1

Uroguanylin inhibits H-ATPase activity and surface expression in 1

renal distal tubules by a PKG dependent pathway 2

3

1Vanessa da Silva Lima, 2Renato O. Crajoinas, 3Luciene R. Carraro-Lacroix, 4

1Alana N. Godinho, 1João L. G. Dias, 2Rafael Dariolli, 2Adriana C. C. Girardi, 5

1,4Manassés C. Fonteles, 3Gerhard Malnic, 1Lucília M. A. Lessa* 6

7

1Superior Institute of Biomedical Sciences, State University of Ceará, Fortaleza, 8

CE, Brazil; 2Heart Institute (InCor), University of São Paulo Medical School, São 9

Paulo, SP, Brazil; 3Department of Physiology and Biophysics, Biomedical Sciences 10

Institute, University of São Paulo, São Paulo, SP, Brazil; 4Mackenzie University, 11

São Paulo, SP, Brazil 12

13

Running title: Modulation of H-ATPase by uroguanylin 14

15

*Address correspondence to: 16

Lucília M. A. Lessa 17

Superior Institute of Biomedical Sciences 18

Av. Paranjana, 1700 19

60.714.903 Fortaleza - Ceará, Brazil 20

Phone: 55-85-3101-9836 21

e-mail: lucilialessa17@gmail.com 22

23

Articles in PresS. Am J Physiol Cell Physiol (July 16, 2014). doi:10.1152/ajpcell.00392.2013

Copyright © 2014 by the American Physiological Society.

2

Abstract 24

Cumulative evidence suggests that guanylin peptides play an important role 25

on electrolyte homeostasis. We have previously reported that uroguanylin (UGN) 26

inhibits bicarbonate reabsorption in renal distal tubule. In the present study, we 27

tested the hypothesis that the bicarbonaturic effect of UGN is at least in part due to 28

inhibition of H+-ATPase-mediated hydrogen secretionin the distal nephron. By in 29

vivo stationary microperfusion experiments we were able to show that UGN inhibits 30

H+-ATPase activity by a PKG dependent pathway, since KT5823 (PKG inhibitor) 31

abolished the UGN effect on distal bicarbonate reabsorption and H89 (PKA 32

inhibitor) was unable to prevent it. The in vivo results were confirmed by the in vitro 33

experiments, where we used fluorescence microscopy to measure intracellular pH 34

(pHi) recovery after an acid pulse with NH4Cl. By this technique we observed that 35

UGN and 8Br-cGMP inhibited H+-ATPase-dependent pHi recovery, and that the 36

UGN inhibitory effect was abolished in the presence of the PKG inhibitor. In 37

addition, by using RT-PCR technique we verified that MDCK-C11 cells express 38

guanylate cyclase-C. Besides, UGN stimulated an increase of both cGMP content 39

and PKG activity, but was unable to increase the production of cellular cAMP 40

content and PKA activity. Furthermore, we found that UGN reduced cell surface 41

abundance of H+-ATPase B1 subunit in MDCK-C11 and that this effect was 42

abolished by the PKG inhibitor. Taken together, our data suggest that UGN inhibits 43

H+-ATPase activity and surface expression in renal distal cells by a cGMP/PKG 44

dependent pathway. 45

46

Keywords: H+-ATPase; Uroguanylin; Renal Microperfusion; Distal tubule; 47

PKG; cGMP 48

49

3

Introduction 50

51

Guanylins comprise a family of peptides that play an important role in the 52

regulation of salt balance, pH regulation, appetite and gut health (28). Among 53

these peptides, uroguanylin (UGN) is the one with more pronounced renal actions 54

(8). 55

In the kidney, UGN modulates the excretion of sodium, potassium, 56

bicarbonate, chloride and water (1, 8, 21, 29). These actions occur by altered 57

tubular reabsorption and tubular secretion of these electrolytes along the nephron 58

without changes in glomerular filtration rate. Besides, most of these effects are 59

related to increase of cGMP levels in urine (8, 11). 60

In a previous study, our group has demonstrated that UGN inhibits 61

bicarbonate reabsorption in proximal and distal tubules (1). In proximal tubules, the 62

UGN effect was attributed to inhibition of NHE3 activity by activation of both PKG 63

and PKA pathways (21). However, in distal tubules, an additional mechanism, 64

other than inhibition of the Na+/H+ exchanger, was suggested for UGN action on 65

bicarbonate reabsorption (1). 66

The vacuolar H+-ATPase (V-ATPase) is the major cellular mechanism of H+ 67

secretion/bicarbonate reabsorption in the alpha-intercalated cells of the distal 68

segments of the nephron, playing an important role in lumen acidification (38). The 69

V-ATPase is a large multi-subunit protein that mediates ATP-driven vectorial H+ 70

transport across cell membranes. Its activity is controlled by a number of different 71

mechanisms, including regulation of the assembly of the V-ATPase via complex or 72

dynamic regulation of its subunit expression in the cell membrane surface (10). 73

4

Among the multiple subunits, B1 seems to occupy a prominent role in the 74

regulation of H+-ATPase. B1 subunit knockout mice develop tubular acidosis, 75

metabolic acidosis, dehydration, and growth retardation (7). In addition, the 76

inactivation of the B1 subunit in intercalated cells leads to type 1 distal renal tubular 77

acidosis (dRTA), a disease associated with salt- and potassium-wasting 78

nephropathy (14). 79

Considering that H+-ATPase in distal segments is constantly submitted to 80

hormonal regulation, such as the renin-angiotensin-aldosterone system (RAS) and 81

natriuretic peptides (25, 26, 40) and that we have previously demonstrated that 82

UGN inhibits hydrogen secretion in renal distal tubule, the purpose of the present 83

study was to test the hypothesis that the UGN inhibitory effect on distal bicarbonate 84

reabsorption might be dependent at least in part on H+-ATPase inhibition. The 85

signaling mechanisms involved in the inhibitory effect of UGN on hydrogen 86

secretion in renal distal tubules were also addressed. The findings of the present 87

study show that UGN inhibits H+-ATPase activity in both rat renal distal tubule and 88

in MDCK-C11 cells. This effect seems to be dependent on a reduction of the 89

surface expression of B1 H+-ATPase subunit. In addition, the current data show 90

that the cGMP/PKG signaling pathway and not cAMP/PKA is involved in the UGN 91

regulation of distal bicarbonate reabsorption. 92

93

94

95

5

Materials and methods 96

Reagents and Antibodies: All chemicals were obtained from Sigma 97

Chemical Co. (St. Louis, MO) unless otherwise noted. Uroguanylin was purchased 98

from Bachem (Philadelphia, PA). KT5823, a specific, inhibitor of protein kinase G 99

(PKG) was purchased from Calbiochem (San Diego, CA). EZ-LinkTM Sulfo-NHS-100

SS-Biotin as well as immunopure immobilized streptavidin were purchased from 101

Thermo Fisher Scientific Inc (Rockford, IL). A monoclonal antibody (mAb) to H+-102

ATPase subunit B1 (V-ATPase B1) was purchased from Santa Cruz Biotechnology 103

Inc. (Santa Cruz, CA). The mAb to actin (JLA20) was purchased from Merck 104

Millipore (Billerica, MA). Horseradish peroxidase-conjugated secondary antibodies 105

were purchased from Life Technologies Corporation (Carlsbad, CA). 106

Animals: Animal procedures and protocols were followed in accordance with 107

the ethical principles in animal research of the Brazilian College of Animal 108

Experimentation and were approved by the Committees of the State University of 109

Ceará and São Paulo. Experiments were performed using male Wistar rats (250 to 110

