisingly, EAP also contained minor quantities of 3 proteins(CBX8, RING1, and BCoR) involved in polycomb-mediatedrepression. The chromoboxprotein CBX8 (also known as humanpolycomb 3 or HPC3) and RING1 are common components of thepolycomb repressive complex 1.34 BCoR has been previouslydetected in a corepressor complex recruited by the BCL-6 pro-tein.35 Both CBX8 and BCoR have been identified in interactionscreens as direct binding partners of ENL or AF9, arguing againstan artefactual copurification.14-16 It is therefore tempting to specu-late that EAP might also exist in a repressive mode. Indeed, thereare reports that a complex of the ENL homolog AF9 and DOT1L isinvolved in aldosterone-controlled repression of a sodium channelgene in renal cells.36

The identification of EAP also has implications for our under-standing of the transforming mechanism of the MLL-ENL fusionprotein. Within the context of the leukemogenic MLL-ENL, the

biological activities of EAP would be constitutively mistargeted viathe fusion partner. As a consequence, elongation and therefore geneexpression would be inappropriately stimulated. Indeed, a dramaticincrease of H3K79 dimethylation is a hallmark of target genesactivated by MLL-ENL.13 This correlates well with our results thatmutations in ENL that impair the interaction with DOT1L alsoinactivate the transforming potential of the corresponding MLL-ENL fusion. Interestingly, the unrelated fusion MLL-AF10 alsoworks through recruitment of DOT1L.12 It remains to be seen ifchromatin modification and transcriptional elongation are impor-tant also for other MLL fusion proteins. If this is the case, drugs thatpotentially interfere with these mechanisms might be attractivetherapeutic agents.

Acknowledgments

We thank Renate Zimmermann and Gaby Sander for technicalsupport and B.C. Kone for sharing reagents.

This work was supported by DFG grants SL27/6–2 andSFB473/D2 (R.K.S.) and National Institutes of Health grantsCA78815 and CA92251 (J.L.H.). M.-P.G.-C. acknowledges fund-

Figure 6. The transforming capability of an MLL-ENL fusion protein correlates with Dot1l binding.(A) Schematic depiction of alanine insertion mutationsintroduced into the ENL C-terminus. (B) Results of aserial replating assay with primary hematopoietic pre-cursor cells isolated from bone marrow and transducedeither with wild-type MLL-ENL, MLL-ENL mutant A, orMLL-ENL mutant B. Given are the average colonynumbers including standard deviations in the thirdround of replating. Next to the bar graph, a representa-tive example of stained colonies is shown. The insetsshow Western blot experiments detecting expressionof the corresponding GAL4/MLL fusion proteins.(C) 2-hybrid test for interaction of ENL mutants A and Bwith full-length Dot1l and CBX8. Yeast was cotrans-formed with a bait plasmid containing mutants A and Bas indicated and a Dot1l interaction target. Growth onadenine/histidine deficient selective medium is shown.(D) qRT-PCR analysis of MLL-ENL target gene expres-sion. RNA was isolated from primary hematopoieticcells 1 week after transduction with retroviral constructscoding for wild-type MLL-ENL, mutant A, or mutant B,respectively. Relative RNA levels of the known MLL-ENL target genes Hoxa7, Hoxa9, and Meis1 weredetermined by qRT-PCR, normalized with respect toactin expression, and plotted with values for wild-typeMLL-ENL transduced cells set arbitrarily to 1. Note thatthe results are displayed on a logarithmic scale. Aver-age and standard deviation of triplicates are plotted.

PURIFICATION OF ENL-ASSOCIATED PROTEINS 4453BLOOD, 15 DECEMBER 2007 � VOLUME 110, NUMBER 13

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom

ing in part by Dr von Haunersches Kinderspital, Munich. Equip-ment funding from Jose-Carreras-Stiftung and Curt-Bohnewand-Fond, and travel support by BaCaTec is gratefully acknowledged.

Authorship

Contribution: R.K.S. designed research; D.M., C.B., D.Z., M.-P.G.-C., S.M., A.S., R.Z., A.N., and A.C. performed research and

collected data; A.C., J.L.H., and R.K.S. analyzed and interpreteddata; and J.L.H. and R.K.S. drafted the manuscript.

