ROYAUME DU MAROC UNIVERSITE MOHAMMED V

FACULTE DE MEDECINE ET DE PHARMACIE RABAT

Année 2017 Numéro d’ordre : 22/16 CSVS

THÈSE DE DOCTORAT NATIONAL Centre d’Etude Doctoral Science de la vie et de la Santé

Formation Doctorale : Biologie médicale, Pathologie Humaine et Expérimentale et Environnementale

Intitulé de la thèse

Hajar LEMRISS Présentée et soutenue le 25 juillet 2017

JURY :

Professeur Président Faculté de Médecine et de Pharmacie, Université Mohammed V, Rabat

Professeur Azeddine IBRAHIMI Directeur de thèse Faculté de Médecine et de Pharmacie, Université Mohammed V, Rabat

Professeur Chakib NEJJARI Rapporteur Université Mohammed VI des Science de la Santé, Casablanca

Professeur Anas Kettani Rapporteur Faculté des Sciences Ben M’Sik, Université Hassan II, Casablanca

Professeur Rachid EL JAOUDI Rapporteur Faculté de Médecine et de Pharmacie, Université Mohammed V, Rabat

Analyse génomique de souches multi-résistantes de Staphylococcus capitis isolées dans des services

néonataux de plusieurs pays du monde

Dédicace

Un simple merci ne suffira pas à remercier ma famille.

A mes parents pour leur amour, leur présence et leur soutien sans faille.

Vous avez été des piliers durant ces années d’étude parfois laborieuses, vos encouragements ont

été bénéfiques et m’ont permis d’aller de l’avant.

Vous m’avez toujours poussé à faire ce que j’aimais. Trouvez ici le résultat de vos efforts, avec

toute la reconnaissance et l’amour que je vous porte.

A mon frère pour ta présence pendant les moments difficile, pour ta générosité infinie et ton

soutien. Je te dédie cette thèse et je te souhaite une vie pleine de joie, de bonheur et de succès.

A mes sœurs, qui ont été présentes et compréhensives, leurs appels et leurs mots de soutien m’ont

beaucoup apportés. Que cette thèse soit le témoignage de ma profonde affection.

A mon neveu, Youssouf, mon petit rayon de soleil.

A tout le reste de ma famille, ma grand-mère, ma tante, mon oncle,

mes cousins et mes cousines, pour vous encouragements je vous dédiez cette thèse avec ma

profonde affection.

REMERCIEMENTS

Cette thèse est le fruit de collaborations multiples entre le Laboratoire de

Biotechnologie Médicale (MedBiotech) de la Faculté de Médecine et de Pharmacie de Rabat,

Université Mohammed V, le Centre National de Référence des Staphylocoques (CNRS),

Lyon, France et le Laboratoire de Recherche et d’Analyses Médicales de la Fraternelle de la

Gendarmerie Royale (LRAM) Rabat. De plus, elle est le résultat d’un effort constant qui

n’aurait pu aboutir sans la contribution d’un nombre de personnes. Ainsi se présente

l’occasion de leur exprimer mes remerciements:

A Mon Directeur de thèse le Pr. Azeddine IBRAHIMI, Professeur d’Enseignement

Supérieur et Chef du Laboratoire de Biotechnologie Médicale (Médbiotech) à la Faculté de

Médecine et de Pharmacie de Rabat, Université Mohammed V, pour m’avoir accueilli dans

votre équipe de recherche, pour votre confiance dès le départ, pour votre encadrement, pour

votre disponibilité sans faille malgré un emploi du temps plus que chargé et pour votre

patience. Je tiens également à vous remercier pour la liberté d’action que vous m’avez donnée

à chaque étape, vos précieux conseils, vos connaissances scientifiques et vos encouragements

tout au long des années que j’ai passé au sein de votre laboratoire afin d'aboutir à cette thèse

d'analyse génomique. Veuillez trouver ici toute ma reconnaissance et mon profond respect.

A Monsieur le Dr Saâd EL KEBBAJ, Directeur du Laboratoire de Recherche et

d’Analyses Médicales de la fraternelle de la Gendarmerie Royale (LRAM), pour m’avoir

acceptée en tant que stagiaire à plusieurs reprises dans votre laboratoire afin d'apprendre les

outils de séquençage haut débit et d'analyses bioinformatiques pour aboutir à ce travail. Je

vous remercie pour l'intérêt que vous portez à la recherche scientifique et à l'avancée des

sciences biomédicales au Maroc. Veuillez trouver ici le témoignage de ma reconnaissance,

mes sincères remerciements et ma profonde gratitude.

A mon Co-encadrant de thèse le Pr. Frédéric Laurent, Professeur des Universités

de Microbiologie à la Faculté de Pharmacie de Lyon au sein de l’Université Claude Bernard

Lyon 1 et Co-directeur du Centre National de Référence des Staphylocoques, Lyon, France,

pour m’avoir confié ce sujet qui me paraissait si vaste et complexe au départ et qui s’avère

être si passionnant et enrichissant pour finir, et pour votre aide lors de la rédaction des articles

et pour nous avoir fourni les souches utilisées dans le présent travail. Je vous remercie

également pour votre disponibilité et la qualité de vos relations humaine, votre rigueur

scientifique, votre œil critique et pour tout le temps que vous m’avez consacré lors des

discussions constructives que nous avons échangées tout au long des années de doctorat.

J’espère sincèrement que ce travail sera l’occasion de pouvoir continuer à collaborer avec

votre laboratoire. Veuillez trouver ici l’expression de mes sincères remerciements et ma

profonde reconnaissance.

A ma Co-encadrante de thèse le Dr Sanaâ LEMRISS, Chef du Département de

Biosécurité PCL3 au sein du LRAM. Pour m’avoir si chaleureusement accueillie dans votre

laboratoire, pour m’avoir initié dans ce domaine et pour m’avoir guidée avec compétence. Je

tiens également à vous remercier pour votre patience et soutien tout au long de mon stage de

master et de ces années de thèse. Votre encadrement, vos encouragements et vos conseils

précieux pour l’élaboration de ce travail resteront à jamais marqués dans mon cœur. Merci de

m’avoir orientée vers ce sujet vaste et passionnant que représente le séquençage à haut débit

et l’analyse bioinformatique. Veuillez trouver ici l’expression de ma profonde reconnaissance.

A Mr. Le président de jury ainsi que les membres de jury, malgré vos multiples

occupations vous me faites l’honneur d’évaluer mon travail en acceptant de participer à mon

jury. Je vous exprime ma profonde gratitude.

A Monsieur le Pr. Jamal TAOUFIK, Professeur d’Enseignement Supérieure et

Directeur du Centre d’Etudes Doctorales des Sciences de la Vie et de la Santé à la Faculté de

Médecine et de Pharmacie de Rabat, Université Mohammed V, pour m’avoir inscrit au sein

de cet établissement et pour votre aide administrative. Aussi de me faire l’honneur de présider

le jury de cette soutenance de thèse malgré vos nombreuses occupations. Veuillez trouvez ici

toute ma reconnaissance et mes sincères remerciements.

A Monsieur le Pr. Chakib NEJJARI, Professeur d’enseignement Supérieure et

Président de l’Université Mohammed VI des Sciences de la Santé de Casablanca, pour

m’avoir accordé du temps et d’avoir accepté de participer à ce jury en tant que rapporteur de

cette thèse malgré votre emploi du temps plus que chargé. Veuillez trouver ici le témoignage

de mes respectueuses considérations.

A Monsieur le Pr. Anas Kettani, Professeur d’Enseignement Supérieure à la Faculté

des Sciences Ben M’Sik, Université Hassan II de Casablanca, pour m’avoir accordé du temps

en participant à ce jury et d’avoir la gentillesse de bien vouloir juger ce travail en tant que

rapporteur. Je tiens également à vous remercier pour vos encouragements tout au long de mes

années d’études et de vos précieux conseils. Veuillez trouver ici toute ma reconnaissance et

mon profond respect.

A Monsieur le Pr. Rachid ELJAOUDI, Professeur Agrégé à la Faculté de Médecine

et de Pharmacie de Rabat. Je vous suis reconnaissante d’avoir accepté de participer à ce jury

et de bien vouloir juger ce travail en tant rapporteur. Veuillez trouver ici l’expression de ma

profonde reconnaissance.

A Madame le Dr Patrícia Martins Simões, Ingénieur de recherche en

bioinformatique au laboratoire de bactériologie au Centre International de Recherche en

Infectiologie (CIRI), Hospices Civils de Lyon et fait partie de l’Equipe ”Pathogenèse des

infections à staphylocoques” du Centre National de Référence des Staphylocoques, Lyon,

France, pour avoir accepté de travailler en équipe l’analyse bioinformatique sur les données

de séquençage, pour votre aide, vos suggestions et pour vos judicieux conseils au moment de

la rédaction des articles. Je n’ai pu qu’apprécier votre réactivité au cours de nos discussions,

souvent virtuelles, pour aboutir à ce travail collaboratif, preuve que la science est avant tout

une histoire humaine. Bonne chance pour la suite et j’espère que nos chemins se recroiseront.

Veuillez trouver ici l’expression de ma profonde reconnaissance.

A Monsieur le Dr Jean-Philippe Rasigade, Biologiste Médicale au Centre

International de Recherche en Infectiologie (CIRI), Hospices Civils de Lyon, pour votre aide,

pour votre participation et vos conseils avisés au cours de la correction des articles. Veuillez

trouver ici l’expression de mes sincères remerciements.

A Madame le Dr Marine BUTIN, Pédiatre à Centre Hospitalier Universitaire de

Lyon, France et thésard au laboratoire de bactériologie médicale, Hospices Civils de Lyon.

J’ai beaucoup apprécié la qualité de nos échanges scientifiques et de travailler avec toi la

partie génomique de ce projet, merci pour ta motivation, ton énergie et tes conseils. Veuillez

trouver ici l’expression de mes sincères remerciements.

A Monsieur le Doctorant Yann Dumon, Thésard au laboratoire de bactériologie au

Centre International de Recherche en Infectiologie (CIRI), Hospices Civils de Lyon, qui nous

a rejoint en cours de route, merci pour ta contribution dans l’analyse bioinformatique et ton

aide. Veuillez trouver mes sincères remerciements.

A l’équipe du Centre Nationale de Référence des staphylocoques (CNR), je tiens

à remercier les personnes qui ont participé à ce travail, je vous renouvelle ma gratitude pour

vos efforts et vous souhaitez la réussite que vous méritez.

A Mlle Amal SOURI, Chef adjoint du Département de Biosécurité PCL3 au sein du

LRAM, pour votre aide et vos conseils durant toutes les années de ma thèse. Veuillez trouver

ici l’expression de mes sincères remerciements et l’expression de ma profonde

reconnaissance.

A Madame le Pr. Aicha RIFAI, Professeur Assistant à la Faculté des Sciences

Université Chouaib Doukkali pour avoir pris le temps de relire mon manuscrit. Veuillez

recevoir l’expression de ma profonde reconnaissance.

A l’équipe du Département de Biosécurité PCL3, LRAM, j’ai pu passer mes stages

dans un cadre particulièrement agréable, grâce à l’ensemble des membres de l’équipe de

Département de Biosécurité PCL3. Un immense merci pour leur aide, leur gentillesse, leur

infinie patience…, et leur bonne humeur.

Un grand merci à mes collègues au sein du laboratoire de Biotechnologie Médicale

(MedBiotech) pour leur soutien et leurs encouragements.

Ces remerciements ne seraient pas complets sans une pensée pour mes magnifiques

collègues de la promotion doctorale mes amis de longue date. Merci de m’avoir aidé et

encouragé, et pour m’avoir changé les idées quand j’en avais besoin.

Finalement, au terme de ce travail je tiens à remercier toutes les personnes que j'ai

rencontrées lors de mes études doctorales et qui ont contribué de près ou de loin au bon

déroulement de cette thèse.

LISTE DES PUBLICATIONS

ARTICLES

1. Lemriss, H., Martins Simões P., Lemriss, S., Butin, M., Ibrahimi, A., El Kabbaj, S.,

Rasigade JP., Laurent, F. (2014). Non-contiguous finished genome sequence

of Staphylococcus capitis CR01 (pulsetype NRCS-A). Standards in Genomic

Sciences, 9(3), 1118–1127.

2. Lemriss H., Dumont Y, Lemriss S., Martins-Simoes P., Butin M, Lahlou L., Rasigade JP,

El Kabbaj S., Laurent F., Ibrahimi A. (2015). Genome Sequences of Four Staphylococcus

capitis NRCS-A Isolates from Geographically Distant Neonatal Intensive Care

Units. Genome Announcements, 3(4), e00501–15.

3. Lemriss, H., Lemriss, S., Martins-Simoes, P., Butin, M., Lahlou, L., Rasigade, J.-P., El

Kabbaj, S. (2016). Genome Sequences of Multiresistant Staphylococcus capitis Pulsotype

NRCS-A and Methicillin-Susceptible S. capitis Pulsotype NRCS-C. Genome

Announcements. 4(3):e00541-16.

4. Martins Simões, P., Rasigade, J.-P., Lemriss, H., Butin, M., Ginevra, C., Lemriss, S.,

Goering, R. V., Ibrahimi, A., Picaud, J. C., El Kabbaj, S., Vandenesch, F and Laurent, F.

(2013). Characterization of a Novel Composite Staphylococcal Cassette

Chromosome mec (SCCmec-SCCcad/ars/cop) in the Neonatal Sepsis-Associated

Staphylococcus capitis Pulsotype NRCS-A. Antimicrobial Agents and

Chemotherapy, 57(12), 6354–6357.

5. Martins-Simoes P., Lemriss, H., Dumont, Y., Lemriss, S., Rasigade, J.-P., Assant-

Trouillet, S., Ibrahimi, A., El Kabbaj., Butin, M and Laurent, F. (2016). Single-Molecule

Sequencing (PacBio) of the Staphylococcus capitis NRCS-A Clone Reveals the Basis of

Multidrug Resistance and Adaptation to the Neonatal Intensive Care Unit

Environment. Frontiers in Microbiology, 7, 1991.

6. Butin, M., Rasigade, JP., Martins-Simões, P., Meugnier, H., Lemriss, H., Goering,

RV., Kearns, A., Deighton, MA., Denis, O., Ibrahimi, A., Claris, O., Vandenesch

F., Picaud JC and Laurent, F. (2015) Wide geographical dissemination of the

multiresistant Staphylococcus capitis NRCS-A clone in neonatal intensive-care units.

Clinical Microbiology and Infection, vol. 22, no. 1, pp. 46-52.

COMMUNICATIONS ORALES

1- P. Martins-Simões, Y. Dumont, M. Butin, H. Lemriss, S. Lemriss, A. Ibrahimi, S.El

Kabbaj, F. Vandenesch, J.P. Rasigade, F. Laurent. Caractérisation moléculaire par

séquençage PacBio du clone endémique mondial S. capitis NRCS-A responsable de sepsis

en réanimation néonatale : résistances, virulence et avantage sélectif. RICAI, Paris, 14

Décembre 2015.

2- P. Martins Simoes, H. Lemriss, J.-P. Rasigade, S. Lemriss, F. Vandenesch, S. El Kabbaj,

F. Laurent. Staphylococcus capitis NRCS-A: SCC, SCCMEC and Their Evolutionary

History. 5th Congrees of European Microbiologists, FEMS, Juillet 2013

3- M. Butin, P. Martins Simões, J.P. Rasigade, S. Lemriss, H. Lemriss, S. El Kabbaj, A.

Ibrahimi, S. Tigaud, F. Vandenesch, O. Claris, J.C. Picaud, F. Laurent. Diffusion mondiale

du clone Staphylococcus capitis NRCS-A en réanimation néonatale : caractérisation

moléculaire, analyse génomique et histoire évolutive. RICAI, Paris, 21 Novembre 2013.

4- Martins Simões P, Butin M, Lemriss H, Lemriss S, Deighton MA, Kearns A, Denis O,

Goering R, Ginevra C, Picaud JC, Ibrahimi A, EL Kabbaj S, Vandenesch F, Rasigade J-P,

Laurent F. Worldwide distribution of an endemic multi-resistant NRCS-A Staphylococcus

capitis clone in NICU: molecular typing, whole genome analysis and evolutionary

history.10th International Meeting on Microbial Epidemiological Markers, Paris, 02-05

October 2013.

COMMUNICATIONS AFICHEES

1- Butin M, Martins Simões P, Lemriss H, Lemriss S, Vandenesch F, Claris O, Picaud

JC, Rasigade JP, Laurent F. Staphylococcus capitis in neonatal late-onset sepsis:

unexpected worldwide dissemination of an endemic multi-resistant clone. European

Academy of Pediatric Societies. Barcelone, 17 - 21 October 2014.

RESUME

La prévalence des infections staphylococciques, nosocomiales et communautaires, augmente

régulièrement. Le traitement de ces infections est devenu de plus en plus difficile à cause de

l’émergence de souches multirésistantes. Les Staphylocoques ont la capacité d'acquérir des

déterminants de la résistance aux antimicrobiens rapidement, en particulier après

l'introduction de nouveaux agents antimicrobiens dans la pratique clinique.

Récemment, de nombreuses études ont décrit l’émergence dans les hôpitaux de plusieurs

pays, et particulièrement dans les unités de soins intensifs néonatales (USIN), des isolats de

Staphylococcus capitis résistantes à la méthicilline et ayant une sensibilité réduites à la

vancomycine (VISA). Ces isolats de S. capitis ont causé des septicémies mortelles chez les

nourrissons de faible poids (<1500 g), ce qui a entraîné une vague d'échecs thérapeutiques et

des problèmes socio-économiques.

Une étude de séquençage de haut débit (NGS), d’assemblage, d’analyse bioinformatique des

données NGS, de typage moléculaire et de comparaison des génomes complets de neuf

souches de S. capitis isolées de différents USIN dans le monde à différentes périodes a été mis

en place afin de contribuer à améliorer et à approfondir les connaissances sur le génome

complet de cet espèce peu étudié dans le monde.

Les objectifs étaient d'analyser et de comparer les éléments génétiques communs de ces neuf

souches aux six génomes de l’espèce S. capitis isolés chez des adultes et d'autres souches de

staphylocoques d’une part et de caractériser le clone NRCS-A et de comprendre les origines

de son succès d’autre part.

Les résultats de cette analyse et de comparaison de génomes ont permis d’avoir un premier

génome de référence de la souche S. capitis CR01 et l’identification des transferts horizontaux

des éléments génétiques mobiles (SCCmec-SCCcad / ars / cop et l’élément CRIPR, plasmide

et phage), des gènes de résistance aux antibiotiques, des déterminants de virulences associés à

la pathogénicité, de transposon, des séquences d’insertions et un gène nsr trouvé

exclusivement dans les souches de S. capitis appartenant au clone NRCS-A fonctionnel et

confère une résistance à la nisine.

Les caractéristiques génomiques trouvées mettent l'accent sur la contribution des éléments

génétiques mobiles à l'émergence de la résistance multiple du clone de S. capitis NRCS-A et

sur l'unicité du clone NRCS-A en ce qui concerne la résistance aux antibiotiques, les facteurs

de virulence et les éléments génétiques. Aucun déterminant de virulence connu spécifique à

NRCS-A n'a été détecté, ce qui ne soutient pas le rôle de la virulence en tant que force

motrice de l'émergence du NRCS-A dans les USIN du monde entier.

En conclusion, notre étude a permis de caractériser, d’élucidé et d’enrichir les connaissances

sur les génomes de S.capitis, ainsi que les mécanismes génétique impliqués à l’émergence,

l’évolution, l’adaptation et la dissémination du clone endémique NRCS-A.

Mots-clés : Staphylococcus capitis, NGS, bioinformatique, élément mobile, cassette

SCCmec-SCCcad / ars / cop, résistance aux antibiotiques, virulence, phage, plasmide,

transposon, évolution et dissémination clonale, NRCS-A.

ABSTRACT

The prevalence of staphylococcal nosocomial and community infections increases steadily.

Treatment of these infections has become increasingly difficult due to the emergence of

multidrug resistant strains. Staphylococci have the ability to acquire determinants of

antimicrobial resistance quickly, especially after the introduction of new antimicrobial agents

into clinical practice.

Recently, many studies have described the emergence of methicillin-resistant Staphylococcus

capitis isolates with reduced sensitivity to vancomycin (VISA) in hospitals in several

countries, particularly in the neonatal intensive care units (NICUs). These S. capitis isolates

caused fatal septicemia in low-weight infants (<1500 g), which resulted in a wave of

therapeutic failures and socio-economic problems.

A study using high-throughput sequencing (NGS), assembly, bioinformatics analysis of NGS

data, molecular typing and complete genome comparison of nine S. capitis strains which are

isolated from different NICUs worldwide at different period of time has been set up to

contribute to the improvement and deepening of knowledge about the complete genome of

this little studied species in the world.

The objectives were to analyze and compare the common genetic elements of these nine

strains to six S. capitis genomes isolated from adults and other strains of staphylococci in one

hand, and to characterize the NRCS-A clone and understand the origins of his success on the

other hand.

The results of this analysis and comparison of genomes allowed to have a first reference

genome of the S. capitis CR01 strain and the identification of the horizontal translocations of

the mobile genetic elements (SCCmec-SCCcad / ars / CRIPR, plasmid and phage), antibiotic

resistance genes, pathogenicity-associated virulence determinants, transposon, insert

sequences and an nsr gene found exclusively in S. capitis strains belonging to clone NRCS- A

which is functional and confers resistance to nisin.

The genomic characteristics found in this study emphasize the contribution of mobile genetic

elements to the emergence of multiple resistance of the S. capitis NRCS-A clone and the

uniqueness of the NRCS-A clone concerning antibiotic resistance, virulence factors and

genetic elements.

No known virulence determinant specific to NRCS-A has been detected, which does not

support the role of virulence as a driving force for the emergence of NRCS-A in NICUs

around the world.

In conclusion, our study allowed us to characterize, elucidate and enrich the knowledge on the

genomes of S.capitis, as well as the genetic mechanisms involved in the emergence,

evolution, adaptation and spread of the clone Endemic NRCS-A.

Keywords: NSCS-A, Staphylococcus capitis, NGS, bioinformatics, mobile element, cassette

SCCmec-SCCcad / ars / cop, resistance to antibiotics, virulence, phage, plasmid, transposon,

evolution and clonal dissemination.

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 1

SOMMAIRE

INTRODUCTION 13

OBJECTIF DELA THESE 17

CHAPITRE I: Revue bibliographique 18

I.1 GENOMIQUE 18

I.1.1 Révolution biologique 18

I.1.2 Séquençage génomique 20

I.1.2.1 Historique 20

I.1.2.2 Constitution de banque d’ADN 22

I.1.2.3 Séquençage 1er

Génération 24

I.1.2.3.1 Méthodes de séquençage 24

I.1.2.3.2 Automatisation de méthode de Sanger 26

I.1.2.3.3 Stratégies de séquençage de génome entier 27

I.1.2.4 Séquençage nouvelle génération (Next Generation Sequencing (NGS)) 30

I.1.2.4.1 Séquençage de 2ème

génération 31

I.1.2.4.2 Séquençage de 3ème

génération 39

I.1.2.4.3 Technologies émergentes 40

I.1.2.5 Application de séquençage à haut débit 41

I.1.2.5.1 Le séquençage de novo 41

I.1.2.5.2 Le reséquençage 41

I.1.2.5.3 La métgénomique 42

I.1.2.6 Génomique comparative et exploitation des génomes 42

I.1.2.6.1 Assemblages des génomes 42

I.1.2.6.2 Annotation des génomes 44

I.1.2.6.3 Apport de la génomique comparative 44

I.2 LES STAPHYLOCOQUES 47

I.2.1 Taxonomie 47

I.2.1.1 Historique 47

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 2

I.2.1.2 Classification 47

I.2.2 Réservoir et transmission 48

I.2.3 Physiopathologie 48

I.2.4 Infection 49

I.2.5 Caractéristiques intrinsèques 50

I.2.5.1 Génome 50

I.2.5.2 Enveloppe cellulaire 50

I.2.5.3 Capsule 50

I.2.5.4 Facteurs de virulence 51

I.2.5.5 Régulation des facteurs de virulence 52

I.2.6 Antibiothérapie 53

I.2.6.1 Mécanismes d’action des antibiotiques 53

I.2.6.2 Résistance aux antibiotiques 54

I.2.7 Cassettes SCCmec 56

I.2.7.1 Définition 56

I.2.7.2 Structure générale 57

I.2.7.3 Classification et typage 57

I.2.8 Staphylococcus capitis 60

I.2.8.1 Taxonomie 60

I.2.8.2 Habitat 60

I.2.8.3 Pouvoir pathogène 60

I.2.8.4 Résistance aux antibiotiques 60

I.2.8.5 Caractères bactériologiques 61

I.2.8.6 Caractéristiques génomiques 61

CHAPITRE II: Séquence génomique complète de Staphylococcus capitis

CR01 : Génome de référence 63

II.1 Abstract 65

II.2 Introduction 65

II.3 Classification and information 65

II.4 Genome sequencing information 70

II.5 Genome project history 70

II.6 Growth conditions and DNA isolation 70

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 3

II.7 Genome sequencing and assembly 70

II.8 Genome annotation 71

II.9 Genome properties 71

II.10 Conclusion 73

II.11 Acknowledgments 74

II.12 References 74

CHAPITRE III: Séquençage de huit isolats de Staphylococus capitis isolées

de différentes régions géographiques dans le monde 77

III.1 Genome Sequences of Four Staphylococcus capitis NRCS-A Isolates from

Geographically Distant Neonatal Intensive Care Units 79

III.2 Genome Sequences of multiresistant Staphylococcus capitis pulsotype NRCS-A and

methicillin- 2 susceptible Staphylococcus capitis pulsotype NRCS-C 83

CHAPITRE IV: Génomique comparative de souches de Stapylococcus

capitis 88

IV.1 Characterization of a Novel Composite Staphylococcal Cassette Chromosome mec

(SCCmec-SCCcad/ars/cop) in the Neonatal Sepsis-Associated Staphylococcus capitis

Pulsotype NRCS-A 91

IV.2 Single-Molecule Sequencing (PacBio) of the Staphylococcus capitis NRCS-A Clone

Reveals the Basis of Multidrug Resistance and Adaptation to the Neonatal Intensive

Care Unit Environment 107

IV.2.1 Abstract 107

IV.2.2 Introduction 108

IV.2.3 Methods 109

IV.2.4 Results 113

IV.2.5 Discussion 122

IV.2.6 Author contributions 123

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 4

IV.2.7 Funding 123

IV.2.8 Acknowledgments 123

IV.2.9 References 124

IV.2.10 Supplementary data 129

CHAPITRE V: Diffusion mondiale du clone Staphylococcus capitis NRCS-A

en réanimation néonatale : caractérisation moléculaire, analyse génomique

et histoire évolutive 136

V.1 Abstract 138

V.2 Introduction 138

V.3 Materials and Methods 139

V.4 Results 142

V.5 Discussion 146

V.6 Conclusion 147

V.7 Transparency declaration 148

V.8 Acknowledgements 148

V.9 References 148

V.10 Supplementary data 150

CHAPITRE VI : DISCUSSION GENERALE ET PERSPECTIVES 154

REFERENCES BIBLIOGRAPHIQUES 166

ANNEXES 181

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 5

LISTE DES ABREVIATIONS

ADN : Acide désoxyribonucléique

ADNc : ADN complémentaire

Agr : accessory gene regulator

ARN : Acide ribonucléique

ARNm : ARN messager

ARNt : ARN de transfert

AST : Antimicrobial Susceptibility Testing

BAC : Chromosomes Artificiels Bactériens

BBH : Bidirectional best hits

BLAST : Basic Local Alignment Search Tool

BMR : Bactéries Multirésistantes

bp : Base pair (paire de base)

CARD : Comprehensive Antibiotic Resistance Database

ccr : Cassette Chromosome Recombinase

CDS : Coding Sequence (sequence codante)

CHUV : Centre Hospitalier Universitaire Vaudois

CMI : Concentration Minimale Inhibitrice

COG : Cluster of Orthologous Groups (Groupe de Cluster Orthologues)

CoNS : Coagulase-negative staphylococci

CRISPR : Clustered Regularly Interspaced Short Palindromic Repeat

CRT : Cyclic Reversible Termination

dru-typing : Direct repeat units typing

ddNTP : Didésoxyribonucéotides triphosphate

dNTP : Désoxyribonucéotides triphosphate

emPCR : PCR en émulsion

FC : Flow Cell

FRET : Fluorescence Resonance Emission Transfer

GIs : Genomic Islands

GISA : Glycopeptide intermidiate Staphylococcus aureus

GTR : General Time Reversable

IHGSC : International Human Genome Sequencing Consortium

KEGG : Kyoto Encyclopedia of Genes and Genomes

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 6

LISTE DES ABREVIATIONS (Suite)

LOS : late-onset sepsis

NICU : neonatal intensive care units

MALDI-TOF : Matrix-Assisted Laser Desorption Ionization Time-Of-Flight

MID : Multiplex Identifier

MGE : Mobile Genetic Elements

ML : Maximum Likelihood

MLST : Multi Locus Sequence Typing

MSCRAMM : Microbial Surface Components Recognizing Adhesive Matrix Molecules

NCBI : National center for biotechnology information

NGS : Next-generation sequencing

NTS : Nouvelles Techniques de Séquençages

ORF : Open Reading Frames

ORF : Open Reading Frame

pb : paire de bases

PBP : Penicillin Binding Proteins

PCR : Polymerase Chain Reaction

PFGE : Pulsed-field gel electrophoresis

PGM : Personal Genome Machine

PMS : Phenol Soluble Modulin

PTP : PicoTiterPlate

PVL : Leucocidine de Panton-Valentine

SARM : S. aureus résistants à la méticilline

SARM-C : S. aureus résistants à la méticilline d’origine communautaire

SARM-H : Staphylococcus aureus Résistant à la Méticilline Hospitalier

SASM : S. aureus sensible à la méticilline

SCC : Staphylococcal Chromosomal Cassette

SCCmec : Staphylococcal Chromosomal Cassette mec

SCN : Staphylocoques à Coagulase Négative

SCP : Staphylocoques à Coagulase Positive

SCNRM : SCN résistants à la méticilline

SMS : Single Molecule Sequencing

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 7

LISTE DES ABREVIATIONS (Suite)

SMRT : Single Molecule Real Time

SNN : Septicémies nosocomiales néonatales

SNP : Single Nucleotide Polymorphism

SOLiD : Sequencing by Oligonucleotide Ligation and Detection

RAST : Rapid annotation using subsystem technology

RDP : Ribosomal Database Project

VFDB : Virulence Factors database

VISA : Vancomycin Intermediate Staphylococcus aureus

WGS : Whole genome sequencing

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 8

LISTE DES FIGURES

Figure I.1 : Dogme central de la biologie moléculaire.

Figure I.2 : Evolution du nombre de génomes complets disponible

(http://www.genomesonline.org).

Figure I.3 : Quelques étapes importantes démontrant l’évolution des progrès du

séquençage (Blow, 2008).

Figure I.4 : Schéma simplifié de préparation de banques d’ADN génomique et d’ADNc

(http://www.britannica.com/).

Figure I.5 : Schéma récapitulatif de la méthode de séquençage de Maxim et Gilbert

(http://departments.oxy.edu/biology/Stillman/bi221/092200/lecture_notes.htm).

Figure I.6 : Séquençage d’ADN par synthèse enzymatique avec chimie dye primer et dye

terminator (http://www.appliedbiosystems.com/).

Figure I.7 : Schéma de la stratégie du séquençage aléatoire global

(www.bio.davidson.edu/COures/genomics/method/shotgun.html).

Figure I.8 : Schéma simplifiée de la stratégie de séquençage "clone par clone".

Figure I.9 : Chronologie de la commercialisation des séquenceurs à haut-débit

Figure I.10 : Etapes du pyroséquençage (Ahmadianet al., 2006).

Figure I.11 : Préparation de la libraire d’ADN (http://www.454.com/).

Figure I.12 : Préparation des billes où sont fixées les sstDNA pour le séquenceur 454

(http://www.454.com/).

Figure I.13 : Schéma simplifié de Pyroséquençage sur PTP 454 (http://www.454.com/).

Figure I.14 : Amplification en pont de la technologie Illumina ((http://www.illumina.com/).

Figure I.15 : Les principales infections staphylococciques.

Figure I.16 : Facteurs de virulence exprimés à la surface ou excrétés par S. aureus en

fonction de la densité bactérienne (Ferry T et al., 2005).

Figure I.17 : L’histoire d’apparition des antibiotiques et des SARMs (Kos et al.,2012).

Figure I.18 : Représentation des 4 types de cassettes SCCmec (Hiramatsuet al., 2002).

Figure I.19 : Représentation schématique des 8 cassettes SCCmec (Van den Eede et al.,

2009).

Figure II.1 : Reference mass spectrum from Staphylococcus capitis strain (CR01).

Figure II.2 : Transmission electron microscopy of Staphylococcus capitis strain (CR01)

using a JEOL 1400. The scale bar represents 200 nm.

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 9

LISTE DES FIGURES (Suite)

Figure II.3 : 16S rRNA Phylogenetic tree highlighting the position of Staphylococcus

capitis strain CR01 (indicated by the yellow circle) relative to other type strains

within the genus Staphylococcus.

Figure II.4 : Graphical circular map of the chromosome

Figure IV.1.1 : Comparative structure analysis of the composite staphylococcal chromosome

cassette SCCmec-SCCcad/asr/cop element of Staphylococcus capitis strain

CR01.

Figure IV.1.2 : Phylogenetic analysis of whole genome-sequenced S. capitis strains and

proposed evolutionary history of SCC elements acquisition in S. capitis.

Figure IV.1.3 : Schematic diagram and comparative analysis of the clustered regularly inter-

spaced short palindromic region (CRISPR) region in Staphylococcus capitis

strain CR01 SCCmec element with ST398 LA-MRSA strain 08BA02176.

Figure IV.2.1 : Comparison of the genetic content of the strain CR01 plasmid with the draft

genomes of the other three NRCS-A strains

Figure IV.2.2 : Comparison of the genetic content of the strain CR01 intact prophage present

in the other three draft genomes of NRCS-A strains.

Figure V.1 : Dendrogram and schematic representation of pulsotypes and dru types of

100 Staphylococcus capitis isolates from neonatal intensive-care units (NICUs)

(n = 86) or other settings (n = 14).

Figure V.2 : Single-nucleotide polymorphism (SNP)-based maximum-likelihood tree with

whole genome sequences of neonatal Staphylococcus capitis isolates from four

distinct countries and publicly available S. capitis genomes.

Figure V.S1 : Molecular characterization of S. capitis bloodstream isolates from neonates

(n = 12) and adult patients (n = 2).

Figure V.S2 : Flow diagram of isolate selection.

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 10

LISTE DES TABLEAUX

Tableau I.1 : Mécanismes d’action des principales familles d’antibiotiques utilisées chez

l’Humain.

Tableau I.2 : Identification biochimique de S. capitis

Tableau I.3 : Lieu, origine et date de séquençage des 3 souches S. capitis.

Tableau I.4 : Caractéristiques générales du génome des trois souches de S. capitis

(http://www.ncbi.nlm.nih.gov/genome/genomes/2054?details=on&

http://www.ncbi.nlm.nih.gov/genome/genomes/155?details=on&project_id=53

751).

Table II.1 : Classification and general features of Staphylococcus capitis strain CR01,

pulsetype-NRCS-A according the MIGS recommendation.

Table II.2 : Project information.

Table II.3 : Nucleotide content and gene count levels of the genome.

Table II.4 : Number of genes associated with general COG functional categories.

Table III.1 : Summary of genome sequencing in the present study.

Table IV.1.S1 : Open reading frames of the novel composite staphylococcal chromosome

cassette (SCC) found in methicillin-resistant Staphylococcus capitis NCRS-A

prototype strain CR01. The first 42 ORFs (orf1 to orf42) were found in the

SCCmec element, while orf43 to orf70 were found in the SCCcad/ars/cop

element.

Table IV.1.S2 : Highest probable matches for the 15 interspersed DNA sequences (spacers)

identified in the clustered regularly inter-spaced short palindromic repeats

(CRISPR) region within the SCCmec element found in S. capitis strain CR01.

Table IV.2.1 : Baterial strains used in nisin susceptibility test.

Table IV.2.2 : General genomic features of S. capitis strain CR01 compared with another

three WGS NRCS-A genomes.

Table IV.2.3 : Comparison of virulence factors in S. capitis NRCS-A, non-NRCS-A, and S.

epidermidis after exclusion of virulence factors present only in S. aureus.

Table IV.2.4 : Genomic profiles of antibiotic resistance for clone NRCS-A strains from four

different countries.

Table IV.2.S1 : Genes found exclusively in the S. capitis NRCS-A clone and not in other S.

capitis public genomes.

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 11

LISTE DES TABLEAUX (SUITE)

Table IV.2.S2 : Methylated motifs detected for S. capitis NRCS-A strain CR01.

Table V.1 : Antimicrobial susceptibility profile of Staphylococcus capitis bloodstream

isolates from neonates (n = 12) and adults (n = 2).

Table V.S1 : Characteristics of 7 house-keeping genes and related primers 389 used for the

determination of the genetic relationships between 14 S. capitis isolates.

Table V.S2 : Profiles of the MLST-like approach of S. capitis bloodstream isolates from

neonates (n=12) and 409 adults (n=2).

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 12

LISTES DES ANNEXES

Annexe 1 : Chronologie non exhaustive des événements marquants survenus en

biologie (Rose), et en bioinformatique (Incolore).

Annexe 2 : Espèces et sous-espèces du genre Staphylococcus et hôtes associés.

Annexe 3 : Principales caractéristiques des différentes techniques de séquençage.

INTRODUCTION

INTRODUCTION

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V⎹ 13

Le Staphylocoque est observé pour la première fois par Pasteur en 1879 dans un pus de

furoncle, et ensuite identifié par Ogston en 1881 à travers la description d’observations

cliniques et bactériologiques relatives à son rôle dans le sepsis et la formation d’abcès

(Vandenesch et al., 2007). Actuellement, 50 espèces et sous espèces sont répertoriées dans le

genre Staphylococcus.

La prévalence des infections staphylococciques, nosocomiales et communautaires, augmente

régulièrement. Le traitement de ces infections est devenu de plus en plus difficile à cause de

l’émergence de souches multirésistantes. Les Staphylocoques ont la capacité d'acquérir des

déterminants de la résistance aux antimicrobiens rapidement, en particulier après

l'introduction de nouveaux agents antimicrobiens dans la pratique clinique.

A partir de 1950, dix ans après la découverte de la pénicilline, les Staphylococcus aureus

deviennent un problème thérapeutique majeur par l’acquisition de la résistance plasmidique à

la pénicilline. Peu après l’introduction d’un nouvel antibiotique, la méticilline (découverte en

1959), apparaissent des souches de S. aureus résistantes appelées S. aureus résistants à la

méthicilline (SARM). En fait, les SARM sont résistants non seulement à la méticilline mais

également aux autres antibiotiques de la même classe. Ces souches de SARM sont avant tout

responsables d’infections nosocomiales pouvant évoluer sur un mode épidémique (Mishaan et

al., 2005). En outre, des infections à SARM d’origine communautaire (SARM-C) ont été

également décrites (Dufour et al., 2002, Okuma et al., 2002).

Récemment, de nombreuses études ont décrit l’émergence dans les hôpitaux de plusieurs

pays, et particulièrement dans les unités néonatales de soins intensifs (NICU), des isolats de

Staphylococcus capitis résistantes à la méticilline et ayant une sensibilité réduites à la

vancomycine (Van Der Zwet, 2002 ; Gras-Le Guen et al., 2007). Ces isolats de S. capitis ont

causé des septicémies mortelles chez les nourrissons de faible poids (<1500 g), ce qui a

entraîné une vague d'échecs thérapeutiques et des problèmes socio-économiques (Rasigade et

al, 2012).

Une étude menée dans des NICU françaises a démontré la propagation d'une seule population

clonale de S. capitis (pulsotype NRCS-A) résistante à la méthicilline, associée à une

sensibilité réduite à la vancomycine, antibiotique de première ligne pour le traitement de ces

sepsis néonataux (Rasigade et al, 2012). De plus, ce même clone a été récemment identifié

dans les NICU en Belgique, au Royaume-Uni et en Australie, ce qui suggère une distribution

mondiale (Van Der Zwet et al., 2002 ; Venkatesh et al., 2006 ; D'mello et al., 2008 ;Rasigade

INTRODUCTION

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V⎹ 14

et al., 2012 ; Boghossian et al., 2013 ; Cui et al., 2013). En revanche, dans la bactériémie chez

l'adulte, S. capitis est rarement trouvée et lorsqu'elle est détectée, elle présente une plus

grande diversité en terme de génotypes et de profils de sensibilité aux antimicrobiens que

chez les nouveau-nés (Qin N et al., 2012).

Ce clone présente un profil atypique. En plus d'une résistance à l’ensemble des bêta-

lactamines, il possède une résistance à l’ensemble des aminosides, ainsi qu'une sensibilité

diminuée (hétérorésistance) aux glycopeptides qui constituent le traitement probabiliste de

première intention en cas de sepsis chez le prématuré. Cette combinaison de résistance est très

rarement retrouvée parmi les souches présentes chez l'adulte et reflète la pression de sélection

des antibiotiques utilisés dans les services de néonatologie.