300g) housed under standardized conditions (constant temperature of 22°C, 12-h 111

dark-light cycle, and relative humidity of 60%) at the Superior Institute of 112

Biomedical Sciences of State University of Ceará and of São Paulo. In order to 113

perform stationary in vivo microperfusion, the animals were anesthetized with 114

intramuscular ketamine (75mg/Kg) and xylazine (8mg/Kg). The left jugular vein 115

was cannulated for infusion of 3% mannitol in isotonic saline at a rate of 116

0.1mL/min. The kidney was exposed by a lumbar approach and prepared for “in 117

vivo” micropuncture. 118

6

Stationary “in vivo” microperfusion: The microperfusion procedure was 119

performed as described previously (1). A proximal tubule was punctured by means 120

of a double-barrelled micropipette, one barrel being used to inject FDC-green 121

colored Ringer perfusion solution (in mM, NaCl, 80; KCl, 5; NaHCO3, 25; CaCl2, 1; 122

MgSO4, 1.2; and raffinose to reach isotonicity, at 0 PCO2), and the other to inject 123

Sudan-black colored castor oil used to block the injected fluid columns in the 124

lumen. A distal segment of the same nephron, recognized by the colored perfusion 125

and by its transepithelial PD (higher than 20 mV, lumen negative), was impaled by 126

a double barrelled asymmetric microelectrode to measure intratubular pH, the 127

larger barrel containing at its tip the H+-ion sensitive ion-exchange resin (Fluka, 128

Buchs, Switzerland) and the smaller, 1 M KCl reference solution colored by FDC-129

green. Properties of the microelectrode were described previously (13). The pH 130

microelectrodes were calibrated before and after every impalement on the kidney’s 131

surface by superfusion with 20mM Phosphate-Ringer buffer solutions containing 132

130mM NaCl, at 37°C. The pH values were adjusted to 6.5, 7.0 and 7.5 with 0.1N 133

NaOH or HCl. A luminal oil block was split by perfusions so that the solution was 134

isolated and blocked by oil. The perfusion rate was sufficient to increase luminal 135

pH to values near those of the perfusion fluid, i.e. 25 mM NaHCO3 or pH ~8. After 136

blocking the luminal solution with oil, the increase in luminal H+ activities, 137

representing bicarbonate reabsorption, were followed until a stable level was 138

reached. 139

By this technique several curves (about 3 to 7) control and experimental 140

were obtained per tubule, the mean of control or experimental curves constituting 141

the values for this tubule. The value of N given for an experimental condition 142

7

corresponds to the number of perfused tubules, approximately 1 to 3 being 143

perfused in one rat, and for each group at least 4 rats were used. Luminal HCO3- 144

activity, initially starting with 25 mM was then progressively reduced to a stationary 145

level (HCO3-s) by H+ secretion. The voltage between the microelectrode barrels, 146

representing the luminal H+ activity, was sampled every 0.5 second by an AD 147

converter (Lynx, São Paulo, Brazil) in a microcomputer. At the same time, the 148

potential difference between the reference barrel and ground (the rat tail) was 149

recorded, giving the evolution of transepithelial PD with time during the perfusion. 150

Luminal bicarbonate was calculated from luminal pH and blood PCO2 measured by 151

a Severinghaus electrode. The rate of tubular acidification was expressed as the 152

half-time of the exponential reduction of the injected HCO3- concentration to its 153

stationary level (t1/2). Net HCO3- reabsorption (JHCO3

-) per cm2 of tubule 154

epithelium was calculated from the equation: 155

2)(2ln

332

13

rHCOHCOt

J soHCO ∗−= −−− 156

where t/2 is the half-time of bicarbonate reabsorption, r is the tubule internal radius 157

measured by an ocular micrometer, and [HCO3-]o and [HCO3

-]s are the 158

concentrations of the injected HCO3- and HCO3

- at the stationary level, 159

respectively. The tubules were perfused with control solution, 10-6 M Uroguanylin 160

(UGN) and/or the specific NHE inhibitor, 10-4M HMA; H+-ATPase inhibitor, 10-7M 161

Concanamycin A. In the experiments designed to investigate the signaling 162

mechanisms of UGN action we used 10-6 M KT5823 (PKG inhibitor); 10-5 M H89 163

(PKA inhibitor). 164

8

Cell culture: MDCK-C11 cells were obtained from Dr. Hans Oberleitner and 165

used from passages (80-90). Serial cultures were maintained in DMEM low 166

glucose supplemented with 5% L-glutamine, 5% sodium piruvate, 10% (vol/vol) 167

heat-inactivated fetal bovine serum, 100 IU/ml penicillin, and 100 µg/ml 168

streptomycin. Cells were grown at 37°C, 95% humidified air-5% CO2 (pH 7.4) in a 169

CO2 incubator (Lab-Line Instruments, Melrose Park, IL). The cells were 170

subcultured with trypsin-EGTA (0.02%) and seeded on tissue culture plates 171

containing sterile glass coverslips (for pH measurements) to become confluent. For 172

all experiments, cells were placed in serum-free medium 24 h before the 173

experiments. 174

Gene expression of GC-C receptor and MDCK-C11 cells: RNA was 175

extracted from MDCK-C11 cells using TRIzol Reagent (Invitrogen, Carlsbad, CA) 176

following the manufacturer's protocol. cDNA synthesis from total RNA (1 µg) was 177

produced by reverse transcription (RT) using the superscript III kit according to the 178

manufacturer’s protocol (Invitrogen). Polymerase chain reaction (PCR) was 179

performed using Taq-polymerase manufacturing protocol (Promega). Briefly, 180

thermal cycling for initial GC-C analysis included a denaturation step at 95 °C for 5 181

min followed by 36 cycles of 95°C for 30 seconds, annealing temperature of 64.5 182

°C for 30 seconds and 72°C for 1 min. 28S gene was used as a housekeeping 183

gene. The initial 28S analysis included a denaturation step at 95 °C for 5 min 184

followed by 36 cycles of 95°C for 30 seconds, annealing temperature of 60 °C for 185

30 seconds and 72°C for 1 min. Primer sequences and expected product lengths 186

were: GC-C receptor (XM_543798.2) primer: forward 5'– 187

AACCATTGGCGATGCCTACA -3' and reverse 5'- AGTTGGCGAGCATGTCAGAA 188

9

-3'; 491bp and 28S primer: forward 5'– TCATCAGACCCCAGAAAAGG -3' and 189

reverse 5'- GATTCGGCAGGTGAGTTGTT -3'; 102bp. PCR products were 190

resolved by electrophoresis at 100 V through 2% agarose gel and visualized with 191

GelRed™ (Biotium). 192

Fluorescence microscopy: Intracellular pH was measured 193

spectrofluorimetrically at 37°C with the fluorescent pH-sensitive probe BCECF-AM. 194

Cells grown to confluence on glass coverslips were loaded with the dye by 195

exposure for 5 min to 12 μM BCECF-AM in the control solution (Table 1). The 196

acetoxymethyl ester form of BCECF enters the cell and is rapidly converted to the 197

anionic-free acid form by intracellular esterases. Following the loading period, the 198

glass coverslips were rinsed with the control solution to remove the BCECF-199

containing solution and placed in a thermoregulated chamber mounted on an 200

inverted epifluorescence microscope (Nikon, TMD). The measured area under the 201

microscope had a diameter of 260 μm and contained on the order of 40 cells. 202

Bathing solutions were rapidly exchanged without disturbing the position of the 203

coverslips. Fluorescence was monitored using 440 (pH insensitive) or 495 nm (pH 204

sensitive) alternately as excitation wavelengths, utilizing a xenon light source. 205

Emission was measured at 530 nm by a photomultiplier-based fluorescence 206

system (Georgia Instruments), at time intervals of 5 s. pHi was calculated from the 207

fluorescence emission ratio of the two excitation wavelengths using a standard 208

calibration procedure based on the use of 10 μM nigericin in high potassium Ringer 209