D.M. and C.B. contributed equally to this work.Conflict-of-interest disclosure: The authors declare no compet-

ing financial interests.Correspondence: Robert K. Slany, Genetics, University Erlan-

gen, Staudtstrasse 5, 91058 Erlangen, Germany; e-mail:rslany@biologie.uni-erlangen.de.

References

1. Gilliland DG, Jordan CT, Felix CA. The molecularbasis of leukemia. Hematology Am Soc HematolEduc Program. 2004:80-97.

2. Hess JL. Mechanisms of transformation by MLL.Crit Rev Eukaryot Gene Expr. 2004;14:235-254.

3. Slany RK. When epigenetics kills: MLL fusionproteins in leukemia [review]. Hematol Oncol.2005;23:1-9.

4. Schreiner SA, Garcia-Cuellar MP, Fey GH, SlanyRK. The leukemogenic fusion of MLL with ENLcreates a novel transcriptional transactivator.Leukemia. 1999;13:1525-1533.

5. So CW, Cleary ML. Common mechanism for on-cogenic activation of MLL by forkhead family pro-teins. Blood. 2003;101:633-639.

6. Zeisig BB, Milne T, Garcia-Cuellar MP, et al.Hoxa9 and Meis1 are key targets for MLL-ENL-mediated cellular immortalization. Mol Cell Biol.2004;24:617-628.

7. Zeisig BB, Schreiner S, Garcia-Cuellar MP, SlanyRK. Transcriptional activation is a key functionencoded by MLL fusion partners. Leukemia.2003;17:359-365.

8. Martin ME, Milne TA, Bloyer S, et al. Dimerizationof MLL fusion proteins immortalizes hematopoi-etic cells. Cancer Cell. 2003;4:197-207.

9. So CW, Lin M, Ayton PM, Chen EH, Cleary ML.Dimerization contributes to oncogenic activationof MLL chimeras in acute leukemias. Cancer Cell.2003;4:99-110.

10. Erfurth F, Hemenway CS, de Erkenez AC, DomerPH. MLL fusion partners AF4 and AF9 interact atsubnuclear foci. Leukemia. 2004;18:92-102.

11. Zeisig DT, Bittner CB, Zeisig BB, Garcia-CuellarMP, Hess JL, Slany RK. The eleven-nineteen-leukemia protein ENL connects nuclear MLL fu-sion partners with chromatin. Oncogene. 2005;24:5525-5532.

12. Okada Y, Feng Q, Lin Y, et al. hDOT1L links his-tone methylation to leukemogenesis. Cell. 2005;121:167-178.

13. Milne TA, Martin ME, Brock HW, Slany RK, HessJL. Leukemogenic MLL fusion proteins bindacross a broad region of the Hox a9 locus, pro-moting transcription and multiple histone modifi-cations. Cancer Res. 2005;65:11367-11374.

14. Garcia-Cuellar MP, Zilles O, Schreiner SA, Birke

M, Winkler TH, Slany RK. The ENL moiety of thechildhood leukemia-associated MLL-ENL oncop-rotein recruits human Polycomb 3. Oncogene.2001;20:411-419.

15. Hemenway CS, de Erkenez AC, Gould GC. Thepolycomb protein MPc3 interacts with AF9, anMLL fusion partner in t(9;11)(p22;q23) acute leu-kemias. Oncogene. 2001;20:3798-3805.

16. Srinivasan RS, de Erkenez AC, Hemenway CS.The mixed lineage leukemia fusion partner AF9binds specific isoforms of the BCL-6 corepressor.Oncogene. 2003;22:3395-3406.

17. GenBank. National Center for Bioinformatic Infor-mation. http://www.ncbi.nlm.nih.gov/Genbank/index.html. Accessed July 11, 2007.

18. Perkins DN, Pappin DJ, Creasy DM, Cottrell JS.Probability-based protein identification by search-ing sequence databases using mass spectrom-etry data. Electrophoresis. 1999;20:3551-3567.