Aujourd’hui, la connaissance scientifique de cette population clonale multirésistantes de S.

capitis (pulsotype NRCS-A), très peu étudiée et disséminée dans les NICU à travers le

monde, devient une urgence primordiale afin de réduire son endémie et limiter sa propagation.

Le séquençage complet du génome (WGS) est devenu un outil essentiel pour comprendre le

pouvoir des bactéries pathogènes. Des avancées majeures ont eu lieu dans le domaine du

séquençage au cours de cette dernière décennie avec le développement de plateformes de

séquençage nouvelle génération, caractérisées par un haut débit et la possibilité d’analyser

simultanément de nombreux échantillons. La génomique comparative des S. aureus est

désormais possible, car plusieurs génomes de S. aureus ont été séquencés et disponibles dans

les bases de données (Holden et al., 2004; Azarian et al., 2015 ; Sabat et al., 2017) . Des

travaux d’analyse génomique ont été également réalisés pour S. epidermidis RP62a et S.

epidermidis ATCC12228 en comparant leurs génomes à ceux des espèces staphylocoques les

plus pathogènes. Ces études ont permis de découvrir de manière approfondie les gènes qui

contribuent probablement à la virulence de S. epidermidis, en particulier la formation de

biofilm et la défense immunitaire (Zhang et al., 2003; Gill et al., 2005). Par la suite, des

projets de génomique comparative similaires ont été effectués pour d'autres espèces de

Staphylocoques à Coagulase Négative (SCN) telles que S. saprophyticus (Kuroda et al.,

2005), S. haemolyticus (Takeuchi et al., 2005 ; Cavanagh et al., 2014) et S. lugdunensis

(Heilbronner et al., 2011).

En revanche, très peu de travaux de recherche ont été entrepris concernant le séquençage du

génome complet de S. capitis. La disponibilité de ce dernier va permettre d’explorer les

caractéristiques génomiques (résistance aux antibiotiques, facteurs de virulence, éléments

INTRODUCTION

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V⎹ 15

génétiques mobiles (MGE) et gènes spécifiques) ayant un rôle dans l'émergence du phénotype

multirésistant du clone NRCS-A dans les différents NICU, et de comprendre l’histoire de son

évolution, son adaptation et sa dissémination dans le monde.

Dans ce contexte et en collaboration avec le Centre Nationale de Référence des

staphylocoques, Lyon, France, notre travail de thèse est un projet de séquençage, d’analyse

bioinformatique et de comparaison génomique de souches multirésistantes de S. capitis

(pulsotype NRCS-A) d'origines géographiques différentes et isolées à différentes périodes.

Le manuscrit est organisé de la façon suivante :

Un premier chapitre présente une revue bibliographique sur la génomique et les

staphylocoques.

Un second chapitre concerne le séquençage, l’assemblage et l’annotation de S. capitis

CR01 (pulsotype NRCS-A) qui représente le premier génome complet de référence de

souches isolées en neonatologie.

Un troisième chapitre traite le séquençage, l’assemblage et l’annotation de huit

souches de S. capitis d'origines géographiques différentes dans le monde et isolées à

différentes périodes.

Le chapitre 4 décrit le reséquençage, par un séquenceur de 3ème génération PacificBio

(SMRT), et l’assemblage du génome de la souche de S. capitis CR01 (pulsotype

NRCS-A), afin d’avoir un génome de référence fermé. De plus, ce chapitre présente

également le travail d’analyse et de comparaison de ce génome de référence par

rapport aux huit autres génomes séquencés de S. capitis, aux six génomes de S. capitis

disponibles sur les bases de données (souches adultes), et aux souches non S. capitis,

en utilisant différents outils et logiciels bioinformatiques, afin de caractériser et de

localiser les éléments génétiques communs (gènes de résistances, facteurs de

virulences, îlots de pathogénicité, îlots génomiques et MGE).

Le chapitre 5 illustre les diverses méthodes moléculaires utilisées (PFGE Sma et SacII,

typage SCCmec, MLST, Dru typing et analyse phylogénétique des génomes complet)

pour prouver la diffusion mondiale et l’unicité du clone épidémique NRCS-A de la

souche S. capitis.

INTRODUCTION

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V⎹ 16

Le chapitre 6 est consacré à une discussion générale des résultats et aux perspectives

ouvertes de ce travail.

OBJECTIF DE LA THESE

OBJECTIF DE LA THESE

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V⎹ 17

L’objectif principal de mon projet de thèse est de contribuer à améliorer et à approfondir les

connaissances du génome complet de l’espèce S. capitis peu étudié dans le monde, et de

caractériser le clone endémique NRCS-A de cette espèce afin de comprendre les origines de

son succès de dissémination et d’adaptation dans les NICU de quatre pays (France, Belgique,

Angleterre et Australie).

La méthodologie du travail s’articule autour de quatre grands axes :

Séquençage, assemblage et annotation d’un premier génome de référence de l’espèce

S. capitis CR01 isolée de l’NICU en France.

Séquençage, assemblage et annotation de huit autres génomes de S. capitis isolées des

NICU de quatre pays du monde (France, Belgique, Angleterre et Australie).

Identification, analyse et comparaison des éléments génétiques communs des neuf

souches séquencées pendant mon travail de thèse aux six génomes de l’espèce S.

capitis isolés chez des adultes et d'autres souches de staphylocoques disponibles sur

NCBI.

Caractérisation du clone endémique NRCS-A de cette espèce, afin de comprendre les

mécanismes génétique de résistances aux antibiotiques impliqués à son émergence,

son évolution, son adaptation et sa dissémination dans le monde.

CHAPITRE I

Revue bibliographique

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 18

I.1 GENOMIQUE

En l’espace de 50 ans seulement, la biologie est passée de l’étude d’un seul gène à l’étude de

génomes, de transcriptomes ou de protéomes d’organismes complets, avec une granularité

d’analyse allant de la simple molécule isolée à l’organisme dans sa globalité. Ceci a été rendu

possible par les avancées technologiques réalisées conjointement en biologie et en

bioinformatique qui ont été motivées par la volonté des scientifiques de soutirer

toujours davantage d’informations de notre génome. L’annexe 1 regroupe les événements

majeurs qui sont intervenus en biologie, et en bioinformatique depuis 1944.

I.1.1 Révolution biologique

La révolution biologique a été initiée par quatre événements majeurs : la découverte de l’ADN

en tant que support de l’information génétique (Avery et al., 1944) et de sa structure en double

hélice (Watson et Crick, 1953), ainsi que la mise en place du dogme central de la biologie

moléculaire et le déchiffrage du code génétique (Matthaei et al., 1962). Ces événements

constituent les fondements de la génomique.

Le dogme central est la modélisation simplifiée du flux de l’information génétique à travers

différentes molécules de la cellule et se résume en trois processus (Figure I.1).

ADN ARNm Protéine

Figure I.1:Dogme central de la biologie moléculaire

Grâce à ces principes, de nouvelles techniques de biologie moléculaire ont pu être

développées, et en synergie avec la montée en puissance et la disponibilité des ordinateurs, une

nouvelle discipline a émergé : la bioinformatique.

L’apparition de deux nouvelles approches de séquençage de l’ADN (Maxam et al., 1977;

Sanger et al., 1977) a permis à la bioinformatique prend réellement son envol. La

production de séquences par ces méthodes est l’occasion de créer les nouvelles banques de

données EMBL (Cochrane et al., 2009) et GenBank (Benson et al., 2009), afin de

répertorier ces séquences nucléiques, et de développer de nouveaux algorithmes

Réplication

Transcription Traduction

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 19

permettant de traiter les données biologiques. Ces derniers ont abouti aux outils majeurs

de la bioinformatique que sont FASTA (Pearson et Lipman, 1988), CLUSTALW (Thompson

et al., 1994), et BLAST (Altschul et al., 1997).

Avec l’apparition des séquenceurs automatiques et de nouveaux outils de biologie

moléculaire, la production des séquences s’accélère et l’on voit apparaître des projets de

séquençage de génomes complets qui aboutissent vers la fin du siècle.

Après dix années d’efforts, l’arrivée des premières séquences préliminaires du génome

Humain (Lander e tal., 2001; Venter et al., 2001) marque la fin de l’ère génomique et

l’entrée dans l’ère post-génomique. Cependant, il a fallu attendre jusqu’en 2004 pour

obtenir de la part de l’IHGSC Consortium une version que l’on peut considérer comme

finalisée (IHGSC, 2004).

Actuellement, grâce aux techniques de séquençage haut-débit, les projets de séquençage se

sont multipliés (environ 60000) de sorte que la communauté scientifique a accès à 1530

génomes complets et publiés (Figure I.2).

Figure I.2 : Evolution du nombre de génomes complets disponible

(http://www.genomesonline.org)

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 20

I.1.2 Séquençage génomique

Le séquençage de l’ADN constitue une méthode dont le but est de déterminer la succession

linéaire des bases A, C, G et T prenant part à la structure de l’ADN. La lecture de cette

séquence permet d’étudier l’information biologique contenue par celle-ci. Étant donné

l’unicité et la spécificité de la structure de l’ADN chez chaque individu, la séquence de

l’ADN permet de nombreuses applications dans le domaine de la médecine, comme, par

exemple, le diagnostic, les études génétiques, l’étude de paternité, la criminologie, la

compréhension de mécanismes physiopathologiques, la synthèse de médicaments, les

enquêtes épidémiologiques. L’objectif de la partie ci-dessous est de décrire l’évolution du

séquençage manuel jusqu’aux séquenceurs haut débit qui sont les plus utilisées à l'heure

actuelle.

I.1.2.1 Historique

En 1965, Holley et ses collaborateurs ont séquencé les deux premiers acides nucléiques de

l’histoire, l’ARNt de l’alanine de la bactérie Escherichia coli, puis celui de la levure

Saccharomyces cerevisiae. C’est grâce à la capacité de purifier des ARNt particuliers et à la

connaissance de RNAses, dont la spécificité était connue, que ces premiers séquençages ont

pu avoir lieu. De plus, il a été possible de déterminer la structure secondaire de l’ARNt,

puisque l’hybridation entre les bases était connue à l’époque. C’est en 1971 que la première

molécule d’ADN a été séquencée. Cette molécule consistait en une séquence de 12

nucléotides, soit la séquence des extrémités cohésives du phage lambda (Wu, 1970). Ces

premières séquences ont été obtenues à l’aide de réactions chimiques spécifiques, comme la

dépurination. Ces méthodes permettaient d’obtenir des séquences longues de 10 à 20

nucléotides.

En 1975, Sanger et Coulson ont introduit la méthode de terminaison des chaînes pour le

séquençage de l’ADN (Figure I.3). En 1977, Maxam et Gilbert ont conçu une méthode

similaire à celle de Sanger, mais ils utilisaient plutôt des nucléotides qui ne permettaient pas

l’élongation des chaînes. La même année, Sanger a introduit la méthode des

didéoxynucléotides, méthode qui permettait de séquencer jusqu’à 100 nucléotides. Cette

technique a permis le séquençage du génome du phage PhiX (Sanger et al., 1977).

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 21

La grande innovation suivante dans l’histoire du séquençage a été l’automatisation des

protocoles et de l’analyse (Première génération) (Hutchison, 2007). Cette avancée importante

a permis de démocratiser le séquençage, jusqu’à permettre le séquençage de génomes

complets (95%), dont le génome humain en février 2001 (Lander et al., 2001, Venter et al.,

2001) et le génome des TriTryp en 2005.

La seconde génération d’outils de séquençage est apparue en 2005 en réponse au prix élevé et

au faible débit du séquençage de première génération. Ici, des dizaines de milliers de

séquences sont traitées ensemble et en parallèle. C’est l’apparition du séquençage haut-débit

(« high throughput sequencing » ou encore le « next-generation sequencing »).

Alors que le projet de séquençage du génome humain a coûté trois milliards de dollars et a

duré 13 ans (achevé en 2006), celui de James Watson (âgé de 79 ans, co-découvreur de la

structure de l’ADN) a coûté un million de dollars et a été réalisé en deux mois. Il a été

effectué sur un séquenceur FLX de Roche (société 454 Life Sciences, Baylor College of

Medicine, Houston, Texas, États-Unis,). Quatre mois après, l’institut Craig Venter publiait le

génome complet de Craig Venter (Levy et al., 2007). Contrairement à celui de James Watson,

celui-ci a été séquencé selon la technique classique de Sanger (Figure 3).

En 2009, un des co-fondateurs de la société Helicos Bionsciences, Stephen R. Quake,

séquence son génome (Pushkarev et al., 2009) avec une profondeur de 28x et une couverture

de génome de 90% pour un coût de 48000 dollars. La même année (2009), quatre autres

génomes humains ont été décrits : ceux d’un homme yoruba du Nigeria (Bentley et al., 2008)

séquencé à une profondeur de 30x, de 2 coréens (Ahn et al., 2009 ; Kim et al ., 2009) à une

profondeur de 28 et 29x et d’un chinois Han (Wang et al., 2008) à une profondeur de 36x. Ces

séquençages individuels constituent une étape majeure vers la médecine personnelle

Les plateformes NGS actuellement disponible dans le marché utilisent des technologies de

séquençage à haut débit de la seconde génération proposées par Roche 454 Life Sciences,

Illumina, Solid et Ion Torrent et la troisième génération (« next-next-generation sequencing »)

proposé par Pacific Biosciences (PacBio RS) (Metzker, 2010 ; McAdam et al., 2014).

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 22

Figure I.3 : Quelques étapes importantes démontrant l’évolution des progrès du séquençage

(Blow, 2008).

I.1.2.2 Constitution de banque d’ADN

Tout projet de séquençage commence par la constitution d’une ou plusieurs banques d’ADN.

Cette banque est une collection de fragments d’ADN à séquencer qui ont été intégrés au

génome de cellules hôtes (généralement des microorganismes) à des fins de stockage et de

réplication. L’intégration est réalisée par l’intermédiaire d’une molécule d’ADN, appelée

vecteur de clonage, à l’intérieur de laquelle a été placé un fragment de l’ADN que l’on veut

séquencer (appelé dans le cas présent ‘insert’).

Il existe deux types de banques d’ADN : les banques d’ADN génomique dont les inserts sont

issus de la fragmentation du matériel génétique initial à séquencer, et les banques d’ADNc

dont les inserts sont des ARNm qui ont été « recopiés » en ADN sous l’effet d’une enzyme de

rétrovirus, la transcriptase inverse. Les banques génomiques sont utilisées dans le cadre de

séquençage de génomes, alors que les banques d’ADNc sont utilisées dans des études

d’expression de gènes.

Mis à part une première étape différente entre la construction d’une banque génomique et

celle d’une banque d’ADNc, les autres étapes sont communes aux deux (Figure I.4).

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 23

Première étape :

Banque génomique : consiste à fractionner l’ADN génomique par digestion partielle

avec une endonucléase, ou une enzyme de restriction, mais les méthodes physiques

sont préférées car elles sont plus reproductibles et les fragmentations sont plus

aléatoires. Ces méthodes physiques peuvent mettre en jeu la sonication, la nébulisation

sous haute pression, ou la force de cisaillement (Levinthal et Davison, 1961).

Banque d’ADNc : aucune fragmentation n’est nécessaire. Au contraire, une attention

toute particulière est apportée pour préserver les molécules d’ARN qui sont plus

fragiles que l’ADN, puisqu’elles ne sont constituées que d’un seul brin. Lors de cette

première étape, l’ARNm est rétro-transcrit en ADN sous l’action de la transcriptase

inverse, une enzyme de rétrovirus.

Les autres étapes :

Elles consistent en une séparation par électrophorèse sur gel d’agarose des fragments

d’ADN ou d’ADNc afin de sélectionner et d’extraire du gel les fragments de taille

désirée, puis de les intégrer au vecteur de clonage choisis. Les cellules hôtes sont

ensuite transformées par l’insertion d’un vecteur à leur matériel génétique. Finalement,

les cellules ayant été transformées sont cultivées et isolées en colonies bien distinctes.

Les cellules ayant intégré un vecteur sont sélectionnées à l’aide d’un des marqueurs du

vecteur, généralement un gène de résistance à un antibiotique présent dans le milieu de

culture, et qui empêche la multiplication des cellules non transformées. Chaque colonie

est ensuite repiquée, conservée et étiquetée par un identifiant unique en vue de son

séquençage.

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 24

Figure I.4 : Schéma simplifié de préparation de banques d’ADN génomique et d’ADNc

(http://www.britannica.com/)

I.1.2.3 Séquençage 1er

génération

I.1.2.3.1 Méthodes de séquençage

Il existe deux méthodes de séquençage dites « classiques » : la méthode de Maxam et

Gilbert, par dégradation chimique sélective et la méthode De Sanger par synthèse

enzymatique. Alors que l’utilisation de la première est restée confidentielle, la deuxième a été

largement développée et constitue aujourd’hui la technique de référence.

Méthode chimique (Maxam et al., 1977)

Cette méthode est basée sur une dégradation chimique de l'ADN et utilise les réactivités

différentes des quatre bases A, T, G et C, pour réaliser des coupures sélectives. En

reconstituant l'ordre des coupures, on peut remonter à la séquence des nucléotidesde l'ADN

correspondant. On peut décomposer ce séquençage chimique en six étapes successives :

Marquage : Les extrémités des deux brins d'ADN à séquencer sont marquées par un

traceur radioactif (32

P). Cette réaction se fait en général au moyen d'ATP radioactif et de

polynucléotide kinase.

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 25

Isolement du fragment d'ADN à séquencer : Celui-ci est séparé au moyen d'une

électrophorèse sur un gel de polyacrylamide. Le fragment d'ADN est découpé du gel et

récupéré par diffusion.

Séparation de brins : Les deux brins de chaque fragment d'ADN sont séparés par

dénaturation thermique, puis purifiés par une nouvelle électrophorèse.

Modifications chimiques spécifiques : Les ADN simple-brin sont soumis à des

réactions chimiques spécifiques des différents types de base. Walter Gilbert a mis au

point plusieurs types de réactions spécifiques, effectuées en parallèle sur une fraction de

chaque brin d'ADN marqué : par exemple, une réaction pour les G (alkylation par le

sulfate de diméthyle), une réaction pour les G et les A (dépurination), une réaction pour

les C, ainsi qu'une réaction pour les C et les T (hydrolyse alcaline).

Coupure : Après ces réactions, l'ADN est clivé au niveau de la modification par réaction

avec une base, la pipéridine.

Analyse : Pour chaque fragment, les produits des différentes réactions sont séparés par

électrophorèse en conditions dénaturantes et analysés pour reconstituer la séquence de

l'ADN. Cette analyse est analogue à celle que l'on effectue pour la méthode de Sanger

(Figure I.5).

Les produits chimiques utilisés dans les milieux réactionnels lors des coupures spécifiques

étant excessivement dangereux pour la santé, cette méthode a été abandonnée au profit de la

méthode par synthèse enzymatique.

Figure I.5 : Schéma récapitulatif de la méthode de séquençage de Maxim et Gilbert (http://departments.oxy.edu/biology/Stillman/bi221/092200/lecture_notes.htm)

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 26

Méthode enzymatique (Sanger et al., 1977).

Cette méthode, encore appelée méthode De Sanger en raison de son inventeur, est basée sur

l’activité de l’ADN polymérase qui permet de polymériser un brin d’ADN complémentaire à

un brin matrice, à partir d’un oligonucléotide, appelé amorce. Cette capacité est utilisée pour

synthétiser un brin complémentaire, mais de façon incomplète, en arrêtant aléatoirement la

réaction de manière à obtenir statistiquement des produits issus de réaction interrompue à

chacune des bases du fragment à séquencer.

Le mix réactionnel est constitué du vecteur de clonage contenant le fragment à cloner, de la

polymérase, des amorces et des dNTP. Pour arrêter aléatoirement la réaction, une faible

concentration de ddNTP est ajoutée. Ces ddNTP ne comportant pas de groupement 3’-OH,

ils agissent comme des terminateurs de la réaction de polymérisation en empêchant

l’accomplissement d’une liaison 5'-3' phosphodiester ultérieure.

A l’instar de la méthode chimique, un marquage des produits de réaction est nécessaire pour

pouvoir détecter ces derniers après leur séparation par électrophorèse sur gel. Pour ceci, il

existe deux chimies : dyeprimer et dyeterminator(Figure I.6).

Figure I.6 : Séquençage d’ADN par synthèse enzymatique avec chimie dye primer et dyeterminator (http://www.appliedbiosystems.com/)

I.1.2.3.2 Automatisation de méthode de Sanger

La lecture manuelle de gels de séquençage est fastidieuse et sujette à de multiples erreurs

d’interprétation, surtout après avoir lu les premiers milliers de bases. C’est pourquoi cette

tâche a été automatisée à l’aide des séquenceurs.

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 27

L’étape de séquençage par synthèse enzymatique est toujours nécessaire. Elle est déléguée à

des robots qui la réalisent dans des microplaques de 96 ou 384 puits, correspondant à autant

de clones séquencés. Ces plaques sont ensuite transférées dans un séquenceur, qui va réaliser

l’électrophorèse tout en enregistrant sur ordinateur les profils d’intensités lumineuses des

fluorochromes. Ces profils sont appelés chromatogrammes.

Il existe deux types de séquenceurs automatiques de technologie Sanger :

Les séquenceurs à gel plat disposent d’un gel enserré entre deux plaques de verre en

haut duquel sont disposés des puits.

Des séquenceurs à capillaires tel que ABI 3730 DNA Analyser de Life technologies.

Cette technologie a permis des progrès en génomique depuis sa commercialisation en

2002. En 2004, en utilisant le séquenceur à capillaire automatique ABI3700, dans le

cadre d'un projet collaboratif, le génome de P. atrosepticum SCRI1043 a été séquencé,

ce qui a permis la caractérisation des facteurs de virulence de cette espèce par

comparaison aux pathogènes de plantes ou d'animaux de la famille des

Enterobacteriaceae (Bell et al., 2004).

I.1.2.3.3 Stratégies de séquençage de génome entier

On distingue deux méthodes de séquençage des génomes entiers :

Séquençage aléatoire globale (ou whole-génome shotgun)

Séquençage par ordonnancement hiérarchique

Dans les deux cas, l'ADN génomique est tout d'abord fragmenté par des méthodes soit

enzymatiques (enzymes de restriction), soit physiques (ultrasons).

Séquençage aléatoire globale « whole-génome shotgun »

Le séquençage du premier génome bactérien, Haemophilus influenzae, a introduit la méthode

du séquençage aléatoire global (Fleischman et al., 1995). Cette dernière avait été proposée en

1982 par Sanger et ses collaborateurs et avait été utilisée, à plus petite échelle, pour le

séquençage du génome du phage lambda. C’est la stratégie retenue aujourd’hui pour tous les

génomes bactériens. On l’associe plus volontiers aux sociétés privées, telles que Celera

Genomics ou Syngenta, parce qu’elle est rapide et économique. Celera a ainsi accompli le

séquençage de plusieurs organismes par une stratégie aléatoire globale. Toutefois, il faut

remarquer que, pour de grands génomes comme celui de l'Homme, ces sociétés se sont

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 28

souvent appuyées sur des données de cartographie établies par les chercheurs académiques.

En outre, pour ces grands génomes, on tend aujourd’hui à utiliser des stratégies mixtes,

mêlant séquençage aléatoire global et "clone par clone".

Le séquençage du génome humain a donné lieu à une lutte médiatique entre Celera Genomics

et le consortium international responsable du « projet Genome humain », qui utilisait quant à

lui une stratégie « clone par clone »

Principe

La technique "shotgun" repose sur un principe simple : découper un génome en un grand

nombre de fragments de petite taille (Figure I.7). Les extrémités d'une partie de ces fragments

sont ensuite séquencées, puis ces séquences sont assemblées sur la base de leurs

chevauchements grâce à des programmes informatiques pour essayer de produire une

séquence complète (Ameziane et al., 2005). Les difficultés d'une telle technique sont à deux

niveaux :

1- avoir assez de fragments pour couvrir le génome dans son entier

2- réussir l'assemblage

Figure I.7: Schéma de la stratégie du séquençage aléatoire global

(www.bio.davidson.edu/COures/genomics/method/shotgun.html)

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 29

Séquençage par ordonnancement hiérarchique

Une stratégie différente dite "clone par clone" ou hiérarchique a été adoptée par divers

consortiums internationaux pour le séquençage du génome humain et d’autres grands

génomes (riz, arabette, ver).

Principe :

L’ADN génomique est découpé en fragments de 50 à 200 kb, puis cloné dans un vecteur

adapté (BAC). Le nombre de clones doit permettre une couverture de 5 à 10 fois la longueur

totale du génome étudié. Le chevauchement et l'ordonnancement des clones sont réalisés soit

par hybridation de sondes spécifiques, soit par analyse des profils de restriction, soit plus

fréquemment par un ordonnancement après séquençage et hybridation des extrémités des

BAC. Après ordonnancement des clones, ils sont fragmentés et séquencés individuellement,

puis assemblés par alignement bioinformatique.

Avec un volume de séquences lues équivalant à 5 ou 6 fois la taille d’un génome comme celui

de l’être humain (profondeur de 5X), il est possible d’assembler clone par clone

une"Ébauche" où l’on obtient pour chaque clone quelques dizaines de contigs. Toutefois, ces

contigs initiaux ne sont en général ni ordonnés, ni orientés. En augmentant la profondeur

jusqu’à 10X, on obtient des contigs plus longs, moins nombreux, et surtout ordonnés et

orientés grâce aux paires de lectures ou à d’autres informations (Figure I.8). Reste alors à

entreprendre une étape fastidieuse de lissage et de finition, pour garantir à tout endroit moins

d’une erreur tous les 10 000 nucléotides, et pour boucher les trous résiduels par un travail

local (www.genoscope.cnr.fr).

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 30

Figure I.8 : Schéma simplifié de la stratégie de séquençage "clone par

clone"(www.genoscope.cnr.fr).

I.1.2.4 Séquençage nouvelle génération (Next Generation Sequencing (NGS))

Les nouvelles technologies de séquençage dites NGS (Next Generation Sequencing), ont

permis de séquencer de l'ADN plus rapidement avec une meilleure qualité tout en réduisant le

coût qui est passé de plus de 1000 dollars pour un million de bases en 2001 à moins de 100

dollars en 2015 (http://www.genome.gov/sequencingcosts/).

Des séquenceurs de paillasse (benchtop sequencers) ont été développés pour permettre l’accès

aux technologies de NGS à la plupart des laboratoires, y compris aux laboratoires de

microbiologie médicale, et non plus aux seuls laboratoires spécialisés (Figure I.9). Ils sont

caractérises par un cout moindre, une petite taille et des performances restreintes mais

suffisantes pour la plupart des applications du NGS en laboratoire de recherche standard

(Loman NJ et al., 2012 ; Junemann S et al., 2013)

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 31

Figure I.9 : Chronologie de la commercialisation des séquenceurs à haut-débit

I.1.2.4.1 Séquençage de 2ème

génération

La technique de séquençage De Sanger a atteint ses limites en termes de rendement. Il n’est

plus possible d’accélérer le séquençage qu’en multipliant le nombre de gels, de capillaires ou de

machines, et la vitesse d’électrophorèse peut difficilement être accélérée sans amoindrir la

qualité de séquençage. C’est pourquoi de nouvelles technologies ont vu le jour pour

aboutir à des séquenceurs temps réel (séquençage base par base) massivement

parallélisés, utilisant des techniques très diverses tel que :

Le pyroséquençage à haut-débit (Technologie 454)

Les techniques de terminaison cyclique réversible (Solexa/Illumina et Helicos)

Le séquençage par ligation (SOliD).

Le séquençage par nano-mesure de PH (PGM)

Malgré leurs différences méthodologiques, les techniques de séquençage à haut débit

actuellement offertes suivent un protocole dont les grandes lignes sont similaires (benthly

2008). Même si les méthodes utilisées à chacune des étapes sont différentes, l’ordre dans

lequel elles sont effectuées est invariable :

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 32

Préparation d’une librairie de séquences marquées par des adaptateurs ;

Amplification des séquences marquées de manière à ce qu’elles soient séparées

spatialement ;

Séquençage par réactions enzymatiques cycliques mesurées en temps réel.

Pyroséquençage (technologie 454)

Le pyroséquençage est la technique qui connaît actuellement le plus grand succès

concurrençant la méthode de Sanger. Cette technique de séquençage d’ADN introduite depuis

1988, par Hyman, a été améliorée par introduction d’une étape PCR. Il s’agit d’un séquençage

par synthèse qui se caractérise par la révélation en temps réel de l’activité de l’ADN

polymérase et qui ajoute un seul nucléotide non fluorescent à la fois.

La première étape consiste à préparer le mélange réactionnel, avec les enzymes clés et les

différents substrats. Ici, les nucléotides ne sont pas ajoutés tous ensemble comme dans une

réaction de séquençage de Sanger mais successivement. Si le nucléotide ajouté dans le milieu

réactionnel correspond à celui attendu par la polymérase, il sera incorporé dans le brin en

cours de synthèse (d’élongation) libérant un pyrophosphate. L’ATP sulfurylase vient alors

transformer ce pyrophosphate (Ludwig et al., 2004) en ATP qui est alors utilisé, couplé à une

Luciférine, par une luciférase avec production d’oxyluciférine et d’un signal lumineux.

L’apyrase dégrade les nucléotides en surplus. Le signal lumineux est capté par un capteur

CCD, puis reproduit sous forme d’un pic sur le Pyrogramme. La hauteur de ce pic est fonction

de l’intensité du signal lumineux, elle-même proportionnelle au nombre de nucléotides

incorporés en même temps. On peut donc déduire la séquence à partir de la taille des pics

obtenus. Par ailleurs, en cas de mélange de nucléotides à une même position (polymorphisme

de séquence), la taille des pics permet d’avoir une quantification de la proportion de brins

porteurs de l’un ou l’autre des nucléotides (Figure I.10).

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 33

Figure I.10 : Etapes du pyroséquençage (Ahmadianet al., 2006).

La technologie de 454 Life Sciences conçue par Rothberg (Margulieset al., 2005) est fondée

sur l’intégration de plusieurs techniques :

- le pyroséquençage,

- les technologies des plaques en fibre optique pico-titré (PTP),

- la PCR en émulsion « emPCR » dans des microréacteurs,

- les technologies informatiques de pointe pour l’acquisition, le traitement et

l’analyse des images.

Préparation de la libraire d’ADN (Figure I.11)

L’ADN génomique est fragmenté par nébulisation (1400-1800 pb), des séquences

adaptateurs sont fixées à chaque extrémité des fragments d’ADN à séquencer. Un des

adaptateurs contient un marqueur biotine en 5’ qui sert à fixer les fragments sur des billes

grâce à un système streptavidine/biotine. Les fragments d’ADN sont dénaturés afin de

libérer les brins non-biotinés, pour obtenir une librairie d’ADN simple brin.

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 34

Figure I.11 : Préparation de la libraire d’ADN (http://www.454.com/)

PCR en émulsion « emPCR » (Figure I.12)

Les sstDNA sont ensuite amplifiées par « emPCR ».Ces molécules sont fixées sur des billes

de manière à fixer une seule molécule de sstDNA par bille. Les billes sont, ensuite,

émulsionnées dans une solution eau/huile dans des proportions favorisant l’inclusion d’un

seul couple bille-sstDNA par gouttelette d’eau, qui va agir comme un microréacteur pour la

réaction de PCR. Après plusieurs cycles de PCR, chaque gouttelette contient une bille où sont

fixés tous les clones amplifiés. Un ensemble de clones issus d’une même matrice est souvent

dénommé «polonie» en référence à l’amplification de toute une colonie de clones par la

polymérase.

Figure I.12 : Préparation des billes où sont fixées les sstDNA pour le séquenceur 454

(http://www.454.com/)

Pyroséquençage (Figure I.13)

Afin de paralléliser massivement les réactions de pyroséquençage, le séquenceur 454 utilise

une PTP constituée de puits. Les billes couvertes de sstDNA sont mélangées au mix de

réaction contenant la polymérase et sont étalées sur la PTP. Les puits de cette dernière sont

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 35

d’une forme telle qu’une seule bille peut être déposée dans chaque puits. Les puits et les billes

de sstDNA sont ensuite recouverts de billes d’enzymes immobilisées contenant la sulfurylase

et la luciférase. Au moment de pyroséquençage, chacune des bases A, C, G, et T est

ajoutée séquentiellement sur la PTP. L’image des intensités de lumière émise par la

réaction intervenue dans chaque puits après l’ajout de chaque base est enregistrée. Avant

l’ajout de la base suivante, les bases non intégrées par la polymérase sont dégradées par une

solution d’apyrase. Ce cycle d’ajout des quatre bases est réitéré 42 fois pour obtenir des

séquences d’une longueur moyenne de 700 pb pour un total de 400 à 600 millions de

bases séquencées (Shendure et Shendureet al., 2008; Metzker, 2010).

Figure I.13 : Schéma simplifié de Pyroséquençage sur PTP 454 (http://www.454.com/)

Analyse des images et détermination de la séquence d’ADN

Connaissant l’ordre dans lequel les 4 nucléotides sont ajoutés automatiquement, l’analyse des

différentes images capturées permet la déduction de la séquence des différents fragments

d’ADN (illustré par Pyrogramme). Des logiciels bioinformatiques sont ensuite utilisés pour

reconstituer la séquence initiale grâce au groupage des contigs. Cette technologie produit de

longues séquences qui facilitent l’assemblage de novo des génomes sans utiliser un génome

de références. En quelque année, la longueur des séquences est passé d’environ 300pb à

700pb et aujourd’hui, la mise à jour de l appareil permet d’atteindre des séquences d’environ

1Kb. Ainsi, une expérimentation sur GS-FLX+génère 1Gb de nucléotide en 23h (Loman et

al., 2012; Jûnemann et al., 2013).. Ces capacités technologiques en font aujourd’hui un outil

indispensable dans les études génomiques et transcriptomiques qui requière un assemblage de

novo. En 2013, la société Roche a annoncé qu'elle prévoyait d'arrêter la commercialisation de

la technologie 454 d'ici mi-2016 (www.genomeweb.com).

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 36

Techniques de terminaison cyclique réversible (Illumina /Solexa)

Initialement développée par Solexa, la plateforme Illumina Genome analyser (Sandiego,

USA), a mis en place une technologie de séquençage sur lames de type puces à ADN, fondée

sur l’intégration de plusieurs techniques : les biopuces à ADN, la nanotechnologie, une

variante de la technique de Sanger appelé terminaison cyclique réversible (CRT), ainsi que

des technologies informatiques de pointe pour l’acquisition, le traitement et l’analyse des

images (Fedurco et al., 2006).

La spécificité de cette technologie repose sur une amplification en pont (bridge PCR) des

fragments à séquencer. Elle a lieu sur une surface de verre appelée flow cell (FC), similaire à

une lame de microscope, divisée en huit lignes (à l'origine, une ligne par échantillon). Les

fragments de la librairie à séquencer possèdent des adaptateurs à leurs extrémités. Ceux-ci

vont leur permettre de se fixer de façon aléatoire sur la FC, par hybridation sur les amorces

qui en couvrent la surface (Figure I.14). Un nouveau brin est alors synthétisé par une

polymérase (a) : il est fixé de façon covalente à la FC. Le brin d'origine est alors éliminé par

dénaturation (b) et l'extrémité libre du brin restant s'hybride à une amorce adjacente pour

former un pont (c). La polymérase synthétise à nouveau le brin complémentaire pour former

un pont d'ADN double brin (d) puis les deux copies sont libérées par dénaturation (e). Le

cycle d'amplification en pont (étapes c à e) recommence pour former à terme un regroupement

d'ADN clonal en une zone appelée cluster (f). Les brins anti-sens (correspondant aux amorces

vertes) sont ensuite clivés (g) : c'est la linéarisation.

L'extrémité 3' libre des fragments d'ADN est bloquée et l'amorce de séquençage s'y hybride

(Figure 14). Le séquençage s'effectue sur des centaines de millions de clusters simultanément,

grâce à une chimie de terminateurs réversibles : des nucléotides bloqués marqués par

fluorescence sont ajoutés, l'un d'entre eux est incorporé, la fluorescence émise est relevée puis

le fluorophore et le bloqueur sont clivés permettant l'ajout d'un nouveau nucléotide. A chaque

cycle d'incorporation, une base peut être déterminée. (Eid et al., 2009).

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 37

Figure I.14 : Amplification en pont de la technologie Illumina ((http://www.illumina.com/)

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 38

Aujourd’hui le système HiSeq 2000 possède un rendement de 6 milliards de séquences pour

un total d’environ 600 Gb en 11 jours (avec une taille moyenne de séquence de 100 pb). Cette

technologie est aujourd’hui très largement employée (séquençage, reséquençage, Chip-Seq,

RNA-Seq).

Séquençage par ligation (SOliD)

La plateforme SOLiD (Sequencing by Oligonucleotide Ligation and Detection) du système

décrit par Shendure et al., 2005, emploie des processus de préparation et amplification

d’échantillons similaires à ceux développés pour la technologie 454. Mais le processus de

séquençage diffère considérablement, dans le fait qu’il repose sur un séquençage par

«ligation», où des oligonucléotides de 8 bases marqués par fluorescence sont liés de manière

séquentielle sur l’amorce de séquençage. Chacun des quatre types de sonde porte un

fluorophore distinct en 3’, représentant la séquence de l’échantillon complémentaire aux

quatrièmes et cinquièmes bases de la sonde oligonucléotidique. Le signal fluorescent généré

par l’hybridation de la sonde est alors détecté et enregistré par un scanner laser et un

processus d’acquisition de données similaires au système Solexa. La sonde liée est alors

clivée entre la 5ème

et 6ème

base, enlevant la moitié fluorescente, et des séries répétées de la

ligation de la sonde (Metzker, 2010).

Grâce à cette méthode, il est possible de lire jusqu'à un milliard et demi de séquences en

parallèle de 75 bases de long (des fragments courts). Le système incorporé de correction

d'erreurs associé à l'utilisation de la ligase rend cette technologie très fiable et utilisable dans

des projets de reséquençage de génome et de transcriptome.

Séquençage par nano-mesure de PH (PGM)

En 2007, Jonathan M. Rothberg fonde la compagnie Ion Torrent, rachetée en 2010 par Life

Technologies, qui commercialisera en décembre 2010 son premier séquenceur, le PGM

(Personal Genome Machine) pour 50000 $. La technologie utilise une méthode de séquençage

par synthèse, similaire au pyroséquençage, basée sur la libération naturelle d’un ion H+ lors

de l’incorporation d’un nucléotide à un fragment d’ADN en cours de production. La séquence

est déterminée par mesure des variations de pH suite à l’incorporation des différents

nucléotides, au sein d’une puce semi-conductrice. Ce système de détection « simple » ne

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 39

nécessitant ni système optique ni marqueur fluorescent, font de la technologie Ion Torrent une

méthode de séquençage rapide et peu couteuse par rapport aux autres plateformes NGS.

La dernière version de ce séquenceur (puce 318) lui permet désormais de lire 1 Gb avec une

grande précision en seulement deux heures et la longueur de lecture atteindra les 400 pb en

2012. Le PGM a ainsi servi à décoder le génome de la souche d'Escherichia coli qui a fait des

ravages en Europe et provoqué un scandale sanitaire en mai 2011 (Mellmann et al., 2011).

I.1.2.4.2 Séquençage de 3ème génération

La troisième génération de séquençage de masse est symbolisée par le séquençage d’une

seule molécule d’ADN « SMS » (Gupta., 2008). Contrairement à la seconde génération,

aucune amplification de l’ADN (ou ARN) n’est nécessaire pour effectuer les mesures. Une

seule molécule est « lue ». Ces innovations diminueraient la durée et simplifieraient

considérablement les étapes de préparation des banques d’ADN. De plus, l’élimination de ces

étapes permettrait aussi de diminuer les sources de biais possibles pouvant être introduits par

les phases de PCR (erreurs de polymérisation ou recombinaisons par PCR). Un autre avantage

de cette technique réside dans le fait que des ADN faiblement concentrés voir même dégradés

pourraient ainsi tout de même devenir exploitables (Orlando., 2011).

Technologie HeliScope

Helicos Biosciences a développé le premier séquenceur d'une molécule unique : le HeliScope

Single Molecule Sequencer. A la différence de la chimie utilisée sur la plateforme Illumina,

ici les nucléotides sont marqués avec le même fluorophore et cette technologie apparaît

parfaitement adapté aux études transcriptomiques quantitatives. Helicos ne vend désormais

plus d'appareil et propose un service de séquençage.

Technologie SMRT (Single Molecule Real-Time Analysis)

La technologie de séquençage PacBio, développée par l'entreprise Pacific Biosciences

(Californie, USA), permet de séquencer une molécule d'ADN en temps réel (SMRT : single

molecule real time) à l'aide d'un instrument, le PacBio RS. Le processus de séquençage se fait

sur un support appelé "SMRT Cell" composé de dizaines de milliers de puits sous forme de

structure détecteur appelé ZMW (zero-mode waveguide). Au fond de chaque puits, d'un

diamètre de 100 nm, est fixée une seule polymérase. Ces structures ZMW permettent

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 40

d'enregistrer en temps réel les dNTP incorporés où chacun des 4 nucléotides est lié à un

flurochrome différent.