(Table 1), at pH 6, 7, and 8 (36). 210

Cell pH recovery: Cell pH recovery was evaluated following the acidification 211

of pHi with the NH4Cl pulse technique (2) after a 2-min exposure to 20 mM NH4Cl 212

10

(Table 1), in the absence of external Na+ (Table 1), to inhibit the Na+/H+ exchanger, 213

with or without several inhibitors, as described later. In all the experiments, we 214

calculated the initial rate of pH recovery (dpHi/dt, pH units/min) from the first 2 min 215

after the start of the pHi recovery curve by linear regression analysis. 216

cGMP and cAMP Assay: MDCK-C11 cells were cultured to 100% 217

confluence in 96-well plates. Cells were incubated for 10 min with culture medium 218

containing 1 mM 3-isobutyl-1-methylxanthine (IBMX) or IBMX plus 10-6 M 219

Uroguanilyn or 10-6 M ANP (used as positive control in cGMP assay) or 10-4 M 220

Forskolin (used as positive control in cAMP assay). cGMP and cAMP were 221

measured by using the AmershamTM Enzyme immunoassay BiotrakTM (EIA) 222

System (GE Healthcare) according to specifications of the manufacturer. 223

Determination of PKA Activity in Cell Lysates - MDCK-C11 grown to 224

confluence in 24 well-plates were treated or not with UGN and subsequently 225

solubilized in lysis buffer containing 20 mM MOPS, 50 mM β-glycerol phosphate, 226

50 mM NaF, 1 mM sodium vanadate, 5 mM EGTA, 2 mM EDTA, 1% NP40, 1 mM 227

DTT, 1 mM benzamidine, 1 mM PMSF, 10 µg/mL aprotinin and 10 µg/mL 228

leupeptin. PKA activity was measured in this cell lysate using a non-radioactive 229

PKA Kinase Activity Assay (Enzo Life Sciences, Inc., Farmingdale, NY), according 230

to the manufacturer's instructions. 231

Determination of PKG Activity in Cell Lysates - MDCK-C11 grown to 232

confluency in 24 well-plates were treated or not with UGN and subsequently 233

solubilized in extraction buffer containing 20 mM Tris, pH 7.4, 150 mM NaCl, 1 mM 234

EDTA, 1 mM EGTA, 0.2 mM PMSF, 1 µg/mL pepstatin, 0.5 µg/mL leupeptin, 2 mM 235

NaF, 0.2 mM Na3VO4, 5 mM β-mercaptoethanol. PKG activity was measured in 236

11

this cell lysate using a single-site and semi-quantative CycLex cGK Assay Kit 237

(CycLex Co., Ltd., Nagano, Japan) according to the manufacturer's instructions. 238

Cell surface biotinylation: The assay was performed as described previously 239

(3). Cells were rinsed twice in ice-cold PBS-Ca-Mg (PBS with 0.1 mM CaCl2, 1.0 240

mM MgCl2). Surface membrane proteins were then biotinylated by incubating the 241

cells twice for 25 min with 2mL of ice-cold biotinylation buffer (150 mM NaCl, 10 242

mM triethanolamine, 2 mM CaCl2, and 1.5 mg/mL EZ-Link sulfo-NHS-SS-biotin). 243

Cells were then rinsed twice for 20 min with a quenching buffer (PBS-Ca-Mg, 100 244

mM glycine), washed twice with ice-cold PBS-Ca-Mg and strapped into ice-cold 245

solubilization buffer (50 mM Tris, 150 mM NaCl, 5 mM EDTA, 0.5% sodium 246

deoxycholate, 1% Triton X-100, pH 7.4) containing protease inhibitors (0.7 µg/mL 247

pepstatin A, 0.5 µg/mL leupeptin, and 40 µg/mL PMSF). After lysis on ice for 60 248

min, extracts were centrifuged for 10 min at 14,000 g and 4°C. The protein 249

concentration of the supernatants was measured according to Lowry (22) and 250

equal protein amounts of cell lysate (500 µg) were equilibrated with streptavidin-251

agarose beads at 4°C. Prior to the addition of streptavidin, an aliquot of the 252

supernatant was saved for analysis of total B1- subunit H-ATPase protein 253

expression by immunoblotting. The beads were then washed three times in ice-254

cold solubilization buffer. Biotinylated proteins were released by incubation in 255

Laemmli buffer and subjected to SDS-PAGE and immunoblotting. 256

SDS-PAGE and immunoblotting - Protein samples were solubilized in 257

Laemmli sample buffer and separated by SDS-PAGE using 7.5% polyacrylamide 258

gels. For immunoblotting, proteins were transferred to PVDF (Millipore Immobilon-259

P, Millipore, Bedford, MA) at 350 mA for 8-10 hours at 4ºC with a TE 62 transfer 260

12

electrophoresis unit (GE HealthCare). Sheets of PVDF containing transferred 261

proteins were incubated first in Blotto (5% non-fat dry milk and 0.1% Tween 20 in 262

PBS, pH 7.4) for 1 hour to block nonspecific binding of antibody, followed by 263

overnight incubation in primary antibody diluted in Blotto (1:1000). The sheets were 264

then washed in Blotto and incubated for 1 hour with an appropriate HRP-265

conjugated secondary antibody diluted 1:2000 in Blotto. After washing 5X in Blotto 266

and 2X in PBS (pH 7.4), the sheets were incubated in an enhanced 267

chemiluminescense (ECL) reagent for 1 minute and then placed in a digital 268

imaging system (ImageQuant LAS 4000 mini, GE HealthCare) to visualize the 269

bands. The quantification was realized using ImageJ densitometry software. 270

Statistical analysis: The data were analysed by a Visual Basic program in 271

Excel software. Statistical comparisons were made by the unpaired t-test, taking 272

the probability of 0.05 (5%) as the limit of significance. When more than two groups 273

were compared, one way ANOVA followed by Tukey’s post hoc test, taking 0,05 274

(5%) as limit of significance, was performed. In microperfusion experiments a 275

minimum of 6 tubules were used (n = number of perfused tubules). 276

277

278

279

280

281

282

283

284

13

Results 285

UGN inhibits H+-ATPase-mediated proton secretion in the rat distal tubule. 286

We have previously demonstrated that UGN inhibits distal bicarbonate 287

reabsorption (1) in the presence or absence of hexamethylene amiloride (HMA), a 288

Na+/H+ exchanger (NHE) inhibitor. These previous results suggest that UGN 289

inhibits NHE-dependent and H+-ATPase dependent proton secretion in this 290

nephron segment. To test the hypothesis that UGN inhibits H+-ATPase activity in 291

the distal nephron, we performed “in vivo” stationary microperfusion experiments in 292

which we perfused distal segments of the nephron with UGN alone or together with 293

concanamycin A (CONC), an H+-ATPase inhibitor and/or HMA. The perfusion of 294

CONC together with HMA significantly inhibited the secretion of H+ in rat distal 295

tubules compared to the control solution (Figure 1). Addition of UGN to CONC + 296

HMA also caused a significant inhibition when compared to the control and this 297

inhibition was similar to the one found when we perfused the distal tubules with 298

HMA + CONC (Figure 1). This finding demonstrates that the effect of UGN on 299

distal H+ secretion involves inhibition of no mechanism other than NHE or H+-300

ATPase. 301

302

Signaling mechanisms mediating the effects of UGN on bicarbonate reabsorption 303

in rat renal distal segments 304

Considering that the guanylate cyclase/cGMP/PKG pathway has been 305

described as the classical signaling mechanism for guanylin actions (8), we then 306

examined whether the activation of this signaling pathway mediates the effect of 307

UGN in the distal tubule. We first evaluated the effect of a cGMP analogue, 8Br-308