19. Keller A, Nesvizhskii AI, Kolker E, Aebersold R.Empirical statistical model to estimate the accu-racy of peptide identifications made by MS/MSand database search. Anal Chem. 2002;74:5383-5392.

20. Nesvizhskii AI, Keller A, Kolker E, Aebersold R. Astatistical model for identifying proteins by tan-dem mass spectrometry. Anal Chem. 2003;75:4646-4658.

21. Carey MS, Smale ST. Transcriptional regulationin eukaryotes. Cold Spring Harbor, NY: ColdSpring Harbor Laboratory Press; 2000.

22. Lavau C, Szilvassy SJ, Slany R, Cleary ML. Im-mortalization and leukemic transformation of amyelomonocytic precursor by retrovirally trans-duced HRX-ENL. EMBO J. 1997;16:4226-4237.

23. De Luca A, De Falco M, Baldi A, Paggi MG. Cy-clin T: three forms for different roles in physiologi-cal and pathological functions. J Cell Physiol.2003;194:101-107.

24. O’Keeffe B, Fong Y, Chen D, Zhou S, Zhou Q.Requirement for a kinase-specific chaperonepathway in the production of a Cdk9/cyclin T1heterodimer responsible for P-TEFb-mediated tatstimulation of HIV-1 transcription. J Biol Chem.2000;275:279-287.

25. Slany RK, Lavau C, Cleary ML. The oncogeniccapacity of HRX-ENL requires the transcriptionaltransactivation activity of ENL and the DNA bind-

ing motifs of HRX. Mol Cell Biol. 1998;18:122-129.

26. Feng Q, Wang H, Ng HH, et al. Methylation ofH3-lysine 79 is mediated by a new family ofHMTases without a SET domain. Curr Biol. 2002;12:1052-1058.

27. Zhang W, Hayashizaki Y, Kone BC. Structure andregulation of the mDot1 gene, a mouse histoneH3 methyltransferase. Biochem J. 2004;377:641-651.

28. Zhu B, Zheng Y, Pham AD, et al. Monoubiquitina-tion of human histone H2B: the factors involvedand their roles in HOX gene regulation. Mol Cell.2005;20:601-611.

29. Peterlin BM, Price DH. Controlling the elongationphase of transcription with P-TEFb. Mol Cell.2006;23:297-305.

30. Estable MC, Naghavi MH, Kato H, et al. MCEF,the newest member of the AF4 family of transcrip-tion factors involved in leukemia, is a positivetranscription elongation factor-b-associated pro-tein. J Biomed Sci. 2002;9:234-245.

31. Bitoun E, Oliver PL, Davies KE. The mixed-lin-eage leukemia fusion partner AF4 stimulatesRNA polymerase II transcriptional elongation andmediates coordinated chromatin remodeling.Hum Mol Genet. 2007;16:92-106.

32. Bitoun E, Davies KE. The robotic mouse: unravel-ling the function of AF4 in the cerebellum. Cere-bellum. 2005;4:250-260.

33. Doty RT, Vanasse GJ, Disteche CM, WillerfordDM. The leukemia-associated gene Mllt1/ENL:characterization of a murine homolog and dem-onstration of an essential role in embryonic devel-opment. Blood Cells Mol Dis. 2002;28:407-417.

34. Bardos JI, Saurin AJ, Tissot C, Duprez E, Free-mont PS. HPC3 is a new human polycomb ortho-logue that interacts and associates with RING1and Bmi1 and has transcriptional repressionproperties. J Biol Chem. 2000;275:28785-28792.

35. Huynh KD, Fischle W, Verdin E, Bardwell VJ.BCoR, a novel corepressor involved in BCL-6repression. Genes Dev. 2000;14:1810-1823.

36. Zhang W, Xia X, Reisenauer MR, Hemenway CS,Kone BC. Dot1a-AF9 complex mediates histoneH3 Lys-79 hypermethylation and repression ofENaCalpha in an aldosterone-sensitive manner.J Biol Chem. 2006;281:18059-18068.

4454 MUELLER et al BLOOD, 15 DECEMBER 2007 � VOLUME 110, NUMBER 13

For personal use only. by guest on June 1, 2013. bloodjournal.hematologylibrary.orgFrom