Les signaux obtenus sont enregistrés et analysés par des méthodes informatiques de pointe

(Eid et al., 2009 ; Sengenès, 2012).

Pour l'assemblage des lectures issues du séquenceur PacBio, l'entreprise a développé plusieurs

algorithmes d'assemblage adaptés selon la taille des lectures et la couverture du séquençage.

Dans le cas des génomes bactériens, il s'agit de HGAP (Hierarchical Genome Assembly

Process) qui comprend plusieurs étapes dans le processus d'assemblage (Chin et al., 2013).

La vitesse de séquençage de cette technologie est de 10 bases par seconde avec une longueur

moyenne de lecture de plus de 1000 pb (jusqu’à 3000 pb). Malgré son succès, la technologie

PacBio génère aussi des erreurs de séquençage liées à la quantification des homopolymères.

Technologies des nanopores

Plusieurs plateformes permettant le séquençage d’une molécule d’ADN par passage à travers

un nanopore d’une membrane biologique ou synthétique sont actuellement en développement.

Les différents nucléotides A, C, G et T sont successivement détectés lors de leur passage à

travers du pore par des systèmes optiques (marquage des nucléotides) ou électriques

(modification du courant en fonction du degré d’occupation du pore et du temps de transit,

spécifiques à chaque nucléotide).

Les nanopores utilises peuvent être solides (graphène) ou biologiques (α-hémolysine,

Mycobacterium smegmatis porin A)

I.1.2.4.3 Technologies émergentes

Une quatrième vague de séquenceurs va voir le jour, s’arguant des qualités de chacune des

plateformes citées plus haut.

Technologie FRET (Fluorescence Resonance Emission Transfer)

Cette technologie de séquençage est basée sur le transfert d’énergie distance-dépendant entre

deux molécules : un donneur et un accepteur. Le séquençage s’effectue par synthèse à l’aide

d’une ADN polymérase (donneur) et de nucléotides marques à l’aide d’un fluorophore

(accepteurs).

La molécule d’ADN à séquencer est déposée sur une surface en présence d’une ADN

polymérase mobile : les nucléotides marqués sont ensuite ajoutés au milieu. Lorsque la

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 41

polymérase incorpore un nucléotide sur un fragment d’ADN en cours de synthèse, il y a

transfert d’énergie entre le groupement donneur et le groupement accepteur par proximité.

Une fluorescence est émise, et détectée.

Une plateforme de séquençage utilisant cette technologie est actuellement en cours de

développement : Starlight (Life Technologies).

Technologie de séquençage in situ

Une équipe a récemment mis au point une technique permettant le séquençage de courts

fragments d’ARN au sein de tissus, afin d’étudier le profil d’expression génique in situ. La

4ème

génération de séquenceurs permettra peut-être elle-aussi le séquençage de molécules

d’ADN ou d’ARN directement à partir d’une cellule ou d’un tissu (Junemann et al., 2013;

McGinn, 2013).

I.1.2.5 Applications de séquençage à haut débit

Les applications disponibles avec le séquençage à haut débit peuvent globalement se

regrouper en trois grandes catégories.

I.1.2.5.1 Le séquençage de novo

Il s’agit du séquençage d’un génome pour lequel il n’existe pas de séquence référence, donc

détermination d’une séquence inconnue. Pour réussir à obtenir des versions de génome de

bonne qualité, il est souvent nécessaire de combiner plusieurs méthodes. Le pyroséquençage

permet grâce à des lectures longues de construire une première version du squelette du

génome quand les méthodes par terminateurs réversibles vont corriger les erreurs présentes

dans cette première reconstruction pour produire un brouillon du génome de qualité. Dans le

domaine médical ces outils sont utilisés pour la découverte de génomes d’agents pathogènes

inconnus ou de nouveaux virus (Gaynor et al., 2007).

I.1.2.5.2 Le reséquençage

Dans les études de génomes, le terme de reséquençage est utilisé à la place de séquençage.

Cette dénomination, essentiellement utilisée en génétique, désigne le séquençage d’un

segment d’ADN suivi de la comparaison du résultat obtenu avec celui d’une séquence de

référence connue. Le séquençage à haut débit est alors employé pour connaître quelles sont

les variations génomiques de l’échantillon qui est étudié en comparaison avec celui pris

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 42

comme référence. Ces approches sont certainement parmi les plus employées actuellement

dans le domaine médical. Ces outils ont typiquement pour vocation de remplacer les

méthodes traditionnelles d’hybridation génomique comparative (CGH) et de permettre de

préciser les diagnostics soit de façon préventive soit pour caractériser une pathologie déjà

déclarée.

I.1.2.5.3 La métagénomique

Le dernier domaine d’application du séquençage à haut débit, à la frontière entre

reséquençage et séquençage de novo, concerne la métagénomique. Le but est de découvrir

dans un mélange complexe l’ensemble des organismes qui le composent comme par exemple

la flore intestinale. On peut ainsi imaginer qu’en séquençant le sérum de patients, il sera

possible de déterminer quels sont les agents pathogènes qui y sont présents et qui sont à

l’origine de la pathologie observée. Il pourrait aussi être possible d’envisager en toxicologie le

suivi de l’incorporation de vecteurs viraux dans différents tissus d’un organisme en dehors de

ceux ciblés par le vecteur de thérapie génique (Chiu et al., 2008).

I.1.2.6 Génomique comparative et exploitation des génomes

I.1.2.6.1 Assemblages des génomes

L’assemblage de séquence est le processus consistant à aligner, orienter et fusionner les

fragments d’ADN obtenus durant la phase de séquençage. Cette étape est nécessaire parce que

le séquençage d’ADN ne peut pas retourner en sortie le génome complet en une lecture. Au

lieu de cela, on obtient de petites séquences de 20bp à 40000bp (selon la technologie utilisée)

en utilisant souvent des fragments venant de séquençage shotgun. A partir des lectures de la

phase de séquençage, l’assembleur (un programme informatique) va essayer de mettre les

lectures ensemble en se basant sur leur chevauchement. L’assemblage est généralement fait en

2 étapes:

D’abord, les fragments sont assemblés en utilisant le chevauchement des lectures pour

construire de plus grandes séquences complètes appelées contigs. L’information

utilisée est ainsi généralement limitée aux lectures simples (sans l’information de

paire).

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 43

Ensuite vient la phase de scaffolding (échafaudage) : cette étape a pour but d’orienter

et de placer les contigs les uns par rapport aux autres pour obtenir une séquence

unique, bien que possédant des lacunes (soit des trous dans la séquence finale). Ces

lacunes seront corrigées lors de l’étape de finition du génome qui vise à combler les

trous restant dans l’assemblage par des méthodes expérimentales, comme la PCR ou

l’extension d’amorces (Pevzner et al., 2001).

L’assemblage de génomes complets destinés à être comparés nécessite une phase de

vérification. Les critères de qualité d’une séquence génomique complète sont une couverture

suffisante, un petit nombre de contigs et un minimum d’incertitude sur l’ordre de ces derniers.

Les étapes de finition et de validation d’un projet de séquençage sont généralement longues et

difficiles, dépendant à la fois de la méthode de séquençage utilisée, de la stratégie

d’assemblage et de la richesse en éléments répétés des génomes. De plus, la construction des

banques et librairies d’ADN génomique ou l’utilisation des programmes d’assemblage (et leur

paramétrage) peuvent générer des erreurs préjudiciables à l’analyse ultérieure des séquences

tels que des contigs chimériques et des décalages de phase de lecture artéfactuels.

Il existe différentes techniques permettant la validation d’un assemblage au niveau

«macroscopique » (scaffolding).

Une approche plus ancienne, utilisant le clonage, consiste à combiner un séquençage de

plusieurs banques de fragments génomiques de tailles différentes. Il existe des banques

d’inserts de taille moyenne (de 5 à 12 kpb) et des banques d’inserts de plus grande taille (50 à

100 kpb) clonés dans des vecteurs BACs (Bacterial Artificial Chromosome). Le séquençage et

l’assemblage d’inserts de différentes tailles permettent d’organiser les contigs entre eux et de

réduire l’incertitude de l’assemblage de certaines zones.

Une autre approche, par des cartes de restrictions obtenues par digestion de l’ADN

génomique par une enzyme, peut être utilisée pour valider un assemblage de génome. Une

migration sur gel ou une lecture optique des produits obtenus permet d’obtenir un profil de

restriction qui peut être comparé à un profil de restriction in silico du génome à valider.

Les cartes optiques sont des outils développés par la société OpGen Technologies (Madison,

WI) depuis une dizaine d’années. Il s’agit de cartes de restriction ordonnées à haute résolution

d’un génome dont l’obtention est grandement automatisée. Elle permet d’ordonner et

d’orienter des contigs lors d’un assemblage de génome et constitue également une méthode de

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 44

validation indépendante d’un projet de séquençage. Comparée à une carte de restriction in

silico d’une séquence connue, ces cartes optiques peuvent aussi être utilisées en génomique

pour identifier des réarrangements génomiques tels que des insertions, des délétions, des

duplications et des inversions (Shukla et al., 2009). Cette méthode peut être d’un grand intérêt

pour la finition de génomes complets (; Lim et al., 2001; Reslewic et al., 2005 Latreille et al.,

2007).

Dans certains cas, les approches et techniques de validation citées ci-dessus, les techniques

classiques de biologie moléculaire (PCR) et d’analyses bioinformatiques (biais de

composition en GC, assembleurs…) ne suffisent pas à valider l’organisation et la structure

d’un chromosome bactérien. Les incertitudes peuvent alors être levées par la mise en place

d’autres stratégies expérimentales faisant l’objet de projet de recherche.

I.1.2.6.2 Annotation des génomes

Le séquençage d’un génome permet de prédire les fonctions de gènes contenus dans un

organisme en annotant les gènes détectés dans une séquence d’ADN. Ce travail d’annotation

peut être décomposé en deux tâches dont l’une, l’annotation structurale, consiste à identifier et

à localiser les éléments génétiques en présence. La deuxième, l’annotation fonctionnelle,

consiste en la détermination de la fonction de ces éléments, en particulier la fonction des

gènes protéiques qui demeurent centraux dans l’annotation des génomes. Cette dernière est

réalisée à l’aide de pipelines d’annotation à savoir la plateforme Microscope (MaGe) de

Genoscope (Vallenet et al., 2006), la plateforme MIGALE AGMIAL (AGMIAL) (Bryson et

al., 2006), la platforme Prokka (Seemann, 2014) et le serveur Rast (Aziz et al., 2008). Ces

outils d’annotation intègre la détection des gènes à partir de la séquence des bases

nucléotidiques, la comparaison avec des génomes connus, un algorithme d’annotation

automatique permettant entre autres d’effectuer un choix, le plus rationnel possible, de la

fonction d’un gène et une interface visuelle permettant une annotation manuelle. Cependant,

cette annotation manuelle expertisée nécessite un travail manuel de vérification, long et

fastidieux (McAdam et al., 2014).

I.1.2.6.3 Apport de la génomique comparative

L’intérêt pour le séquençage a été stimulé par un besoin de connaissances. En effet, séquencer

le génome d’un micro-organisme permet d’avoir accès à la totalité de son information

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 45

génétique. Cependant, cette connaissance a plus de valeur si elle est mise en perspective et

comparée avec d’autres informations génomiques ou phénotypiques.

Le séquençage et la comparaison de plusieurs génomes au sein d’une espèce ou d’un genre

bactérien permet de définir le génome central (ou « core-genome ») et le génome total (ou «

pan-genome ») de l’espèce ou du genre. Le pan-génome décrit le nombre total de gènes

retrouvés au moins une fois dans une espèce ou un genre. En effet, les bactéries peuvent avoir

de grandes variations de contenu en gènes entre souches proches. L’analyse de ces gènes

permet donc de comprendre l’évolution d’un groupe bactérien, particulièrement pertinent dans

l’étude des métagénomes. Cependant, elle peut aussi être utilisée dans un contexte génomique

plus restreint. Le pan-génome inclut le core-génome contenant les gènes présents chez tous

les organismes en question, le génome accessoire contenant les gènes présents dans deux ou

plus des souches ou espèces, et les gènes uniques, spécifiques d’une seule souche ou espèce.

Le core-génome inclut généralement tous les gènes responsables des aspects principaux de la

physiologie et des caractères phénotypiques majeurs d’une espèce ou d’un genre. En

revanche, les gènes accessoires et uniques contribuent à la diversité des souches ou des

espèces et peuvent coder pour des voies métaboliques supplémentaires et des fonctions qui ne

sont pas essentielles à la croissance mais qui peuvent conférer un avantage adaptatif à

l’organisme, comme par exemple l’adaptation à une niche écologique, la résistance aux

antibiotiques ou encore la colonisation d’un hôte particulier. De tels gènes sont généralement

retrouvés dans les îlots génomiques (Medini et al., 2005 Reinhardt et al., 2009).

L’analyse des gènes accessoires permet donc de comprendre les spécificités de chaque

organisme séquencé. Remarquons ici que ces distinctions ne sont pas strictement biologiques

car elles dépendent en partie des souches ou espèces incluses dans l’analyse ainsi que des

paramètres utilisés pour les comparaisons et le regroupement des gènes.

Les études comparatives in silico effectuées sur les séquences des micro-organismes ont

permis de progresser dans de nombreux domaines concernant notamment la structure et la

diversité des génomes et en particulier l'identification de gènes de virulence et de

déterminants de pathogénicité pour les espèces pathogènes. Ces gènes peuvent êtres multiples

et variés. Ce sont principalement les gènes codant pour des toxines, les systèmes d’export de

macromolécules (ou systèmes de sécrétion) et les gènes codant pour des fonctions liées aux

interactions avec l’hôte tels que des gènes codant pour des fonctions d’adhésion, des gènes de

synthèse des polysaccharides de surface et de molécules d’interaction avec le système

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 46

immunitaire de l’hôte et des systèmes de captation du fer (Sidérophores)] qui sont recherchés

comme déterminants de virulence.

Le contenu en gènes d’un organisme reflète ses possibilités d’interactions avec son

environnement. Par exemple, la présence de gènes codant pour les enzymes d’une voie

catabolique donnée dans un génome indique que le micro-organisme est probablement

capable d’utiliser telles ou telles ressources présentes dans son environnement. Egalement,

comparer les contenus de plusieurs micro-organismes en gènes codant pour des systèmes

d’import et d’export de macromolécules tels que les polysaccharides ou les polyamino-acides

peut renseigner sur la capacité de ces micro-organismes à utiliser les ressources et nutriments

présents dans leurs milieux de vie dans les conditions physico-chimiques nécessaires à leurs

croissance. Le contenu en gènes d’un génome de micro-organisme reflète donc sa niche

écologique (Bhattacharyya et al., 2002; Buchrieser et al., 2003; Mellmann et al., 2011).

La comparaison de données génomiques de plusieurs isolats au sein d’une espèce permet

d’identifier des gènes ubiquitaires dans l’espèce. L’apport de génomes d’autres espèces

proches peut permettre d’identifier alors les gènes spécifiques de cette espèce. Ces gènes

spécifiques et ubiquitaires peuvent par exemple être utilisés comme cibles pour la mise au

point de moyens de détection ou de vaccins.

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 47

I.2 LES STAPHYLOCOQUES

I.2.1 Taxonomie

I.2.1.1 Historique

Les staphylocoques ont été l’objet de nombreuses investigations menées par d’éminents

microbiologistes à l’instar de Koch, Pasteur, Ogston et Rosenbach.

En 1878, Koch souligne le rôle pathogène des bactéries se présentant sous forme de cocci

Gram positif (Spicer, 2003). Ces cocci seront ensuite isolées, puis identifiés d’un pus par

Louis Pasteur en 1880. Ils seront baptisés en 1883 par Ogston sous le nom de

Staphylocoque pour décrire ces grains (kokkos) groupés en amas irréguliers à la

façon d'une grappe de raisin (staphylos) (Ogston, 1882).

En 1884, Rosenbach a obtenu des cultures pures de ces bactéries. Il a scindé le genre

Staphylococcus en deux groupes selon que les colonies étaient blanches ou dorées. La même

année, Gram mettait au point une méthode de coloration des bactéries à partir du violet de

gentiane : les staphylocoques étaient classés parmi les cocci à Gram positif (Gram, 1884).

I.2.1.2 Classification

La classification des staphylocoques a connu de nombreux bouleversements. Lors de la

première édition en 1923 du « Bergey’s Manual® of Determinative Bacteriology », les

staphylocoques étaient classés dans la famille des Streptococcaceae puis lors de la deuxième

édition en 1926, dans la famille des Micrococcaceae. En 1948, cette famille comprenait alors

les genres Micrococcus et Staphylococcus. Ce n’est qu’en 1957 que les staphylocoques et les

microcoques furent séparés sur la base de leur capacité à utiliser le glucose en anaérobiose.

Cependant, ce test amena beaucoup de confusion en attribuant certaines espèces du genre

Staphylococcus au genre Micrococcus (Baird-Parker, 1971 ; Pulverer, 1987).

En 1974, avec les débuts de la biologie moléculaire, Baird-Parker sépare définitivement le

genre Staphylococcus du genre Micrococcus, grâce à la différence du contenu en guanine et

en cytosine de leur ADN: 66-75% pour Micrococcus et 30-39% pour Staphylococcus

(Bascomb et Manafi, 1998). Avec l’évolution des techniques génomiques, le genre

Staphylococcus a été reclassé avec les bactéries à Gram positif dont l’ADN présente un GC%

inférieur à 55. Le GC% et la composition de la paroi sont des marqueurs robustes pour séparer

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 48

le genre Staphylococcus des autres coques à Gram positif et à catalase positive. Ainsi, la

famille des Micrococcaceaea été remaniée et dans la seconde édition du « Bergey’s Manual®

of Systematic Bacteriology », le genre Staphylococcus a été reclassé dans l’ordre des

Bacillales et dans la famille des Staphylococcaceae.

A ce jour, cinquante espèces et sous-espèces ont été identifiées au sein du genre

Staphylococcus (Annexe 2). Les espèces sont généralement classées en deux groupes sur la

base de leur capacité à produire une coagulase libre :

les staphylocoques à coagulase positive (SCP) : généralement considérés comme les

plus pathogènes, représentés par une seule espèce (S. aureus)

les staphylocoques à coagulase négative (SCN) : représentés par de multiples espèces

(S. epidermidis, S. saprophyticus, S. hominis, S. capitis ou S. hæmolyticus)

I.2.2 Réservoir et transmission

Les staphylocoques sont des bactéries ubiquitaires présentes sur la peau, les muqueuses et la

sphère rhino-pharingée chez l’Homme et chez les animaux. Ils ont également été isolés de

l’environnement naturel (sol, eau douce et eau de mer, poussière, air), de l’environnement

domestique de l’Homme (cuisine, réfrigérateur), de l’environnement hospitalier et des ateliers

de préparation alimentaires et à partir de denrées alimentaires (Annexe 2).

Chez l’Homme, la transmission est directe à partir des lésions ouvertes, ou indirecte par voie

aérienne et par les objets souillés. En milieu hospitalier, la transmission est essentiellement

manuportée par le personnel soignant.

I.2.3 Physiopathologie

Le pouvoir pathogène d’une souche est lié à sa capacité de survie et à ses nombreux facteurs

de virulence. La pathogénie des infections à S. aureus est liée à la synthèse d’adhésines, de

nombreuses exoprotéines et de toxines (Vandenesch et al., 2007):

Les adhésines, ont le pouvoir de reconnaitre les protéines de la matrice extracellulaire et

sont ainsi impliquées dans les phénomènes de colonisation des tissus de l’hôte.

Les exoprotéines comportent des facteurs qui interférent avec les défenses naturelles :

o La capsule qui joue un rôle antiphagocytaire.

o La protéase dirigée contre les immunoglobulines.

o Les leucocidines destructrices des polynucléaires.

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 49

o La protéine A qui interfère avec l’opsonisation.

o La coagulase favorisant la formation d’un caillot protecteur autour de la

bactérie.

o L’hyaluronidase et lastaphylokinasequi sont des invasines favorisant la

diffusion de l’infection et donc la dissémination de la bactérie.

Les toxines à activité superantigénique et les exfoliantes à tropisme cutané

La pathogénie des infections à SCN est plus incertaine. Leurs principaux facteurs de virulence

sont constitués d’adhésines dont certaines ont des homologies avec celles de S. aureus et sont

liées à la capacité de production d’exopolysaccharides plus ou moins exubérants entrant dans

la composition de biofilm et inhibant la phagocytose.

I.2.4 Infection

Les infections à staphylocoque se présentent souvent sous la forme d’infections suppuratives

superficielles cutanéomuqueuses pouvant se compliquer par diffusion à distance du foyer

infectieux initial (Figure I.15). Il peut parfois s’agir d’infections non suppuratives via un

phénomène toxinique.

Les infections à S. aureus sont liées aux capacités d’adhésion de l’isolat, à l’expression de

certains facteurs de virulence (notamment certaines toxines) et à la susceptibilité de l’hôte. À

l’inverse, les SCN sont peu virulents. L’expression clinique des infections à SCN est souvent

pauvre et celles-ci reposent essentiellement sur la capacité d’adhésion des SCN à du matériel

comme des cathéters ou des valves cardiaques prothétiques.

La gravité des infections à Staphylocoques dépend également du site infecté (Figure I.15),

notamment lorsqu’il concerne un organe vital, et le spectre des infections à SCN estlimité

alors que presque tous les sites anatomiques peuvent être infectés par S. aureus.

L’impact de la résistance à la méticilline sur la gravité clinique est largement débattu dans la

littérature, surtout pour S. aureus (Combes et al., 2004 ; Zahar et al., 2005). La morbidité des

infections à SARM pourrait être supérieure à celle des infections à SASM, plus en raison de

l’allongement de la durée de séjour attribuable à ces infections, aux difficultés thérapeutiques

rencontrées (Combes et al., 2004), aux pathologies associées et au terrain qu’à une plus

grande virulence (Jordens et al.,1989).

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 50

Figure I.15 : Les principales infections staphylococciques

I.2.5 Caractéristiques intrinsèques

I.2.5.1 Génome

Le génome du staphylocoque est constitué d’un chromosome circulaired’environ2800 paires

de bases, avec des prophages, plasmides et transposons. Les gènes de virulence et de

résistance aux antibiotiques sont retrouvés à la fois sur le chromosome et sur des éléments

extra chromosomiques, permettant leur transfert d’une bactérie à l’autre dans la même espèce

et dans des espèces différentes (Lindsay et al., 2004).

I.2.5.2 Enveloppe cellulaire

L’enveloppe cellulaire est formée du peptidoglycane, des acides teichoïques et

lipoteichoïques. Le peptidoglycane qui représente 50% de l’enveloppe du staphylocoque est

formé de polysaccharides auxquels s’attachent de manière covalente des acides teichoïques.

I.2.5.3 Capsule

Des polysaccharides capsulaires sont trouvés chez 90 % des souches. Onze types capsulaires

sont été décrits, et les types 5 et 8 sont les plus fréquents en pathologie humaine. La majorité

des staphylocoques dorés résistants à la méticilline appartiennent au type 5. La capsule permet

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 51

une meilleure résistance des souches à l'opsonisation et à la phagocytose. Certaines souches

produisent un exo polysaccharide, qui entraîne la formation d'un biofilm, engluant les

bactéries et constituant ainsi une forme de résistance au site de colonisation.

Certaines protéines ou glycoprotéines sont responsables de la spécificité de type. Il existe 14

sérotypesmis en évidence par réaction d'agglutination au moyen d'immunosérums (Renaud et

al., 2007).

I.2.5.4 Facteurs de virulence

Protéines de surface : Il existe une grande homologie dans la capacité de produire des

protéines d’adhésion au sein de toutes les espèces du genre Staphylococcus. Plusieurs de

ces protéines de surface jouent un rôle dans la capacité des staphylocoques à coloniser les

tissus en se fixant aux cellules et à la matrice extracellulaire. Ils agissent comme des

adhésines et portent de manière plus générale le nom de MSCRAMM.

Facteur inhibant la phagocytose : La protéine A inhibe l’opsonophagocytose grâce à sa

capacité de fixation du fragment Fc des immunoglobulines. Elle est actuellement

considérée comme une MSCRAMM car elle permet l’attachement de S. aureus au facteur

de Von Willebrand. Il s’agit d’un peptide présent sur l’endothélium lésé, et la protéine A

peut de ce fait jouer le rôle d’adhésine au début de l’infection intra vasculaire (Renaud et

al., 2007).

Toxines : Les SCP à la différence des SCN, produisent de nombreuses toxines :

Cytotoxines : la protéine alpha est une toxine à action membranaire. Après liaison au

récepteur membranaire, elle forme des pores d’où peuvent s’échapper des cations et

petites molécules

Super antigènes: ces toxines pyrogènes se lient au CMH de type II et causent une

prolifération majeure de lymphocytes T avec production de cytokines.

Entérotoxines: elles sont responsables du choc toxique staphylococcique et de

toxiinfection alimentaire (entérotoxines A, B, C1, C2, C3, D et E),

TSST-1 (toxicshocksyndromtoxin 1) : elle est structurellement proche des

entérotoxines B et C. On la retrouve dans 20 % des souches de S.aureus.

Exfoliatines: toxines épidermolytiques A et B. Elles sont responsables d’érythème et

de clivage de l’épiderme, causant l’épidermolyse bulleuse staphylococcique.

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 52

Leucocidine de Panton-Valentine (PVL) : fait partie d’une famille de toxines

synergohyménotropes. Ce sont des protéines à deux composants non associés mais

agissant en synergie sur les membranes cellulaires. Ces toxines ont des cellules cibles

(polynucléaires, monocytes, macrophages) sur lesquelles elles se fixent et

provoquent la formation de canaux membranaires laissant passer les cations divalents

(Renaud et al., 2007).

Enzymes : Les staphylocoques produisent de nombreuses enzymes comme des protéases,

lipases, hyaluronidases qui lysent les tissus et peuvent faciliter l’extension de l’infection

aux tissus adjacents.

La coagulase est une protéine extracellulaire qui se lie à la prothrombine de l’hôte et forme

un complexe appelé staphylothrombine. La thrombine activée transforme donc le

fibrinogène en fibrine. C’est la base du test de la coagulase en tube. C’est un marqueur

classique de l’identification de S. aureus. Il n’y a cependant pas d’argument formel en

faveur du rôle de la coagulase dans la virulence des souches.

Les lactamases inactivent la pénicilline. Les PBP sont situées dans la membrane

cytoplasmique, leur modification confère une résistance aux pénicillines A et M et aux

céphalosporines (Renaud et al., 2007).

I.2.5.5 Régulation des facteurs de virulence

La synthèse des facteurs de virulence est biphasique. A la phase initiale de la croissance

bactérienne, ce sont surtout les gènes codant pour des adhésines qui sont activés.

Secondairement, les gènes des toxines prennent le relais. Cette activation séquentielle est sous

la dépendance du système de régulation de la virulence appelé agr (accessory gene regulator)

(Bronneret al., 2004; Dufour et al., 2002). Le système agr met en jeu un mécanisme de

déclenchement par un seuil «quorum sensing» : il code pour un peptide qui est sécrété dans

l’espace extracellulaire et son accumulation agit comme un signal sur la densité cellulaire

conduisant à l’activation du système agr (Yarwood et Schlievert, 2003) (Figure I.16). Ce

dernier possède un polymorphisme génétique avec quatre groupes alléliques identifiés

(Jarraud et al., 2000).

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 53

Figure I.16: Facteurs de virulence exprimés à la surface ou excrétés par S. aureus en

fonction de la densité bactérienne (Ferry T et al., 2005).

I.2.6 Antibiothérapie

Un antibiotique (du grec anti : « contre », et bios : « la vie ») est une molécule naturelle ou

synthétique qui détruit ou bloque la croissance des bactéries. Dans le premier cas, on qualifie

l’antibiotique de bactéricide et dans le second cas on dira plutôt que l’antibiotique est

bactériostatique. Plusieurs molécules aujourd'hui sur le marché sont des molécules de

synthèse, dérivées ou non d'antibiotiques naturels.

I.2.6.1 Mécanismes d’action des antibiotiques

Les antibiotiques agissent de manière spécifique sur les bactéries en bloquant une étape

essentielle de leur développement. On peut classer ces molécules selon les mécanismes

qu’elles inhibent. Cinq mécanismes sont majoritairement ciblés, soit l’inhibition de la

synthèse de la paroi bactérienne, de la transcription, de la réplication de l’ADN, de la

traduction et finalement le métabolisme des folates (Procopio et al., 2012) (Tableau I.1).

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 54

Tableau I.1 : Mécanismes d’action des principales familles d’antibiotiques utilisées chez

l’Humain

Mécanismes d’action Familles d’antibiotiques

Inhibition de la synthèse de la paroi

bactérienne

Pénicillines, céphalosporines, carbapénèmes,

daptomycines, monobactames, glycopeptides

Inhibition de la transcription Rifampicine

Inhibition de la réplication de l’ADN Fluoroquinolones

Inhibition de la synthèse protéique Tétracyclines, aminoglycosides, streptogramines,

lincosamides, macrolides, kétolides, oxazolidinones

Inhibition du métabolisme des

folates

Sulfonamides, triméthoprime

I.2.6.2 Résistance aux antibiotiques

La découverte de la pénicilline et ses propriétés bactéricides, par Alexander Fleming en 1929,

a ouvert la voie au traitement des maladies infectieuses par les antibiotiques et a donné de

grands espoirs en changeant le pronostic de ces infections. La pénicilline a été utilisée pour la

première fois en 1941 pour traiter un patient atteint de septicémie à staphylocoque.

En 1953, a été isolée pour la première fois au Canada, une souche de S. aureus résistante à la

pénicilline qui était à l'origine de lésions cutanées, de pneumonies chez les enfants ou de

septicémies. L'arrivée d'un autre antibiotique, la méticilline, dans les années 60, a mis fin à

cette épidémie. Par ailleurs, la résistance à la méticilline de souches de S. aureus, isolées en

pathologie humaine, n'a pas mis longtemps à survenir et a été décrite dès 1961 au Royaume-

Uni (Figure I.17).Cette résistance est due à la production d’une protéine liant les pénicillines,

PLP2a, qui a une affinité faible pour toutes les bêtalactamines. La PLP2a est codée par le

gène mecA qui est inclus dans un élément génétique mobile dénommé SCCmec (Lowy, 1981).

Bien que cette cassette soit un élément génétique mobile, son acquisition in vivo est un

phénomène exceptionnellement observé. Ainsi, S. epidermidis représente la majorité des

SCNRM (Bertrand et al., 2005). Quelques clones SARM hospitaliers ont émergé depuis

l’introductionde la méticilline et sont responsables à eux seuls de la majorité des infections

nosocomiales à S. aureus (Robinson, 2004). Il existe cinq grands groupes de SARM

hospitaliers et actuellement, le clone SARM hospitalier dénommé clone Lyon est majoritaire

en France (Robinson, 2004 ;Ferry et al., 2006). Ce clone, le plus souvent sensible à la

gentamicine, résistant à la kanamycine, à la tobramycine, aux macrolides lincosamides et

streptogramines B et aux fluoroquinolones, était responsable de70 % des bactériémies à

SARM dans les services de réanimation de Lyon en 2003 (Ferry et al., 2006). Dans les

services de réanimation, épicentres de la résistance bactérienne, un taux de SARM supérieur à

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 55

50 % était habituel dans les années quatre-vingts et quatre-vingt-dix. Les efforts concernant le

contrôle des SARM à l’hôpital ont abouti à une diminution constante des taux depuis 1994. Il

atteint 22,8 % des souches isolées en réanimation en 2006 à l’Assistance publique-Hôpitaux

de Paris. Depuis la fin des années quatre-vingt-dix, les SARM circulants et particulièrement

les SARM appartenant au clone Lyon, ont plus fréquemment une résistance de type

hétérogène à la méticilline, et globalement une plus grande sensibilité aux antibiotiques, plus

particulièrement à la gentamicine (Aubry-Damon et al., 1997).

Depuis une dizaine d’années, des clones SARM ont émergé dans la communauté. Ces clones

ont acquis la cassette SCCmec et ont la capacité de produire la PVL qui est un facteur de

virulence associé à des pathologies bien particulières (Lina et al., 1999 ;Dufour et al., 2002).

Plusieurs clones SARM-C ont émergé en même temps sur les cinq continents (Vandenesch et

al., 2003). Un de ces clones, USA300, est responsable d’infections cutanées épidémiques

familiales et hospitalières aux États-Unis (Vandenesch et al., 2003 ; Mishaan et al ., 2005).

Selon des données récentes, ce clone serait devenu majoritaire dans certaines villes des États-

Unis et a même été responsable d’infections nosocomiales (Gonzalez et al., 2006). En Europe,

il existe un clone SARM-C différent du clone USA300 mais dont la prévalence reste faible.

La résistance et la sensibilité intermédiaire de S. aureus aux glycopeptides, respectivement

VRSA et GISA, sont exceptionnelles et concernent les SARM hospitaliers (Figure I.17). Une

première souche de SARM ayant une résistance à la vancomycine a été isolée au Japon en

1996 (Hanaki et al., 1999), puis d’autres souches ont été isolées, notamment aux États-Unis et

en Grande-Bretagne. La première souche de S. hæmolyticus résistante à la vancomycine a été

rapportée en 1987. Des résistances cliniques liées à une augmentation des CMI ont été

décrites pour S. hæmolyticuset S. epidermis dans des péritonites. Elles sont apparues le plus

souvent après une longue exposition préalable à la vancomycine. Le mécanisme de cette

résistance est dû à une augmentation de synthèse de la paroi bactérienne limitant la

pénétration de la vancomycine jusqu’à sa cible (Hanakiet al., 1999). Ces souches VISA ne

semblent pas avoir posé de problème clinique, mais leur apparition doit faire redoubler de

prudence, d’autant qu’elles sont très difficiles à dépister au laboratoire. On note tout de même

une augmentation progressive de la CMI des SARM aux glycopeptides dont l’impact en

clinique est encore incertain (Robert et al., 2006).

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 56

Figure I.17 : L’histoire d’apparition des antibiotiques et des SARMs (Kos et al.,2012).

I.2.7 Cassettes SCCmec

I.2.7.1 Définition

La cassette SCCmec est l'élément génétique mobile véhiculant le gène mecA qui code pour la

résistance à la méticilline chez les staphylocoques (Hiramatsu et al., 2002; Ito et al., 1999).

Cet élément possède plus de 50 orfs et est muni d’un site précis d’intégration : orfX ou

attBscc dans le génome de S. aureus. Des insertions jusqu’à 15kB, des délétions, ou des

duplications ont été observées entraînant l’évolution des séquences attB chez les SASM et par

conséquent leur incapacité à acquérir les cassettes SCCmec dans leur chromosome. Au total,

l’intégration d’une cassette SCCmec représente un coût évolutif pour une souche qui n’a

d’intérêt que si elle est soumise à la pression antibiotique. Sinon, elle poursuit son évolution la

rendant inapte à intégrer de tels éléments génétiques (Noto et al., 2008).

Enfin, il convient de noter que ces cassettes SCCmec ne sont pas exclusivement retrouvées

chez S. aureus, mais sont également rencontrées parmi les SCN. Il existe d’ailleurs une très

grande diversité de cassettes SCCmec parmi les SCN (Hanssen et al., 2007).

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 57

I.2.7.2 Structure générale

La structure des cassettes SCCmec est formée de deux éléments essentiels (Figure I.18) :

Le complexe mec : est composé du gène mecA, des éléments de régulation mecI et mecR1

et d’une séquence d’insertion située à proximité du gène mecA : IS431. L’ensemble forme

le complexe mec de classe A. Des variations ont été détectées, notamment des délétions ou

des insertions partielles dans les gènes de régulation de mecA, donnant naissance aux

autres complexes mec: classe B, classe C, classe D et classe E ( Katayama et al., 2001 ;

IWG-SCC 2009).

Les gènes codant les recombinases : sont responsables de l’intégration et de l’excision de

la cassette ccr situés en 5’ en amont du complexe mec, les gènes ccr sont impliqués dans

l’intégration site spécifique des cassettes SCCmec. Différents types ont été définis : ccr1,

ccr2, ccr3. De part et d’autre de ces éléments, sont situées les régions J: J1, J2 et J3 qui

contiennent de nombreux pseudo gènes d’intérêts inconnus pour la bactérie.

Figure I.18 : Représentation des 4 types de cassettes SCCmec (Hiramatsuet al., 2002).

Le complexe ccr est représenté en orange, le complexe mec en rose. Les zones grises correspondent aux éléments non essentiels des

complexes SCCmec et sont divisées en 3 régions : J1 à J3. Différents gènes codant la résistance à différents antibiotiques sont retrouvés dans les régions J de différentes cassettes SCCmec expliquant les phénotypes multirésistants des souches possédant de tels complexes. Il est

à noter qu’environ 70% de la cassette SCCmec IV est composée de seulement les gènes essentiels. La région J1 est différente des autres

cassettes SCCmec, la région J2 est absente et la région J3 est quasi identique à celle de la cassette SCCmec II.

I.2.7.3 Classification et typage

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 58

L’analyse des différentes collections de souches a permis la mise en évidence de huit types de

cassettes SCCmec selon l’International Working Group on the Classification of

Staphylococcal Cassette Chromosome Elements (IWG-SCC 2009) (Figure I.19).

Figure I.19 : Représentation schématique des 8 cassettes SCCmec (Van den Eede et al.,

2009).

De nombreuses méthodologies de typage des cassettes ont été décrites reposant initialement

sur l’association d’analyses southern et l’utilisation de trois enzymes de restriction, de

nombreuses PCR, et de séquençages. Oliveira et al. ont proposé une stratégie d’identification

rapide des 4 cassettes (I, II, III et IV) par une PCR multiplex unique (Oliveira et al., 2002).

L’analyse de leurs séquences a rapidement fait apparaitre de nombreuses différences :

Cassette SCCmec I : associe gène ccr1 avec un complexe mec de classe B, issu de la

délétion d’une partie de gène mecR1 et de son remplacement par une partie de l’IS1272.

Enfin, la région J1 contient de nombreux pseudo gènes et un gène pls codant une protéine

de surface.

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 59

Cassettes SCCmec de type II et III : sont caractérisées par l’association au complexe

mec de classe A de nombreux gènes d’origines plasmidiques codant la résistance aux

aminoglycosides, aux macrolides, aux tétracyclines, au cadmium, etc. Enfin, ces cassettes

présentent fréquemment une mutation du gène mecI, répresseur du gène mecA.

Cassette SCCmec IV : est caractérisée par une taille plus faible en comparaison aux

précédentes, une recombinase ccr2 et un complexe mec de classe B. Elle possède une

région J de taille réduite et l’absence de gènes de résistance à d’autres antibiotiques

(Hiramatsu et al., 2002).

Cependant, l’analyse de nombreuses collections de souches a rapidement démontré la

complexité structurale des autres cassettes SCCmec mettant en lumière les insuffisances de la

technique de caractérisation développée par Oliveira et al. en 2002. En 2006,

Chongtrakool et al. proposèrent de nouvelles techniques d’identification et une nouvelle

nomenclature d’identification des cassettes SCCmec :

Cassette SCCmec de type V (Ito et al., 2004) : découverte sur un SARM provenant

d’Australie associe un complexe mec de classe C2 avec un nouveau gène de recombinase

présent à l’état unique ccrC. De petite taille et ne présentant pas de résistances associées

aux antibiotiques, cette cassette possède un ensemble de gènes facilitant sa stabilisation

dans le chromosome bactérien.

Cassette SCCmec de type VI (Oliveira et al., 2006) : se caractérise par l’association

d’un complexe mec de type B, de recombinases ccrAB4 et non ccrAB2 et d’une région J1

spécifique.

Cassette SCCmecde type VII (Higuchiet al., 2008): a été individualisée, en 2008, dans

une souche de SARM-C. Elle est de grande taille (41,3kb) par rapport aux autres

cassettes SCCmec, cette nouvelle entité est composée de trois grandes régions distinctes :

la région J1 (site attL, le gène codant la recombinase ccrC8, l’IS431 le transposon Tn554,

et l’ORF), la région J2 (le complexe mec qui est homologue avec la cassette SCCmec V)

et région J3 (issue de recombinaisons multiples entre les différentes cassettes

précédemment décrites).

Cassette SCCmecde type VIII (Zhang et al., 2009) : Elle est en cours de

caractérisation (www.sccmec.org/Pages/SCC_TypesEN.html).

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 60

I.2.8 Staphylococcus capitis

Cette espèce représente la souche cible de notre travail.

I.2.8.1 Taxonomie

Le Staphylococcus capitis est une espèce de SCN. En 1991, elle a été subdivisée en deux

sous-espèces : S. capitis subsp. capitis et S. capitis sbspurealyticus (annexe 2). La

classification scientifique de S. capitis est la suivante :

Uni Bactéries

Embranchement Firmicutes

Classe Bacilles

Ordre Bacillales

Famille Staphylococcaceae

Genre Staphylococcus

Espèce Capitis

Sous-espèce capitissubsp. Capitis

capitissbspurealyticus

I.2.8.2 Habitat

Le S. capitis fait partie de la flore cutanée normal de l’homme, elle a été isolée au voisinage

des glandes sébacées du cuir chevelu, du visage, du cou et des oreilles et aussi chez le

chimpanzé et dans le lait de chèvre (Bannerman et al., 1991).