14

cGMP, on distal bicarbonate reabsorption. As shown in Figure 2A, the perfusion of 309

distal segments with 1µM 8Br-cGMP significantly inhibited the distal hydrogen 310

secretion similarly to UGN. Besides, in the presence of HMA (NHE inhibitor) there 311

was a slight tendency of an additional inhibition of hydrogen secretion by 8Br-312

cGMP, compared to HMA alone, but it was not significant, probably due to the 313

reduced permeability of the cGMP analogue (11). Nevertheless, as illustrated in 314

Figure 3A, there was no significant change in bicarbonate reabsorption when the 315

distal segments were perfused with UGN and the PKG inhibitor, KT5823, when 316

compared to the control or to the group perfused only with KT5823. However, 317

these groups were significantly different from the group perfused only with UGN 318

(Figure 3A). These results indicate that PKG inhibition prevents the UGN inhibitory 319

effect on hydrogen secretion in rat distal tubules, suggesting that the inhibition of 320

bicarbonate reabsorption by UGN is mediated, at least in part, by activation of the 321

cGMP/PKG signaling pathway. 322

In a previous study we showed that the UGN inhibitory effect on proximal 323

bicarbonate reabsorption was dependent on both PKG and PKA activation (21). 324

Thus, we evaluated the possible involvement of PKA on UGN action in distal 325

tubule. As seen in Figure 2B, the cAMP analogue, 8Br-cAMP, produced a 326

tendency to inhibit hydrogen secretion, although this trend did not reach 327

statistical significance. Besides, as illustrated in Figure 3B, the PKA inhibitor, H89, 328

associated with UGN was unable to reverse the inhibitory effect of this peptide on 329

distal hydrogen secretion, suggesting that PKA activation is not involved in the 330

UGN distal effect. 331

UGN inhibits H+-ATPase-dependent pHi recovery in MDCK-C11 cells 332

15

With the purpose to further investigate the inhibitory effect of UGN on H+-333

ATPase activity we performed fluorescence microscopy experiments to investigate 334

the UGN effect on H+-ATPase-dependent intracellular pH recovery in the distal 335

tubule cell line, MDCK-C11, a cell line with H+-secretory alpha intercalated cell 336

characteristics (12). In Figure 4, we can observe the original representative records 337

of pHi recovery experiments after an acid pulse with NH4Cl. As depicted in the 338

figure, there was an important inhibition of the rate of pHi recovery in 0Na+ solution 339

(Figure 4B) comparing to the original record of an experiment in the presence of 340

Na+ (Figure 4A). Under incubation with UGN 1µM, the inhibition of the Na+-341

independent pHi recovery was even more pronouced (Figure 4C). In Figure 5A, the 342

mean values of the pHi recovery rates and hydrogen flux of the groups discussed 343

above are plotted. The hydrogen flux (JH+) was calculated from the following 344

equation: 345

idtdpHiJH β⋅=+ / 346

where dpHi/dt is the rate of pHi recovery after the acid load and βi is the cytosolic 347

buffering capacity averaged for the respective pH range. We compared the rates of 348

H+ extrusion at the average pHi of all experimental groups and the respective 349

average βi of MDCK-C11 cells was used according to Fernandez et al (2000) (6). 350

The mean pHi used in the calculation of H fluxes corresponds to mean values 351

obtained during the pHi recovery period after the ammonium pulse. These data 352

show the significant inhibition of Na+-independent pHi recovery rates promoted by 353

UGN (Figure 5A and B). 354

16

MDCK-C11 cells express three mechanisms related to intracellular pH 355

regulation: NHE1 (isoform 1 of the Na+/H+ exchanger), H+/K+-ATPase and H+-356

ATPase (6, 12). Therefore, to further investigate whether the effect of UGN on Na+-357

independent pHi recovery in MDCK-C11 cells involved the inhibition of H+-ATPase, 358

fluorescence microscopy experiments were performed in the presence of 0Na+ 359

solution, to inhibit Na+-dependent pHi recovery; experiments with EIPA, a NHE1 360

inhibitor and Schering, a H+/K+-ATPase inhibitor, were also performed. In these 361

conditions, incubation of UGN promoted a significant additional inhibition of pHi 362

recovery and hydrogen flux, compared to the group treated with the inhibitors only. 363

These data indicate that UGN inhibits the pHi recovery and H+ flux dependent on 364

H+-ATPase activity (Figure 6A and B). 365

In order to investigate the involvement of cGMP/PKG pathway in this 366

inhibitory effect of UGN, we observed the effect of a cGMP analogue, 8Br-cGMP, 367

on H+-ATPase dependent pHi recovery. Incubation of the cGMP analogue caused 368

a significant inhibition of H+-ATPase activity, in a similar magnitude as did UGN 369

(Figure 5). Moreover, administration of KT5823, a PKG inhibitor, prevented the 370

effect promoted by UGN (Figure 6), demonstrating that inhibition of H+-ATPase by 371

UGN involves PKG activation. 372

373

Effect of UGN on intracellular contents of cGMP and cAMP, PKG and PKA 374

activities and GC-C expression in MDCK–C11 cells 375

Considering the possible involvement of the cGMP/PKG pathway in the 376

inhibitory effect of UGN on H+-ATPase activity (Figure 3A and 6), we evaluated the 377

effect of UGN on the intracellular cGMP concentration and PKG activity in distal 378

17

tubule cells. Figure 7A illustrates that the incubation of MDCK-C11 cells with UGN 379

for 10 minutes promoted a significant increase of intracellular cGMP content. In this 380

experiment, ANP (atrial natriuretic peptide), an agonist of guanylate cyclase – A 381

(GC-A), was used as a positive control, which demonstrated an effect similar to 382

UGN. Furthermore, both UGN and ANP were also able to stimulate a significant 383

increase of PKG activity in MDCK-C11 cells (Figure 7B). Considering these 384

findings we next examined and confirmed that MDCK-C11 cells express the 385

classical guanylin receptor, guanylate cyclase C (GC-C) (Figure 7C). It is worth 386

mentioning that the GC-C-mRNA could only be detected when higher amounts 387

(give the used concentration) of cDNA template were used for amplification 388

(Figure 7C), suggesting that MDCK cells display very low endogenous expression 389

of this receptor. 390

We also evaluated the effect of UGN on intracellular cAMP concentration 391

and PKA activity. Incubation of MDCK-C11 cells with UGN did not change either 392

intracellular cAMP content or PKA activity (Figure 8A and B). In these 393

experiments, forskolin was used as a positive control, and in contrast to the UGN 394

effect, forskolin incubation promoted a significant increase of both intracellular 395

cAMP concentration and PKA activity. 396

397

Effect of UGN on H+-ATPase surface expression in distal tubule cells 398

In order to investigate the mechanism by which UGN inhibits H+-ATPase activity, 399

we next examined whether UGN was capable of decreasing the B1 H+-ATPase 400

subunit cell surface expression in MDCK-C11 cells (Figure 9). The total levels of 401

B1 H+-ATPase subunit (Figure 9A), the β-subunit of H+/K+-ATPase (Figure 9B) and 402

18

actin in 15 min- vehicle, UGN and UGN + KT5823-treated cells were examined to 403

ensure that the yield of protein extracted was constant in each of the experimental 404

conditions. As observed in the representative immunoblotting shown in Figure 9C, 405

the inhibition of H+-ATPase by UGN was accompanied by a reduction of the 406

surface amount of V-ATPase. The peptide induced an inhibition of surface H+-407

ATPase B1 subunit by 54 ± 8%, relative to control. In addition, in the presence of 408

KT5823, a PKG inhibitor, this effect of UGN was abolished. Consistent with the 409

functional findings shown in Figures 1 and 5, UGN did not affect the cell surface 410

expression of the β-subunit of H+/K+-ATPase in MDCK-C11 cells (Figure 9D), 411

suggesting that this peptide does not modulate H/K-ATPase-mediated hydrogen 412

secretion in the distal tubule. 413

414

415

19

Discussion 416

It is now recognized the diuretic, natriuretic and kaliuretic properties of UGN. 417

In addition a potential effect of this peptide on renal tubular acidification has been 418

demonstrated (1, 21, 29). In a previous study, we demonstrated that UGN inhibits 419

bicarbonate reabsorption / hydrogen secretion in rat renal proximal and distal 420

segments (1). Moreover, an additional mechanism, besides inhibition of NHE2, 421

was proposed for the effect of UGN on hydrogen secretion in distal segments, 422

since in the presence of the NHE inhibitor HMA, UGN promoted an additional 423

inhibitory effect on hydrogen secretion (1). 424

Our present findings show that UGN inhibits H+-ATPase activity but not 425

H+/K+-ATPase-mediated hydrogen secretion in the distal nephron cells, both in vivo 426

and in vitro. In microperfusion experiments conducted in the presence of the 427

Na+/H+ exchanger (HMA) and H+-ATPase (concanamicin) inhibitors, no additional 428

inhibitory effect was promoted by UGN. These findings reinforce our previous 429

study, which suggested that the remaining inhibitory effect promoted by UGN on 430

distal bicarbonate reabsorption, in the presence of HMA, involves inhibition of H+-431

ATPase (1). 432

MDCK-C11 cells have properties of intercalated cells which secrete protons 433

and chloride in the collecting duct of mammals (6, 12). Since we have proposed to 434

evaluate H+-ATPase activity, our pHi recovery experiments were undertaken in the 435

presence of NHE1 and H/K-ATPase inhibitors, since these transporters are also 436

constitutively expressed in MDCK-C11 cells (6). Thus, in the presence of their 437

respective inhibitors and 0Na+ solution the remaining hydrogen secretion in MDCK 438

- C11 cells would be performed by H+-ATPase. In these conditions, our findings 439

20

clearly showed that UGN inhibits the Na+- independent pHi recovery exerted by H+-440

ATPase. 441

Several studies indicate an important role for guanylins in pancreatic and 442

intestinal secretion of HCO3- (17, 18, 19, 32). In intestinal cells, guanylin,

443

uroguanylin and the thermo-stable toxin of Escherichia coli (Sta) stimulate anion 444

secretion into the intestinal lumen. This mechanism involves the increase of 445

intracellular cGMP by activating a guanylate cyclase C (GC-C). The activation of 446

this pathway leads to phosphorylation of the cystic fibrosis transmembrane 447

regulator (CFTR) by PKG (18, 32). Activation of CFTR stimulates the activity of a 448

Cl/HCO3- exchanger, which promotes an increase in secretion of HCO3

- into the 449

intestinal lumen (19). 450

In the kidney, it has been demonstrated that pendrin, an anion exchanger 451

found in β-intercalated cells, is downregulated at the transcriptional level by UGN 452

(29). Recently, our group has also demonstrated a role for UGN in the control of 453

luminal acidification (1, 21). Our findings suggest that guanylin peptides inhibit 454

bicarbonate reabsorption in proximal and distal segments of the nephron (1,20,21). 455

In contrast, recently, Rozenfeld and coworkers have demonstrated that UGN 456

downregulates the pendrin gene in β-intercalated cells (29) which in turns would 457

inhibit bicarbonate secretion. It is possible that this effect of UGN in β-intercalated 458

cells could be sort of a compensatory mechanism for the peptide inhibitory effect 459

on distal hydrogen secretion through α-intercalated cells of UGN. 460

The inhibition of H+-ATPase by a cGMP-dependent mechanism has been 461

described in plants (35) and in rat cortical collecting ducts (37). In the current 462

study we demonstrated that a permeable cGMP analogue inhibits distal hydrogen 463

21

secretion. In addition, a previous study from our laboratory has also demonstrated 464

the inhibition of distal hydrogen secretion by renoguanylin, a new member of the 465

guanylin family, through a mechanism dependent on PKG activation (20). 466

Moreover, the expression of guanilate cyclase C receptor has been demonstrated 467

in rat renal cortex (21) and, also, in MDCK-C11 cells, favoring the activation of the 468

classical guanylin receptor by UGN in these studies. In fact, our data show that 469

UGN incubation was able to stimulate the increment of the intracellular level of 470

cGMP and PKG activity in MDCK-C11 cells, which indicates the activation of the 471

classical pathway by UGN in this study. 472

In addition to the undeniable importance of the GC-C pathway on guanylin 473

action, especially during salt overload, when this receptor is upregulated (9, 27), 474

the presence of an additional receptor, other than GC-C, for UGN effect in the 475

kidney has been suggested (33). The mentioned studies have shown that GC-C 476

knockout mice still exhibit UGN-induced natriuresis (5), and also that UGN could 477

activate a G-protein receptor sensitive to pertussis toxin, in proximal tubule cells 478

(34). Moreover, we have previously demonstrated that UGN inhibits bicarbonate 479

reabsorption in proximal tubules through inhibition of NHE3 activity, by a 480

mechanism dependent on the activation of not only PKG but also the PKA 481

pathway. However, this same study showed that the activation of adenylyl cyclase 482

was not involved in the proximal effect of UGN (21). 483

In contrast to our previous work in proximal tubules (21), the present 484

observations showed that the PKA pathway was not involved in the distal effect of 485

UGN on hydrogen secretion, since the inhibition of PKA did not prevent the 486

inhibitory effect of UGN on distal hydrogen secretion. Besides, neither the 487

22

intracellular content of cAMP nor PKA activity were changed by UGN incubation of 488

MDCK-C11. Accordingly, the perfusion of distal segments with a cAMP analogue 489

did not promote a significant inhibitory effect of distal hydrogen secretion. 490

The activity of H+-ATPase may be regulated by trafficking, domain 491

assembly/disassembly, and changes in the ratio of ATP hydrolysis/H+-pumping as 492

well as by other means (39). Subcellular localization, regulation, and functional 493

differences of H+-ATPase populations may at least in part be regulated by the 494

presence of specific subunit isoforms. The B1, α4 and d2 isoforms have been 495

labeled as intercalated cell specific (38). Holliday et al. reported that the amino-496

terminal domains of both isoforms of the B subunit, B1 and B2, contain binding 497

sites to F-actin which may be responsible for the interaction between V-ATPase 498

and actin filaments in vivo and could allow for the observed trafficking (15). 499

The importance of the B1 subunit for the regulation of the proton pump has 500

been evidenced in patients with the inherited form of type 1 dRTA (distal renal 501

tubular acidosis). In humans, mutations of the gene encoding for the B1 subunit 502

(Atp6v1b1) in intercalated cells of distal tubule has been involved in the 503

pathogenesis of this disease (16). The characteristics of dRTA are not limited to 504

abnormal acid-base balance; hence it causes metabolic acidosis, but often 505

includes a salt-and potassium- losing nephropathy that may lead to hypokalemia 506

and dehydration (14, 30, 31). In the current study, we demonstrate that the 507

inhibitory effect of UGN on H+-ATPase activity in distal tubule involves reduction of 508

H+-ATPase B1 subunit abundance in the plasma membrane of distal tubule cells. 509