I.2.8.3 Pouvoir pathogène

Il a été décrit que cette espèce a été la cause de plusieurs infections : endocardite infectieuse

et sur prothèse valvulaire, méningites sur valve de dérivation et septicémie tardive.

I.2.8.4 Résistance aux antibiotiques

Il y a très peu d’information sur le niveau de résistance de cette espèce. Récemment, Il a été

décrit l’émergence de souches résistante à la méticiline et ayant une sensibilité réduite à la

vancomycine dans les hôpitaux de plusieurs pays (Van Der et al., 2002, Gras-Le Guen et al.,

2007, Rasigade et al., 2012). Le rôle de la cassette SCCmec n’a jamais été décrit.

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 61

I.2.8.5 Caractères bactériologiques

Il s’agit de cocci à Gram positif qui ils peuvent être isolés en diplocoques ou en amas. Comme

tous les Staphylocoques, cette espèce n’a pas d’exigence nutritive particulière. Son

métabolisme respiratoire est aérobie-anaérobie facultatif. L’aspect et la couleur des colonies

des deux sous espèces diffèrent :

S. capitis subsp. capitis : Diamètre des colonies de1 à 3 mm, lisse, convexes, à centre

surélevés, luisantes, bords réguliers, opaques, non pigmentées (blanc craie)

S.capitis sbs purealyticus : Diamètre des colonies de 4 à 7 mm, surélevées, circulaire,

bords réguliers à dentelés, luisantes, opaques, surfaces lisse ou rugueuse, pigmentées

en jaune ou jaune-orange, pigmentation tardive et dominante en périphérie de la

colonie pour 73% des souches (Renaud et al., 2007).

Les principaux caractères biochimiques d’identification de S. capitis sont présentés dans le

tableau 2.

Tableau I.2 : Identification biochimique de S. capitis

Caractères Espèces et sous-

espèces

Pig

men

t

Uré

ase

Orn

ith

ine

déc

arb

ox

yla

se

Arg

inin

e ar

yla

my

das

e

Ph

osp

hat

ase

alca

lin

e

Py

rro

lydo

ny

lary

lam

idas

e

Bêt

a-G

luco

sid

ase

Bêt

a-G

alac

tosi

das

e

Th

erm

onu

cléa

se

Co

agu

lase

lib

re

Fac

teu

r ag

glu

tin

ant

Production d’acide enaréabiose)

Alp

ha-

Lac

tose

Mal

tose

Man

nit

ol

D-M

ann

ose

Sac

char

ose

D-T

ura

no

se

D-T

réh

alo

se

S.capitissubsp.

Capitis + d d + d d +

S.capitissbspurealytic

us d ± + ±

+, 90% ou plus de souches positives ; ±, 90% ou plus de souches faiblement positives ; , 90% ou plus de souche négative ;

d, 11 à 89% de souches positives ; (), réaction lente ;

I.2.8.6 Caractéristiques génomiques

En utilisant la stratégie de séquençage aléatoire, il a été décrit en 2012 début de ma thèse que

seulement trois centres ont réalisé le séquençage du génome entier de trois espèces de S.

capitis d’origine clinique (tableau I.3). Les caractéristiques générales du génome de ces trois

souches de S. capitis sont citées dans le tableau I.4. Actuellement le nombre des génomes

séquencés est de 37 génomes (9 génomes font partie de ce travail).

(https://www.ncbi.nlm.nih.gov/genome/genomes/2054?)

CHAPITRE I

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 62

Tableau I.3 : Lieu, origine et date de séquençage des 3 souches S. capitis.

Désignation Centre de Séquençage Spécimen

D’origine

Année de

Séquençage

S. captis SK14 Institut J Craig Venter

(HumanMicrobiome Project)

Peau 03/02/2009

S. capitis

VCU116.

Institut national des maladies

allergiques et infectieuses(NIAID) et

centres de séquençagedu génomepour

les maladies infectieuses(GSCID

inconnu 25/07/2011

S. capitis QN1 Zhejiang University(Creative

Research Groups of the National

Natural Science Foundation of China

and the Technology Group Project for

Infectious Disease Control of Zhejiang

Province)

Peau

22/05/2012

Tableau I.4: Caractéristiques générales du génome des trois souches de S.

capitis.(http://www.ncbi.nlm.nih.gov/genome/genomes/2054?details=on&http://www.ncbi.nl

m.nih.gov/genome/genomes/155?details=on&project_id=53751)

Organisme

Type S. capitis SK14 S. capitis QN1 S. capitis VCU116

Bio project PRJNA55415 PRJNA31013 PRJNA53751

Instrument 454 GS FLX Illumina Hiseq2000 454

Statut Draft Draft Draft

Taille du génome

(Mb)

2.44 2.43 2.45

Contenu GC (%) 32.8 32.8 32.8

Gène 2.406 2.430 2.444

Pseudogènes 111

Protéine 2.230 2.374

ARNr 2 5 5

ARNt 57 53 55

Autre ARN 7 10

Nucléotide 33 31 39

Assemblage ASM17413v1 StacapQN11.0 ASM22152v2

Statut (Scaffolds

or contigs)

32 30 38

CDS (predicted

coding sequences)

2.230 2.368

CHAPITRE II

Séquence génomique complète de

Staphylococcus capitis CR01 :

Génome de référence

CHAPITRE II

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 63

Les staphylocoques, membres de notre écosystème cutané, ensemble avec les streptocoques et

les pneumocoques font partie d’un groupe d’agents pathogènes à Gram positif opportunistes

et envahissants, connus sous le nom de cocci pyogènes, responsables d’une variété

d’infections humaines (Lowy FD, 1998).

Les infections à staphylocoques représentent un pourcentage important des infections graves,

notamment au cours des infections nosocomiales, dont la prévalence ne baisse pas malgré les

mesures de prévention. La pathogénicité des staphylocoques pose peu de problème en ce qui

concerne Staphylococcus aureus (SA), mais elle est plus discutée pour les staphylocoques à

coagulase négative (SCN).

Les espèces de SCN les plus fréquentes sont S. capitis, S. epidermidis, S. haemolyticus et S.

hominis (Kloos et Musselwhite, 1975). Leur distribution sur la peau n’est pas uniforme (Kloos

et al., 1976). Il existe des niches préférentielles qui témoignent d’une adaptation de certaines

espèces aux différentes régions de la peau. Les espèces les plus exigeantes se trouvent dans

les zones où se produit une sudation importante, constituant ainsi un excellent milieu de

culture. S. epidermidis est prédominant dans les narines. S. epidermidis et S. hominis sont

persistants sur la tête, les aisselles, les jambes et les bras. Le front est souvent colonisé par S.

capitis et S. haemolyticus. S. saccharolyticus est souvent isolé de la tête et des bras et S.

auricularis de l’oreille. Au niveau des mains se retrouvent les espèces S. epidermidis, S.

haemolyticus et S. hominis (Kloos et Schleifer, 1986)

Staphylococcus capitis est une espèce en pathologie humaine, et qui le plus souvent n'exprime

que très peu de virulence et de résistances aux antibiotiques. Cependant, il a été identifié par

électrophorèse en champs pulsé « PFGE » un clone, nommé NRCS-A, responsable

d'infections tardives chez les nouveaux nés hospitalisés dans les services de réanimation

néonatale (enfants très grands prématurés). Ce clone a été identifié comme spécifiquement

responsable de septicémie dans ce type de service sur une large échelle de temps et dans de

nombreux pays à travers le monde, alors qu’il n’est jamais retrouvé chez les adultes (Van Der

Zwet et al., 2002 ; Venkatesh et al., 2006 ; Rasigade et al., 2012 ; D'mello et al., 2008 ;

Boghossian et al., 2013 ; Cui et al., 2013).

Au début de mes travaux de thèse, aucun génome complet de Staphylococcus capitis isolée

chez les nouveaux nés hospitalisés dans les services de réanimation néonatale n’a été

disponible dans les bases de données. Seulement trois draft génomes de souches isolées de

chez les adultes ont été déposés dans GenBank (Qin N et al., 2012). Il s’agit de S. capitis

CHAPITRE II

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 64

VCU116 (NCBI Ref. Seq : NZ_AFTX00000000.1), S. capitis SK14 (NCBI Ref. Seq :

NZ_ACFR00000000.1) et S. capitis QN1 (NCBI Ref. Seq : NZ_AJTH00000000.1). Dans ce

contexte, nous avons envisagé de séquencer le génome complet d’une souche multi-résistante

S.capitis CR01 (pulsotype NRCS-A) qui a été isolée en 2009 des services de réanimation

néonatale, hospices civils, Lyon, France. L'objectif était d'avoir un génome de référence

permettant de mieux caractériser cette espèce émergente. Pour ce faire, nous avons utilisé

deux technologies de séquençage à haut débit (mixte) : le pyroséquençage GFLX+ titanuim

(454) et le PacBio (SMART). La première technologie de séquençage fait objet de ce chapitre

et la deuxième est détaillée dans le chapitre IV.

Au moment du lancement de notre projet de recherche, la plateforme de séquençage à haut

débit choisie est le séquenceur 454 de chez Life Sciences, en raison de la longueur des

séquences générées. C’est ce paramètre, important à considérer pour une espèce dont le

génome de référence n’est pas encore disponible, qui nous a conduit à privilégier cette

technique par rapport à d’autres plateformes qui donnent des fragments plus courts à savoir

les deux technologies illumina et solide qui sont plus difficiles à assembler et à annoter

(Metzker, 2010).

Les lectures (« reads ») obtenues par le pyroséquençage GFLX+ titanuim, ont été assembler

en utilisant l’assembleur Newbler 2.7, ce qui a permis d'avoir un premier draft génome de la

taille de 2,504,472 bp. Ce draft génome a été annoté par la plateforme d’annotation MaGe

(Vallenet et al., 2006 ; Vallenet et al., 2013) et a été déposé, par la suite, dans GenBank sous

le numéro d’accession CBUB000000000.1

Le séquençage PacBio détaillé dans le chapitre IV, nous a permis de confirmer le scaffolding

qui a été fait par le pyroséquençage GFLX+ titanuim et aussi d'améliorer la séquence du draft

génome en fermant les gaps au sein des scaffolds. Au final, nous avons pu assembler la

séquence de S.capitis CR01 sous forme d'un seul chromosome circulaire de 2,522,871bp et un

plasmide de 26.140 pb.

Le contenu de ce chapitre est présenté sous forme d’un article publié dans la revue Standards

in Genomic Sciences (Lemriss et al., 2014). La référence de cet article est la suivante : Stand

Genomic Sci. 2014 Jun 15; 9(3): 1118–1127 (doi:10.4056/sigs.5491045). Dans cette

publication, j’ai réalisé tout le travail du laboratoire, principalement l’identification de la

souche S. capitis CR01 par spectrométrie de masse MALDI TOF, l’antibiogramme de cette

souche, l’extraction de l’ADN génomique, le séquençage à haut débit par pyroséquençage

CHAPITRE II

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 65

GFLX+ titanuim, l'assemblage génomique en utilisant les différentes méthodologies

bioinformatiques et outils (logiciels et machines) et l’annotation automatique et manuelle.

II.1 Abstract

Staphylococcus capitis is a coagulase-negative staphylococci (CoNS) commonly found in the

human microflora. Recently, a clonal population of Staphylococcus capitis (denominated

NRCS-A) was found to be a major cause of late-onset sepsis (LOS) in several neonatal

intensive care units in France. Here, we report the complete genome sequence and annotation

of the prototype Staphylococcus capitis NCRS-A strain CR01. The 2,504,472 bp long genome

(1 chromosome and no plasmids) exhibits a G+C content of 32.81 %, and contains 2,468

protein-coding and 59 tRNA genes and 4 rRNA genes.

II.2 Introduction

A frequent cause of low-weight newborns mortality and morbidity in Neonatal Intensive Care

Units (NICUs) are late-onset sepsis (LOS), that are de-fined as sepsis occurring after 3 days

of age. The most frequently encountered pathogens are coagulase-negative staphylococci

(CoNS) and within those Staphylococcus epidermidis has been shown to be the most

prevalent [1,2]. However, a few studies have reported the emergence of Staphylococcus

capitis as a main CoNS- and LOS- causative pathogen in NICU settings [2,4]. A study in

French NICUs [2] has demonstrated the spread of a single clonal population of methicillin-

resistant S. capitis (pulsotype NRCS-A) associated to reduced susceptibility to vancomycin,

the first line of antibiotics used in cases of LOS. Moreover, this clone has also been recently

identified in NICUs in Belgium, United Kingdom and Australia, which suggests a worldwide

distribution. In contrast, in adult bacteremia, S. capitis are rarely found and when detected, it

presents a bigger diversity in terms of genotypes as well as antimicrobial susceptibility

profiles than neonates bacteremia.

In order to elucidate the molecular mechanisms behind the wide spreading of the S. capitis

NRCS-A clone in NICUs throughout the world, we sequenced a prototype strain (CR01).

II.3 Classification and information

A strain belonging to the clonal population of Staphylococcus capitis NCRS-A pulsetype

(Table II.1) was isolated from the blood culture of a preterm infant with LOS, hospitalized in

the NICU of the Northern Hospital Group Center (Hospices Civils de Lyon, Lyon, France)

and suffering of LOS.

Species identification of the bacterial isolates and antimicrobial susceptibility testing (AST)

CHAPITRE II

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 66

were performed, respectively, using Vitek MS (bioMérieux, Marcy l’Etoile), 16S rDNA

sequencing, the automated BD Phoenix system (Becton Dickinson, Sparks, MD) and with

Shimadzu-MALDI-TOF MS system (Shimadzu Corporation), as implemented on [5].

The strain was identified as being a Staphylococcus capitis by VITEK MS with 99.9% and at

93.7% by the MALDI-TOF MS, using the Shimadzu Launchpad software program and the

SARAMIS database application (AnagnosTec GmbH) for automatic measurement and

identification (Figure II.1). Based on the information provided by the manufacture, when the

score is ≥ 70%, identification is considered of high confidence.

The antimicrobial susceptibility test (AST) results were analyzed according to the

recommendations of the French Microbiology Society [6]. The S. capitis bacteremia was

considered positive based on a single positive blood culture [2, 7]. The The S. capitis NCRS-

A isolate CR01, as all isolates from this clone, is resistant to penicillin, methicillin,

gentamicin, rifampin, hetero-resistant to vancomycin and sensitive to fusidic acid and

fluoroquinolones.

Table II.1, Figure II.2 and Figure II.3 show detailed information concerning general features

of Staphylococcus capitis strain (CR01) and position within the staphylococcus genus.

Table II.1 Classification and general features of Staphylococcus capitis strain CR01,

pulsetype-NRCS-A according the MIGS recommendation [10].

MIGS ID Property Term Evidence codea

Current classification

Domain Bacteria

Phylum Firmicutes

Class Bacilli

Order Bacillales

Family Staphylococcaceae

Genus Staphylococcus

Species Staphylococcus capitis

Strain CR01, pulsetype-NRCS-A

TAS [11]

TAS [12,14]

TAS [15,16]

TAS [17,18]

TAS [19,20]

TAS [17,21, 23]

TAS [9]

TAS [2, 40]

Gram stain Positive TAS [24]

Cell shape round-shaped TAS [9]

Motility No-motile TAS [24]

Sporulation none TAS [24]

Temperature range mesophilic IDA

Optimum temperature 37°C TAS [9]

Carbon source Carbohydrates TAS [9]

Energy source chemoorganotropic TAS [9]

Terminal electron

receptor

O2 TAS [9]

MIGS-6 Habitat Skin of humans TAS [9]

MIGS-6.3 Salinity

physiological TAS [9]

CHAPITRE II

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 67

MIGS-22 Oxygen

Facultative anaerobes TAS [9]

MIGS-15 Biotic relationship free-living TAS [9]

MIGS-14 Pathogenicity Opportunistic pathogen

(Nosocomial bacteremia in

premature neonates)

TAS[2]

MIGS-4 Geographic location NICU Lyon, France TAS[2]

MIGS-5 Sample collection

time

2007 IDA

MIGS-4.1

MIGS-4.2

Latitude – Longitude 45° 45' 35" N 4° 50' 32" E IDA

MIGS-4.3 Depth Not applicable IDA

MIGS-4.4 Altitude 162 m IDA

a) Evidence codes - IDA: Inferred from Direct Assay; TAS: Traceable Author Statement (i.e.,

a direct re-port exists in the literature); NAS: Non-traceable Author Statement (i.e., not

directly observed for the liv-ing, isolated sample, but based on a generally accepted property

for the species, or anecdotal evidence). These evidence codes are from the Gene Ontology

project [20].

Figure II.1 Reference mass spectrum from Staphylococcus capitis strain (CR01).

CHAPITRE II

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 68

Figure II.2 Transmission electron microscopy of Staphylococcus capitis strain (CR01) using

a JEOL 1400. The scale bar represents 200 nm.

CHAPITRE II

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 69

Figure II.3 16S rRNA Phylogenetic tree highlighting the position of Staphylococcus capitis

strain CR01 (indicated by the yellow circle) relative to other type strains within the genus

Staphylococcus. All 16S rRNA sequences were obtained from the RDP database using as

filtering criteria: sequences with more than 1200 nt and classified as “good” quality

sequences. The tree uses sequences aligned with the MUSCLE software, with the default

parameters as implemented on Seaview version 4 [24], and a tree was inferred based on 1285

sites using the distance model of observed diver-gence, as implemented in the BioNJ

algorithm.

The 16S rRNA sequences were aligned using the MUSCLE software, with the default

parameters as implemented on Seaview version 4 [24], and a tree was inferred based on 1285

sites using the distance model of observed divergence, as imple-mented in the BioNJ

algorithm, and a bootstrap-ping process repeated 500 times.

The final tree was rooted using the 16S rRNA sequence of Macrococcus equipercicus Type

strain that belongs to a closely-related sister genus.

CHAPITRE II

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 70

II.4 Genome sequencing information

The genome sequence of S. capitis strain CR01 was determined by high-throughput

sequencing performed on a Genome Sequencer FLX + system (454 Life Sciences/Roche)

using FLX Titanium reagents according to the manufacturer's protocols and instructions, with

approximately 47 fold coverage of the genome. This platform provides longer read lengths

than other sequencing platforms to obtain raw sequences. De novo assemblies were

performed using the Roche Newbler (v 2.7) software package.

II.5 Genome project history

Table II.2 presents the project information and its association with MIGS version 2.0

compliance[5].

Table II.2 Project information

MIGS ID Property Term

MIGS-31 Finishing quality Non-contiguous finished

MIGS-28 Libraries used 454 pyrosequence rapid library

MIGS-29 Sequencing platforms 454 GS FLX+

MIGS-31.2 Fold coverage 47.0 × pyrosequence

MIGS-30 Assemblers Newbler Assembler 2.7

GenBank CBUB000000000.1

II.6 Growth conditions and DNA isolation

The sample was prepared for sequencing by growing S. capitis CR01, aerobically at 37°C in

Blood Agar for 24-48 hours. Genomic DNA was extracted using the PureLinkTM genomic

DNA kit (InvitrogenTM) according to the manufacturer’s recommended protocol. The

quantity of DNA obtained was determined using a NanoVue TM Plus (HVD Life Sciences),

and 1 μg of DNA was used for sequencing of whole-genome of this strain.

II.7 Genome sequencing and assembly

The isolated DNA of S. capitis CR01 was used to create 454-shotgun libraries following the

GS Rap-id library protocol (Roche 454, Roche). The resulting 454 DNA libraries were

sequenced using a whole-genome shotgun strategy by GS FLX Titanium sequencing kit XL+

[25] (202,108 reads totaling 2.5 Mb, X48 fold coverage of the genome). Genome sequences

were processed by Roche’s sequencing software according to the manufacturer's instructions

(454 Life Science). The resulting shotgun reads were assembled de novo using the Roche

Newbler assembly software 2.7 (454 Life Science) and 26 large contigs (Contig00001 to

Contig00026) were obtained. The N50 was 176239 bp.

CHAPITRE II

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 71

II.8 Genome annotation

An automatic syntactic and functional annotation of the draft genome was performed using

the MicroScope platform pipeline [26,27]. The syntactic analysis combines a set of programs

including AMIGene [28], tRNAscan-SE [29], RNAmmer [30], Rfam scan [31] and Prodigal

software [32] to predict genomic objects that are mainly CDSs and RNA genes. More than 20

bioinformatics methods are then used for functional and relational analyses: homology search

in the generalist databank UniProt [33] and in more specialized databases as COG [34],

InterPro [35], PRIAM profiles for enzymatic classification [36], prediction of protein

localization using TMHMM [37], SignalP [38] and PsortB [39] tools.

II.9 Genome properties

The genome includes one circular chromosome of 2,504,472 bp (32.81% GC content). A total

of 2,565 genes were predicted with 2,453 being protein-coding genes, 59 tRNA-enconding

genes, 4 rRNA-encoding genes (including 2 copies of 5S rRNA, 1 copy of both the large and

the small-subunits, respectively, 23S and 16S rRNA) and 34 other RNA related ORFs. No

plasmid was detected.

Of the 2,453 protein-coding genes, 1,892 genes (76.7%) were assigned to a putative function

with the remaining annotated as hypothetical proteins. The predicted coding density in S.

capitis strain CR01 was 86%.

Table II.3 and Figure II.4 detailed description of the properties and the statistics of

Staphylococcus capitis strain CR01 genome. The distribution of the genes into COGs

functional categories is presented in Table II.4.

Table II.3 Nucleotide content and gene count levels of the genome

Attribute Value % of totala

Genome size (bp) 2.504.472 100.00%

DNA G+C content (bp) 821.717 32.81%

DNA coding region (bp) 2.158.855 6.2%

Number of Scaffolds 26 -

Total genesb 2566 100.00%

RNA genes 97 4.00%

tRNA-enconding genes 59 2.30%

rRNA-encoding genes 4 0.20%

Protein-coding genes (CDS) 2454 96.00%

Genes assigned to COGs 1999 81.00%

CHAPITRE II

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 72

Genes of unknown function 561 23.34%

Genes with transmembrane helicesc 630 25.70%

CRISPR repeats 1 -

a) The total is based on either the size of the genome in base pairs or the total number of

protein coding genes in the annotated genome.

b) Total number of genes includes CDS, RNA genes and pseudogenes.

c) Detection of transmembrane helices was performed using TMHMM v. 2.0 [40].

Table II.4 Number of genes associated with general COG functional categories

Code Value %age 2a Description

J 178 7.21 Translation

K 184 7.46 Transcription

L 169 6.85 Replication, recombination and repair

D 29 1.18 Cell cycle control, mitosis and meiosis

V 85 3.44 Defense mechanisms

T 89 3.61 Signal transduction mechanisms

M 113 4.58 Cell wall/membrane biogenesis

N 23 0.9 Cell motility

W 1 0.04 Extracellular structures

U 33 1.34 Intracellular trafficking and secretion

O 86 3.48 Posttranslational modification, protein

turnover, chaper-ones

C 144 5.83 Energy production and conversion

G 210 8.51 Carbohydrate transport and

metabolism

E 370 14.99 Amino acid transport and metabolism

F 92 3.73 Nucleotide transport and metabolism

H 109 4.42 Coenzyme transport and metabolism

I 92 3.73 Lipid transport and metabolism

P 270 10.94 Inorganic ion transport and metabolism

Q 56 2.27 Secondary metabolites biosynthesis,

transport and catabo-lism

R 425 17.22 General function prediction only

S 203 8.23 Function unknown

- 469 19.00 Not in COGs

a) The total is based on the total number of protein coding genes in the annotated

genome.

CHAPITRE II

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 73

Figure II.4 Graphical circular map of the chromosome. From outside to the center: Genes on

the forward strand (colored by COG categories), genes on the reverse strand colored by COG

categories), RNA genes (tRNAs green, rRNAs blue), GC content, and GC skew.

II.10 Conclusion

Here, we described a new genome sequence of Staphylococcus capitis (strain CR01 belonging

to NRCS-A clone) as a first step toward comparing its content with other sequenced

Staphylococcus capitis genomes as well as CoNS genomes of species associated with late-

onset sepsis. Detailed analyses are in progress to identify virulence fac-tors and mobile

genetic elements (MGE), such as the staphylococcal chromosome cassette (SCCmec) [18],

potentially related to the high specificity of the NRCS-A clone to the NICU environment.

CHAPITRE II

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 74

II.11 Acknowledgments

This work was supported by a grant from the Fondation pour la Recherche Médicale (FRM,

grant ING20111223510) and by the Institut Na-tional de la Recherche Médicale (INSERM)

and the French Ministry of Health.

II.12 References

1. Klingenberg C, Rønnestad A, Anderson AS, Abrahamsen TG, Zorman J, Villaruz A,

Flægstad T, Otto M, Sollid, Ericson J. Persistent strains of coagulase-negative

staphylococci in a neonatal intensive care unit: virulence factors and invasiveness.

Clin Microbiol Infec 2007 Nov;13(11):1100-11.

2. Rasigade J-P, Raulin O, Picaud J-C, Tellini C, Bes M, Grando J, Ben Saïd M, Claris

O, Etienne J, Tigaud S, Laurent F. Methicillin-Resistant Staphylococcus capitis with

Reduced Vancomycin Susceptibility Causes Late-Onset Sepsis in Intensive Care

Neonates. PLoS ONE 2012;7(2):e31548.

3. Ng PC, Chow VC, Lee CH, Ling JM, Wong HL and Chang, RCY. Persistent

Staphylococcus capitis septicemia in a preterm infant. Pediatr Infect Dis J 2006

Jul;25(7):652-4.

4. de Silva GDI, Kantzanou M, Justice A, Massey RC, Wilkinson AR, Day NPJ,

Peacock SJ. The ica Operon and Biofilm Production in Coagulase-Negative

Staphylococci Associated with Carriage and Disease in a Neonatal Intensive Care

Unit. J Clin Microbiol 2002 Feb;40(2):382-8.

5. Field D, Garrity G, Gray T, Morrison N, Selengut J, Sterk P, Tatusova T, Thomson N,

Allen MJ, Angiuoli et al. The minimum information about a genome sequence

(MIGS) specification. Nat Biotechnol 2008; 26:541-547.

6. Woese CR, Kandler O, Wheelis ML. Towards a nat-ural system of organisms:

proposal for the do-mains Archaea, Bacteria, and Eukarya. Proc Natl Acad Sci USA

1990; 87:4576-4579.

7. Gibbons NE, Murray RGE. Proposals Concerning the Higher Taxa of Bacteria. Int J

Syst Bacteriol 1978; 28:1-6. http://dx.doi.org/10.1099/00207713-28-1-1.

8. Murray RGE. The Higher Taxa, or, a Place for Everything...? In: Holt JG (ed),

Bergey's Manual of Systematic Bacteriology, First Edition, Volume 1, The Williams

and Wilkins Co., Baltimore, 1984, p. 31-34.

9. List of new names and new combinations previ- ously effectively, but not validly,

published. List no. 132. Int J Syst Evol Microbiol 2010; 60:469- 472.

http://dx.doi.org/10.1099/ijs.0.022855-0.

10. Ludwig W, Schleifer KH, Whitman WB. Class I. Bacilli class nov. In: De Vos P,

Garrity G, Jones D, Krieg NR, Ludwig W, Rainey FA, Schleifer KH, Whitman WB

(eds), Bergey's Manual of Systemat- ic Bacteriology, Second Edition, Volume 3,

Springer-Verlag, New York, 2009, p. 19-20.

11. Skerman VBD, McGowan V, Sneath PHA. Ap- proved Lists of Bacterial Names. Int

J Syst Bacteriol 1980; 30:225-420.

12. Prévot AR. In: Hauderoy P, Ehringer G, Guillot G, Magrou. J., Prévot AR, Rosset D,

Urbain A (eds), Dictionnaire des Bactéries Pathogènes, Second Edition, Masson et

CHAPITRE II

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 75

Cie, Paris, 1953, p. 1-692.

13. List Editor. List of new names and new combina- tions previously effectively, but not

validly, pub- lished. List no. 132. Int J Syst Evol Microbiol 2010; 60:469-472.

14. Schleifer KH, Bell JA. Family VIII. Staphylococcaceae fam. nov. In: De Vos P,

Garrity G, Jones D, Krieg NR, Ludwig W, Rainey FA, Schleifer KH, Whitman WB

(eds), Bergey's Manual of Systematic Bacteriology, Second Edi- tion, Volume 3,

Springer-Verlag, New York, 2009, p. 392.

15. Rosenbach FJ. In: Bergmann JF (ed), Microorganismen bei den Wund-Infections-

Krankheiten des Menschen., Wiesbaden, 1884, p. 1-122.

16. Judicial Commission. Opinion 17. Conservation of the Generic name Staphylococcus

Rosenbach, Designation of Staphylococcus aureus Rosenbach as the Nomenclatural

Type of the Genus Staphy- lococcus Rosenbach, and Designation of the Neotype

culture of Staphylococcus aureus Rosenbach. Int Bull Bacteriol Nomencl Taxon 1958;

8:153-154.

17. Kloos WE, Musselwhite MS. Distribution and Per-sistence of Staphylococcus and

Micrococcus Spe-cies and Other Aerobic Bacteria on Human Skin. Appl Microbiol

1975; 30:381-385.

18. Martins Simões P, Rasigade J-P, Lemriss H, Butin M, Ginevra C, Lemriss S, R. V.

Goering, Ibrahimi A, Picaud JC, Vandenesch F, EL Kabbaj S, Laurent F.

Characterization of a novel staphylococcal chromosome cassette (SCCmec) within a

composite SCC island in neonatal sepsis-associated Staphylococcus capitis pulsotype

NRCS-A. Antimicrob. Agents Chemother 2013; 57(12):6354.

19. Schleifer KH, Bell JA. Family VIII. Staphylococcaceae fam. nov. In: De Vos P,

Garrity G, Jones D, Krieg NR, Ludwig W, Rainey FA, Schleifer KH, Whitman WB

(eds), Bergey's Manual of Systematic Bacteriology, Second Edi- tion, Volume 3,

Springer-Verlag, New York, 2009, p. 392.

20. Ashburner M, Ball CA, Blake JA, Botstein D, But-ler H, Cherry JM, Davis AP,

Dolinski K, Dwight SS, Eppig JT, et al. Gene ontology: tool for the unification of

biology. The Gene Ontology Con-sortium. Nat Genet 2000; 25:25-29.

21. Cherkaoui A, Hibbs J, Emonet S, Tangomo M, Girard M, Francois P, Schrenzel J.

Comparison of two matrix-assisted laser desorption ionization-time of flight mass

spectrometry methods with conventional phenotypic identification for routine

identification of bacteria to the species level. J Clin Microbiol 2010; 48:1169-1175.

22. French Society for Microbiology. Recommandations du Comite de l'Antibiogramme

de la Société Française de Microbiologie. 2009. Available at:

wwwsfmasofr/doc/downloadphp?doc=DiU8C&fic =casfm_2009pdf. Accessed 22

February 2009.

23. Hall KK, Lyman JA. Updated review of blood cul-ture contamination. Clin Microbiol

Rev 2006; 19:788-802.

24. Gouy M, Guindon S, Gascuel O. SeaView Ver-sion 4: A Multiplatform Graphical

User Interface for Sequence Alignment and Phylogenetic Tree Building. Mol Biol

Evol 2010; 27:221-224.

25. Fleischmann RD, Adams MD, White O, Clayton RA, Kirkness EF, Kerlavage AR,

Bult CJ, Tomb JF, Dougherty BA, Merrick JM, et al. Whole-genome random

sequencing and assembly of Haemophilus influenzae Rd. Science 1995 Jul

CHAPITRE II

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 76

28;269(5223):496-512.

26. Vallenet D, Belda E, Calteau A, Cruveiller S, Engelen S, Lajus A, Le Fèvre F, Longin

C, Mornico D, Roche D et al. MicroScope—an integrated microbial resource for the

curation and comparative analysis of genomic and metabolic data. Nucleic Acids Res

2013 Jan;41(Database issue):D636-D647.

27. Vallenet D, Labarre L, Rouy Z, Barbe V, Bocs S, Cruveiller S, Lajus A, Pascal G,

Scarpelli C, Médigue C. MaGe: a microbial genome annotation system supported by

synteny results. Nucleic Acids Res 2006 Jan 10;34(1):53-65.

28. Bocs S, Cruveiller S, Vallenet D, Nuel G, Médigue C. AMIGene: Annotation of

MIcrobial Genes. Nucleic Acids Res 2003; 31:3723-3726.

29. Lowe TM, Eddy SR. tRNAscan-SE: a program for improved detection of transfer

RNA genes in ge-nomic sequence. Nucleic Acids Res 1997; 25:955-964.

30. Lagesen K, Hallin P, Rødland EA, Staerfeldt HH, Rognes T, Ussery DW. RNAmmer:

consistent and rapid annotation of ribosomal RNA genes. Nucleic Acids Res 2007;

35:3100-3108.

31. Gardner PP, Daub J, Tate JG, Nawrocki EP, Kolbe DL, Lindgreen S, Wilkinson AC,

Finn RD, Grif-fiths-Jones S, Eddy SR, Bateman A. Rfam: updates to the RNA

families database. Nucleic Acids Res 2009; 37:D136-D140.

32. Hyatt D, Chen GL, Locascio PF, Land ML, Lar-imer FW, Hauser LJ. Prodigal:

prokaryotic gene recognition and translation initiation site identifi-cation. BMC

Bioinformatics 2010; 11:119.

33. UnitProt Consortium. The Universal Protein Resource (UniProt) 2009. Nucleic Acids

Res 2009; 37:D169-D174.

34. Tatusov RL, Fedorova ND, Jackson JD, Jacobs AR, Kiryutin B, Koonin EV, Krylov

DM, Mazumder R, Mekhedov SL, Nikolskaya AN, et al. The COG database: an

updated version includes eukaryotes. BMC Bioinformatics 2003; 4:41.

35. Hunter S, Apweiler R, Attwood TK, Bairoch A, Bateman A, Binns D, Bork P, Das U,

Daugherty L, Duquenne L, et al. InterPro: the integrative pro-tein signature database.

Nucleic Acids Res 2009; 37:D211-D215.

36. Claudel-Renard C, Chevalet C, Faraut T, Kahn D. Enzyme-specific profiles for

genome annotation: PRIAM. Nucleic Acids Res 2003; 31:6633-6639.

37. Sonnhammer EL, von Heijne G, Krogh A. A hid-den Markov model for predicting

transmembrane helices in protein sequences. Proc Int Conf Intell Syst Mol Biol 1998;

6:175-182.

38. Bendtsen JD, Nielsen H, von Heijne G, Brunak S. Improved prediction of signal

peptides: SignalP 3.0. J Mol Biol 2004; 340:783-795.

39. Gardy JL, Laird MR, Chen F, Rey S, Walsh CJ, Es-ter M, Brinkman FS. PSORTb

v.2.0: expanded prediction of bacterial protein subcellular locali-zation and insights

gained from comparative pro- teome analysis. Bioinformatics 2005; 21:617-623.

40. Moller S, Croning MDR, Apweiler R. Evaluation of methods for the prediction of

membrane spanning regions. Bioinformatics 2001; 17:646-653.

CHAPITRE III

Séquençage de huit isolats de

Staphylococus capitis isolées de

différentes régions géographiques

dans le monde

CHAPITRE III

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 77

Bien que les techniques de séquençage à haut débit sont restreintes principalement aux études

de recherche, l’étude du génome bactérien d’isolats cliniques devient, actuellement, de plus en

plus réalisé, car le coût de séquençage de l'ADN continue à diminuer, et ce grâce à la

possibilité de séquencer un grand nombre d’échantillon dans un seul run de séquençage

(Koser et al., 2012 ; Salipante et al., 2014 ; Roach et al., 2015). En outre, le séquençage du

génome de ces isolats bactériens a mis en lumière divers aspects d'un certain nombre d'agents

pathogènes, y compris la transmission de la souche globale et intra-hôpital, l'évolution de la

résistance aux antibiotiques, l'échange horizontal des éléments mobiles, la distribution du

matériel génomique à travers une espèce bactérienne et l'identification de nouveaux agents

pathogènes bactériens (Farhat et al., 2013 ; Conlan et al ., 2014; Tong et al., 2015).

Les staphylocoques représentent une proportion importante parmi les bactéries responsables

d’infections graves. Ils sont observés dans de multiples situations cliniques, aussi bien en

pathologie communautaire qu’en pathologie nosocomiale (Zahlane, Haouach et Zouhdi,

2007).

Les staphylocoques à coagulase négative, appelés aussi staphylocoques blancs, représentent

les pathogènes les plus souvent identifiés dans les bactériémies en unités de réanimation

néonatale. L’espèce Staphylococcus epidermidis est la plus prévalente, représentant

classiquement plus de 70 % des staphylocoques blancs isolés dans ce contexte (Klingenberg

et al., 2007). Parmi les autres espèces, Staphylococcus capitis est rarement rapporté dans les

bactériémies et chez l’adulte, il est le plus souvent considéré comme un contaminant en cas

d’isolement dans les hémocultures (Ruhe et al., 2004). Les résultats de l’électrophorèse à

champ pulsé (PFGE) ont permis de mettre en évidence la présence endémique d’un clone

particulier de S. capitis multirésistant aux antibiotiques dans les services de réanimation

néonatale à Lyon, en France et plus généralement dans plusieurs pays d’Europe et en

Australie (Rasigade et al., 2012). La fréquence inhabituellement élevée des bactériémies à S.

capitis, en réanimation néonatale au sein des hospices civils de Lyon et dans plusieurs NICU

dans le monde, a motivé une étude détaillée de ce pathogène en collaboration avec le Centre

Nationale de Référence des staphylocoques (CNRS), Lyon, le Laboratoire de Recherche et

d’analyse Médicale de la Fraternelle de la gendarmerie Royal (LRAM), Rabat et le

Laboratoire de Biotechnologie Médicale (Medbiotech), Rabat.

Dans le chapitre précédent, nous avons décrit une nouvelle séquence génomique de S. capitis

CR01, appartenant au clone NRCS-A, comme une première étape nécessaire afin d’avoir un

CHAPITRE III

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 78

génome de référence. Ce dernier sera une base de comparaison avec d'autres génomes

séquencés de S. capitis, associées à une septicémie tardive, ainsi qu’avec des génomes CoNS

et ce dans le but d'élucider les mécanismes moléculaires de la propagation de ces souches de

S. capitis NRCS-A dans les NICU en France et dans le monde.

Le choix méthodologique de notre étude s’est porté sur l’usage de la technologie de

pyroséquençage du GFLX+ titanium, qui est un outil puissant pour la découverte d’agents

pathogènes. Cette technologie produit des séquences de 400 à 700 pb, facilitant les travaux

d’assemblage des séquences dans une approche de séquençage de novo de génomes complets.

Nous avons séquencé huit souches de S. capitis : CR02, CR03, CR04, CR05, CR06, CR07,

CR08 et CR09. Ces souches ont été isolées de quatre pays (France, Australie, Belgique et

Angleterre) entre les périodes 2002 et 2009. Il s’agit de six isolats cliniques (5 Pulsotypes

NRCS-A et 1 NRCS-C) et de deux souches de laboratoire (souches obtenues après 15

repiquages en présence de la vancomicyne et puis 9 repiquages en son absence « CMI haute

stable »).

La préparation de la librairie est une étape primordiale. En effet, de la qualité de la librairie

dépend la qualité de la PCR en émulsion et par la suite le séquençage. Vu la faisabilité de

séquencé plusieurs génomes dans un seul run de séquençage, nous avons utilisé dans cette

étude des séquences MID (Multiplex Identifier : amorces universelles couplées à un

identifiant) de 6 à 10 pb, spécifique à un échantillon, permettant l’identification d’un génome

lorsque plusieurs isolats sont séquencés et analysés simultanément (Multiplexage).

L’analyse bioinformatique est réalisée à l’aide des logiciels fournis avec le séquenceur

GFLX+ titanium. Les images acquises par la camera au cours du pyroséquencage ont été

converties en signal exploitable pour l’analyse bioinformatique des données par le logiciel GS

Run Processor (Roche Diagnostics). Deux étapes ont été nécessaires : analyse des images

(identification des puits et mesure de la quantité de lumière émise à chaque cycle pour chaque

puits) et analyse des signaux (détermination de la séquence des fragments d’ADN localisés

dans chaque puits à partir des informations précédentes). La qualité du séquençage a été

vérifiée sur le module GS run browser (Roche Diagnostics).

Après démultiplexage des séquences MID (8 fichier), les lectures « read » issues de

séquençage de chaque génome de S. capitis ont été assemblées avec l’assembleur Newbler

version 2.7 par l’approche de novo. Une séquence contiguée a été crée avec une taille et

couverture varie selon chaque génome donnant des draft génomes pour les huit souches. Ces

CHAPITRE III

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 79

derniers ont été annotés par la suite avec la plateforme d’annotation MicroScope (Mage). Les

séquences obtenues des six isolats cliniques ont été déposées dans la base de données

Genbank sous les numéros d’accès : CTEB01000000 pour CR03, CTEM01000000 pour

CR04, CTEO01000000 pour CR05, CTEL01000000 pour CR09, CZWI00000000 pour CR02,

CZWH00000000 pour CR07. En revanche, les données des deux souches de laboratoire

(CR06 et CR08) ne sont pas encore publiées et sont toujours en cours d’étude par des

collègues du CNR, Lyon, France.