Besides, this effect was abolished in the presence of the PKG inhibitor, reinforcing 510

the involvement of the GC-C/cGMP/PKG pathway in the distal effect of UGN. 511

23

In summary, our findings indicate a role for UGN, a peptide known for its 512

effect in the regulation of sodium homeostasis, also in acid-base balance, by 513

inhibiting distal bicarbonate reabsorption. We suggest that UGN activates GC-C 514

receptors in distal segments of the nephron by increasing intracellular cGMP 515

content leading to PKG activation and decreasing insertion of H-ATPase B1 516

subunit in the apical membrane of α-intercalated cells. The data presented 517

herewith, also corroborate with previous studies that have postulated a role for 518

intercalated cells in the maintenance of body fluid and electrolyte balance, 519

involving inhibition of the B1 subunit of H+-ATPase (14). Furthermore, our current 520

and previous findings (21) and those of others (23, 26, 40) suggest UGN as a 521

possible counterregulator for the actions of the renin-angiotensin-aldosterone 522

system, a well-known promoter of sodium retention and acid extrusion by the 523

kidneys. 524

525

526

24

References 527

1. Amorim JB, Musa-Aziz R, Lessa LM, Malnic G, Fonteles MC. Effect of 528

uroguanylin on potassium and bicarbonate transport in rat renal tubules. 529

Can J Physiol Pharmacol 84: 1003-1010, 2006. 530

2. Boron WF, De Weer P. Intracellular pH transients in squid giant axons 531

caused by CO2, NH3, and metabolic inhibitors. J Gen Physiol 67: 91-532

112, 1976. 533

3. Carraro-Lacroix LR, Girardi AC, Malnic G. Long-term regulation of 534

vacuolar H(+)-ATPase by angiotensin II in proximal tubule cells. Pflugers 535

Arch 458: 969-79, 2009. 536

4. Carraro-Lacroix LR, Malnic G. Acid-base transport by the renal distal 537

nephron. J Nephrol.23 Suppl 16: S19-27, 2010. 538

5. Carrithers SL, Ott CE, Hill MJ, Johnson BR, Cai W, Chang JJ, Shah 539

RG, Sun C, Mann EA, Fonteles MC, Forte LR, Jackson BA, Giannella 540

RA, Greenberg RN. Guanylin and uroguanylin induce natriuresis in mice 541

lacking guanylyl cyclase-C receptor. Kidney Int 65: 40-53, 2004. 542

6. Fernandez R, Oliveira-Souza M, Malnic G. Na+-independent proton 543

secretion in MDCK-C11 cells. Pflugers Arch 441: 287-93, 2000. 544

7. Finberg KE, Wagner CA, Bailey MA, Wang T, Mentone SA, 545

Kashgarian M, Geibel JP, Lifton, RS. Loss of plasma membrane H-546

ATPase activity from cortical collecting duct intercalated cells of H-547

ATPase B1 subunit deficient mice: a mouse model of distal renal tubular 548

acidosis. J Am Soc Nephrol 13:4, 2002. 549

8. Fonteles MC, do Nascimento NR. Guanylin peptide family: history, 550

interactions with ANP, and new pharmacological perspectives. Can J 551

Physiol Pharmacol 89: 575-85, 2011. 552

9. Fonteles MC, Havt A, Prata RB, Prata PH, Monteiro HS, Lima AA, 553

Jorge AR, Santos CF, Greenberg RN, Nascimento NR. High-salt 554

intake primes the rat kidney to respond to a subthreshold uroguanylin 555

dose during ex vivo renal perfusion. Regul Pept 158: 6-13, 2009. 556

10. Forgac M. Vacuolar ATPases: rotary proton pumps in physiology and 557

pathophysiology. Nat Rev Mol Cell Biol 8: 917-29, 2007. 558

25

11. Forte LR, London RM, Freeman RH and Krause WJ. Guanylin 559

peptides: renal actions mediated by cyclic GMP. Am J Physiol Renal 560

Physiol 278: F180-F191, 2000. 561

12. Gekle M, Wuensch S, Oberleithner H, Silbernagl S. Characterization 562

of two MDCK cell subtypes as a model system to study principal cell and 563

intercalated cell properties. Pfluegers Arch 428:157-62, 1994. 564

13. Gil FZ, Malnic G. Effect of amphotericin B on renal tubular acidification 565

in the rat. Pfluegers Arch 413: 280-286, 1989. 566

14. Gueutin V, Vallet M, Jayat M, Peti-Peterdi J, Cornière N, Leviel F, 567

Sohet F, Wagner CA, Eladari D, Chambrey R. Renal β-intercalated 568

cells maintain body fluid and electrolyte balance. J Clin Invest 123:4219-569

31, 2013. 570

15. Holliday LS, Lu M, Lee BS, Nelson RD, Solivan S, Zhang L, Gluck 571

SL. The amino-terminal domain of the B subunit of vacuolar H+-ATPase 572

contains a filamentous actinbinding site. J Biol Chem 275: 32331-7, 573

2000. 574

16. Karet FE, Finberg KE, Nelson RD, Nayir A, Mocan H, Sanjad SA, 575

Rodriguez-Soriano J, Santos F, Cremers CW, Di Pietro A, Hoffbrand 576

BI, Winiarski J, Bakkaloglu A, Ozen S, Dusunsel R, Goodyer P, 577

Hulton SA, Wu DK, Skvorak AB, Morton CC, Cunningham MJ, Jha V, 578

Lifton RP. Mutations in the gene encoding B1 subunit of H+-ATPase 579

cause renal tubular acidosis with sensorineural deafness. Nat Genet 21: 580

84-90, 1999. 581

17. Kulaksiz H, Cetin Y. The electrolyte/fluid secretion stimulatory peptides 582

guanylin and uroguanylin and their common functional coupling proteins 583

in the rat pancreas: a correlative study of expression and cell-specific 584

localization. Pancreas. Am J Pathol 25:170-5, 2002. 585

18. Kulaksiz H, Schmid A, Hönscheid M, Eissele R, Klempnauer J, Cetin 586

Y. Guanylin in the human pancreas: a novel luminocrine regulatory 587

pathway of electrolyte secretion via cGMP and CFTR in the ductal 588

system. Histochem Cell Biol 115:131-45, 2001. 589

26

19. Lee MG, Choi JY, Luo X, Strickland E, Thomas PJ, Muallem S. Cystic 590

fibrosis transmembrane conductance regulator regulates luminal Cl-591

/HCO3- exchange in mouse submandibular and pancreatic ducts. J Biol 592

Chem 274: 14670-7, 1999. 593

20. Lessa LM, Amorim JB, Fonteles M, Malnic G. Effect of renoguanylin 594

on hydrogen/bicarbonate ion transport in rat renal tubules. Regul Pept 595

157: 37-43, 2009. 596

21. Lessa LM, Carraro-Lacroix LR, Crajoinas RO, Bezerra CN, Dariolli R, 597

Girardi AC, Fonteles MC, Malnic G. Mechanisms underlying the 598

inhibitory effects of uroguanylin on NHE3 transport activity in renal 599

proximal tubule. Am J Physiol Renal Physiol 303: F1399-408, 2012. 600

22. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein 601

measurement with the Folin phenol reagent. J Biol Chem 193: 265-275, 602

1951. 603

23. Michell AR, Debnam ES, Unwin, RJ. Regulation of Renal Function by 604

the Gastrointestinal Tract: Potential Role of Gut-Derived Peptides and 605

Hormones. Annu Rev Physiol 70:379-403, 2008. 606

24. Moss NG, Riguera DA, Fellner RC, Cazzolla C, Goy MF, Moss NG, 607

Goy MF. Natriuretic and antikaliuretic effects of uroguanylin and 608

prouroguanylin in the rat. Am J Physiol Renal Physiol 299: F1433-42, 609

2010. 610

25. Oliveira-Souza M, Malnic G, Mello-Aires M. Atrial natriuretic peptide 611

impairs the stimulatory effect of angiotensin II on H+-ATPase. Kidney 612

international 62: 1693–9, 2002. 613

26. Pech V, Zheng W, Pham TD, Verlander JW, Wall SM. Angiotensin II 614

activates H+-ATPase in type A intercalated cells. J Am Soc Nephrol 615

19:84-91, 2008. 616

27. Potthast R, Ehler E, Scheving LA, Sindic A, Schlatter E, Kuhn M. 617

High salt intake increases uroguanylin expression in mouse kidney. 618

Endocrinology 142: 3087-3097, 2001. 619

28. Rahbi H, Narayan H, Jones DJL, Ng LL. The uroguanylin system and 620

human disease. Clinical science 123: 659–68, 2012. 621

27

29. Rozenfeld J, Tal O, Kladnitsky O, Adler L, Efrati E, Carrithers SL, 622

Alper SL, Zelikovic I. The pendrin anion exchanger gene is 623

transcriptionally regulated by uroguanylin: a novel enterorenal link. Am J 624

Physiol Renal Physiol 302: F614-24, 2012. 625

30. Sebastian A, McSherry E, Morris RC Jr. Renal potassium wasting in 626

renal tubular acidosis (RTA): its occurrence in types 1 and 2 RTA despite 627

sustained correction of systemic acidosis. J Clin Invest 50: 667-78, 1971. 628

31. Sebastian A, McSherry E, Morris RC Jr. Impaired renal conservation of 629

sodium and chloride during sustained correction of systemic acidosis in 630

patients with type 1, classic renal tubular acidosis. J Clin Invest 58:454-631

69, 1976. 632

32. Seidler U, Blumenstein I, Kretz A, Viellard-Baron D, Rossmann H, 633

Colledge WH, Evans M, Ratcliff R, Gregor M. A functional CFTR 634

protein is required for mouse intestinal cAMP-, cGMP- and Ca(2+)-635

dependent HCO3- secretion. J Physiol 505:411-23, 1997. 636

33. Sindic A, Basoglu C, Cerci A, Hirsch JR, Potthast R, Kuhn M, 637

Ghanekar, Viswerswariah SS, Schlatter E. Guanylin, uroguanylin, and 638

heat-stable euterotoxin activate guanylate cyclase C and/or a pertussis 639

toxin-sensive G protein in human proximal tubule cells. J Biol Chem 640

277:17758-64, 2002. 641

34. Sindic A, Velic A, Basoglu C, Hirsch JR, Edemir B, Kuhn M, 642

Schlatter E. Uroguanylin and guanylin regulate transport of mouse 643

cortical collecting duct independent of guanylate cyclase C. Kidney Int 644

68: 1008-1017, 2005. 645

35. Suwastika IN, Gehring CA. The plasma membrane H+-ATPase from 646

Tradescantia stem and leaf tissue is modulated in vitro by cGMP. Arch 647

Biochem Biophys 367:137-9, 1999. 648

36. Thomas J, Buchsbaum R, Zimniak A, Racher E. Intracellular pH 649

measurements in Ehrlich ascites tumor cells utilizing spectroscopic 650

probes generated in situ. Biochemistry 18: 2210-2218, 1979. 651

28

37. Tojo A, Guzman NJ, Garg LC, Tisher CC, Madsen KM. Nitric oxide 652

inhibits bafilomycin-sensitive H+-ATPase activity in rat cortical collecting 653

duct. Am J Physiol Renal,Fluid Electrolyte Physiol 267:F509-F515, 1994. 654

38. Wagner CA, Devuyst O, Bourgeois S, Mohebbi N. Regulated acid-655

base transport in the collecting duct. Pflugers Arch 458: 137-56, 2009. 656

39. Wagner CA, Finberg KE, Breton S, Marshansky V, Brown D, Geibel 657

JP. Renal vacuolar H+-ATPase. Physiol Rev 84: 1263-314,2004. 658

40. Winter C, Kampik NB, Vedovelli L, Rothenberger F, Paunescu TG, 659

Stehberger PA, Brown D, John H, Wagner CA. Aldosterone stimulates 660

vacuolar H(+)-ATPase activity in renal acid-secretory intercalated cells 661

mainly via a protein kinase C-dependent pathway. Am J Physiol Cell 662

Physiol 301: C1251-61, 2011. 663

664

665

666

667

668

669

670

671

29

672

Table 1. Composition of solutions 673

Reagents Control NH4Cl O Na+ Calibration

NaCl 141.0 121.0 ---- 20,0

KCl 5.4 5.4 5.4 130,0

CaCl2 1.0 1.0 1.0 1,0

KH2PO4 0.4 0.4 0.4 ---

MgCl2 0.5 0.5 0.5 1,0

MgSO4 0.4 0.4 0.4 ---

Na2HPO4 0.3 0.3 ---- ---

HEPES 10.0 10.0 10.0 5

Glucose 0.6 0.6 0.6 ---

NH4Cl ---- 20.0 ---- ---

NMDG ---- ---- 141.3 ---

PH 7.4 7.4 7.4 6,5 / 7,0 / 7,5

Nigericin --- --- --- 0,00267

All values are in millimolars, except for pH. HCl or NaOH were used in all Na+-containing solutions to titrate to 674 the appropriate pH, and KOH was used in the Na+-free solution / HEPES 4-2-hydroxyethyl-1-675 piperazineethanesulfonic acid, NMDG N-methyl-D-glucamine 676

677

678

30

FIGURE LEGENDS 679

680

Figure 1: UGN effect on distal bicarbonate reabsorption involves H+-681

ATPase and NHE inhibition. JHCO3- was evaluated by means of stationary 682

microperfusion according to the protocol described in “Methods”. Kidney distal 683

tubules were perfused with control solution alone or together with uroguanylin 684

(UGN) (10-6 M) or the NHE inhibitor HMA (10-4 M) or/and the H-ATPase inhibitor 685

Concanamycin A (10-7M). Data are means ± SE. *p < 0.05 vs Control. 686

687

Figure 2 - 8Br-cGMP but not 8Br-cAMP mimicks the UGN effect on distal 688

bicarbonate reabsorption A, Experiments were performed in the presence of 689

8br-cGMP (10-6 M) and/or HMA (10-4 M), a selective inhibitor of NHE. B. Tubules 690

were perfused with 8br-cAMP (10-6 M) and/or HMA (10-4 M). Numbers of perfused 691

tubules are indicated in the bars. Data are means ± SE. *p < 0.05 vs Control; &p < 692

0,05 vs KT5823+UGN. 693

694

Figure 3: The inhibitory effect of UGN on H+ secretion in rat renal distal 695

tubule is mediated by PKG. A, Experiments were performed in the presence or 696

absence of uroguanylin (UGN) (10-6 M) and KT5823 (10-6 M), a selective inhibitor 697

of cGMP-dependent protein kinase (PKG), which prevented the effect promoted by 698

the peptide. B. Tubules were perfused with control solution with or without 699

uroguanylin and H89 (10-5 M), a PKA inhibitor, which was unable to prevent the 700

inhibitory effect of Uroguanylin. Numbers of perfused tubules are indicated in the 701

bars. Data are means ± SE. *p < 0.05 vs Control; #p < 0,05 vs KT5823+UGN. 702

31

Figura 4: Original Traces of Fluorescence Microscopy Experiments with 703

MDCK-C11 cells. The records show the recovery of pHi along 2 minutes after an 704

acid pulse with NH4Cl. The Figure shows three different conditions. A, control 705

solution with 135 mM Na+; B, 0Na+ solution and C, 1 µM uroguanylin (UGN) added 706

to the 0NA+ solution. 707

708

Figure 5: Uroguanylin inhibits Na+-independent pH recovery and hydrogen 709

flux (JH+) in MDCK C11 cells. MDCK-C11 cells were treated with control solution 710

(135mM Na), 0NA solution or 1µM Uroguanylin diluted in 0Na solution. After 711

intracellular acidification by means of the ammonium pulse technique in MDCK-712

C11 cells, the initial rates of pH recovery (pH units/min) were calculated from the 713

curves by linear regression analysis (A). In B are plotted the rates of hydrogen 714

extrusion which were obtained from the product of dpHi/dt and intracellular buffer 715

capacity βi of the avarege pHi of the experimental groups (pHi 6,5). Uroguanylin 716