Ce chapitre est présenté sous forme de deux articles publié dans Genome Annoucement

(Lemriss et al., 2015, Lemriss et al., 2016 ). Les références de ces articles sont les suivantes :

Genome Anounc 3(4):e00501-15. doi:10.1128/genomeA.00501-15.

Genome Announc 4(3):e00541-16. doi:10.1128/genomeA.00541-16.

Dans ces deux publications (partie III.1 et partie III.2 ci-dessous), j’ai réalisé tout le travail de

paillasse, d’analyse bioinformatique et de rédaction des manuscrits.

III.1 Genome Sequences of Four Staphylococcus capitis NRCS-A Isolates from

Geographically Distant Neonatal Intensive Care Units

Abstract

Staphylococcus capitis pulsotype NRCS-A was previously reported as a frequent cause of

late-onset sepsis in neonatal intensive care units (NICUs) worldwide. Here, we report the

whole-genome shotgun sequences of four S. capitis pulsotype NCRS-A strains, CR03, CR04,

CR05, and CR09, isolated from Belgium, Australia, the United Kingdom, and France,

respectively.

Coagulase-negative staphylococci (CoNS) are the most frequently encountered pathogens in

neonatal intensive care units (NICUs) (1). However, in the NICU setting, recent studies have

indicated that methicillin-resistant Staphylococcus capitis might emerge as a significant

pathogen, causing late-onset sepsis (LOS) in several neonatal intensive care units in France,

the Netherlands, and Australia (2, 4).

A study in French NICUs demonstrated the spread of a single clonal population of

methicillin-resistant S. capitis (pulsotype NRCS-A) associated with reduced susceptibility to

vancomycin, which is the first line of antibiotics used in cases of LOS. Moreover, this clone

CHAPITRE III

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 80

has also been recently identified in NICUs in Belgium, the United Kingdom, and Australia,

suggesting a worldwide distribution (5, 6).

In this report, we present the draft genome sequences of four S. capitis (pulsotype NRCS-A)

strains (CR03, CR04, CR05, and CR09) isolated from blood cultures from four neonates

hospitalized in NICUs in Belgium, Australia, the United Kingdom, and France, respectively.

All S. capitis strains were grown in blood agar at 37°C, and genomic DNA was extracted

using the PureLink genomic DNAkit (Invitrogen), according to the manufacturer’s

recommended protocol. The quantity of DNA was determined using a NanoVue Plus (HVD

Lifesciences), and 1 _g of DNA was used to sequence the whole genome of each strain. The

454-shotgun libraries were prepared from the extracted genomic DNA following GS rapid

library protocol (Roche 454; Roche).

The genome sequence of each S. capitis strain was determined by high-throughput sequencing

performed on a Genome Sequencer FLX_ system (454 Life Sciences/Roche) using FLX

Titanium reagents, according to the manufacturer’s protocols and instructions. De novo

assemblies were performed using the Roche Newbler (version 2.9) software package, and the

sequencing results are summarized in Table III.1.

Table III.1 Summary of genome sequencing in the present study

Strain Country

source

Reads

(MB)

Fold

Covrage

N°of contigs

Genome size (bp)

G+C content

%

Assession no

S.captis CR03 Belgium 141,728 30 31 2,508,352 32 81 CTEB01000000

S.capitis CR04 Australia 132,280 30 38 2,512,289 32.80 CTEM01000000

S.capitis CR05 United Kingdom

139,569 31 39 2,543,917 32.84 CTEO01000000

S.capitis CR09 France 132,205 30 34 2,490,458 32.82 CTEL01000000

An automatic syntactic and functional annotation of the draft genome was performed using

the MicroScope platform pipeline (7, 8). The syntactic analysis combines a set of programs,

including AMIGene (9), tRNAscan-SE (10), RNAmmer (11), Rfam scan (12), and Prodigal

software (13) to predict genomic objects that are mainly coding sequences (CDSs) and RNA

genes. More than 20 bioinformatics methods were used for functional and relational analyses.

The homology search was performed in the generalist databank UniProt (14) and in more

specialized databases, such as COG (15), InterPro (16), PRIAM profiles for enzymatic

CHAPITRE III

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 81

classification (17), prediction of protein localization using TMHMM (18), SignalP (19), and

PSORTb (20) tools.

The chromosome of strain CR03 (ENA accession no. CTEB01000000) contains 2,575 genes,

2,466 coding sequences (CDSs), 4 rRNAs, and 61 tRNAs; the chromosome of strain CR04

(accession no. CTEM01000000) contains 2,566 genes, 2,457 CDSs, 4 rRNAs, and 60 tRNAs;

the chromosome of strain CR05 (accession no. CTEO01000000) contains 2,624 genes, 2,508

CDSs, 4 rRNAs, and 60 tRNAs; and the chromosome of strain CR09 (accession no.

CTEL01000000) contains 2,540 genes, 2,432 CDSs, 4 rRNAs, and 59 tRNAs.

Nucleotide sequence accession numbers. This whole-genome shotgun project has been

deposited at the ENA database under the accession numbers listed in Table 1. The versions

described in this paper are in the first versions, under BioProject designation no. PRJEB8618.

Acknowledgments

This work was supported by a grant from the Fondation pour la Recherche Médicale (FRM,

grant 75 ING20111223510) and by the Institut National de la Recherche Médicale (INSERM)

and the French 76 Ministry of Health. This work was also supported by a grant from the NIH

for H3Africa BioNet.

References

1. Klingenberg C, Rønnestad A, Anderson AS, Abrahamsen TG, Zorman J, Villaruz A,

Flægstad T, Otto M, Sollid, Ericson J. 2007. Persistent strains of coagulase negative

staphylococci in neonatal 80 intensive care unit: virulence factors and invasiveness.

Clin Microbiol Infec. 13(11):1100-11.

2. Rasigade J-P, Raulin O, Picaud J-C, Tellini C, Bes M, Grando J, Ben Saïd M, Claris

O, Etienne J, Tigaud S, Laurent F. 2012. Methicillin-Resistant Staphylococcus capitis

with Reduced Vancomycin Susceptibility Causes Late-Onset Sepsis in Intensive Care

Neonates. PLoS ONE. 7(2):e31548.

3. Wil C. Van Der Zwet, Yvette J. Debets-Ossenkopp, Erik Reinders, Maria Kapi, Paul

H. M. Savelkoul, Ruurd M. Van Elburg, Keiichi Hiramatsu and Christina M. J. E.

Vandenbroucke Grauls. 2002. Nosocomial Spread of a Staphylococcus capitis Strain

with Heteroresistance to Vancomycin in a Neonatal Intensive Care Unit. J Clin

Microbiol. 40(7):2520-2525.

4. D'mello D, J. Daley A, Shihab Rahman M, Qu Y, Garland S , Pearce C and A.

Deighton M. 2008. Vancomycin Heteroresistance in Bloodstream Isolates of

Staphylococcus capitis. J Clin Microbiol. 40(9):3124-3126.

CHAPITRE III

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 82

5. Cui B, Smooker PM, Rouch DA, Daley AJ, Deighton MA. 2013. Differences between

two clinical Staphylococcus capitis subspecies as revealed by biofilm, antibiotic

resistance, and pulsed-field gel electrophoresis profiling. J Clin Microbiol. 51: 9–14.

6. Butin M, Martins Simoes P, Lemriss H, Lemriss S, Vandenesch F, Claris O, Picaud

JC, Rasigade JP and Laurent F. 2014. Staphylococcus capitis in neonatal late-onset

sepsis: unexpected worldwide dissemination of an endemic multi-resistant clone. In:

European Academy of Pediatric Societies - Poster symposium - Session Neonatal

Sepsis - Poster No: 011. Barcelona, Spain.

7. Vallenet D, Belda E, Calteau A, Cruveiller S, Engelen S, Lajus A, Le Fèvre F, Longin

C, Mornico D, Roche D, Rouy Z, Salvignol G, Scarpelli C, Thil Smith A A,Weima,

M, and Médigue C. 2013. MicroScope an integrated microbial resource for the

curation and comparative analysis of genomic and metabolic data. Nucleic Acids Res

41:D636-D647.

8. Vallenet D, Labarre L, Rouy Z, Barbe V, Bocs S, Cruveiller S, Lajus A, Pascal G,

Scarpelli C, Médigue C. 2006. MaGe: amicrobial genome annotation system

supported by synteny results. Nucleic Acids Res 34:53-65.

9. Bocs S, Cruveiller S, Vallenet D, Nuel G, Médigue C. 2003. AMIGene: Annotation of

Microbial Genes. Nucleic Acids Res 31:3723-3726.

10. Lowe TM, Eddy SR. 1997. tRNA scan-SE: a program for improved detection of

transfer RNA genes in genomic sequence. Nucleic Acids Res 25:955-964.

11. Lagesen K, Hallin P, Rødland EA, Staerfeldt HH, Rognes T, Ussery DW. 2007.

RNAmmer: consistent and rapid annotation of ribosomal RNA genes. Nucleic Acids

Res 35:3100-3108.

12. Gardner PP, Daub J, Tate JG, Nawrocki EP, Kolbe DL, Lindgreen S, Wilkinson AC,

Finn RD, Grif-fiths-Jones S, Eddy SR, Bateman A. 2009. Rfam: updates to the RNA

families database. Nucleic Acids Res 37:D136-D140.

13. Hyatt D, Chen GL, Locascio PF, Land ML, Larimer FW, Hauser LJ. 2010. Prodigal:

prokaryotic gene recognition and translation initiation site identification. BMC

Bioinformatics.11:119.14. UnitProt Consortium. The Universal Protein Re-source

(UniProt) 2009. Nucleic Acids Res 2009; 117 37:D169-D174.

14. UnitProt Consortium. The Universal Protein Re-source (UniProt) 2009. Nucleic Acids

Res 2009; 117 37:D169-D174.

15. Tatusov RL, Fedorova ND, Jackson JD, Jacobs AR, Kiryutin B, Koonin EV, Krylov

DM, Mazumder R, Mekhedov SL, Nikolskaya AN, Rao BS, Smirnov S, Sverdlov AV,

CHAPITRE III

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 83

Vasudevan S, Wolf YI, Yin JJ, and Darren AN. 2003. The COG database: an updated

version includes eukaryotes. 121 BMC Bioinformatics. 4:41.

16. Hunter S, Apweiler R, Attwood TK, Bairoch A, Bateman A, Binns D, Bork P, Das U,

Daugherty L, Duquenne L, Finn RD, Gough J, Haft D, Hulo N, Kahn D, Kelly E,

Laugraud A, Letunic I, Lonsdale D, Lopez R, Madera M, Maslen J, McAnulla C,

McDowall J, Mistry J, Mitchell A, Mulder N, Natale D, Orengo C, Quinn AF,

Selengut JD, Sigrist CJ, Thimma M, Thomas PD, Valentin F, Wilson D, Wu CH and

Yeats C. 2009. InterPro: the integrative protein signature database. Nucleic Acids Res

37:D211-D215.

17. Claudel-Renard C, Chevalet C, Faraut T, Kahn D. 2003. Enzyme-specific profiles for

genome annotation: PRIAM. Nucleic Acids Res 31:6633-6639.

18. Sonnhammer EL, von Heijne G, Krogh A. 1998. A hid-den Markov model for

predicting transmembrane helices in protein sequences. Proc Int ConfIntellSyst Mol

Biol. 6:175-182.

19. Bendtsen JD, Nielsen H, von Heijne G, Brunak S. 2004. Improved prediction of signal

peptides:SignalP 3.0. J Mol Biol. 340:783-795.

20. Gardy JL, Laird MR, Chen F, Rey S, Walsh CJ, Es-ter M, Brinkman FS. 2005.

PSORTb v.2.0: 8 expanded prediction of bacterial protein subcellular localization and

insights gained from comparative 136 proteome analysis. Bioinformatics. 21:617-623.

21. European Nucleotide Archive. http://www.ebi.ac.uk/ena/data/view.

III.2 Genome Sequences of multiresistant Staphylococcus capitis pulsotype NRCS-A and

methicillin- 2 susceptible Staphylococcus capitis pulsotype NRCS-C

Abstract

Here, we report the draft genome sequences of methicillin-susceptible Staphylococcus captis

pulsotype NCRS-C (CR02 strain) and multiresistant Staphylococcus captis pulsotype NCRS-

A (CR07 strain).

Staphylococcus capitis is a Gram-positive coccus belonging to the coagulase-negative

staphylococcus group (CoNS) that is frequently found on the human skin and mucosa (1).

Recently, a few studies have reported the emergence of S. capitis, which was found to be a

major cause of late-onset sepsis (LOS) in several neonatal intensive care units (NICUs) (2, 3).

CHAPITRE III

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 84

A clonal population of methicillin-resistant S. capitis NRCS-A strains has spread into several

geographically distant NICUs (4). These isolates exhibit reduced susceptibility to

vancomycin, which is the most widely used antimicrobial agent in the NICU setting (5, 6).

In order to elucidate the molecular mechanisms behind the wide-spreading of methicillin-

resistant S. capitis and methicillin susceptible S. capitis in NICUs in France, we sequenced

two different pulsotypes (NRCS-A and NRCS-C) of S. capitis strains (CR07 and CR02).

In this report, we present the draft genome sequences of multiresistant S. capitis pulsotype

NRCS-A and methicillin susceptible S. capitis pulsotype NRCS-C isolated from blood

cultures from NICUs in Lyon, France.

These two pulsotype strains were grown in blood agar at 37°C, and genomic DNA was

extracted using the PureLink genomic DNA kit (Invitrogen), according to the manufacturer’s

recommended protocol. The DNA libraries were prepared from 1µg DNA genomic extracted

following GS rapid library protocol (Roche 454; Roche).

The genome sequence of each S. capitis strain was determined by high-throughput sequencing

performed on a Genome Sequencer FLX_system (454 Life Sciences/Roche) using FLX

Titanium reagents, according to the manufacturer’s protocols and instructions. De novo

assemblies were performed using Roche Newbler assembly software (version 2.9).

An automatic syntactic and functional annotation of the draft genome was performed using

the MicroScope platform pipeline (7). The syntactic analysis combines a set of programs

including AMIGene (8), tRNAscan-SE (9), RNAmmer (10), Rfam scan (11), and Prodigal

software (12) to predict genomic objects that are mainly coding sequences (CDSs) and RNA

genes. More than 20 bioinformatics methods were used for functional and relational analyses.

The homology search was performed in the generalist databank UniProt (13) and in more

specialized databases such as COG (14), InterPro (15), PRIAM profiles for enzymatic

classification (16), prediction of protein localization using TMHMM (17), SignalP (18), and

PsortB (19) tools.

The draft genome sequence of methicillin-susceptible S. capitis NRCS-C (CR02 strain) has

33.05% G_C content, is 2,344,750 bp in length which is distributed in 320 contigs (average

coverage, 7.0_) with 2,415 genes, 2,476 CDSs, 42 pseudo genes, 4 rRNAs (5S,16S, 23S), and

59 tRNAs.

CHAPITRE III

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 85

The draft genome sequence of methicillin-resistant S. capitis NRCS-A (CR07 strain) has

32.83% G_C content, is 2,477,101 bp in length which is distributed in 26 contigs (average

coverage, 31x) with 2,411 CDSs, 4 rRNAs (5S,16S, 23S), and 61 tRNAs.

Nucleotide sequence accession numbers. These whole genome sequences were deposited at

GenBank under the accession numbers CZWI00000000 and CZWH00000000 for a

methicillin-susceptible S. capitis NRCS-C strain (CR02) and a multiresistant S. capitis

NRCS-A strain (CR07), respectively. The versions described in this paper are the first

versions.

Acknowledgments

This work was supported by a grant from the Fondation pour la Recherche Médicale (FRM,

grant ING20111223510) and by the Institut National de la Recherche Médicale (INSERM)

and the French Ministry of Health. This work was also supported by a grant from the NIH for

H3Africa BioNet.

References

1. Li X, Lei M, Song Y, Gong K, Li L, Liang H, Jiang X. 2014. Whole genome sequence

and comparative genomic analysis of multidrug-resistant Staphylococcus capitis

subsp. urealyticus strain LNZR-1. Gut Pathogens. 6:45.

2. Klingenberg C, Rønnestad A, Anderson AS, Abrahamsen TG, Zorman J, Villaruz A,

Flægstad T, Otto M, Sollid, Ericson J. 2007. Persistent strains of coagulase negative

staphylococci in neonatal intensive care unit: virulence factors and invasiveness. Clin

Microbiol Infec. 13(11):1100-11.

3. Rasigade J-P, Raulin O, Picaud J-C, Tellini C, Bes M, Grando J, Ben Saïd M, Claris

O, Etienne J, Tigaud S, Laurent F. 2012. Methicillin-Resistant Staphylococcus capitis

with Reduced Vancomycin Susceptibility Causes Late-Onset Sepsis in Intensive Care

Neonates. PLoS ONE. 7(2):e31548.

4. Butin M, Rasigade JP , Martins-Simões P, Meugnier H, Lemriss H, Goering R.V,

Kearns A, Deighton M.A, Denis O, Ibrahimi A, Claris O, Vandenesch F, Picaud JC,

Laurent F. 2016. Wide geographical dissemination of the multiresistant

Staphylococcus capitis NRCS-A clone in neonatal 84 intensive-care units. Clin

Microbiol Infec. 22(1):46-52.

5. . Cui B, Smooker PM, Rouch DA, Daley AJ, Deighton MA. 2013. Differences

between two clinical Staphylococcus capitis subspecies as revealed by biofilm,

CHAPITRE III

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 86

antibiotic resistance, and pulsed-field gel 87 electrophoresis profiling. J Clin

Microbiol. 51: 9–14.

6. Vallenet D, Belda E, Calteau A, Cruveiller S, Engelen S, Lajus A, Le Fèvre F, Longin

C, Mornico D, Roche D, Rouy Z, Salvignol G, Scarpelli C, Thil Smith A A,Weima,

M, and Médiguel C. 2013. MicroScope an integrated microbial resource for the

curation and comparative analysis of 91 genomic and metabolic data. Nucleic Acids

Res 41:D636-D647.

7. Vallenet D, Labarre L, Rouy Z, Barbe V, Bocs S, Cruveiller S, Lajus A, Pascal G,

Scarpelli C, Médigue C. 2006. MaGe: amicrobial genome annotation system

supported by synteny results. Nucleic Acids Res 34:53-65.

8. Bocs S, Cruveiller S, Vallenet D, Nuel G, Médigue C. 2003. AMIGene: Annotation of

Microbial Genes. Nucleic Acids Res 31:3723-3726.

9. Lowe TM, Eddy SR. 1997. tRNA scan-SE: a program for improved detection of

transfer RNA genes in genomic sequence. Nucleic Acids Res 25:955-964.

10. Lagesen K, Hallin P, Rødland EA, Staerfeldt HH, Rognes T, Ussery DW. 2007.

RNAmmer: consistent and rapid annotation of ribosomal RNA genes. Nucleic Acids

Res 35:3100-3108.

11. Gardner PP, Daub J, Tate JG, Nawrocki EP, Kolbe DL, Lindgreen S, Wilkinson AC,

Finn RD, Grif-fiths-Jones S, Eddy SR, Bateman A. 2009. Rfam: updates to the RNA

families database. Nucleic Acids Res 37:D136-D140.

12. Hyatt D, Chen GL, Locascio PF, Land ML, Larimer FW, Hauser LJ. 2010. Prodigal:

prokaryotic gene recognition and translation initiation site identification. BMC

Bioinformatics.11:119.13.

13. UnitProt Consortium. The Universal Protein Re-source (UniProt) 2009. Nucleic Acids

Res 2009; 37:D169-D174.

14. Tatusov RL, Fedorova ND, Jackson JD, Jacobs AR, Kiryutin B, Koonin EV, Krylov

DM, Mazumder R, Mekhedov SL, Nikolskaya AN, Rao BS, Smirnov S, Sverdlov AV,

Vasudevan S, Wolf YI, Yin JJ, and Darren AN. 2003. The COG database: an updated

version includes eukaryotes. BMC Bioinformatics. 4:41

15. Hunter S, Apweiler R, Attwood TK, Bairoch A, Bateman A, Binns D, Bork P, Das U,

Daugherty L, Duquenne L, Finn RD, Gough J, Haft D, Hulo N, Kahn D, Kelly E,

Laugraud A, Letunic I, Lonsdale D, Lopez R, Madera M, Maslen J, McAnulla C,

McDowall J, Mistry J, Mitchell A, Mulder N, Natale D, Orengo C, Quinn AF,

Selengut JD, Sigrist CJ, Thimma M, Thomas PD, Valentin F, Wilson D, Wu CH and

CHAPITRE III

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 87

Yeats C. 2009. InterPro: the integrative protein signature database. Nucleic Acids Res

37:D211-D215.

16. Claudel-Renard C, Chevalet C, Faraut T, Kahn D. 2003. Enzyme-specific profiles for

genome annotation: PRIAM. Nucleic Acids Res 31:6633-6639.

17. Sonnhammer EL, von Heijne G, Krogh A. 1998. A hid-den Markov model for

predicting transmembrane helices in protein sequences. Proc Int ConfIntellSyst Mol

Biol. 6:175-182.

18. Bendtsen JD, Nielsen H, von Heijne G, Brunak S. 2004. Improved prediction of signal

peptides: SignalP 3.0. J Mol Biol. 340:783-795.

19. Gardy JL, Laird MR, Chen F, Rey S, Walsh CJ, Es-ter M, Brinkman FS. 2005.

PSORTb v.2.0: expanded prediction of bacterial protein subcellular localization and

insights gained from comparative proteome analysis. Bioinformatics. 21:617-623.

87

CHAPITRE IV

Génomique comparative de souches

de Stapylococcus capitis

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 88

Les bactéries pathogènes constituent une menace majeure pour la santé humaine, que ce soit

de manière naturelle ou liée aux activités humaines. De ce fait, elles font l'objet d'études

approfondies afin de comprendre leurs modalités d'évolution, les mécanismes gouvernant

l'acquisition du caractère pathogène, ainsi que la sélection et le transfert de facteurs de

virulence, notamment dans le contexte du développement des résistances aux antibiotiques et

de l'augmentation de la fréquence des infections nosocomiales.

Les staphylocoques à coagulase négative (SCN) sont la cause la plus fréquente de septicémie

tardive dans les unités de soins intensifs néonatals (NICU). L’espèce Staphylococcus

epidermidis est la plus prévalente (> 70 %) dans ce contexte. Cependant, des rapports récents

ont identifié Staphylococcus capitis, un autre SCN, comme une cause émergente de

bactériémie dans les salles de NICU. Les isolats de S. capitis, provenant des nourrissons de

plusieurs NICU dans le monde (France, Royaume-Uni, Belgique et Australie), ont plusieurs

caractéristiques moléculaires (électrophorèse sur gel à champ pulsé) et bactériologiques

frappantes. Ils appartiennent tous au même type, désigné par NRCS-A, ce qui indique leur

relation clonale et leur profil de résistance reflétant leur adaptation aux agents antimicrobiens

spécifiquement utilisés dans les NICU, y compris la résistance aux bêta-lactamines, aux

aminoglycosides et hétérorésistance aux glycopeptides ( Rasigade et al., 2012; de Souza

Rugolo et al., 2014).

Peu de séquences génomiques de S. capitis sont publiquement disponibles à ce jour. Une

seule et unique étude, utilisant le génome d'un isolat de S. capitis recueillie à partir d'une

infection sanguine chez un adulte, a rapporté la comparaison génomique des facteurs de

virulence entre S. capitis et S. epidermidis (Cameron et al., 2015). Compte tenu de

l'importance spécifique de S.capitis NRCS-A dans l'établissement NICU et de sa diffusion

internationale, nous présentons dans ce chapitre la première séquence de génome fermé de la

souche française CR01 de prototype NRCS-A, une comparaison des séquences du génome

entier (WGS) de cette souche avec trois autres souches de prototype NRCS-A recueillies dans

des pays éloignés (Belgique (CR03), Australie (CR04), Royaume-Uni (CR05)) et une

description des caractéristiques génomiques de ce clone NRCS-A.

Le séquençage par la méthode shotgun, l’assemblage et l’annotation (syntaxique et

fonctionnelle) du génome complet de S. capitis CR01, prototype NRCS-A, (souche Française

isolée en 2009) a été réalisé en 2012 comme décrit dans le 2ème chapitre. Ce génome a été le

premier draft génome disponible de cette bactérie. Cette séquence a donc été le point de

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 89

départ de l’étude de ce pathogène par des approches de la génomique comparative, en utilisant

diverses plateformes (publiques et privées), logiciels et outils bioinformatiques.

Les analyses préliminaires du draft génome de cette souche CR01 ont permis la

caractérisation d’une nouvelle cassette SCCmec de type V (numéro d’accession à GenBank

/DDBJ / EMBL : KF049201). Cette dernière est fortement homologue à celle

des S. aureus résistants à la méticilline ST398 (LA-SARM) et portant de façon surprenante un

élément CRISPR (2 CRISPER) d’immunité adaptative et une cassette SCC portant des gènes

de résistance aux métaux lourds (SCCcad/ars/cop). La comparaison avec d’autres génomes

SARM et de S. capitis a permis de proposer un schéma évolutif avec acquisition successive

indépendante des 2 cassettes (SCCmec et SCCcad/ars/cop) de 60,9 kb confirmé par le typage

moléculaire et l’étude phylogénique.

Le séquençage par SMART (Single-Molecule Real-Time) de cette souche française CR01

nous a permis de confirmer le scaffolding qui a été fait par le pyroséquençage 454 et aussi

d'améliorer la séquence du draft génome en fermant les gaps au sein des scaffolds. Au final,

nous avons obtenu une séquence sous forme d'un seul chromosome circulaire de 2,522,871

bp et d’un plasmide de 26.140 bp. Ces séquences ont été corrigées et annotées avec la

plateforme MicroScope (MaGe) (Vallenet et al., 2006. 2013) et le logiciel Mauve (Darling et

al., 2010).

Sur la base des séquençages à haut débit d’un large panel d’isolats cliniques de souches de S.

capitis, provenant d’un échantillonnage à différentes périodes de temps (2000-2009) et à

différentes localisations (France (CR01), Belgique (CR03), Australie (CR04), Royaume-Uni

(CR05)) comme décrit dans le chapitre III, des comparaisons génomiques avec les autres

souches de S. capitis des adultes et d’autres staphylocoques disponibles sur les bases de

données ont été réalisées pour étudier les spécificités génétiques (gènes de virulence, de

résistances, éléments génétiques mobiles, etc.) et l'évolution du clone endémique au cours du

temps.

Le génome fermé de la souche CR01 a été comparé avec trois génomes assemblés des

souches du clone NRCS-A (CR03, CR04 et CR05), six génomes publiques de S.

capitis n’appartenant pas au clone NRCS-A et autres staphylocoques.

Nous avons pu mettre en évidence au sein du clone NRCS-A des gènes de résistance

(mecA, aacA-aphD, ...) associés à des éléments génétiques mobiles ou contenus dans le core-

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 90

genome, expliquant le profil de résistance de ce clone, des facteurs de virulence dans le core-

genome comprenant des Phenol Soluble Modulins, des hémolysines, des protéines de la paroi

fixant le fibrinogène ou la fibronectine, et l'opéron ica. En outre, nous avons noté la présence

spécifique d’un gène de résistance à la nisine (nsr), absent des génomes non-NRCS-A et de la

plupart des génomes de S. aureus et de staphylocoques à coagulase négative (SCN).

Nos résultats soulignent le rôle des éléments génétiques mobiles dans l'émergence du

phénotype multirésistant du clone NRCS-A, lui conférant un profil de résistance parfaitement

adapté à la pression de sélection existant en réanimation néonatale. Par ailleurs le gène de

résistance à la nisine, bactériocine "large-spectre" active sur de nombreuses bactéries à Gram

positif et sécrétée par les bactéries de la flore commensale digestive (Lactococcus,

entérocoques, BGN…), pourrait contribuer à une meilleure fitness au clone NRCS-A et lui

conférer un avantage sélectif au sein du microbiote des prématurés par rapport aux autres

souches de S. capitis et plus largement aux autres souches de SCN ne possédant pas ce gène.

Ce chapitre est présenté sous forme de deux articles publiés dans le journal Antimicrobial

Agents and Chemotherapy (Martins Simões et al., 2013) et celui de Frontiers in Microbiology

(Martins Simões et al., 2016). Les références de ces deux articles sont les suivantes :

Antimicrob. Agents Chemother.December 2013 vol. 57 no. 126354-6357.

doi:10.1128/AAC.01576-13.

Environment. Front. Microbiol. 7:1991. doi: 10.3389/fmicb.2016.01991

Dans ces deux publications (partie IV.1 et partie IV.2 ci-dessous), j’ai réalisé toutes les

analyses de la génomique comparative en double avec l’équipe du CNR de Staphylocoques,

Lyon, France et j’ai contribué à la rédaction des manuscrits.

Le travail de la partie IV.1 a fait également l’objet de deux communications orale ci-dessous

et dont les résumés sont présentés dans la partie publications et communications.

1- P. Martins-Simões, Y. Dumont, M. Butin, H. Lemriss, S. Lemriss, A. Ibrahimi, S.El

Kabbaj, F. Vandenesch, J.P. Rasigade, F. Laurent. Caractérisation moléculaire par

séquençage PacBio du clone endémique mondial S. capitis NRCS-A responsable de sepsis

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 91

en réanimation néonatale : résistances, virulence et avantage sélectif. RICAI, Paris, 14

Décembre 2015.

2- P. Martins Simoes, H. Lemriss, J.-P. Rasigade, S. Lemriss, F. Vandenesch, S. El Kabbaj,

F. Laurent. Staphylococcus capitis NRCS-A: SCC, SCCMEC and Their Evolutionary

History. 5th Congrees of European Microbiologists, FEMS, Juillet 2013.

IV.1 Characterization of a Novel Composite Staphylococcal Cassette Chromosome mec

(SCCmec-SCCcad/ars/cop) in the Neonatal Sepsis-Associated Staphylococcus capitis

Pulsotype NRCS-A

Abstract

Multiresistant Staphylococcus capitis pulsotype NRCS-A has been reported to be a major

pathogen causing nosocomial bacteremia in preterm infants. We report that the NRCS-A

strain CR01 harbors a novel 60.9-kb composite staphylococcal cassette chromosome mec

(SCCmec) element, composed of an SCCmec with strong homologies to Staphylococcus

aureus ST398 SCCmec and of an SCCcad/ars/cop harboring resistance genes for cadmium,

arsenic, and copper. Whole-genome-based comparisons of published S. capitis strains suggest

that strain CR011 acquired the two elements independently.

Coagulase-negative staphylococci (CoNS) are common commensals of the human skin and

mucosa that are now recognized as important opportunistic pathogens that cause nosocomial

bloodstream and indwelling medical device-related infections (1). Recent studies have

reported the emergence of methicillin-resistant, vancomycin-heteroresistant Staphylococcus

capitis as an important cause of late-onset sepsis (LOS) in neonatal intensive care units

(NICUs) in France and other countries (2–6). Surprisingly, all S. capitis strains from intensive

care neonates were reported to belong to a single pulsed-field gel electrophoresis pulsotype,

NRCS-A, and to harbor a type V-related staphylococcal cassette chromosome mec (SCCmec)

element (6). In contrast, S. capitis bloodstream isolates from adult patients belong to several

distinct, non-NRCS-A pulsotypes. To gain insights into the genetic characteristics of this

LOS-specific multiresistant S.capitis clone, we sequenced and characterized the SCCmec

element of one representive starin (CR01) with the NRCS_A plusotype.

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 92

Strain CR01 was isolated from the blood cultures of an infant diagnosed with LOS in 2007 in

the NICU of the Hospices Civils de Lyon, France. The strain was part of a previously

published collection (6), had the pulsotype NRCS-A, and harbored a type V-related

SCCmec element. We performed whole-genome pyrosequencing (454 Life Sciences/Roche)

for this strain and used bioinformatics tools to identify and characterize a novel 60.9-kb

composite SCCmec element (DDBJ/EMBL/GenBank accession no. KF049201). The cassette

was found to be inserted into the characteristic 3′ end of the orfX gene (7, 8). To define the

SCC region, we searched for SCC-specific insertion site sequences (ISSs) (9, 10). Three ISSs

were found, with the furthest downstream from orfX being partially deleted. Because the

predicted SCC region was found in two different contigs, the SCC sequence was closed using

PCR.

SCCmec characterization and similarities to SCCmec elements of livestock-

associated Staphylococcus aureus

A 38.8-kb SCCmec element was identified immediately downstream of orfX. This element

harbored a type V (5C2&5) SCCmec and contained 42 open reading frames (ORFs; orf1 to

orf42 in Table IV.1 in the supplemental material), as predicted using the syntactic and

functional annotation implemented in the MicroScope/MaGe platform pipeline (11, 12).

Using the MicroScope genome browser, the sequence of the CR01 SCCmec element was

aligned with 22 genomes of methicillin-resistant Staphylococcus strains, which are available

in the MaGe database. Two genomes in this database carried SCCmec elements showing a

remarkable similarity to the NRCS-A strain CR01 SCCmec in terms of gene content, gene

order, and nucleotide identity. Both SCCmec elements were carried by livestock-associated

methicillin-resistant S. aureus (LA-MRSA) strains, namely, the S0385 and 08BA02176

strains, which belong to the highly prevalent LA-MRSA sequence type 398 (ST398) (Fig.

IV.1.1; see also Table IV.1). A detailed comparison of gene organization in these three

SCCmec elements revealed that the structures of the joining regions J3 and J2 and

the mec and ccr complexes were identical to those found in the ST398 LA-MRSA strain

S0385, whereas the joining region J1 was identical to that of the ST398 LA-MRSA strain

08BA02176. In both the CR01 and the 08BA02176 SCCmec elements, the J1 region

contained clustered regularly interspaced short palindromic repeat (CRISPR) loci with their

associated cas genes. CRISPR loci are the sole prokaryotic defense mechanism against

foreign DNA conferring an adaptive immune response, inversely to other defense

mechanisms such as restriction-modification (R-M) systems (13). Using the online

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 93

CRISPRFinder software tool (14), we identified two CRISPR elements in the NRCS-A strain

CR01 located immediately before the second ISS (Fig. 1). The first CRISPR element

consisted of 16 direct repeats (DRs) and 15 spacers. The second CRISPR element consisted of

three nonconserved DRs and two spacers. This subtype III-A CRISPR locus (15) (including

the 2 CRISPRs and the cas genes) showed a high similarity to the element found in the ST398

LA-MRSA strain 08BA02176 SCCmec element (see Fig. IV.1.3 table IV.1.S2 in the

supplemental material).

Figure IV.1.1. Comparative structure analysis of the composite staphylococcal

chromosome cassette SCCmec-SCCcad/asr/cop element of Staphylococcus capitis strain

CR01. Sequence of the SCCmec-SCCcad/asr/cop element of strain CR01 was aligned against

whole genomes of ST398 S. aureus strains S0385 and 08BA02176, and of S. capitis strain

SK14. Open reading frames (ORFs) are shown as arrows indicating the transcription direction

and colored according to the SCCmec region to which they belong (J3, mec complex, J2, ccr

complex or J1). Homologous gene clusters in different strains have similar colors. The

chromosomal orfX gene and the transposase IS43 are represented by black and yellow arrows,

respectively. Insertion site sequences (ISSs) are indicated by vertical lines and colored stars as

follows: light yellow star, ccrC recombinase ISS; dark yellow star, ccrAB recombinase ISS

with associated direct repeat (DR) sequences; and red star, vestigial ccrAB ISS and DR

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 94

sequences. The CRISPR associated genes (cas genes) are indicated in light green within the

J3 region, while the ccr complex in the SCCcad/ars/cop element are colored in turquoise and

the resistance genes in dark red.

To further investigate the relationships between the CR01 SCCmec elements and those of

ST398 S. aureus (strains S0385 and 08BA02176), we characterized the SCCmec-associated

direct repeat units (dru) using the scheme described by Goering et al., which has been

described as a discriminant epidemiological tool for differentiating highly uniform epidemic

methicillin-resistant strains (16). Dru analysis showed that the SCCmec cassettes of both the

CR01 strains and the ST398 08BA02176 strain shared the same dru type (5a-2d-4a-0-2d-5b-

3a-2g-4b-4e-3e), namely, dt11c, which further highlighted the close genetic proximity

between these SCCmec elements. Strain S0385 harbored a different dru type, namely, dt10a

(dt10a, 5a-2d-4a-0-2d-5b-3a-2g-3b-4e), but presenting only one mutation in the ninth repeat

and one repeat fewer. The dru type found in strain CR01 was identical to the ones found in

other S. capitis NRCS-A strains (n = 12, data not shown), further corroborating the clonality

within this lineage.

Collectively, these findings suggest that the S. capitis NRCS-A strain CR01 and ST398 LA-

MRSA strains have undergone a recent horizontal transfer of SCCmec elements originating

from a common source.

SCCcad/ars/cop characterization and relationships to other SCC elements

Immediately downstream of the SCCmec domain, we identified a second, 22.2-kb-long SCC

domain (SCCcad/ars/cop) harboring 29 predicted ORFs (orf43 to orf70 in Table IV.1.S1 in

the supplemental material), including a type 8 ccrA1B3 complex with 90% similarity to

the ccr complex recently described in S. aureus strain LGA251 carrying a type IX

SCCmec and the novel mecC allele (17). A comparison of the overall structure of the

SCCcad/ars/cop with other SCC elements revealed only two regions with partial similarities

to previously described SCC elements. The first region encompassed nine ORFs (orf47 to

orf56 in Table IV.1.S1), including the ccrA1B3 gene complex; this region had an organization

similar to the regions found in the SCCpbp4 element of the Staphylococcus epidermidis strain

ATCC 12228 and in the type II SCCmec elements of the S. aureus strains MRSA252 and

N315 (18). The second region encompassed 11 ORFs (orf58 to orf69 in Table IV.1.S1) and

included genes for the detoxification of heavy metals, namely, cadmium (cadDC), arsenic

(arsCBR), and copper (copB). All 11 ORFs were highly homologous to those found in the J1

regions of the SCCmec element of CC398 MRSA S. aureus JCSC6943 (19) and of the

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 95

ΨSCCmec(h1435) domain in Staphylococcus haemolyticus JCSC1435 (18), with nucleotide

identities greater than 97.5%.

Of note, previously published NRCS-A strains have been reported to harbor only a type V-

related SCCmec element (ccrC complex), as determined using the multiplex PCRs described

by Kondo et al. (6, 20). To understand why these PCRs failed to detect the

SCCcad/ars/cop type 8-related ccrAB complex, Kondo's primer sequences were aligned to the

NRCS-A strain CR01 ccrA1 and ccrB3alleles. Several mismatches were observed between

the ccrA primers and their target sequence, which likely prevented amplification of

the ccrAB complex and so explain the misinterpretation of Kondo's scheme.

To assess whether SCC elements are present in other S. capitis strains, we performed a

BLAST search (http://blast.ncbi.nlm.nih.gov) of the composite SCCmec-

SCCcad/ars/cop sequence against publicly available genomes from methicillin-susceptible S.

capitis isolates, namely, those of strains QN1 (GenBank accession no. AJJH00000000) (21),

SK14 (GenBank accession no. ACFR00000000), and VCU116 (GenBank accession

no. AFTX00000000). None of these strains harbored an SCCmec element. Interestingly,

whereas strain QN1 had an intact orfX gene, both the SK14 and the VCU116 strains carried

homologous SCCcad/ars/cop elements inserted into the 3′ end of orfX. These latter elements

were highly similar to the SCCcad/ars/cop found in the NRCS-A strain CR01 (Fig. IV.1.1;

see also Table IV.1.S1 in the supplemental material), except for the first seven ORFs after the

insertion at the end of orfX. Gene organization and nucleotide sequences were identical in 22

remaining ORFs (orf47 to orf49 and orf53 to orf70 in Table IV.1.S1).

Evolutionary history of SCCcad/ars/cop and SCCmec acquisition by S. capitisNRCS-A.

To assess the phylogenetic relationships between the S. capitis strains CR01 (NRCS-A clone),

QN1, SK14, and VCU116, we performed a whole-genome-based single nucleotide

polymorphism (SNP) analysis and constructed a maximum likelihood (ML) SNP tree using

the snpTree online web server (22) and PhyML (23), respectively (see the supplemental

material). Interestingly, all SCCcad/ars/cop-positive strains clustered on a monophyletic

clade, separate from the SCC-negative strain QN1. Furthermore, the sole SCCmec-positive

strain (CR01) was the most divergent compared with strains SK14 and VCU116 (Fig.

IV.1.2a). These results suggest the occurrence of at least two independent SCC acquisition

events within the S. capitis species (Fig. IV.1.2b). The first acquisition of the

SCCcad/ars/copoccurred in the ancestral lineage of strains CR01, SK14, and VCU116, which

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 96

was followed by later acquisition of the SCCmec element in the ancestor lineage of the

NRCS-A clone.

Figure IV.1.2. Phylogenetic analysis of whole genome-sequenced S. capitis strains and

proposed evolutionary history of SCC elements acquisition in S. capitis. (a) SNPs based Maximum likelihood tree of the 4 S. capitis WGS. A total of 27 836 SNPs (indels

excluded) were obtained by alignment against the reference strain S. epidermidis ATCC 12228. Numbers at the branching points represent the aLRT branch support score obtained. Proposed

acquisition events of SCCcad/ars/cop and SCCmec elements are indicated by dark and light arrows,

respectively. (b) Proposed model of sequential acquisition of SCC elements in the S. capitis clade: in a

first event the SCCcad element harboring multiple resistance genes to heavy metals was inserted via site specific recombination at the end of the orfX gene; a second insertion occurred in the

SCCcad/ars/cop positive strain CR01 strain with the insertion of SCCmec at the 3'-end of orfX.

Legend: ancest1 = first ancestor; ancest2 = second ancestor (of CR01,SK14 and VCU116).

Conclusions

The highly clonal population of S. capitis NRCS-A, which is endemic in NICUs in several

countries distant from one another (5), harbors a novel SCCmec-SCCcad/ars/cop composite

island that has likely emerged from two independent acquisition events.

The high degree of structural similarity of the SCCmec type V element and the partial

conservation of genes for heavy metal detoxification strongly suggest the occurrence of

SK14 &

VCU116

Ancest2

CR01

Ancest1

(b)

+

(a)

SCCcad/ars/cop

QN1

+SCCmec

SCCmec

SCCcad/ars/cop

QN1

NRCS-A CR01

VCU116

SK14

0.05

TIME

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 97

genetic shuffling involving S. capitis and CC398 MRSA strains. Whether SCC element

exchanges occurred directly between these strains or indirectly via a common SCC element

donor is presently unclear and warrants further investigation.

Acknowledgements

This work was supported by the Institut National de la Recherche Médicale (INSERM) and

the French Ministry of Health and by a grant from the Fondation pour la Recherche Médicale

(FRM) (grant ING20111223510).

References

1. Otto M. 2009. Staphylococcus epidermidis — the “accidental” pathogen. Nat. Rev.

Microbiol. 7:555–567.

2. Gras-Le Guen C, Fournier S, Andre-Richet B, Caillon J, Chamoux C, Espaze E,

Richet H, Roze JC, Lepelletier D. 2007. Almond oil implicated in a Staphylococcus

capitis outbreak in a neonatal intensive care unit. J. Perinatol. 27:713–717.

3. Ng PC, Chow VC, Lee CH, Ling JM WH, Chang R. 2006. Persistent Staphylococcus

capitis septicemia in a preterm infant. Pediatr Infect Dis J 25:652–654.

4. De Silva GDI, Kantzanou M, Justice A, Massey RC, Wilkinson AR, Day NPJ,

Peacock SJ. 2002. The ica Operon and Biofilm Production in Coagulase-Negative

Staphylococci Associated with Carriage and Disease in a Neonatal Intensive Care

Unit. J Clin Microbiol 40:382–388.

5. Rasigade J-P, Goering R, Kearns A, Hill R, Deighton M, Meugnier H, Bes M, Ben

Saïd M, Claris O, Picaud J-C, Vandenesch F, Etienne J, Laurent F. 2012. Worldwide

epidemic methicillin-resistant Staphylococcus capitis with reduced vancomycin

susceptibility causes late-onset sepsis in intensive care neonates. 15th Isssi Lyon 2012

P 06-075.

6. Rasigade J-P, Raulin O, Picaud J-C, Tellini C, Bes M, Grando J, Ben Saïd M, Claris

O, Etienne J, Tigaud S, Laurent F. 2012. Methicillin-Resistant Staphylococcus capitis

with Reduced Vancomycin Susceptibility Causes Late-Onset Sepsis in Intensive Care

Neonates. Plos One 7:e31548.

7. Ito T, Katayama Y, Asada K, Mori N, Tsutsumimoto K, Tiensasitorn C, Hiramatsu K.

2001. Structural comparison of three types of staphylococcal cassette chromosome

mec integrated in the chromosome in methicillin-resistant Staphylococcus aureus.

Antimicrob. Agents Chemother. 45:1323–1336.

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 98

8. Ma XX, Ito T, Tiensasitorn C, Jamklang M, Chongtrakool P, Boyle-Vavra S, Daum

RS, Hiramatsu K. 2002. Novel Type of Staphylococcal Cassette Chromosome mec

Identified in Community-Acquired Methicillin-Resistant Staphylococcus aureus

Strains. Antimicrob Agents Chemother 46:1147–1152.

9. Ito T, Ma XX, Takeuchi F, Okuma K YH, HiramatsuK. 2004. Novel Type V

Staphylococcal Cassette Chromosome mec Driven by a Novel Cassette Chromosome

Recombinase, ccrC. Antimicrob Agents Chemother 48:2637–2651.

10. Noto MJ, Archer GL. 2006. A subset of Staphylococcus aureus strains harboring

staphylococcal cassette chromosome mec (SCCmec) type IV is deficient in CcrAB-

mediated SCCmec excision. Antimicrob. Agents Chemother. 50:2782–2788.

11. Vallenet D, Labarre L, Rouy Z, Barbe V, Bocs S, Cruveiller S, Lajus A, Pascal G,

Scarpelli C, Médigue C. 2006. MaGe: a microbial genome annotation system

supported by synteny results. Nucleic Acids Res 34:53–65.

12. Vallenet D, Engelen S, Mornico D, Cruveiller S, Fleury L, Lajus A, Rouy Z, Roche D,

Salvignol G, Scarpelli C, Médigue C. 2009. MicroScope: a platform for microbial

genome annotation and comparative genomics. Database J. Biol. Databases Curation

2009:bap021.

13. Sorek R, Lawrence CM, Wiedenheft B. 2013. CRISPR-Mediated Adaptive Immune

Systems in Bacteria and Archaea. Annu. Rev. Biochem. 82:237–266.

14. Makarova KS, Haft DH, Barrangou R, Brouns SJJ, Charpentier E, Horvath P,

Moineau S, Mojica FJM, Wolf YI. 2011. Evolution and classification of the CRISPR-

Cas systems. Nat. Rev. Microbiol. 9:467–477.

15. Grissa I, Vergnaud G, Pourcel C. 2007. CRISPRFinder: a web tool to identify

clustered regularly interspaced short palindromic repeats. Nucleic Acids Res 35:W52–

W57.

16. Goering RV, Morrison D, Al-Doori Z, Edwards GFS, Gemmell CG. 2008. Usefulness

of mec-associated direct repeat unit (dru) typing in the epidemiological analysis of

highly clonal methicillin-resistant Staphylococcus aureus in Scotland. Clin. Microbiol.

Infect. 14:964–969.

17. Shore AC, Deasy EC, Slickers P, Brennan G, O’Connell B, Monecke S, Ehricht R,

Coleman DC. 2011. Detection of staphylococcal cassette chromosome mec type XI

carrying highly divergent mecA, mecI, mecR1, blaZ, and ccr genes in human clinical

isolates of clonal complex 130 methicillin- resistant Staphylococcus aureus.

Antimicrob. Agents Chemother. 55: 3765–3773.

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 99

18. Mongkolrattanothai K, Boyle S, Murphy TV, Daum RS. 2004. Novel non-mecA-

containing staphylococcal chromosomal cassette composite island containing pbp4

and tagF genes in a commensal staphylococcal species: a possible reservoir for

antibiotic resistance islands in Staphylococcus aureus. Antimicrob. Agents

Chemother. 48:1823–1836.

19. Li S, Skov RL, Han X, Larsen AR, Larsen J, S?rum M, Wulf M, Voss A, Hiramatsu

K, Ito T. 2011. Novel Types of Staphylococcal Cassette Chromosome mec Elements

Identified in Clonal Complex 398 Methicillin-Resistant Staphylococcus aureus

Strains. Antimicrob. Agents Chemother. 55:3046–3050.

20. Kondo Y, Ito T, Ma XX, Watanabe S, Kreiswirth BN, Etienne J HK. 2007.

Combination of Multiplex PCRs for Staphylococcal Cassette Chromosome mec Type

Assignment: Rapid Identification System for mec, ccr, and Major Differences in

Junkyard Regions. Antimicrob Agents Chemother 51(1):264–274.

21. Qin N, Ding W, Yao J, Su K, Wu L, Li L. 2012. Genome Sequence of

Staphylococcus capitis QN1, Which Causes Infective Endocarditis. J Bacteriol

194:4469–4470.

22. Leekitcharoenphon P, Kaas RS, Thomsen MCF, Friis C, Rasmussen S, Aarestrup FM.

2012. snpTree - a web-server to identify and construct SNP trees from whole genome

sequence data. Bmc Genomics 13:S6.

23. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W GO. 2010. New

Algorithms and Methods to Estimate Maximum-Likelihood Phylogenies: Assessing

the Performance of PhyML 3.0. Syst. Biol. 59(3):307–21.

Supplementary data

Maximum-Likelihood tree building

All four Staphylococcus capitis WGS strains: CR01, QN1, SK14 and VCU116 were aligned

to the reference genome of S. epidermidis ATCC 12228 using the snpTree online web-server

(1). Briefly, the Nucmer and the show-snps applications (as implemented in the MUMmer

v3.23 software package(2)) were used to, respectively, aligned the query genomes to the

reference one and call the SNPs from the resulting alignment. A prunning is then applied by

establishing the minimum distance between SNPs (default value = 10).

The SNPs were then concatenated into a single alignment by ignoring indels.

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 100

The SNPs alignment was then used to build a maximum-likelihood (ML) tree, using the

PhyML v.3 algorithm as implemented in Seaview v.4 (3, 4). The substitution model chosen

was the general time reversable (GTR) and we optimized: (I) the nucleotide equilibrium

frequency, t(ii) he proportion of invariable sites and (iii) the across site rate variation.

The aLRT SH-like test was used as a measure of branch support and the Nearest Neighbor

Interchange (NNI) method was used for improvement of tree topologies.

Table IV.1.S1. Open reading frames of the novel composite staphylococcal chromosome

cassette (SCC) found in methicillin-resistant Staphylococcus capitis NCRS-A prototype strain

CR01. The first 42 ORFs (orf1 to orf42) were found in the SCCmec element, while orf43 to

orf70 were found in the SCCcad/ars/cop element.

ORFa

gene size (bp) Gene Description of productb

protein size (aa)

Homolog (% id)c

GenBank accession no. d Homologs (strains)

ORF X 480 orfX

Ribosomal RNA large subunit methyltransferase

H 159 nap nap nap

SCCmec

orf1 306 conserved protein of

unknown function 101 100 YP_005732838.1 Staphylococcus aureus ST398

(S0385)

orf2 864 conserved protein of

unknown function 287 100 YP_005732839.1 Staphylococcus aureus ST398

(S0385)

orf3 1476 conserved protein of

unknown function 491 100 YP_005732840.1 Staphylococcus aureus ST398

(S0385)

orf4 1101 conserved protein of

unknown function 366 100

YP_005732841.1 Staphylococcus aureus ST398

(S0385)

orf5 372 conserved protein of

unknown function 123 100 YP_005732842.1 Staphylococcus aureus ST398

(S0385)

orf6 1644 conserved protein of

unknown function 547 100 YP_005732843.1 Staphylococcus aureus ST398

(S0385)

orf7 117 conserved protein of

unknown function 38 100 YP_005732844.1 Staphylococcus aureus ST398

(S0385)

orf8 1677 ccrC Cassette chromosome recombinase type C 558 100 YP_005732845.1

Staphylococcus aureus ST398 (S0385)

orf9 339 conserved protein of

unknown function 112 100 (1) Staphylococcus aureus ST398

(S0385)

orf10 312 conserved protein of

unknown function 103 100 YP_005732846.1 Staphylococcus aureus ST398

(S0385)

orf11 507 conserved protein of

168 100 YP_005732847.1 Staphylococcus aureus ST398

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 101

unknown function (S0385)

orf12 675 tnp transposase for IS431 or

IS66families 224 100 YP_005732848.1 Staphylococcus aureus ST398

(S0385)

orf13 168 HMG-CoA synthase 55 100

YP_005732849.1 ,

YP_006708794.1

Staphylococcus aureus ST398 (S0385), Staphylococcus aureus

08BA02176

orf14 744 ugpQ Glycerophosphoryldiester

phosphodiesterase 247 100

YP_0057328450.1,

YP_006708796.1

Staphylococcus aureus ST398 (S0385), Staphylococcus aureus

08BA02176

orf15 429 maoC putative dehydratase with

a MaoC like domain 142 100

YP_005732851.1,

YP_006708797.1

Staphylococcus aureus ST398 (S0385), Staphylococcus aureus

08BA02176

orf16 2007 mecA

Beta-lactam-inducible penicillin-binding protein

2' 668 100

YP_005732852.1,YP_006708798.

1

Staphylococcus aureus ST398 (S0385), Staphylococcus aureus

08BA02176

orf17 144

ΔmecR

1 Truncated methicillin resistance regulator 47 100

YP_005732853.1,

YP_006708799.1

Staphylococcus aureus ST398 (S0385), Staphylococcus aureus

08BA02176

orf18 93 Δtnp Truncated transposase for

IS431 or IS66families 30 100 (2) Staphylococcus aureus ST398

(S0385)

orf19 252 Δtnp Truncated transposase of

IS431 family or IS66 83 100 (3) Staphylococcus aureus ST398

(S0385)

orf20 429

3-demethylubiquinone-9 3-methyltransferase

domain protein 142 100

YP_005732854.1,

YP_006708801.1

Staphylococcus aureus ST398 (S0385), Staphylococcus aureus

08BA02176

orf21 930 Transcriptional regulator

(DeoR family) 309 100

YP_005732855.1,

YP_006708802.1

Staphylococcus aureus ST398 (S0385), Staphylococcus aureus

08BA02176

orf22 1989 conserved protein of

unknown function 662 100

YP_005732856.1,

YP_006708804.1

Staphylococcus aureus ST398 (S0385), Staphylococcus aureus

08BA02176

orf23 1110 conserved protein of

unknown function 369 100

YP_005732857.1,

YP_006708805.1

Staphylococcus aureus ST398 (S0385), Staphylococcus aureus

08BA02176

orf24 369 conserved protein of

unknown function 122 100

YP_005732858.1,YP_006708806.

1

Staphylococcus aureus ST398 (S0385), Staphylococcus aureus

08BA02176

orf25 1617 putative primase 538 100

YP_005732859.1,

YP_006708807.1

Staphylococcus aureus ST398 (S0385), Staphylococcus aureus

08BA02176

orf26 1680 ccrC Cassette chromosome

recombinase 559 100 YP_006708808.1 Staphylococcus aureus

08BA02176

orf27 339 conserved protein of

112 100 YP_006708809.1 Staphylococcus aureus

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 102

unknown function 08BA02176

orf28 240 conserved protein of

unknown function 79 100 YP_006708810.1 Staphylococcus aureus

08BA02176

orf29 504 conserved protein of

unknown function 167 100 YP_006708811.1 Staphylococcus aureus

08BA02176

orf30 222 conserved protein of

unknown function 73 100 YP_006708812.1 Staphylococcus aureus

08BA02176

orf31 132 conserved protein of

unknown function 43 100 (4) Staphylococcus aureus

08BA02176

orf32 276 ΔhsdR

truncated type I restriction modification system

methylase 91 100 YP_006708813.1 Staphylococcus aureus

08BA02176

orf33 117 protein of unknown

function 38 na na na

orf34 906 cas1 CRISPR-associated endonuclease Cas1 301 100 YP_006708814.1

Staphylococcus aureus 08BA02176

orf35 306 cas2 CRISPR-associated

endoribonuclease Cas2 101 100 YP_006708815.1 Staphylococcus aureus

08BA02176

orf36 2286 csm1 CRISPR-associated protein,

Csm1 family 761 100 YP_006708816.1 Staphylococcus aureus

08BA02176

orf37 426 csm2 CRISPR-associated protein,

Csm2 family 141 99.53 YP_006708817.1 Staphylococcus aureus

08BA02176

orf38 645 csm3 CRISPR type III-associated

RAMP protein Csm3 214 100 YP_006708818.1 Staphylococcus aureus

08BA02176

orf39 909 csm4 CRISPR-associated RAMP

protein, Csm4 family 302 100 YP_006708819.1 Staphylococcus aureus

08BA02176

orf40 1023 csm5 CRISPR-associated RAMP

protein, Csm5 family 340 100 YP_006708820.1 Staphylococcus aureus

08BA02176

orf41 1269 csm6 CRISPR-associated protein,

Csm6 family 422 100 YP_006708821.1 Staphylococcus aureus

08BA02176

orf42 735 cas6 CRISPR-associated

endoribonuclease Cas6 244 100 YP_006708822.1 Staphylococcus aureus

08BA02176

SCCcad/ars/cop

orf43 159

conserved protein of unknown function, potential pseudo? 52 100

(5), ZP_14685218.1

Staphylococcus aureus 08BA02176, Staphylococcus

epidermidis NIHLM057

orf44 636

conserved membrane protein of unknown

function 211 83.41 NP_788231.1 Oceanobacillus iheyensis strain

HTE831/DSM 14371

orf45 648 Transcriptional regulator,

215 62.09 ZP_07842269.1 Staphylococcus caprae C87

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 103

TetR family

orf46 660

conserved membrane protein of unknown

function 219 72.25 ZP_07842268.1 Staphylococcus caprae C87

orf47 222 conserved protein of

unknown function 73 89.04 ZP_03613434.1, ZP_12550545.1

Staphylococcus capitis SK14, Staphylococcus capitis VCU116

orf48 510 conserved protein of

unknown function 169 94.67 ZP_03613492.1, ZP_12550495.1

Staphylococcus capitis SK14, Staphylococcus capitis VCU116

orf49 312 conserved protein of

unknown function 103 97.07 ZP_03613450.1, ZP_12550524.1

Staphylococcus capitis SK14, Staphylococcus capitis VCU116

orf50 351 conserved protein of

unknown function 116 ZP_03613375.1, ZP_12550516.1

Staphylococcus capitis SK14, Staphylococcus capitis VCU116

orf51 84 protein of unknown

function 27 100 (6) Staphylococcus aureus COL

orf52 1629 ccrB Cassette chromosome

recombinase B 542 92.25 NC_017341.1 Staphylococcus aureusJKD6008

orf53 1350 ccrA Cassette chromosome

recombinase A 449 93.75 ZP_03613501.1, ZP_12550514.1

Staphylococcus capitis SK14, Staphylococcus capitis VCU116

orf54 258 conserved protein of

unknown function 85 96.47 ZP_03613426.1, ZP_12550528.1

Staphylococcus capitis SK14, Staphylococcus capitis VCU116

orf55 1791 conserved protein of

unknown function 596 98.49 ZP_03613521.1, ZP_12550491.1

Staphylococcus capitis SK14, Staphylococcus capitis VCU116

orf56 150 conserved protein of

unknown function 49 100 ZP_03613420.1, ZP_12550498.1

Staphylococcus capitis SK14, Staphylococcus capitis VCU116

orf57 990 conserved protein of

unknown function 329 (100) NZ_ACFR, NZ_AFTX

Staphylococcus capitis SK14, Staphylococcus capitis VCU116

orf58 165 putative acetyltransferase 54 100 ZP_03613441.1, ZP_12550473.1

Staphylococcus capitis SK14, Staphylococcus capitis VCU116

orf59 348 Transcriptional regulator

(MerR family) 115 100 ZP_03613502.1, ZP_12550548.1

Staphylococcus capitis SK14, Staphylococcus capitis VCU116

orf60 684

conserved protein of unknown function, DJ-

1/PfpI family 227 100 ZP_03613391.1, ZP_12550519.1

Staphylococcus capitis SK14, Staphylococcus capitis VCU116

orf61 666 conserved protein YhfK 221 100 ZP_03613415.1, ZP_12550504.1

Staphylococcus capitis SK14, Staphylococcus capitis VCU116

orf62 1005 yfmJ putative oxidoreductase 334 99.7 ZP_03613481.1, ZP_12550540.1

Staphylococcus capitis SK14, Staphylococcus capitis VCU116

orf63 366 conserved protein of

unknown function 121 100 ZP_03613511.1, ZP_12550508.1

Staphylococcus capitis SK14, Staphylococcus capitis VCU116

orf64 618 cadD Cadmium resistance

205 100 ZP_03613409.1, Staphylococcus capitis SK14,

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 104

transporter family protein ZP_12550544.1 Staphylococcus capitis VCU116

orf65 342 cadC

Cadmium resistance transcriptional regulatory

protein 113 100 ZP_03613548.1, ZP_12550523.1

Staphylococcus capitis SK14, Staphylococcus capitis VCU116

orf66 402 arsC arsenate reductase

(thioredoxin) 133 100 ZP_03613466.1, ZP_12550477.1

Staphylococcus capitis SK14, Staphylococcus capitis VCU116

orf67 1290 arsB arsenical pump membrane

protein 429 100 ZP_03613390.1, ZP_12550530.1

Staphylococcus capitis SK14, Staphylococcus capitis VCU116

orf68 318 arsR arsenical resistance

operon repressor 105 100 ZP_03613475.1, ZP_12550472.1

Staphylococcus capitis SK14, Staphylococcus capitis VCU116

orf69 2061 copB

putative copper-transporting P-type

ATPase B 686 99.71 ZP_03613385.1, ZP_12550486.1

Staphylococcus capitis SK14, Staphylococcus capitis VCU116

orf70 546 ydhK putative lipoprotein 181 93.92 ZP_03613457.1, ZP_12550476.1

Staphylococcus capitis SK14, Staphylococcus capitis VCU116

a ORF: open reading frame, b CRISPR: clustered regularly interspaced short palindromic repeats, c

two adjacent ORFs with 100 % id with distinct regions of the same ORF in strain CR01 are indicated

within parenthesis, d new open reading frames (ORFs) predicted after genomic re-annotation

performed in the MaGe/Miscroscope platform pipeline are indicated within parenthesis.

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 105

Table IV.1.S2. Highest probable matches for the 15 interspersed DNA sequences (spacers)

identified in the clustered regularly inter-spaced short palindromic repeats (CRISPR) region

within the SCCmec element found in S. capitis strain CR01.

crispr_

spacer(a) Blastn result(b)

% DNA sequence

similarity

% query

coverage GenBank accession no.

1 Staphylococcus aureus 08BA02176 100 100 NC_018608.1

2

Staphylococcus aureus 08BA02176,

Staphylococcus sp. CDC3 plasmid

SAP020A 100, 94 100 NC_018608.1, NC_013373.1

3

Staphylococcus aureus 08BA02176,

Staphylococcus phage S13' DNA 100, 91 100 NC_018608.1

4 Staphylococcus aureus 08BA02176 100 100 NC_018608.1

5 none - 100 -

6 Anaerococcus prevotii DSM 20548 91 100 NC_013171.1

7 Staphylococcus aureus 08BA02176 100 100 NC_018608.1

8 Staphylococcus aureus 08BA02176 100 100 NC_018608.1

9 Staphylococcus aureus 08BA02176 100 100 NC_018608.1

10 Staphylococcus aureus 08BA02176 100 100 NC_018608.1

12

Staphylococcus aureus 08BA02176,

Staphylococcus phage JD007 100, 94 100 NC_018608.1, NC_019726.1

13 Staphylococcus aureus 08BA02176 100 100 NC_018608.1

15 Staphylococcus aureus 08BA02176 100 100 NC_018608.1

17 Staphylococcus aureus 08BA02176 100 100 NC_018608.1

18 none - 100 -

(a) Spacer regions are numbered according to Figure 2. (b) In the case of spacers with more than one Blastn hesultrit, the hits are ordered from the highest to the lowest % of DNA similarity of their sequences.

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 106

Figure IV.1.3. Schematic diagram and comparative analysis of the clustered regularly

inter-spaced short palindromic region (CRISPR) region in Staphylococcus capitis strain

CR01 SCCmec element with ST398 LA-MRSA strain 08BA02176. (a) Alignment of S. aureus strain 08BA02176 and S. capitis strain CR01 CRISPR regions

with direct repeats (DR) identified, respectively, by light and dark gray diamonds and spacer

sequences numbered sequentially according to their position in the alignment. The CRISPR

locus found in S. capitis strain CR01 with the CRISPR region (CRISPR1), the CRISPR-

associated (cas) genes – cas1, cas2, cmr1-6, cas6 – and the second CRISPR region

(CRISPR*) is also represented. The cas genes are represented by arrows, indicating the

direction of transcription.

(b) The 36 bp direct repeats found in CRISPR1, represented by light gray diamonds in (a), are

indicated in boldface and the corresponding variable spacer sequences, numbered according

to (a).

References:

1. Leekitcharoenphon P, Kaas RS, Thomsen MCF, Friis C, Rasmussen S, Aarestrup

FM. 2012. snpTree - a web-server to identify and construct SNP trees from whole genome

sequence data. Bmc Genomics 13:S6.

2. Kurtz S, Phillippy A, Delcher AL, Smoot M, Shumway M, Antonescu C, Salzberg

SL. 2004. Versatile and open software for comparing large genomes. Genome Biol.

5:R12.

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 107

3. Gouy M, Guindon S, Gascuel O. 2010. SeaView Version 4: A Multiplatform Graphical

User Interface for Sequence Alignment and Phylogenetic Tree Building. Mol Biol Evol

27:221–224.

4. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W GO. 2010. New

Algorithms and Methods to Estimate Maximum-Likelihood Phylogenies: Assessing the

Performance of PhyML 3.0 Syst.Biol. 59(3):307-21.

IV.2. Single-Molecule Sequencing (PacBio) of the Staphylococcus capitis NRCS-A Clone

Reveals the Basis of Multidrug Resistance and Adaptation to the Neonatal Intensive

Care Unit Environment

IV.2.1 Abstract

The multi-resistant Staphylococcus capitis clone NRCS-A has recently been described as a

major pathogen causing nosocomial, late-onset sepsis (LOS) in preterm neonates worldwide.

NRCS-A representatives exhibit an atypical antibiotic resistance profile. Here, the complete

closed genome (chromosomal and plasmid sequences) of NRCS-A prototype strain CR01 and

the draft genomes of three other clinical NRCS-A strains from Australia, Belgium and the

United Kingdom are annotated and compared to available non-NRCS-A S. capitis genomes.

Our goal was to delineate the uniqueness of the NRCS-A clone with respect to antibiotic

resistance, virulence factors and mobile genetic elements. We identified 6 antimicrobial

resistance genes, all carried by mobile genetic elements. Previously described virulence genes

present in the NRCS-A genomes are shared with the six non-NRCS-A S. capitis genomes.

Overall, 63 genes are specific to the NRCS-A lineage, including 28 genes located in the

methicillin-resistance cassette SCCmec. Among the 35 remaining genes, 25 are of unknown

function, and 9 correspond to an additional type I restriction modification system (n = 3), a

cytosine methylation operon (n = 2), and a cluster of genes related to the biosynthesis of

teichoic acids (n = 4). Interestingly, a tenth gene corresponds to a resistance determinant for

nisin (nsr gene), a bacteriocin secreted by potential NRCS-A strain niche competitors in the

gut microbiota. The genomic characteristics presented here emphasize the contribution of

mobile genetic elements to the emergence of multidrug resistance in the S. capitis NRCS-A

clone. No NRCS-A-specific known virulence determinant was detected, which does not

support a role for virulence as a driving force of NRCS-A emergence in NICUs worldwide.

However, the presence of a nisin resistance determinant on the NRCS-A chromosome, but not

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 108

in other S. capitis strains and most coagulase-negative representatives, might confer a

competitive advantage to NRCS-A strains during the early steps of gut colonization in

neonates. This suggests that the striking adaptation of NRCS-A to the NICU environment

might be related to its specific antimicrobial resistance and also to a possible enhanced ability

to challenge competing bacteria in its ecological niche..

IV.2.2 Introduction

Coagulase-negative staphylococci (CoNS) are common commensals of the human skin and

mucosa and are also opportunistic pathogens responsible for infections associated with

indwelling medical devices and bloodstream infections (Otto, 2009). Among

CoNSs, Staphylococcus epidermidis is the most prevalent species and is classically involved

in nosocomial bacteremia in patients with co-morbidities including very low-birth weight

preterm infants (Otto, 2009). However, the Staphylococcus capitis has also been incriminated

in sepsis throughout the world in neonatal intensive care units (NICUs) (Van Der Zwet et

al., 2002; Venkatesh et al., 2006; D'mello et al., 2008; Rasigade et al., 2012; Boghossian et

al., 2013; Cui et al., 2013). We recently reported that a group of closely related multidrug-

resistant (MDR) S. capitis strains belonging to the same clone, named NRCS-A, were present

in most French NICUs but absent in the other pediatric or adult ICUs (Rasigade et al., 2012).

In subsequent work, we demonstrated the dissemination of NRCS-A strains in distant NICUs

throughout the world (Butin et al., 2016). This dissemination is of major concern because of

the extensive drug resistance of NRCS-A as well as its ability to become highly endemic in

some NICUs, representing up to 40% of all bacteremia cases (Stoll et al., 2002, 2005;

Rasigade et al., 2012). Due to the presence of the type V-related staphylococcal chromosome

cassette mec (SCCmec), all S. capitis NRCS-A strains are resistant to beta-lactams and exhibit

reduced susceptibility to other antimicrobial agents in common use in NICUs, including

resistance to aminoglycosides and resistance or heteroresistance to vancomycin (Venkatesh et

al., 2006; Rasigade et al., 2012). Overall, the worldwide diffusion of a multidrug-resistant S.

capitis clone that is highly adapted to NICU antibiotic selective pressure raises questions

about the potential genetic support of its epidemiological success.

Few genome sequences of S. capitis are publicly available to date. In addition, only a single

study using the genome of a S. capitis isolate collected from a bloodstream infection in an

adult has reported the genomic comparison of virulence factors between S. capitis and S.

epidermidis (Cameron et al., 2015). Considering the specific importance NRCS-A in the

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 109

NICU setting and its international dissemination, we present here the first closed genome

sequence of the French NRCS-A prototype strain CR01, a comparison of the whole-genome

sequences (WGS) of three other NRCS-A strains collected from distant countries (Australia,

Belgium, the United Kingdom), and a description of the genomic features of this NRCS-A

clone.

IV.2.3 Methods

Genome sequencing and assembly

The four strains of S. capitis, CR01, CR03, CR04, and CR05, used in this study were part of a

previously published collection, with all strains being of the international S. capitis NRCS-A

clone (Butin et al., 2016). The strains were isolated from blood cultures of preterm infants

diagnosed with neonatal sepsis in Neonatal Intensive Care Units (NICUs) from four different

countries: France (isolate CR01), Belgium (isolate CR03), Australia (isolate CR04) and the

United Kingdom (isolate CR05) (for further details see Supplementary Data).

Initially, whole-genome pyrosequencing (454 Life Sciences/Roche) was performed for all 4

isolates, as previously reported (Lemriss et al., 2014, 2015). Single-molecule real-time

(SMRT) sequencing was then performed for strain CR01 to obtain a closed reference genome

for this clone (Supplementary Data).

Sequencing for de novo assembly was performed using PacBio RS II (Menlo Park, CA,

USA). High molecular weight DNA was sheared in a Covaris g-TUBE (Covaris, Woburn,

MA, USA) to obtain 20 kb fragments. After shearing, the DNA size distribution was checked

using a Fragment Analyzer (Advanced Analytical Technologies, Ames, IA, USA), and 5 μg

of the sheared DNA was used to prepare a SMRTbell library with PacBio SMRTbell

Template Prep Kit 1 (Pacific Biosciences, Menlo Park, CA, USA) according to the

manufacturer's recommendations. The resulting library was size selected using a BluePippin

system (Sage Science, Inc. Beverly, MA, USA) for molecules larger than 11 kb. The

recovered library was sequenced using 1 SMRT cell with P6-C4 chemistry and MagBeads

with a PacBio RSII system (Pacific Biosciences, Menlo Park, CA, USA) at 240 min movie

length.

Based on the SMRT cell sequencing, we generated 50,876 post-filter polymerase reads with

an average read length of 15.6 kb and an N50 read length of 21.1 kb. The average coverage

was 265X; for de novo assembly, the PacBio module “RS_HGAP_Assembly.2” in SMRTpipe

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 110

version v2.3.0 was used for continuous long reads (CLR) after polishing and error correction

with Quiver, as described previously (Chin et al., 2013). DNA methylation was determined

using the RS_Modification_and_Motif_Analysis protocol within SMRT Portal v2.30, with a

standardized in silico false positive error of ~1%. Only motifs with a mean modification

quality value (QV) >50 and a mean coverage of >100X were validated as being modified

(https://github.com/PacificBiosciences/Bioinformatics-Training/wiki/Methylome-Analysis-

Technical-Note). Two polished contigs, one corresponding to the chromosome and the other

to the plasmid, were obtained. Circularization of both contigs was achieved by manual

comparison and removal of regions of overlaps.

Computational analysis

Automatic syntactic and functional annotation of the closed, reference genome of strain CR01

[EMBL accession number: LN866849 (chromosome) and LN866850 (plasmid)] was

performed using the MicroScope platform pipeline (Vallenet et al., 2006, 2013). The

annotation of the draft genomes of strains CR03 (EMBL accession number: CVUF01000001-

CVUF01000031), CR04 (EMBL accession number: CTEM01000001 CTEM01000038) and

CR05 (EMBL accession number: CTEO01000001-CTEO01000039) were also performed

using the MicroScope platform pipeline, as published previously (Lemriss et al., 2014).

Visual inspection and manual curation were carried out using the MaGe platform and BLAST

searches against NCBI databases.

Virulence factors were identified using the Virulence Factors database

(VFDB; http://www.mgc.ac.cn/VFs/, Chen et al., 2012) and tblastn (using the ncbi-blast-

2.2.27+ suite, Camacho et al., 2009) searches against in-house databases of known virulence

genes of staphylococci.

Prophage regions were identified using the PHAST server (http://phast.wishartlab.com, Zhou

et al., 2011). The predicted results were confirmed using the MaGe platform.

For comparison, we obtained publicly available assemblies for six additional whole-genome

sequences of S. capitis: strains QN1 (NCBI Ref. Seq.: NZ_AJTH00000000.1), VCU116

(NCBI Ref. Seq.: NZ_AFTX00000000.1), SK14 (NCBI Ref. Seq.: NZ_ACFR00000000.1),

LNZR-1 (NCBI Ref. Seq.: NZ_JGYJ00000000.1), C87 (NCBI Ref. Seq.:

NZ_ACRH00000000.1), and AYP1020 (NCBI Ref. Seq.: NZ_CP007601.1). All six genomes

were aligned against the closed genome of isolate CR01 using Mauve Progressive v.2.3.1

(Darling et al., 2010) with default settings.

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 111

Resistance genes were identified by a combination of ResFinder v.2.1 (Kleinheinz et

al., 2014) and tblastn searches using the complete, curated Antibiotic Resistance Proteins

database (multifasta file) available at the Comprehensive Antibiotic Resistance Database

(CARD) (McArthur et al., 2013). For ResFinder, cutoffs of 80% minimum length and 90%

identity were used to search for resistance genes in CR03, CR04, and CR05 assemblies

previously performed against the reference CR01 using Mauve Progressive to determine their

location and genomic context. For detection of resistance genes using the CARD complete,

curated Antibiotic Resistance Proteins database, tblastn searches against a database composed

of the four genomes of strains CR01, CR03, CR04, and CR05 were performed.

Genes specific to the NRCS-A clone were identified using the MaGe platform “Gene

Phyloprofiler” tool (Vallenet et al., 2013) and the four annotated genomes of NRCS-A and

public S. capitis genomes. Briefly, genomes were compared in terms of gene content using

pre-computed homologies and synteny groups. Pairwise comparisons between predicted

protein sequences of the studied genome and the proteins of another genome allowed

computation of ranked hits and determination of bidirectional best hits (BBH) (for each

protein, the three best hits were retained). Putative orthologous relationships between two

genomes were defined as gene couples satisfying the BBH criterion and an alignment

threshold for homology set as a minimum of 50% sequence identity along 80% of the length

of the smallest protein. Mauve alignments were also used to complement the genomic context,

followed by manual curation of the putative genes exclusively found in only the four NRCS-

A genomes.

Insertion sequences (IS) in the genomes were identified using the ISfinder analysis tool

(Siguier et al., 2006). Both blastn and blastp queries were performed with default settings.

Matches with an e-value smaller than 0.5 were manually curated. To confirm whether a given

IS position was conserved in the other genomes analyzed, the closed genome of isolate CR01

was aligned with the three other NRCS-A genomes and with the six public genomes using

Mauve Progressive v.2.3.1 (Darling et al., 2010) with default settings. ORFs within

immediate proximity of conserved IS loci in the NRCS-A genomes were compared with the S.

capitis reference genome to check for potential alterations in coding sequences, using both

Mauve Progressive and Mage platform. genomic islands (GIs) were predicted using

IslandViewer 3 (Dhillon et al., 2015) and confirmed by alignment with the three NCRS-A

genomes and the six public S. capitis genomes using Mauve Progressive. IS insertions within

GIs were predicted as mentioned above. NRCS-A-specific GIs were searched in the NCBI

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 112

database using megablast (Camacho et al., 2009) query, limiting to the Staphylococcus taxon

(taxid: 1279). Published GIs from reference genomes were searched against Staphylococcus

aureus Mu50 (NCBI Reference Sequence: NC_002758.2), COL (NCBI Reference

Sequence: NC_002951.2), MW2 (NCBI Reference Sequence: NC_003923.1), N315 (NCBI

Reference Sequence: NC_002745.2), FPR3757 (NCBI Reference Sequence: NC_007793.1)

and S0385 (NCBI Reference Sequence: NC_017333.1), and S. epidermidis RP62A (NCBI

Reference Sequence: NC_002976.3) using the Mage platform [15]. Syntonomes of more than

3 ORFs and with identity greater than 33% were considered to be GIs.

Investigation of nsr gene presence in clinical bacterial strains

A panel of 15 strains (Table IV.2.1) comprising clinical strains of S. capitis (NRCS-A and

non-NRCS-A) were used for nisin susceptibility testing. All staphylococcal species were

originally isolated from blood, and species assignment was determined using Matrix-Assisted

Laser Desorption/Ionization Time of Flight Mass Spectrometry (MALDI-TOF Vitek MS,

Biomerieux, France). After isolation, the strains were cultured on Horse Blood Agar

(Biomerieux) and then stored at −80°. Testing for susceptibility to nisin was performed using

the disk diffusion test adapted from EUCAST1. Briefly, nisin solutions were prepared using

2.5% nisin powder (Sigma Aldrich, USA) according to a previously described protocol (Piper

et al., 2009). Sterile paper disks (Thermofisher Diagnostics, France) were soaked with 30 μg

of nisin solution. After an overnight incubation at 36°C on Horse blood Agar (Biomerieux,

France), a 0.5 McF was seeded on Mueller Hinton agar (MHE) plates (Biomerieux, France).

A disk containing 30 μg of nisin was placed in the middle of the plate. The diameter of the

inhibition zones was measured after overnight incubation of the inoculated MHE plates at

36°C. The average diameter of inhibition and SEM were determined from four independent

experiments.

PCRs for detecting the nsr gene were performed using consensus primers: pF–word-5′

GGAGATATGGGACCTATGATTGCA 3’ and pR-word-

5’GCTGTAAkTTCwCCkGAACTkGC 3′. These primers were designed based on alignment

of the nsr gene sequence found in strain CR01 (S. capitis clone NRCS-A) and sequences

retrieved from NCBI after a blastn (ref) search for homologous sequences in staphylococcal

WGS genomes [S. hyicus ATCC 11249 (acc. num. CP008747), Staphylococcus sp. TE8 (acc.

num. NZ_JMGB00000000.1), S. epidermidis MC28 (acc. num. NZ_ATCZ00000000.2), S.

epidermidis VCU128 (acc. num. NZ_AHLI00000000.1)]. PCR amplification was conducted

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 113

in a final volume of 25 μL, with 2.0 μL bacterial DNA (QuickExtract kit, Qiagen), 2.5 μL 10x

Reaction Buffer, 0.75 μL 50 mM MgCl2, 1 μL 10 mM forward primer, 1 μL 100 mM reverse

primer, 4 μL 5 mM dNTPs, 1 μL each primer and 0.125 μL Taq polymerase (Eurobio,

France). The cycling parameters were as follows: (i) initial denaturation for 3 min at 95°C; (ii)

34 cycles, with 1 cycle consisting of 30 s at 95°C, 60 s at 60°C, and 90 s at 72°C; and (iii) a

final extension for 10 min at 72°C.

Table IV.2.1. Bacterial strains used in the nisin susceptibility test.