(UGN) significantly inhibits Na+-independent pHi recovery and Hydrogen extrusion 717

in MDCK-C11.Number of experiments is indicated in the bars.*p<0,05 vs control, # 718

p<0.05 vs 0 Na. 719

720

Figure 6: Uroguanylin inhibits H+-ATPase-dependent pH recovery in MDCK 721

C11 cells by a PKG dependent pathway. MDCK-C11 cells were treated with 1µM 722

uroguanylin (UGN) or 8br-cGMP in the presence of EIPA (NHE1 inhibitor) and 723

Schering (H/K-ATPase inhibitor) and/or KT5823 (PKG inhibitor) diluted in 0Na 724

solution, after intracellular acidification by means of the ammonium pulse 725

technique. The initial rates of pHi recovery (pH units/min) were calculated from the 726

32

curves by linear regression analysis (A). In B are plotted the rates of hydrogen 727

extrusion which was obtained from the product of dpHi/dt and intracellular buffer 728

capacity βi of the average pHi of the experimental groups (pHi 6,5).Uroguanylin 729

(UGN) significantly inhibits H+-ATPase-dependent pHi recovery and hydrogen 730

extrusion in MDCK-C11 cells. Number of experiments is indicated in the 731

bars.*p<0.05 vs EIPA + SCH. 732

733

Figure 7. UGN stimulates increase of intracellular cGMP content and PKG 734

activity in MDCK-C11 cells, which express GC-C. A, Cells were incubated for 10 735

min with culture medium containing 1 mM 3-isobutyl-1-methylxanthine (IBMX) or 736

IBMX and 10-6 M Uroguanilyn or 10-6 M ANP during 10 minutes prior to lysis. The 737

generation of intracellular cGMP was estimated by enzyme immunoassay (cGMP 738

Direct Biotrak EIA, GE Healthcare) according to manufacturer’s protocol B, PKG 739

activity of UGN-treated cells was measured by the single-site and semi-quantative 740

CycLex cGK Assay Kit (CycLex Co., Ltd., Nagano, Japan) according to the 741

manufacturer’s protocols. UGN promoted an increase of PKG activities, as shown 742

in the bar graph. *p < 0.05 vs. Control.; C, Expression of GC-C receptor in MDCK-743

C11 cells. Total RNA was extracted, reverse transcribed and amplified as 744

described in “Methods”. PCR amplification, using specific primers, gave rise to one 745

band with the predicted size of 491 bp. MDCK-C11 cell cDNA was also tested for 746

the housekeeping gene 28S-rRNA. 747

748

Figure 8: UGN does not stimulate increase of intracellular cAMP content and 749

PKA activity in MDCK-C11 cells. A, MDCK- C11 cells were incubated for 10 min 750

33

with culture medium containing 1 mM 3-isobutyl-1-methylxanthine (IBMX) or IBMX 751

with uroguanylin (10-6 M) or forskolin (10-4 M). cAMP levels were measured by 752

enzyme immunoassay (cAMP Direct Biotrak EIA, GE Healthcare). Each assay was 753

performed in triplicate, and the mean values of 3 assays were calculated. B, PKA 754

activity was measured in MDCK-C11 lysates after treatment with UGN by the PKA 755

Kinase Activity Assay (Enzo Life Sciences, Inc., Farmingdale, NY) according to the 756

manufacturer's instructions. UGN does not promote a significant increase in the 757

activity of PKA, as shown in the bar graph. ***p < 0.05 vs. Control. 758

759

Figure 9. UGN decreases the surface expression of H+-ATPase B1 subunit in 760

MDCK-C11 cells by a PKG dependent mechanism. A and B. Equivalent 761

quantities (50 µg) of total cellular lysates from MDCK-C11 cells treated during 15 762

min with vehicle (CTRL), UGN or UGN combined with the PKG inhibitor were 763

subjected to SDS-PAGE and immunoblotting. A. Representative immunoblotting 764

using the monoclonal antibody against the B1 subunit of H+-ATPase. Actin was 765

used as an internal control. B. Representative immunoblotting using the 766

monoclonal antibody against the β subunit of H+/K+-ATPase. Actin was used as an 767

internal control. C and D. Cell surface biotinylated proteins, after treatment with 768

uroguanylin (UGN) or UGN + KT5823 (PKG inhibitor) for 15 minutes, were 769

subjected to SDS-PAGE and immunoblotting. Immunoblot analyses were 770

performed using (C) a monoclonal antibody against the B1 subunit of H+-ATPase 771

or (D) a monoclonal antibody against the β subunit of H+/K+-ATPase. The amount 772

of H+-ATPase B1 subunit and H+/K+-ATPase β subunit were quantitated by 773

34

densitometry. Number of experiments are indicated within the parenthesis. 774

**P<0.01 vs. CTRL 775

FIGURES

Figure 1

CTRL

HMA+CONC

UGN

HMA+CONC+U

GN0.0

0.5

1.0

1.5

** *

(6) (6)(12) (10)JHC

O3- , n

mol

/cm

2 .s

Figure 2

Control

8br-c

GMPHMA

8br-c

GMP + HMA

0.0

0.5

1.0

1.5

* *

(6) (7) (8) (10)

A

JHC

O3- , n

mol

/cm

2 .s

Control

8br-c

AMPHMA

8br-c

AMP + HMA

0.0

0.5

1.0

1.5

(6) (9) (8) (9)

B

JHC

O3- , n

mol

/cm

2 .s

Figure 3

CTRL

KT5823

UGN

KT5823

+UGN

0.0

0.5

1.0

1.5

*

A

(6) (16) (9)(6)

&JH

CO

3- , nm

ol/c

m2 .s

CTRLH89

UGN

H89+U

GN0.0

0.5

1.0

1.5

* *(6) (8) (6) (7)

B

JHC

O3- , n

mol

/cm

2 .s

Figure 4

5,8

6

6,2

6,4

6,6

6,8

7

7,2

7,4

7,6

6,2

6,4

6,6

6,8

7

7,2

7,4

7,6

1 2 3 4 5 6 7 8 9 10 11 12 13 14 t (min)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 t (min)

B

A Na 135mM NH4Cl

Na 135 mM

Na 135mM NH4Cl

0Na

C Na 135mM NH4Cl

UGN +0Na

t (min) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

Figure 5

Control

0Na

0Na +

UGN

0.00

0.05

0.10

0.15

0.20

** #

A

(10) (15) (10)dpH

i/dt (

pHun

its/m

in)

Control

0Na

0Na +

UGN

0

10

20

30

40

(10) (15) (10)* * #

B

J H(m

M/m

in)

Figure 6

EIPA + SCH

EIPA + SCH +

UGN

EIPA +

SCH + 8b

r-cGMP

EIPA + SCH +

KT5823

EIPA + SCH +

KT + UGN

0.00

0.01

0.02

0.03

0.04

0.05

* *

(6) (6) (8) (7)(9)dpHi

/dt (

unid

pH/m

in)

A

EIPA + SCH

EIPA + SCH +

UGN

EIPA + SCH +

8br -

cGMP

EIPA + SCH +

KT5823

EIPA + SCH +

KT + UGN

0

2

4

6

8

* *

(9) (6) (6) (8) (7)

B

J H(m

M/m

in)

Figure 7

CTRLUGN

ANP 0

100

200

300

* *

[cG

MP]

%C

RTL

CTRLUGN

ANP0

50

100

150

200

250

**

PKG

act

ivity

(% C

TRL)

A

B

C

Figure 8

CTRLUGN

Forskolin

0

200

400

600

800

1000

***cA

MP

(% C

TRL)

C T R L

U GN

F o rsk o lin

0

5 0

1 0 0

1 5 0

2 0 0

2 5 0

* * *

PK

A a

cti

vit

y(%

CT

RL

)

A

B

Figure 9