Species NRCS-A clone Strain Setting Country nsr gene

SC yes CR01 NICU FR +

SC yes CR03 NICU BE +

SC yes CR04 NICU AUS +

SC yes CR05 NICU UK +

SC yes CR07 NICU FR +

SC yes BC69 NICU South K +

SC yes AQ62 NICU NO +

SC yes AW77 NICU NZ +

SC yes BI76 NICU USA +

SC no AB51 ICU AUS −

SC no CR02 ICU FR −

SC no AR22 ICU DK −

SC no AY18 ICU GR −

SC no AZ72 ICU Sing −

SC no BA24 ICU USA − SC, Staphylococcus capitis; FR, France; BE, Belgium; UK, United Kingdom; AUS, Australia; South

K, South Korea; NO, Norway; NZ, New Zealand; USA, United States of America; DK, Denmark; GR,

Greece; Sing, Singapore; NICU, neonatal intensive care unit; ICU, intensive care unit (adults).

IV.2.4 Results

WGSs of four strains belonging to S. capitis clone NRCS-A and originating from NICUs in

four distant countries were obtained to investigate lineage-specific virulomes, resistomes, and

mobilomes as well as the presence of unshared genes using 454 pyrosequencing technology,

as reported previously (Lemriss et al., 2014, 2015). Depending on the isolate, assembly of the

draft genomes produced 26 to 39 contigs. Re-sequencing of strain CR01 using SMRT

technology (PacBio) allowed for the generation of closed complete sequences for the

chromosome and the single plasmid that was subsequently used to produce scaffolds for the

three remaining WGSs.

The length of CR01's chromosome is 2,522,871 bp and exhibits a low G + C content

(33.02%), as is expected for staphylococci. We identified and annotated 2419 protein-coding

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 114

regions, 19 rRNAs, 62 tRNAs, 34 ncRNAs (including RNAIII), and 20 transposases

associated with insertion sequence elements and transposons. Of note, gaps (identified in the

draft genome assemblies of the four NRCS-A isolates (based on 454 pyrosequencing))

frequently occur within the vicinity of transposases, suggesting that some of the 454 short

read assemblies were unable to bridge the gaps associated with repetitive genomic elements.

These data clearly emphasize the suitability of third-generation sequencing technologies, such

as PacBio SMRT, for obtaining fully defined de novo assemblies and, thus, for overcoming

the issue of both local and global repeats (Koren and Phillippy, 2015). The genomic

characteristics of the NRCS-A isolates tested in this study are summarized in Table IV. 2.2.

Tables IV.2.2. General genomic features of S. capitis strain CR01 compared with another

three WGS NRCS-A genomes.

Features S.capitis strain

CR01(Fr)

S.capitis strain CR03

(Be)

S.capitis strain

CR04 (Aus)

S.capitis strain CR05

(UK)

GC% Content 33.02 32.81 32.80 32.84

Nb of phages 1 1 1 3

Nb of plasmids 1 1a 1a 0

Nb and type of Insertion

sequences

(nb on chromosome+ nb on

plasmid)

IS256: 10+0

IS1272: 3+1

IS256: 1+0b

IS1272: 1+0

IS256: 1+0b

IS1272: 1+0

IS256: 1b

IS1272: 0

IS431mec-like: 2+3 IS431mec-like: 2+4 IS431mec-like: 2+0 IS431mec-like: 2 aPutative plasmid, no definitive data about circularization. bInsertion sequence isolated in a small contig, indicating probable multiple insertions in the complete genome.

Virulome

The presence of virulence-associated genes in the closed genome of strain CR01 and

subsequently the draft genomes of strains CR03 (Be), CR04 (Aus), and CR05 (UK) were

inferred by comparison with known virulence factors previously reported for S. aureus, S.

epidermidis, and S. haemolyticus using the VFDB database (Chen et al., 2012). The findings

were augmented with BLAST searches of well-characterized staphylococcal virulence factors

and key regulators (Table IV.2.3). Comparison of the four NRCS-A genomes with the six

published genomes of non-NRCS-A S. capitis, including QN1, VCU116, SK14, LNZR-1,

C87, and AYP1020 strains, showed that none of the known staphylococcal virulence genes

are exclusively carried by the NRCS-A clone.

Interestingly, the virulome of the NRCS-A S. capitis genome was quite similar to that of S.

epidermidis RP62A, including the icaABDCR and capABC biofilm-related operons, Clp

proteases and multiple copies of PSM beta type 1b in tandem (75% aa identity to PSMbeta1b

of strain RP62) and one PSM alpha (59% aa identity) (Otto, 2012). All PSMs were found in

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 115

the same genetic environment as in the S. epidermidis RP62A genome, with conservation of

upstream and downstream genes.

As previously observed for the fully closed S. epidermidis RP62a and S. epidermidis ATCC

12228 genomes (Zhang et al., 2003; Gill et al., 2005), no S. aureus toxins, except beta- and

delta-hemolysins, were identified in any of the 10 S. capitis genomes (four NRCS-A and six

public non-NRCS-A). Similarly, none of the genes associated with secretion systems

(esxA, esxB, esaA, esaB, esaC, essA, essB, and essC) or S. aureus serine proteases (splA, B,

C, D, E, and F) are present in the S. capitis genomes.

Table IV.2.3. Comparison of virulence factors in S. capitis NRCS-A, non-NRCS-A, and S.

epidermidis after exclusion of virulence factors present only in S. aureus.

S. epidermidis S.capitis NRCS-A clone S.capitis non NRCS-A

Function Gene ATCC

12228 RP62A

CR01

(fr) CR03 CR04 CR05 SK14

VCU11

6 C87 QN1 LNZR-1

Adherence atl + + + + + + + + + + +

ebh + + + + + + + + + + +

ebp + + + + + + + + + + +

icaR 0 + + + + + + + + + +

icaA 0 + + + + + + + + + +

icaD 0 + + + + + + + + +

icaB 0 + + + + + + + + + +

icaC 0 + + + + + + + + + +

sdrF + + 0 0 0 0 0 0 0 0 0

sdrG + + 0 0 0 0 0 0 0 0 0

sdrH + + + + + + + + + +

Exozymes sspB + + 0 0 0 0 0 0 0 0 0

sspC 0 + 0 0 0 0 0 0 0 0 0

lip + + + + + + + + + + +

geh + + + + + + + + + + +

sspA + + 0 0 0 0 0 0 0 0 0

nuc + + + + + + + + + + +

Host immune

Invasion capABC + + + + + + + + + + +

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 116

Toxins hlb + + + + + + + + + + +

hld + + + + + + + + + +

hemolysin 0 + 0 0 0 0 + + 0 + 0

hlIII + + + + + + + + + + +

Proteases ClpP + + + + + + + + + + +

ClpB + + + + + + + + + + +

ClpC + + + + + + + + + + +

ClpX + + + + + + + + + + +

Phenol Soluble

Modulins PSM α + + + + + + + + + + +

PSM β1a + + 0 0 0 0 0 0 0 0 0

PSM β1B + + + + + + + + + + +

PSM β2 + + 0 0 0 0 0 0 0 0 0

PSM β3 + + 0 0 0 0 0 0 0 0 0

PSM δ + + + + + + + + + + +

PSM ε + + 0 0 0 0 0 0 0 0 0

PSM-mec + + 0 0 0 0 0 0 0 0 0

Esterases esterase1 + + + + + + + + + + +

esterase2 + + + + + + + + + + +

HTH

transcription

factors

associated with

virulence

SarA + + + + + + + + + + +

SarR + + + + + + + + + + +

SarV + + + + + + + + + + +

SarX + + + + + + + + + + +

SarZ + + + + + + + + + + +

MgrA + + + + + + + + + + +

Rot + + + + + + + + + + +

The presence of virulence genes is indicated by the “+” sign

Resistome

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 117

Several antibiotic resistance-associated genes were identified and correlated with the specific

resistance phenotype previously reported for the NRCS-A clone (Rasigade et al., 2012;

Table IV.2.4). All are located on mobile genetic elements (MGEs). Resistance to

aminoglycosides is related to the bifunctional aminoglycoside-modifying gene aacA-aphD,

which is carried on the transposon Tn4001 (GenBank accession no. AB682805.1; Lyon et

al., 1984). Resistance to methicillin is due to the presence of a composite SCCmec-

SCCcad/ars/cop cassette exclusively present in the NRCS-A clone, as recently published by

our team (Martins Simões et al., 2013). Genomic comparison between the four NRCS-A

strains showed that this mobile element is nearly identical: all ORFs are conserved (100% aa

homology), and the few nucleotide sequence variations occur only in the CRISPR repeat

region, as is expected for these regions. As previously reported (Martins Simões et al., 2013),

no other antibiotic resistance genes were detected for this composite SCC element. Finally,

the plasmidic bla operon, coding for blaZ beta-lactamase and its regulators, is present in all

NRCS-A strains, except strain CR05 (UK).

With regard to other antimicrobial families, for which variability in resistance profiles have

been observed among NRCS-A isolates, phenotypic antimicrobial susceptibility testing

matched the specific resistance gene contents of each NRCS-A strain. Plasmidic msrA

and tetK genes, respectively involved in erythromycin resistance (with a negative D-test) and

tetracycline resistance, were only identified in strain CR04 (Australia). In strain CR05 (UK),

the gene far1, which is responsible for fusidic acid resistance, is carried by a putative phage.

Tables IV.2.4. Genomic profiles of antibiotic resistance for clone NRCS-A strains from four

different countries.

Antibiotic gene Strains Genomic context

CR01

(Fr)

CR03

(Be)

CR04

(Aus)

CR05

(UK)

Penicillin BlaZ + + + − Plasmid

Methicillin mecA + + + + Chromosome

Tetracycline tetK − − + − Plasmid*

Aminoglycosides aac(6′ )-aph(2′′) + + + + Chromosome

Macrolide, Lincosamide and Streptogramin B msr(A) − − + − Plasmid*

Fusidic acid far/fusB − − − + Phage (chromosome)*

All antibiotic resistance genes were found in MGEs. Putative regions in the draft genomes are indicated by an *

Mobile elements

As mentioned previously, the shortest circular sequence obtained by SMRT for strain CR01

corresponds to a plasmid of 26.140 bp (GC content of 29.25%). It harbors 35 ORFs, including

(i) the bla operon coding for penicillinase resistance to penicillins (see above) and (ii) copper

resistance-related genes such as copZ, copA, and csoR (copper transcriptional repressor;

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 118

Figure .1). Genome comparison of strain CR01's plasmid with the three other NRCS-A draft

genomes revealed that the plasmid is not conserved in all NRCS-A strains (Figure IV.2.1). In

strain CR03 (Belgium), one contig presents 31 of the 35 ORFs identified on the CR01

plasmid. Conversely, in strain CR04 (Australia), only 9 of the 35 ORFs (corresponding to

the blaZRI operon and copper resistance operon) were detected in a contig corresponding to a

putative plasmid. Finally, no putative plasmid was detected in strain CR05 (UK).

Figure IV.2.1. Comparison of the genetic content of the strain CR01 plasmid with the

draft genomes of the other three NRCS-A strains. Open reading frames (ORFs) are shown

as arrows indicating the direction of transcription. Homologous gene clusters are indicated by

a light gray shadow connecting ORFs present in distinct plasmid sequences. Light gray

arrows represent unknown proteins, unless specified otherwise. Arrows with dotted lines

represent partial or truncated ORFs. Antibiotic resistance genes are colored with a gray

gradient; genes associated with resistance to heavy metals are colored in dark gray.

Abbreviations: tnp, transposase; copZ, copper insertion chaperone and transporter

component; copA, copper transporter ATPase; csoR, copper-sensing transcriptional

repressor; czcD, potassium/proton-divalent cation antiporter; rep, replication-associated

family protein; repA, replication-associated protein RepA; blaZ, beta-lactamase resistance

gene; blaR, regulatory protein BlaR1; blaI, penicillinase repressor; mntH, divalent metal

cation transporter MntH, tetK, tetracycline resistance gene.

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 119

One intact prophage region was identified in all four NRCS-A genomes. This region shows

100% aa identity to the genomes of strains CR01, CR03, and CR04, but it is degenerate in

CR05 (Figure (Figure2).2). Moreover, this phage exhibits strong homology to a phage present

in strain VCU116 [57.1, 90.2, 76.2% aa homology for regions 1, 2 and 3, respectively

(Figure IV.2.2) and less than 30% homology with phage Staphy_StB20_(NCBI Ref.

Seq. NC_019915), the closest phage found in the NCBI database. Of note, two additional

incomplete prophage regions were also detected in strain CR05.

Figure IV.2.2. Comparison of the genetic content of the strain CR01 intact prophage

present in the other three draft genomes of NRCS-A strains. Prophage prediction was

performed using PHAST software; cR01's prophage is divided into three regions according to

the degree of conservation compared to the other strains. The mean percent of aa identity in

each region is indicated, and a gray gradient is also used to represent the percent similarity.

Nineteen distinct insertion sequence (IS) elements, clustering into three distinct families (type

IS256, n = 4; type IS1272, n = 5; IS431mec, n = 10), were identified in the CR01 genome.

The presence of type IS256 was confirmed in all four NRCS-A strains, with two IS256

elements being associated with the aminoglycosides resistance gene aacA-aphD (′aac(6′)-

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 120

aph(2″) on transposon Tn4001. Type IS1272 was also found in strains CR03 and CR04 but

not in strain CR05, and their genomic locations are not conserved. Two IS431mec cassettes

are present in all NRCS-A genomes, as they are carried within the SCCmec-

SCCcad/ars/cop element that is specific to and conserved among the NRCS-A lineage

(Martins Simões et al., 2013).

Finally, other GIs (n = 5) were predicted for CR01 (Table IV. 2.2) and found in the CR03,

CR04, and CR05 strains. However, only one was found exclusively in the NRCS-A lineage.

This GI (bp position: 150,780–158,140 in the strain CR01 genome) contains six ORFs: one

putative phosphoglycolate phosphatase, one conserved protein of unknown function and three

pseudogenes of phage proteins (bp position: 151,470–152,238). Unexpectedly, two of these

pseudogenes present 40 and 46.5% aa identity to Listeria monocytogenes phage B025 protein

gp27 and the third pseudogene presents 60.6% aa identity to L. monocytogenes phage B025

protein gp28. Both gp27 and gp28 proteins have unknown functions.

Methylome and restriction modification systems

SMRT technology (PacBio) allows for genome-wide detection of modified nucleotides based

on the rate at which DNA polymerase incorporates bases during sequencing (Flusberg et

al., 2010, Nat. Methods; Roberts et al., 2013). Analysis of polymerase kinetic profiles in strain

CR01 identified 1333 methylated positions (Table IV.2.S2) including 94% (n = 1253)

corresponding to adenine methylations (m6A) and 0.006% (n = 8) to cytosine methylations

(m4C). The adenine modifications observed correlate with the presence of two adenine

restriction-modification systems (hsdMSR 1 pos: 476,473–482,360 bp; hsdMSR 2 pos:

686,750–691,866 bp) in the strain CR01 genome, whereas the presence of an mcrBC 5-

methylcytosine restriction system (bp position 487,030–492,276) correlates with the cytosine

modifications detected. Interestingly, the latter is associated in tandem with the specific

additional hdsMSR 1 operon located immediately after the SCCmec-SCCcad/ars/cop element

(see above).

NRCS-A clone specific genes

Comparison of the closed genome of strain CR01 with the draft genomes of the three other

NRCS-A genomes and with the six public non-NRCS-A genomes revealed a unique set of 63

genes present exclusively in the NRCS-A clone genome (Table IV.2.S1). Of these, 28 ORFS

are carried by the composite SCCmec-SCCcad/ars/cop mobile element, which is related to the

acquisition of methicillin resistance (mecA gene). Interestingly, within this cassette, the

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 121

CRISPR element is specific to the NRCS-A lineage (Martins Simões et al., 2013). Of note,

both the clone-specific cassette (28 genes) and its genetic environment (downstream and

upstream regions) are fully conserved in the four NRCS-A strains, which confirmed that the

four isolates belong to the same clonal population, even though they were isolated from

distant countries/continents. Indeed, it is highly unlikely that the same SCCmec element

(100% identity) could be acquired in four independent events in four distant countries.

Among the 35 remaining genes found exclusively in the NRCS-A lineage, 25 are of unknown

function, and 10 correspond to the following: (i) an additional type I restriction modification

system (hsdMSR, n = 3 genes), (ii) a cytosine methylation operon (mcrBC, n = 2), (iii) a

cluster of four genes known to be involved in the biosynthesis of teichoic acids [ispD (2-C-

methyl-D-erythritol 4-phosphate cytidylyltransferase), tarJ (ribitol-5-phosphate

dehydrogenase), tarK (Glycosyl glycerophosphate), and tagF (CDP-glycerol

glycerophosphotransferase), n = 4]. Of note, the tenth gene encodes a 316 aa protein

presenting 41% aa homology with the determinant for resistance to nisin (nsr gene) that is

present in some Lactococcus lactis strains (Froseth and McKay, 1991; Liu et al., 2005) and

which shows protease activity. Contrary to the plasmidic localization of the nsr gene in nisin-

resistant L. lactis strains, the nsr gene in the NRCS-A clone is located on the chromosome

(position: 521,747–522,694 bp) immediately upstream from the potassium (K+)

transporter kdpEDABC operon conserved in all S. capitis isolates and downstream from the

four teichoic acid biosynthesis genes (ispD, tarJ, tarK, and tagF; see above). No IS or

transposon-like region was identified near the nsr gene.

Phenotypic assay of clone NRCS-A nisin resistance

To assess functional expression of the nisin resistance gene (nsr) found exclusively in the

NRCS-A clone, we performed a disk diffusion test with nisin-charged disks using a collection

of S. capitis strains, including nine strains belonging to the NRCS-A clone and six nsr-

negative, non-NRCS-A strains. The S. capitis strains belonging to the NRCS-A clone

presented significantly lower nisin inhibition zones (mean of four independent measurements

± SEM: 8.81 mm ± 1.31) than the strains isolated from adults that do not carry the nsr gene

(16.5 ± 1.5; the Student t-test, p < 0.001 vs. 8.8 mm ± 1.3 in NRCS-A). This confirms that

the nsr gene found exclusively in S. capitis strains belonging to the neonatal NRCS-A clone is

functional and confers resistance to nisin. Nonetheless, it is known (i) that S. aureus (SA) can

modulate its resistance to nisin and other small antibacterial peptides via two-component

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 122

systems (TCSs) GraSR, NsaSR, BraSR in association with ABC transporters (Howden et

al., 2010; Blake et al., 2011; Falord et al., 2011; Kolar et al., 2011; Kawada-Matsuo et

al., 2013) and (ii) that SA strains resistant or heteroresistant to vancomycin (VISA and

hVISA) usually present increased cell wall thickening (Cui et al., 2003). The same

mechanisms have been observed in L. lactis resistant to nisin (Kramer et al., 2006; Shin et

al., 2016). Thus, to assess whether the resistance to nisin observed in the NRCS-A strains is

due exclusively to expression of the nsr gene and not to a cell wall-thickening adaptation,

complementary experiments are required using nsr+/nsr− isogenic isolates. Such analyses are

beyond the scope of the present paper.

IV.2.5 Discussion

The NRCS-A clone is of major interest due to its worldwide high dissemination in NICUs and

its prevalence as an agent of neonatal sepsis in preterm newborns (Butin et al., 2016).

Comparison between the complete genome of the prototype strain belonging to the S.

capitis NRCS-A clone (strain CR01, France) with the draft genomes of clinical S.

capitis isolates belonging or not to the NRCS-A clone revealed the presence of multiple

MGEs mediating the atypical antibiotic resistance profile of this clone. These data confirm (i)

the ability of the NRCS-A clone to adapt to the specific selective pressure of the antibiotics

used in NICUs and (ii) emphasize the ability of WGS to provide accurate predictions of the

resistance phenotypes of staphylococci and to become a promising alternative for culture

methods.

Based on genomic comparisons using previously characterized staphylococcal virulence

genes, the NRCS-A virulome is highly similar to that of other non-NRCS-A S. capitis as well

as S. epidermidis RP62A strains, which suggests that the success of this clone in neonates is

likely not due to increased virulence. Nonetheless, we identified the exclusive presence of a

gene encoding a functional nisin resistance (nsr) gene in the NRCS-A lineage that is seldom

found in staphylococci.

Nisin a 34 aa antimicrobial peptide produced by a group of gram positive

Lactococcus and Streptococcus species (Shin et al., 2016), is active against a wide range of

gram-positive bacteria, including staphylococci. Its mode of action is dual, involving (i)

inhibition of cell wall biosynthesis (transglycosylation step), as it binds to and sequesters lipid

II from its functional location, and (ii) pore formation (Wiedemann et al., 2001; Peschel and

Sahl, 2006; Egan et al., 2016). Nisin has been described as a key player of the gut barrier, and

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 123

it is widely used as food preservative due to its potent bactericidal activity. Moreover, it has

been shown that (i) expression of the nsr gene, identified in Streptococcus agalactiae, in L.

lactis not producing nisin induces resistance to nisin and (ii) the presence of human nisin-

producing lactic acid bacteria in the gut reduces intestinal colonization by vancomycin-

resistant enterococci (Millette et al., 2008).

Taken together, these data and our results strongly suggest that nisin resistance might be

responsible for the potential increase in the ability of the NRCS-A clone to establish itself as

part of the initial microflora of neonates, in which the Lactococcus genus is one of the

dominant bacterial taxa (Park et al., 2005; Morelli, 2008). Expression of the NSR peptidase

might enable NRCS-A isolates to establish themselves in the gut of neonates and also to

colonize it and survive longer than nisin-susceptible bacteria. This may explain the over-

representation of these isolates in sepsis processes, either through direct translocation in blood

(Taft et al., 2015) or via colonization of indwelling devices. Although it remains unknown

how S. capitis NRCS-A strains are able to translocate into the bloodstream of infants, it is

hypothesized that the entry point might be the digestive tract, which is immature in very

preterm infants (Taft et al., 2015). Further studies are needed to fully characterize the

digestive microflora of very low-weight preterm-infants and its potential impact on the

selection of and the fitness advantage to NRCS-A isolates.

IV.2.6 Author contributions

PM: work, study design, data analysis, and manuscript preparation. HL: data analysis and

manuscript preparation. YD: data analysis, work, and manuscript preparation. SL: work and

manuscript preparation. JR, SA, AI, and SE: manuscript preparation. MB and FL: study

design and manuscript preparation.

IV.2.7 Funding

The present work was financed by the French Ministry of Health and the French Institute for

Public Health Surveillance (INVS) - Santé publique France in the framework of the National

Reference Center of Staphylococci and by the grant ING20111223510 from the Fondation

pour la Recherche Medical (FRM).

IV.2.8 Acknowledgments

We would like to thank Michele Bes and Helene Meugnier at the National Reference Center

for Staphylococci in Lyon (France), and our colleagues at the National Reference Center of

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 124

Staphylococci in Belgium (Olivier Denis), in the United Kingdom (Angela Kearns) and in

Australia (Margaret Deighton).

IV.2.9 References

1. Blake K. L., Randall C. P., O'Neill A. J. (2011). In vitro studies indicate a high

resistance potential for the lantibiotic nisin in Staphylococcus aureus and define a

genetic basis for nisin resistance. Antimicrob. Agents Chemother. 55, 2362–2368.

10.1128/AAC.01077-10.

2. Boghossian N. S., Page G. P., Bell E. F., Stoll B. J., Murray J. C., Cotten C. M., et al. .

(2013). Late-onset sepsis in very low birth weight infants from singleton and multiple-

gestation births. J. Pediatr.162, 1120–1124, 1124.e1. 10.1016/j.jpeds.2012.11.089.

3. Butin M., Rasigade J.-P., Simões P. M., Meugnier H., Lemriss H., Goering R. V., et

al. . (2016). Wide geographical dissemination of multiresistant Staphylococcus

capitis NRCS-A clone in neonatal intensive-care units. Clin. Microbiol. Infect. 22, 46–

52. 10.1016/j.cmi.2015.09.008.

4. Camacho C., Coulouris G., Avagyan V., Ma N., Papadopoulos J., Bealer K., et al. .

(2009). BLAST+: architecture and applications. BMC Bioinformatics 10:421.

10.1186/1471-2105-10-421.

5. Cameron D. R., Jiang J.-H., Hassan K. A., Elbourne L. D., Tuck K. L., Paulsen I. T.,

et al. . (2015). Insights on virulence from the complete genome of Staphylococcus

capitis. Front. Microbiol. 6:980. 10.3389/fmicb.2015.00980.

6. Chen L., Xiong Z., Sun L., Yang J., Jin Q. (2012). VFDB 2012 update: toward the

genetic diversity and molecular evolution of bacterial virulence factors. Nucleic Acids

Res. 40, D641–D645. 10.1093/nar/gkr989.

7. Chin C.-S., Alexander D. H., Marks P., Klammer A. A., Drake J., Heiner C., et al. .

(2013). Nonhybrid, finished microbial genome assemblies from long-read SMRT

sequencing data. Nat. Methods 10, 563–569. 10.1038/nmeth.2474.

8. Cui B., Smooker P. M., Rouch D. A., Daley A. J., Deighton M. A. (2013). Differences

between two clinical Staphylococcus capitis subspecies as revealed by biofilm,

antibiotic resistance, and pulsed-field gel electrophoresis profiling. J. Clin.

Microbiol. 51, 9–14. 10.1128/JCM.05124-11.

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 125

9. Cui L., Ma X., Sato K., Okuma K., Tenover F. C., Mamizuka E. M., et al. .

(2003). Cell wall thickening is a common feature of vancomycin resistance in

Staphylococcus aureus. J. Clin. Microbiol.41, 5–14. 10.1128/JCM.41.1.5-14.2003.

10. D'mello D., Daley A. J., Rahman M. S., Qu Y., Garland S., Pearce C., et al. .

(2008). Vancomycin heteroresistance in bloodstream isolates of Staphylococcus

capitis. J. Clin. Microbiol. 46, 3124–3126. 10.1128/JCM.00592-08.

11. Darling A. E., Mau B., Perna N. T. (2010). progressiveMauve: multiple genome

alignment with gene gain, loss and rearrangement. PLoS ONE 5:e11147.

10.1371/journal.pone.0011147.

12. Dhillon B. K., Laird M. R., Shay J. A., Winsor G. L., Lo R., Nizam F., et al. .

(2015). IslandViewer 3: more flexible, interactive genomic island discovery,

visualization and analysis. Nucleic Acids Res. 43, W104–W108. 10.1093/nar/gkv401.

13. Egan K., Field D., Rea M. C., Ross R. P., Hill C., Cotter P. D. (2016). Bacteriocins:

novel solutions to age old spore-related problems? Front. Microbiol. 7:e461.

10.3389/fmicb.2016.00461.

14. Falord M., Mäder U., Hiron A., Débarbouillé M., Msadek T. (2011). Investigation of

the Staphylococcus aureus GraSR regulon reveals novel links to virulence, stress

response and cell wall signal transduction pathways. PLoS ONE 6:e21323.

10.1371/journal.pone.0021323.

15. Flusberg B. A., Webster D. R., Lee J. H., Travers K. J., Olivares E. C., Clark T. A., et

al. . (2010). Direct detection of DNA methylation during single-molecule, real-time

sequencing. Nat. Methods 7, 461–465. 10.1038/nmeth.1459.

16. Froseth B. R., McKay L. L. (1991). Molecular characterization of the nisin resistance

region of Lactococcus lactis subsp. lactis biovar diacetylactis DRC3. Appl. Environ.

Microbiol. 57, 804–811.

17. Gill S. R., Fouts D. E., Archer G. L., Mongodin E. F., Deboy R. T., Ravel J., et al. .

(2005). Insights on evolution of virulence and resistance from the complete genome

analysis of an early methicillin-resistant Staphylococcus aureus strain and a biofilm-

producing methicillin-resistant Staphylococcus epidermidis strain. J. Bacteriol. 187,

2426–2438. 10.1128/JB.187.7.2426-2438.2005.

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 126

18. Howden B. P., Davies J. K., Johnson P. D., Stinear T. P., Grayson M. L.

(2010). Reduced Vancomycin Susceptibility in Staphylococcus aureus, including

Vancomycin-Intermediate and Heterogeneous Vancomycin-Intermediate Strains:

resistance mechanisms, laboratory detection, and clinical implications. Clin.

Microbiol. Rev. 23, 99–139. 10.1128/CMR.00042-09.

19. Kawada-Matsuo M., Yoshida Y., Zendo T., Nagao J., Oogai Y., Nakamura Y., et al. .

(2013). Three distinct two-component systems are involved in resistance to the class I

bacteriocins, Nukacin ISK-1 and nisin A, in Staphylococcus aureus. PLoS

ONE 8:e69455. 10.1371/journal.pone.0069455.

20. Kleinheinz K. A., Joensen K. G., Larsen M. V. (2014). Applying the ResFinder and

VirulenceFinder web-services for easy identification of acquired antibiotic resistance

and E. coli virulence genes in bacteriophage and prophage nucleotide

sequences. Bacteriophage 4:e27943. 10.4161/bact.27943.

21. Kolar S. L., Nagarajan V., Oszmiana A., Rivera F. E., Miller H. K., Davenport J. E., et

al. . (2011). NsaRS is a cell-envelope-stress-sensing two-component system

of Staphylococcus aureus. Microbiol. Read. Engl. 157, 2206–2219.

10.1099/mic.0.049692-0.

22. Koren S., Phillippy A. M. (2015). One chromosome, one contig: complete microbial

genomes from long-read sequencing and assembly. Curr. Opin. Microbiol. 23, 110–

120. 10.1016/j.mib.2014.11.014.

23. Kramer N. E., van Hijum S. A., Knol J., Kok J., Kuipers O. P. (2006). Transcriptome

analysis reveals mechanisms by which Lactococcus lactis acquires nisin

resistance. Antimicrob. Agents Chemother.50, 1753–1761. 10.1128/AAC.50.5.1753-

1761.2006.

24. Lemriss H., Lemriss S., Martins-Simoes P., Butin M., Lahlou L., Rasigade J.-P., et al.

. (2015). Genome sequences of four Staphylococcus capitis NRCS-A isolates from

geographically distant neonatal intensive care units. Genome Announc. 3, e00501–

e00515. 10.1128/genomeA.00501-15.

25. Lemriss H., Martins Simões P., Lemriss S., Butin M., Ibrahimi A., El Kabbaj S., et al.

. (2014). Non-contiguous finished genome sequence of Staphylococcus capitis CR01

(pulsetype NRCS-A). Stand. Genomic Sci. 9, 1118–1127. 10.4056/sigs.5491045.

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 127

26. Liu C.-Q., Su P., Khunajakr N., Deng Y.-M., Sumual S., Kim W. S., et al. .

(2005). Development of food-grade cloning and expression vectors for Lactococcus

lactis. J. Appl. Microbiol. 98, 127–135. 10.1111/j.1365-2672.2004.02441.x.

27. Lyon B. R., May J. W., Skurray R. A. (1984). Tn4001: a gentamicin and kanamycin

resistance transposon in Staphylococcus aureus. Mol. Gen. Genet. 193, 554–556.

28. Martins Simões P., Rasigade J.-P., Lemriss H., Butin M., Ginevra C., Lemriss S., et al.

. (2013). Characterization of a novel composite staphylococcal cassette

chromosome mec (SCCmec-SCCcad/ars/cop) in the neonatal sepsis-

associated Staphylococcus capitis pulsotype NRCS-A. Antimicrob. Agents

Chemother. 57, 6354–6357. 10.1128/AAC.01576-13.

29. McArthur A. G., Waglechner N., Nizam F., Yan A., Azad M. A., Baylay A. J., et al. .

(2013). The comprehensive antibiotic resistance database. Antimicrob. Agents

Chemother. 57, 3348–3357. 10.1128/AAC.00419-13.

30. Millette M., Cornut G., Dupont C., Shareck F., Archambault D., Lacroix M.

(2008). Capacity of human nisin- and pediocin-producing lactic Acid bacteria to

reduce intestinal colonization by vancomycin-resistant enterococci. Appl. Environ.

Microbiol. 74, 1997–2003. 10.1128/AEM.02150-07.

31. Morelli L. (2008). Postnatal development of intestinal microflora as influenced by

infant nutrition. J. Nutr. 138, 1791S–1795S. Available online

at: http://jn.nutrition.org/content/138/9/1791S.full#fn-1.

32. Otto M. (2009). Staphylococcus epidermidis: the “accidental” pathogen. Nat. Rev.

Micro. 7, 555–567. 10.38/nrmicro2182.

33. Otto M. (2012). Molecular basis of Staphylococcus epidermidis infections. Semin.

Immunopathol. 34, 201–214. 10.1007/s00281-011-0296-2.

34. Park H.-K., Shim S.-S., Kim S.-Y., Park J.-H., Park S.-E., Kim H.-J., et al. .

(2005). Molecular analysis of colonized bacteria in a human newborn infant gut. J.

Microbiol. 43, 345–353.

35. Peschel A., Sahl H.-G. (2006). The co-evolution of host cationic antimicrobial

peptides and microbial resistance. Nat. Rev. Microbiol. 4, 529–536.

10.1038/nrmicro1441.

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 128

36. Piper C., Draper L. A., Cotter P. D., Ross R. P., Hill C. (2009). A comparison of the

activities of lacticin 3147 and nisin against drug-resistant Staphylococcus aureus and

Enterococcus species. J. Antimicrob. Chemother. 64, 546–551. 10.1093/jac/dkp221.

37. Rasigade J.-P., Raulin O., Picaud J.-C., Tellini C., Bes M., Grando J., et al. .

(2012). Methicillin-resistant Staphylococcus capitis with reduced Vancomycin

susceptibility causes late-onset sepsis in intensive care neonates. PLoS ONE 7:e31548.

10.1371/journal.pone.0031548.

38. Roberts R. J., Carneiro M. O., Schatz M. C. (2013). The advantages of SMRT

sequencing. Genome Biol. 14:405. 10.1186/gb-2013-14-6-405.

39. Shin J. M., Gwak J. W., Kamarajan P., Fenno J. C., Rickard A. H., Kapila Y. L.

(2016). Biomedical applications of nisin. J. Appl. Microbiol. 120, 1449–1465.

10.1111/jam.13033.

40. Siguier P., Perochon J., Lestrade L., Mahillon J., Chandler M. (2006). ISfinder: the

reference centre for bacterial insertion sequences. Nucleic Acids Res. 34, D32–D36.

10.1093/nar/gkj014.

41. Stoll B. J., Hansen N., Fanaroff A. A., Wright L. L., Carlo W. A., Ehrenkranz R. A., et

al. . (2002). Late-onset sepsis in very low birth weight neonates: the experience of the

NICHD Neonatal Research Network. Pediatrics 110, 285–291.

10.1542/peds.110.2.285.

42. Stoll B. J., Hansen N. I., Higgins R. D., Fanaroff A. A., Duara S., Goldberg R., et al. .

(2005). Very low birth weight preterm infants with early onset neonatal sepsis: the

predominance of gram-negative infections continues in the National Institute of Child

Health and Human Development Neonatal Research Network, 2002-2003. Pediatr.

Infect. Dis. J. 24, 635–639. 10.1097/01.inf.0000168749.82105.64.

43. Taft D. H., Ambalavanan N., Schibler K. R., Yu Z., Newburg D. S., Deshmukh H., et

al. . (2015). Center variation in intestinal Microbiota prior to late-onset sepsis in

preterm infants. PLoS ONE10:e0130604. 10.1371/journal.pone.0130604.

44. Vallenet D., Belda E., Calteau A., Cruveiller S., Engelen S., Lajus A., et al. .

(2013). MicroScope–an integrated microbial resource for the curation and comparative

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 129

analysis of genomic and metabolic data. Nucleic Acids Res. 41, D636–D647.

10.1093/nar/gks1194.

45. Vallenet D., Labarre L., Rouy Z., Barbe V., Bocs S., Cruveiller S., et al. .

(2006). MaGe: a microbial genome annotation system supported by synteny

results. Nucleic Acids Res. 34, 53–65. 10.1093/nar/gkj406.

46. Van Der Zwet W. C., Debets-Ossenkopp Y. J., Reinders E., Kapi M., Savelkoul P. H.,

Elburg R. M., et al. . (2002). Nosocomial spread of a Staphylococcus capitis strain

with heteroresistance to vancomycin in a neonatal intensive care unit. J. Clin.

Microbiol. 40, 2520–2525. 10.1128/JCM.40.7.2520-2525.2002.

47. Venkatesh M. P., Placencia F., Weisman L. E. (2006). Coagulase-negative

staphylococcal infections in the neonate and child: an update. Semin. Pediatr. Infect.

Dis. 17, 120–127. 10.1053/j.spid.2006.06.005.

48. Wiedemann I., Breukink E., van Kraaij C., Kuipers O. P., Bierbaum G., de Kruijff B.,

et al. . (2001). Specific binding of nisin to the peptidoglycan precursor lipid II

combines pore formation and inhibition of cell wall biosynthesis for potent antibiotic

activity. J. Biol. Chem. 276, 1772–1779. 10.1074/jbc.M006770200.

49. Zhang Y.-Q., Ren S.-X., Li H.-L., Wang Y.-X., Fu G., Yang J., et al. .

(2003). Genome-based analysis of virulence genes in a non-biofilm-

forming Staphylococcus epidermidis strain (ATCC 12228). Mol. Microbiol. 49, 1577–

1593. 10.1046/j.1365-2958.2003.03671.x.

50. Zhou Y., Liang Y., Lynch K. H., Dennis J. J., Wishart D. S. (2011). PHAST: a fast

phage search tool. Nucleic Acids Res. 39, W347–W352. 10.1093/nar/gkr485.

IV.2.10 Supplementary data

Bacterial isolates and Growth conditions

All four strain of the S. capitis NRCS-A clone were isolated from blood cultures of preterm

infants with presenting a Late-onset sepsis (LOS) and hospitalized in NICUs from 4 distinct

countries (strain CR01, is from an in infant in an NICU in France, strain CR03 from an in a

NICU in Belgium, strain CR04 from a NICU ion Australia and strain CR05 from an NICU in

the United Kingdom).

Species identification of the bacterial isolates and antimicrobial susceptibility testing (AST)

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 130

were performed, respectively, using Vitek MS (bioMérieux, Marcy l’Etoile), 16S rDNA

sequencing, the automated BD Phoenix system (Becton Dickinson, Sparks, MD) and with

Shimadzu-MALDI-TOF MS system (Shimadzu Corporation), as implemented on [1].

The strain was identified as being a Staphylococcus capitis by VITEK MS with 99.9% and at

93.7% by the MALDI-TOF MS, using the Shimadzu Launchpad software program and the

SARAMIS database application (AnagnosTec GmbH) for automatic measurement and

identification. The antimicrobial susceptibility test (AST) results were analyzed according to

the recommendations of the French Microbiology Society [2]. The S. capitis bacteremia was

considered positive based on a single positive blood culture [3,4]. All 4 isolates were resistant

to penicillin, methicillin, gentamicin, rifampin, hetero-resistant to vancomycin and sensitive

to fusidic acid and fluoroquinolones.

DNA isolation

All samples were prepared for sequencing by growing the S. capitis CR01,CR03, CR04 and

CR05 strains aerobically at 37°C in BloodAgar for 24-48 hours. Genomic DNA was then

extracted using the PureLinkTM genomic DNA kit (InvitrogenTM) according to the

manufacturer’s recommended protocol. DNA quantification was performed using a NanoVue

TM Plus (HVD Life Sciences).

Genome sequencing and assembly

454-shotgun libraries were constructed using 1 µg of DNA, for each sample, and following

the GS Rapid library protocol (Roche 454, Roche) with a mean library size of 1547 bp (strain

CR03), 1874 bp (strain CR04) and 1419 bp (strain CR05). The resulting 454 DNA libraries

were sequenced using a high-throughput whole-genome shotgun strategy performed on a

Genome Sequencer FLX+ system (454 Life Sciences/Roche) using FLX Titanium reagents,

according to the manufacturer’s protocols and instructions. De novo assemblies were

performed using the Roche Newbler (version 2.9) software package, and the sequencing

results are summarized below.

Strain Isolation

country

Read

(Mb)

Fold

Covrage

X

No of

Contig

Genome

Size

G+C

Content%

Accession Number

CR01 France 50,876 265 1 2,522,871 33,02 LN866849 (chromosome)

and LN866850 (plasmid) CR03 Belgium

141,728 30 31 2,508,352 32,81 CTEB1000000 CR04 Australia

132,28 30 38 2,512,289 32,8 CTEM1000000 CR05 United King

139,569 31 39 2,543,917 32,84 CTEO1000000

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 131

References:

1. Gagnaire J, Dauwalder O, Boisset S, Khau D, Freydière A-M, Ader F, et al. (2012) Detection of Staphylococcus aureus Delta-Toxin Production by Whole-Cell MALDI-TOF Mass

Spectrometry. PLoS ONE 7(7): e40660. doi:10.1371/journal.pone.0040660

2. French Society for Microbiology. Recommandations du Comite de l'Antibiogramme de la Societe Francaise de Microbiologie. 2009. Available at:

wwwsfmassofr/doc/downloadphp?doc=DiU8C&fic=casfm_2009pdf. Accessed 22 February

2009.

3. Rasigade J-P, Raulin O, Picaud J-C, Tellini C, Bes M, Grando J, Ben Saïd M, Claris O,

Etienne J, Tigaud S, Laurent F. Methicillin-Resistant Staphylococcus capitis with Reduced

Vancomycin Susceptibility Causes Late-Onset Sepsis in Intensive Care Neonates. PLoS ONE 2012;7(2):e31548.

4. Hall KK, Lyman JA. Updated review of blood culture contamination. Clin Microbiol Rev.

2006 Oct;19(4):788-802.

CHAPITRE IV

132 H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹

Table IV.2.S1 – Genes found exclusively in the S. capitis NRCS-A clone and not in other S. capitis public genomes

CR01 ORFs

annotation Gene Product Genomic context

CR01_v3_0498 hsdM putative type I restriction enzyme HindVIIP M protein

Additional restriction modification system type I, immediately after the composite SCCmec-SCCcad/ars/cop element CR01_v3_0499 hsdS HsdS homologue

CR01_v3_0500 hdsR putative type I restriction enzyme HindVIIP R protein

CR01_v3_0529 nsr Nisin-resistance protein nisin resistance gene

CR01_v3_2157 _ protein of unknown function

Phage region CR01_v3_2158 _ putative lipoprotein

CR01_v3_2159 _ conserved protein of unknown function

CR01_v3_2162 _ protein of unknown function

CR01_v3_0176 _ conserved protein of unknown function

CR01_v3_0520 ispD 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase

possibly a biosynthesic pathway CR01_v3_0521 tarJ putative ribitol-5-phosphate dehydrogenase

CR01_v3_0522 _ conserved protein of unknown function

CR01_v3_0523 _ conserved protein of unknown function

CR01_v3_0429 _ conserved protein of unknown function

SCCmec element of the composite SCCmec-SCCcad/ars/cop element

CR01_v3_0430 _ conserved protein of unknown function

CR01_v3_0431 _ conserved protein of unknown function

CR01_v3_0432 _ conserved protein of unknown function

CR01_v3_0433 _ conserved protein of unknown function

CR01_v3_0434 _ putative primase

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat / 133

CR01_v3_0435 _ Cassette chromosome recombinase C7

CR01_v3_0448 _ Transcriptional regulator, DeoR family

CR01_v3_0449 _ conserved protein of unknown function

CR01_v3_0450 _ conserved protein of unknown function

CR01_v3_0451 _ conserved protein of unknown function

CR01_v3_0452 _ conserved protein of unknown function

CR01_v3_0453 ccrC Cassette chromosome recombinase C

CR01_v3_0458 _ conserved protein of unknown function

CR01_v3_0459 _ truncated hsdR

CR01_v3_0460 cas CRISPR-associated endonuclease Cas1

CR01_v3_0461 cas CRISPR-associated endoribonuclease Cas2

CR01_v3_0462 csm CRISPR-associated Csm1 family protein

CR01_v3_0463 csm CRISPR-associated Csm2 protein

CR01_v3_0464 csm CRISPR type III-associated RAMP protein Csm3

CR01_v3_0465 csm CRISPR-associated RAMP protein

CR01_v3_0466 csm CRISPR-associated RAMP protein, Csm5 family

CR01_v3_0467 csm CRISPR-associated protein, Csm6 family

CR01_v3_0468 cas CRISPR-associated endoribonuclease Cas6

CR01_v3_0469 _ conserved protein of unknown function, potential pseudo?

CR01_v3_0470 _ conserved membrane protein of unknown function

CR01_v3_0471 _ Transcriptional regulator, TetR family

CR01_v3_0472 _ conserved membrane protein of unknown function

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat / 134

CR01_v3_0310 _ exported protein of unknown function

CR01_v3_0311 _ conserved protein of unknown function

CR01_v3_0312 _ conserved protein of unknown function

CR01_v3_0183 _ protein of unknown function

CR01_v3_0496 _ protein of unknown function

CR01_v3_0497 _ conserved protein of unknown function

CR01_v3_0505 _ conserved protein of unknown function

CR01_v3_0507 _ McrBC 5-methylcytosine restriction system component

CR01_v3_0508 _ protein of unknown function

CR01_v3_0178 _ protein of unknown function

CR01_v3_0179 _ protein of unknown function

CR01_v3_0180 _ protein of unknown function

CR01_v3_0673 _ protein of unknown function

CR01_v3_0674 _ conserved protein of unknown function

CR01_v3_0675 _ conserved protein of unknown function

CR01_v3_0676 _ protein of unknown function

CR01_v3_0677 _ protein of unknown function

CR01_v3_0680 _ conserved protein of unknown function

CHAPITRE IV

H. Lemriss⎹ Thèse de doctorat⎹ Université Mohammed V-Rabat⎹ 135

Table IV.2.S2 – Methylated motifs detected for S. capitis NRCS-A strain CR01

All methylated motifs presented in this table were validated by checking that the mean modification

QV was >50 and the mean motif coverage was >100.

Motif Modified

Position

Type of

modificati

on

No.

detected

motifsa

No motifs

in genome

% of

methylated/

detected

motifs

Type of

RM

system

Partner

motif

TTAYNNN

NGTC

3 m6A 1253 1256 99.46 I GACNNN

NRTAA

ANGCAG

NTCTNN

NNA

4 m4C 8 10 80.0 II

GCGGTA

NYANNB

3 unknown 40 67 59.7 ?

a The total number includes motifs occurring on the “+” and “-” strands ( partner motif is located in the

“-” strand)

CHAPITRE V

Diffusion mondiale du clone

Staphylococcus capitis NRCS-A en

réanimation néonatale :

caractérisation moléculaire, analyse

génomique et histoire évolutive

CHAPITRE V

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 136

Staphylococcus capitis NRCS-A est un clone endémique impliqué dans les septicémies

nosocomiales néonatales (SNN) à l’échelle mondiale et présente un profil de multirésistance

atypique incluant une sensibilité diminuée à la vancomycine, antibiotique de première ligne

pour le traitement de ces sepsis néonataux. Ce clone multirésistant porte un déterminant de

résistance à la méticilline (staphylococcal cassette chromosome mec, SCCmec) de type V.

Dans cette étude, nous avons cherché à explorer la possibilité de la distribution mondiale du

clone NRCS-A en appliquant diverses méthodes moléculaires (PFGE Sma et SacII, typage

SCCmec, MLST, Dru typing et analyse phylogénétique des génomes complet après WGS)

d’une part, et à savoir la capacité spécifique in vitro de ce clone NRCS-A à acquérir

l’hétérorésistance à la vancomycine sous pression sélective d’autre part.

Quatre vingt six souches NRCS-A isolées de SNN en Angleterre, Australie, Belgique et

France, et quatorze souches de S. capitis non-NRCS-A isolées d’adultes, ont été caractérisées

par électrophorèse en champs pulsés (PFGE) avec les enzymes SmaI et par « direct repeat

unitstyping » (Dru typing).

La grande majorité des souches isolées de SNN ont montré le pulsotype NRCS-A et un dru-

type dt11c (96%) spécifique à ce clone. Ensuite, nous avons sélectionné, un sous-ensemble

d'isolats représentatifs (douze souches isolées de SNN, dont trois par pays, et deux souches

isolées chez des patients adultes), afin de réaliser d’autre typage moléculaire (SacII PFGE,

typage SCCmec et analyse par MLST).

En outre, un arbre phylogénétique a été construit sur la base des génomes complets de cinq

isolats de SNN. Cette analyse phylogénétique de ces cinq isolats des différents pays preuve la

haute parenté génétique dans le clone NRCS-A.

Enfin, l’étude de sensibilité aux antibiotiques montre que toutes les souches NRCS-A ont une

résistance à la méthicilline et aux aminoglycosides et une diminution de sensibilité à la

vancomycine, avec des implications thérapeutiques potentielles pour les nouveau-nés infectés.

Cette étude représente le premier rapport de la dissémination ce clone endémique à grande

échelle géographique.

Des questions restent à propos de l'origine et les moyens de propagation internationale, et les

raisons de la prédilection apparente de ce clone pour les nouveau-nés.

CHAPITRE V

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 137

Le contenu de ce chapitre est présenté sous forme d’un article publié dans la revue « Clinical

Microbiology and Infection » (Butin et al., 2016). La référence de cet article est la suivante :

Clin Microbiol Infect. Jan 2016, 22(1): 46-52 (doi: 10.1016/j.cmi.2015.09.008). Dans cette

publication, j’ai réalisé le travail de séquençage, d’assemblage, d’annotation et d’analyse

phylogénétique des cinq souches sélectionnées pour cette étude : CR01 (CBUB000000000.1),

CR03 (CTEB01000001), CR04 (CTEM01000001), CR05 (CTEO01000001), CR09

(CTEL01000003).

Ce travail a fait objet également des trois communications orales et affichées ci-dessous et

dont les résumés sont présentés dans la partie publications et communications.:

1- Butin M, Martins Simões P, Lemriss H, Lemriss S, Vandenesch F, Claris O, Picaud JC,

Rasigade JP, Laurent F. Staphylococcus capitis in neonatal late-onset sepsis: unexpected

worldwide dissemination of an endemic multi-resistant clone. European Academy of

Pediatric Societies. Barcelone, 17 - 21 October 2014.

2- M. Butin, P. Martins Simões, J.P. Rasigade, S. Lemriss, H. Lemriss, S. El Kabbaj, A.

Ibrahimi, S. Tigaud, F. Vandenesch, O. Claris, J.C. Picaud, F. Laurent. Diffusion mondiale

du clone Staphylococcus capitis NRCS-A en réanimation néonatale : caractérisation

moléculaire, analyse génomique et histoire évolutive. RICAI, Paris, 21 Novembre 2013.

3- Martins Simões P, Butin M, Lemriss H, Lemriss S, Deighton MA, Kearns A, Denis O,

Goering R, Ginevra C, Picaud JC, Ibrahimi A, EL Kabbaj S, Vandenesch F, Rasigade J-P,

Laurent F. Worldwide distribution of an endemic multi-resistant NRCS-A Staphylococcus

capitis clone in NICU: molecular typing, whole genome analysis and evolutionary

history.10th International Meeting on Microbial Epidemiological Markers, Paris, 02-05

October 2013.

CHAPITRE V

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 138

V.1 Abstract

Nosocomial late-onset sepsis represents a frequent cause of morbidity and mortality in

preterm neonates. The Staphylococcus capitis clone NRCS-A has been previously described

as an emerging cause of nosocomial bacteraemia in French neonatal intensive-care units

(NICUs). In this study, we aimed to explore the possible unrecognized dissemination of this

clone on a larger geographical scale. One hundred methicillin-resistant S. capitis strains

isolated from neonates (n = 86) and adult patients (n = 14) between 2000 and 2013 in four

different countries (France, Belgium, the UK, and Australia) were analysed with SmaI pulsed-

field gel electrophoresis (PFGE) and dru typing. The vast majority of NICU strains showed

the NRCS-A pulsotype and the dt11c type (96%). We then randomly selected 14 isolates

(from neonates, n = 12, three per country; from adult patients, n = 2), considered to be a

subset of representative isolates, and performed further molecular typing (SacII PFGE,

SCCmec typing, and multilocus sequence typing-like analysis), confirming the clonality of

the S. capitis strains isolated from neonates, despite their distant geographical origin. Whole

genome single-nucleotide polymorphism-based phylogenetic analysis of five NICU isolates

(from the different countries) attested to high genetic relatedness within the NRCS-A clone.

Finally, all of the NRCS-A strains showed multidrug resistance (e.g. methicillin and

aminoglycoside resistance, and decreased vancomycin susceptibility), with potential

therapeutic implications for infected neonates. In conclusion, this study represents the first

report of clonal dissemination of methicillin-resistant coagulase-negative Stahylococcus

clonale on a large geographical scale. Questions remain regarding the origin and means of

international spread, and the reasons for this clone's apparent predilection for neonates.

V.2 Introduction

Every year, approximately 15 million children are born prematurely worldwide (defined as all

live births before 37 completed weeks). In developed countries, preterm birth is the leading

cause of death in children aged <5 years [1]. In recent decades, technical and medical

advances in neonatal intensive-care units (NICUs) have allowed for an improvement in the

global survival of neonates. Nevertheless, preterm birth-related complications still remain the

major cause of neonatal death [2]. In this context, nosocomial late-onset sepsis (LOS)

(occurring after 3 days of life) represents a frequent cause of morbidity and mortality [3].

Twenty per cent to 30% of very low birthweight preterm babies develop at least one episode

of LOS during their hospitalization in a NICU, resulting in respiratory or neurological

CHAPITRE V

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 139

impairment [4]. Catheter-related bloodstream infections constitute the most frequent cause of

LOS in these vulnerable neonates, owing to multiple indwelling devices and invasive

procedures. Consequently, skin-associated commensal coagulase-negative staphylococci are

the most frequently involved pathogens in LOS, most commonly involving Staphylococcus

epidermidis [3, 5].

However, the predominance of Staphylococcus capitis in several French NICUs has been

reported, whereas this species is rarely reported as a pathogen in adult patients [6]. This

phenomenon is of major concern, for several reasons: first, we have recently shown that all

methicillin-resistant S. capitis strains from NICUs in France belong to a unique clone

(designated NRCS-A), suggesting a high potential for dissemination, whereas

S. capitis isolates from adult patients belong to many distinct clones; second, NRCS-A has

been highly prevalent in our institution (Hospices Civils de Lyon) since at least 2004,

underscoring its ability to persist and become endemic when introduced into NICUs; and

third, NRCS-A strains show decreased susceptibility to all antimicrobial agents that are

commonly used in NICUs [6]. NRCS-A isolates harbour a type V-related staphylococcal

chromosome cassette mec (SCCmec) element conferring resistance to β-lactams [7], and show

a multidrug resistance profile, including resistance or heteroresistance to vancomycin, the

first-line antimicrobial agent in LOS cases [5, 6].

As multiresistant S. capitis LOS cases have been reported in several countries [6, 7, 8, 9], we

sought to explore the possible unrecognized dissemination of the multiresistant NRCS-A

clone on a larger geographical scale. To this end, we collected and characterized

S. capitis bloodstream isolates from NICUs located in geographically diverse countries, by

performing molecular typing and antimicrobial susceptibility testing.

V.3 Materials and Methods

Bacterial isolates

The strain collections of four national reference centres for staphylococci (Australia, Belgium,

France, and the UK) were screened to identify methicillin-resistant S. capitis isolates from

neonatal LOS in NICUs, and from blood cultures of non-neonatal patients (adult or

paediatric). For the period 2000-2013, methicillin-resistant and multiresistant

S. capitis isolates were isolated in NICUs in at least 12 (France), eight (UK), six (Australia)

and four (Belgium) hospitals. Each year during this time period, between two and 70 neonatal

CHAPITRE V

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 140

LOS cases involving S. capitis were identified in each of these hospitals (personal

communication). Each reference laboratory provided a sample of methicillin-

resistant S. capitis strains isolated from its country during the period 2000–2013. In total,

100 S. capitis strains were included in our analysis: 86 from NICUs (France, n = 48;

Belgium, n = 3, Australia, n = 20; and the UK, n = 15) and 14 from other units (paediatric or

adult patients) (France, n = 7; Belgium, n = 3; and Australia, n = 4). These 100 strains were

initially characterized by pulsed-field gel electrophoresis (PFGE) and dru typing.

To confirm our initial results and avoid method-linked bias, we more thoroughly

characterized a subset of isolates belonging to the NRCS-A clone, as it was not feasible to

analyse every isolate in the complete strain collections. Thus, of the 86 NICU isolates, 12

were randomly selected (three NRCS-A isolates per country), and two methicillin-

resistant S. capitis bloodstream isolates from adult patients from France that did not belong to

the NRCS-A clone were selected.

PFGE

PFGE, the reference standard staphylococcal typing and outbreak investigation method, was

performed initially with SmaI restriction digestion, and also with SacII, which has been

recently reported to show increased discriminatory power for S. capitis [6, 9, 10]. Cluster

analysis was performed with BioNumerics software 7.1 (Applied Maths NV, Sint-Martens-

Latem, Belgium). Pattern similarities of >80% (UPGMA, Dice coefficient) were used to

define a pulsotype as previously described [11].

Dru typing

dru typing, a recently developed method based on sequence analysis of a 40-bp variable-

number tandem-repeat region within SCCmec (the mobile genetic element (MGE) harbouring

the mecA gene), was performed as previously described [12].

SCCmec typing

The SCCmec typing was performed as described by Kondo et al. [13].

Multilocus sequence typing

CHAPITRE V

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 141

The genetic relationship between the 14 selected S. capitis isolates was further explored by

multilocus sequence typing (MLST) based on the published S. epidermidis MLST scheme

[14], with appropriately designed consensus primers for amplification of seven housekeeping

genes (Table V.S1). For each allele, sequences were aligned, and single-nucleotide

polymorphisms (SNPs) were detected and compared.

Whole genome sequencing and SNP-based phylogenetic analysis

To explore the genetic conservation inside the NRCS-A clone, five NRCS-A isolates were

selected, including: (a) isolate ST20131582, corresponding to the oldest French isolate

available in our collection (2002) (genome CR09; ENA accession number CTEL01000003)

[15]; and (b) four isolates (one per country) randomly selected from the 12 previously fully

analysed isolates—isolate ST20111775 from France (genome CR01, already published

[16] and considered to be the prototype of the NRCS-A clone; ENA accession number

LN866849), isolate ST20111772 from Belgium (genome CR03; ENA accession number

CTEB01000001) [15], isolate ST20121573 from Australia (genome CR04; ENA accession

number CTEM01000001) [15], and isolate ST20111770 from the UK (genome CR05; ENA

accession number CTEO01000001) [15]. Whole genome sequencing of these five isolates

was performed with pyrosequencing (454; Life Sciences/Roche, Branford, CT, USA).

Moreover, we performed single-molecule real-time sequencing (PacBio, Menlo Park, CA,

USA) for one of these five isolates (ST20111775) to obtain a closed genome (genome CR01).

The mean coverage obtained with the 454 pyrosequencing was 24×, 21×, 20× and 20× for

genomes CR03, CR04, CR05 and CR09, respectively. For the single-molecule real-time

sequencing (genome CR01), a mean coverage of 265× was obtained.

The whole genome sequences (WGSs) of these NRCS-A S. capitis strains were compared

with publicly available S. capitis genomes, which correspond to either skin commensal or

pathogen isolates from adult patients : SK14 (GenBank Reference

Sequence: ACFR00000000.1), VCU116 (GenBank Reference Sequence: AFTX00000000.1),

QN1 (GenBank Reference Sequence: AJTH00000000.1), LNZR-1 (GenBank Reference

Sequence: NZ_JGYJ00000000.1), and C87 (GenBank Reference Sequence :

ACRH00000000.1). To assess the phylogenetic relationships between all S. capitis strains, we

used the REALPHY 1.10 online pipeline [17], with default parameters, to infer phylogenetic

trees from assembled WGS data. We used the closed genome of the S. capitis NRCS-A strain

ST20111775 as the reference genome (genome CR01; ENA accession number LN866849).

CHAPITRE V

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 142

Antimicrobial susceptibility profile

Antimicrobial susceptibility testing of the 14 selected S. capitis isolates (NICU, n = 12; adult

patients, n = 2) was performed with the standard agar diffusion technique as recommended by

the French Society for Microbiology

(www.sfmasso.fr/doc/download.php?doc=DiU8C&fic=casfm_2009.pdf). MICs of

vancomycin, linezolid and daptomycin were determined with the Etest. Strains with a

vancomycin MIC of >2 mg/L were considered to be resistant, and strains with MICs of

≤2 mg/L were tested for vancomycin heteroresistance with the brain–heart infusion agar

method, as previously described [6, 18].

V.4 Results

SmaI PFGE profile

Of the 86 S. capitis isolates from the NICU, all but three (96%) were of the NRCS-A strain

pulsotype (i.e. shared >80% similarity with each other and the NRCS-A pattern)

[6] (Figure. V.1). The three non-NRCS-A strains originated from NICUs in Australia. In

contrast, the 14 non-NICU methicillin-resistant S. capitis isolates showed a diversity of

pulsotypes, only two of which (14%) were NRCS-A: one from a 4-year-old patient

hospitalized in a paediatric intensive-care unit in France, and one from an adult patient in

Australia (Figure. V.1).

Dru typing

With more clonal organisms, PFGE tends to generate related macrorestriction patterns,

causing problems in epidemiological discrimination [12]. Therefore, the 100 S. capitis isolates

were additionally analysed with dru typing for characterization of the MGE harbouring mecA.

Among the 86 NICU isolates, 83 harboured a unique dt11c profile (96%), regardless of their

pulsotype (NRCS-A or not NRCS-A) (Figure. V.1). The three remaining NICU isolates (all

NRCS-A) were dt12r, dt11ba, and dt10h (n = 1 each). Conversely, among the 14 non-NICU

isolates, only two were dt11c (14%), including the NRCS-A paediatric isolate. The

other dru types in non-NICU isolates were diverse: dt10a (n = 1), dt11a (n = 3), dt12af

(n = 1), dt11bd (n = 1), dt3c (n = 2), dt1b (n = 1), and dt9bo (n = 1). Two isolates were non-

typeable.

CHAPITRE V

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 143

Figure V.1. Dendrogram and schematic representation of pulsotypes and dru types of

100 Staphylococcus capitis isolates from neonatal intensive-care units (NICUs) (n = 86)

CHAPITRE V

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 144

or other settings (n = 14). The pulsed-field gel electrophoresis (PFGE) dendrogram was

generated from SmaI PFGE patterns with Bionumerics software 7.1, as previously

described [6] ; [10]. The vertical dotted line represents the 80% limit of similarity. The

pulsotype NRCS-A was defined previously [6]. dru typing was performed as previously

described [12]. *Available genomes.

PFGE with SacII, SCCmec typing, and MLST

To strengthen and complete the data obtained with the set of 100 clinical isolates, we

performed additional analysis on a subset of 14 randomly selected strains: 12 NRCS-A strains

from NICU patients (n = 3 from each country) and two non-NRCS-A strains from adult

patients.

As observed with SmaI, SacII PFGE restriction profiles confirmed the clustering of the 12

NICU isolates into a unique pulsotype (Figure. V.S1). conversely, isolates from adult patients

belonged to two distinct pulsotypes, and shared <80% similarity with NICU isolates.

SCCmec analysis confirmed the genetic closeness of this MGE in the 12 NICU isolates:

indeed, all of these 12 isolates harboured a type V-related SCCmec element, whereas the

isolates from adults harboured a non-typeable SCCmec element (a combination of

a mec complex type C and ccr genes A2/B2/C) (Figure.V.S1). Finally, when an MLST model

encompassing a total of 3020 bp of housekeeping genes was used, the sequence comparison

of the 12 NICU isolates showed that these isolates differed by no more than two SNPs

(Table V.S2), whereas sequences of the two isolates from adult patients showed 32 and 33

SNPs, as compared with the NICU isolates.

Whole genome SNP-based phylogenetic analysis of S. capitis strains

A total of 2 080 323 bp (including coding and intergenic regions) were found to be shared by

all ten genomes (five S. capitis NRCS-A genomes and the five publicly

available S. capitis genomes), and constituted the core genome used for the phylogenetic

reconstruction shown in Figure. V.2. When each genome was compared with the reference

genome of S. capitis NRCS-A CR01, we found a maximum of 162 SNPs and a minimum of

65 SNPs (indels excluded) between the NRCS-A genomes, whereas the non-NRCS-A

genomes harboured at least 7910 SNPs and up to 50 723 SNPs (for LNZR-1 and QN1,

respectively). As seen in Figure. V.2, all five NRCS-A genomes clustered in one clade, which

suggests that they belong to a clonal population.

CHAPITRE V

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 145

Figure V.2. Single-nucleotide polymorphism (SNP)-based maximum-likelihood tree with

whole genome sequences of neonatal Staphylococcus capitis isolates from four distinct

countries and publicly available S. capitis genomes. A total of 2 080 323 homologous sites

from all ten genomes (polymorphic and non-polymorphic sites) were obtained by use of the

REALPHY 1.10 online pipeline with the closed chromosome of S. capitis NRCS-A CR01

(ENA accession number LN866849) as reference. A maximum-likelihood tree was built by

the use of PhyML with default parameters as implemented in REALPHY 1.10. For each

strain, the number of SNPs between each strain and the reference is indicated in grey in

parentheses. Aus, Australia; Be, Belgium; Fr, France.

Antimicrobial susceptibility profiles

Antimicrobial susceptibility profiles of the 14 S. capitis strains are shown in Table V.1. All 12

NICU isolates showed methicillin and aminoglycoside resistance, and either resistance or

heteroresistance to vancomycin, the first-line antimicrobial agent used for LOS. The 12 NICU

isolates remained susceptible to fluoroquinolones.

CHAPITRE V

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 146

Table V.1. Antimicrobial susceptibility profile of Staphylococcus capitis bloodstream isolates

from neonates (n = 12) and adults (n = 2)

V.5 Discussion

Collectively, our data highlight the unexpected multinational geographical distribution of a

clonal population of multidrug-resistant S. capitis (NRCS-A) that shows high specificity for

the NICU environment.

PFGE and dru typing performed on a large number of S. capitis isolates, representing wide

temporal and geographical diversity, revealed that almost all of the S. capitis NICU isolates

collected in four distant countries were of the NRCS-A pulsotype and dt11c (within a

common SCCmec cassette acquired only once). These results suggest the emergence and

widespread dissemination of a unique S. capitis strain. The slight discrepancy between the

pulsotype and the dru type of the isolates could be explained by the fact that the

SCCmec cassette, an MGE, can be transferred between different isolates when present in the

same environment, such as an NICU. Note that, in our collection, two strains from adult

patients were non-typeable by dru typing. This phenomenon has also been observed in rare

methicillin-resistant S. aureus strains, and has been interpreted as an absence of the dru region

in this minority of strains [12].

All tested NRCS-A isolates had the same multidrug resistance profile, including resistance to

all antimicrobial agents widely used in the NICU setting. Unexpectedly, these NICU isolates

remained susceptible to fluroroquinolones, whereas multiresistant coagulase-

CHAPITRE V

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 147

negative Staphylococcus strains are typically fluoroquinolone resistant. This atypical

antimicrobial susceptibility profile is similar to that of previously described NRCS-A

strains [6], and probably reflects the specific antimicrobial selective pressure of NICUs,

where β-lactams, vancomycin, and aminoglycosides, but not fluoroquinolones, are widely

used [19]. In our study, all NRCS-A isolates were either resistant or heteroresistant to

vancomycin. Studies of S. capitis isolates from NICUs have reported constant vancomycin

heteroresistance [7] ; [8], and Van der Zwet et al. initially proposed that this could be an

intrinsic feature of S. capitis [8]. However, our recent results obtained by

comparing S. capitis isolates from neonates and adult patients suggest that vancomycin

heteroresistance is more likely to be a specific feature of the NRCS-A clone [7]. This

heteroresistance might have contributed to S. capitis NRCS-A establishment in NICUs.

Alternatively, the frequent use of vancomycin in neonates might have induced/selected this

heteroresistance in the NRCS-A clone. The clinical significance of vancomycin

heteroresistance is controversial, but therapeutic failures of vancomycin in S. capitis-related

LOS have been reported [8]. Thus, the multidrug resistance profile of this emerging clone

raises therapeutic concerns in cases of LOS, and requires substantiation in a clinical study

focusing on S. capitis LOS.

Taken together, these data demonstrate the clonality of S. capitis isolates from neonates,

despite their distant geographical origin, in contrast to the high level of genetic diversity seen

in isolates from non-NICU patients. Thus, this larger dataset, involving an international

collection of strains, mirrors our previous observation of isolates within France [6].

The geographical spread of a clonal population of S. capitis in distant NICUs, although

unexpected, is reminiscent of the extensive diffusion of clonal group B Streptococcus ST-17

causing meningitis and septicaemia in neonates [20]. However, although the global

dissemination of methicillin-resistant Staphylococcus aureus clones has been well described,

to the best of our knowledge this study represents the first report of widespread diffusion of

methicillin-resistant coagulase-negative staphylococci. This observation raises important and

as yet unsolved questions regarding the origin and the dissemination routes involved in the

international spread of NRCS-A S. capitis, as well as the underlying mechanism(s) of

apparent predilection for neonates.

V.6 Conclusion

CHAPITRE V

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 148

In conclusion, we have demonstrated that a methicillin-resistant and multidrug

resistant S. capitis clone is involved in LOS in NICUs from four distant countries. A better

understanding of the epidemiology and pathophysiology of S. capitis NRCS-A infections in

preterm infants is now warranted.

V.7 Transparency declaration

The authors have no conflicts of interest or funding to disclose.

V. 8 Acknowledgements

This work was supported by the French Ministry of Health and the Institut National de la

Santé et de la Recherche Médicale (Inserm). The funders had no role in study design, data

collection, analysis, decision to publish, or preparation of the manuscript.

V.9 References

1. Liu, L., Johnson, H.L., Cousens, S., Perin, J., Scott, S., Lawn, J.E. et al. Global,

regional, and national causes of child mortality: an updated systematic analysis for

2010 with time trends since 2000.Lancet. 2012; 379: 2151–2161.

2. Howson, C.P., Kinney, M.V., McDougall, L., and Lawn, J.E. Born Toon Soon:

preterm birth matters.Reprod Health. 2013; 10: S1.

3. Boghossian, N.S., Page, G.P., Bell, E.F., Stoll, B.J., Murray, J.C., Cotten, C.M. et

al. Late-onset sepsis in very low birth weight infants from singleton and multiple-

gestation births. J Pediatr. 2013; 162: 1120–1124.

4. Cohen-Wolkowiez, M., Moran, C., Benjamin, D.K., Cotten, C.M., Clark, R.H.,

Benjamin, D.K. Jr. et al.Early and late onset sepsis in late preterm infants. Pediatr

Infect Dis J. 2009; 28: 1052–1056.

5. Venkatesh, M.P., Placencia, F., and Weisman, L.E. Coagulase-negative

staphylococcal infections in the neonate and child: an update. Semin Pediatr Infect

Dis. 2006; 17: 120–127.

6. Rasigade, J.-P., Raulin, O., Picaud, J.-C., Tellini, C., Bes, M., Grando, J. et

al. Methicillin-resistantStaphylococcus capitis with reduced vancomycin susceptibility

causes late-onset sepsis in intensive care neonates. PLoS ONE. 2012; 7: e31548.

CHAPITRE V

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 149

7. D’mello, D., Daley, A.J., Rahman, M.S., Qu, Y., Garland, S., Pearce, C. et

al. Vancomycin heteroresistance in bloodstream isolates of Staphylococcus

capitis. J Clin Microbiol. 2008; 46: 3124–3126.

8. Van Der Zwet, W.C., Debets-Ossenkopp, Y.J., Reinders, E., Kapi, M., Savelkoul,

P.H., Van Elburg, R.M. et al. Nosocomial spread of a Staphylococcus capitis strain

with heteroresistance to vancomycin in a neonatal intensive care unit. J Clin

Microbiol. 2002; 40: 2520–2525.

9. Cui, B., Smooker, P.M., Rouch, D.A., Daley, A.J., and Deighton, M.A. Differences

between two clinicalStaphylococcus capitis subspecies as revealed by biofilm,

antibiotic resistance, and pulsed-field gel electrophoresis profiling. J Clin

Microbiol. 2013; 51: 9–14.

10. Goering, R.V. Molecular epidemiology of nosocomial infection: analysis of

chromosomal restriction fragment patterns by pulsed-field gel electrophoresis. Infect

Control Hosp Epidemiol. 1993;14: 595–600.

11. Tenover, F.C., Arbeit, R.D., Goering, R.V., Mickelsen, P.A., Murray, B.E., Persing,

D.H. et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-

field gel electrophoresis: Criteria for bacterial strain typing. J Clin

Microbiol. 1995; 33: 2233–2239.

12. Goering, R.V., Morrison, D., Al-Doori, Z., Edwards, G.F.S., and Gemmell,

C.G. Usefulness of mec-associated direct repeat unit (dru) typing in the

epidemiological analysis of highly clonal methicillin-resistant Staphylococcus

aureus in Scotland. Clin Microbiol Infect. 2008; 14: 964–969.

13. Kondo, Y., Ito, T., Ma, X.X., Watanabe, S., Kreiswirth, B.N., Etienne, J. et

al. Combination of multiplex PCRs for staphylococcal cassette chromosome mec type

assignment: Rapid identification system for mec, ccr, and major differences in

junkyard regions. Antimicrob Agents Chemother. 2007; 51: 264–274.

14. Thomas, J.C., Vargas, M.R., Miragaia, M., Peacock, S.J., Archer, G.L., and Enright,

M.C. Improved multilocus sequence typing scheme for Staphylococcus

epidermidis. J Clin Microbiol. 2007; 45: 616–619.

15. Lemriss, H., Lemriss, S., Martins-Simoes, P., Butin, M., Lahlou, L., Rasigade, J.P. et

al. Genome sequences of four Staphylococcus capitis NRCS-A isolates from

geographically distant neonatal intensive care units. Genome

Announc. 2015; 3: e00501–e00515.

CHAPITRE V

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 150

16. Lemriss, H., Martins Simões, P., Lemriss, S., Butin, M., Ibrahimi, A., El Kabbaj, S. et

al. Non-contiguous finished genome sequence of Staphylococcus capitis CR01

(pulsetype NRCS-A). Stand Genomic Sci. 2014; 9: 1118–1127.

17. Bertels, F., Silander, O.K., Pachkov, M., Rainey, P.B., and van Nimwegen,

E. Automated reconstruction of whole-genome phylogenies from short-sequence

reads. Mol Biol Evol. 2014; 31: 1077–1088.

18. Satola, S.W., Farley, M.M., Anderson, K.F., and Patel, J.B. Comparison of detection

methods for heteroresistant vancomycin-intermediate Staphylococcus aureus, with the

population analysis profile method as the reference method. J Clin

Microbiol. 2011; 49: 177–183.

19. Clark, R.H., Bloom, B.T., Spitzer, A.R., and Gerstmann, D.R. Reported medication

use in the neonatal intensive care unit: data from a large national data

set. Pediatrics. 2006; 117: 1979–1987.

20. Poyart, C., Réglier-Poupet, H., Tazi, A., Billoët, A., Dmytruk, N., Bidet, P. et

al. Invasive group B streptococcal infections in infants, France. Emerg Infect

Dis. 2008; 14: 1647–1649.

V.10 Supplementary data

Table V.S1: Characteristics of 7 house-keeping genes and related primers 389 used for the

determination of the genetic relationships between 14 S. capitis isolates.

To characterize the genetic relationships between the 14 S. capitis isolates from neonatal

intensive care units (NICUs) patients (n=12) and adult patients (n=2), seven housekeeping

genes per isolate, selected on the basis of the published S. epidermidis MLST scheme (10),

were amplified and sequenced. New consensus primers were designed using Primer3 and the

consensus sequence obtained for each gene from the multiple alignments (Muscle algorithm)

of the 4 publicly available S. capitis genomes (GeneBank). Amplification were performed in

a 25 µL volume using Taq polymerase 0.625 U (0.025 U/µL), MgCl 2 1.5mM, dNTP 0.2

mM, buffer 10X, primers 10 pmol (0.4 pmol/µL) for each primer and extracted 398 DNA (2

µL). The amplification program consisted of: an initialization step of heating to 95°C for 3

minutes, 34 amplification cycles (denaturation at 95°C for 30 seconds, annealing at Tm 400 =

58°C for 60 seconds and extension at 72°C for 90 seconds) and a final elongation step at 401

72°C for 10 minutes. For each gene, sequences were aligned against the respective allele in S.

CHAPITRE V

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 151

epidermidis strain RP62A and trimmed to encompass only the allelic region described in S.

epidermidis MLST (10).

Genes Primers

Name Function 5'-->3' product

size

(bp)

Tm

(°C)

length

(bp)

arcC carbamate kinase arcC_F: GGTGGTAATGCGATTCAGACG 7 792 58,8 21

arcC_R: ATGTGTACCTGCTTGCTTGT 57,7 20

aroE shikimate

dehydrogenase

aroE_F: TGAAATTTGCAGTAATTGGCCA 745 57,4 22

aroE_R: CCTGTCCAAATTTTAAAGCTTTCAGC 60,1 26

tcyC ABC transporter tcyC_F: ACCGAAGTGATTAAAGGYATTGATTT 641 60,1 26

tcyC_R: TGATTAAACATTTCGTCTGGCG 57,7 22

mutS DNA mismatch repair

protein

mutS1_F: TGGCGAATGTAACACCRATGA

mutS1_R: ACGT TTGGCATAGAAGTCCA

764 60,1

57,1

20

21

pyrR pyrimidin operon

regulatory protein

pyrR_F: TCATTTTAGATGAAGCCGCGA

pyrR_R: TCACTGCRTTCTGAKKATCAA

504 58,1 57,7

21

21

tpiA triphosphate isomerase tpiA_F: TGAGAACACCAATTATAGCCGGA 710 59,5 23

tpiA_R: GCCACCTACTAATGCACCATCA 60,4 22

atoB acetyl coenzyme A acetyltransferase

atoB_F: GCATATCGTACACCTATTGGCG 756 59,3 22

atoB_R: CATCACTAACATCGCAGCCG 59,4 20

Table V.S2: Profiles of the MLST-like approach of S. capitis bloodstream isolates from

neonates (n=12) and 409 adults (n=2).

The sequences of the 7 house-keeping genes of 2 adult patients S. capitis isolates (isolate 1

and 2) and 12 NICU S.capitis isolates (isolates 3 to 14) were aligned and the number of single

nucleotide polymorphisms (SNPs) were compared side-by- side. Then, a number was given to

each allele for each of the 7 genes (NB: the order of the numbers was arbitrary defined). The

numbers corresponding to the 7 alleles were aligned (in the following order: arcC, aroE, tcyC,

mutS, pyrR, tpiA and atoB.) for each of the 14 S. capitis isolates and we compared the

obtained allelic profiles.

CHAPITRE V

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 152

Isolate Patient

Setting

Country Number of SNPs between isolates

(pairwase comparaison)

Allelic profile of each isolate

Genes

Alleles

1 2 3 4 5 6 7 8 9 10 11 12 13 14 arcC aroE tcyC mutS pyrR tpiA atoB

ST20091315 Adult France 2 3 3 2 1 2 2 2332122

ST20090912 Adult France 0 2 3 3 2 1 2 2 2332122

ST20121575 Adult Australia 32 32 1 1 1 1 1 1 1 1111111

ST20111770* Adult UK 32 32 0 1 1 1 1 1 1 1 1111111

ST20111771 Adult UK 32 32 0 0 1 1 1 1 1 1 1 1111111

ST20121573* Adult Australia 33 33 1 1 1 1 2 1 1 1 1 1 1211111

ST20121574 Adult Australia 32 32 0 0 0 1 1 1 1 1 1 1 1 1111111

ST20111772* Adult Belgium 32 32 0 0 0 1 0 1 1 1 1 1 1 1 1111111

ST20111773 Adult Belgium 32 32 1 1 1 2 1 1 1 4 1 1 1 1 1 1411111

ST20111774 Adult Belgium 32 32 1 1 1 2 1 1 2 1 5 1 1 1 1 1 1511111

ST20131580 Adult France 33 33 1 1 1 2 1 1 2 2 1 1 2 1 1 1 1 1121111

ST20111775* Adult France 32 32 0 0 0 1 0 0 1 1 1 1 1 1 1 1 1 1 1111111

BACAD74 Adult France 32 32 0 0 0 1 0 0 1 1 1 0 1 1 1 1 1 1 1 1111111

ST20111769 Adult UK 32 32 0 0 0 1 0 0 1 1 1 0 0 1 1 1 1 1 1 1 1111111

*available genomes

CHAPITRE V

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 153

Figure V.S1. Molecular characterization of S. capitis bloodstream isolates from neonates

(n = 12) and adult patients (n = 2).

Figure V.S2. Flow diagram of isolate selection.

153

CHAPITRE VI

DISCUSSION GENERALE

ET PERSPECTIVES

CHAPITRE VI

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 154

L'adaptation des bactéries à leur niche écologique constitue un élément majeur permettant

l'évolution de leurs génomes (Altermann, 2012). Cette évolution est un processus complexe

qui se fait par plusieurs mécanismes tels que les mutations, les réarrangements génétiques ou

par les événements de transferts horizontaux de gènes (Juhas et al., 2009). Le transfert

horizontal de gènes joue un rôle important dans l'évolution des bactéries et permet

l'acquisition de nouvelles fonctions ou de nouveaux caractères phénotypiques (Smith et al.,

1992, 1993 ; Koonin et al., 2001). Ce transfert de gène est plus lié à la coexistence des

espèces au sein d'une même niche écologique qu'au rapprochement taxonomique entre les

bactéries (Brochier et al., 2004). L'utilisation répandue d'antibiotiques en association avec une

hygiène hospitalière intense a entraîné l'émergence de bactéries résistantes aux médicaments

qui sont adaptées pour prospérer chez les patients hospitalisés.

Les staphylocoques demeurent immuablement des pathogènes majeurs en pathologie humaine

et animale. Nos connaissances sur leur épidémiologie, leur biologie, leur virulence, et leur

résistance ne cessent de progresser avec l’utilisation d’outils toujours plus précis et

performants.

Les humains sont le principal réservoir des staphylocoques. L'acquisition staphylococcique se

fait directement par contact des mains ou des fluides corporels des individus infectés

(colonisés). La transmission peut également se produire par contact indirect d'objets

colonisés, y compris les stéthoscopes, les vêtements et l'équipement. Les staphylocoques de la

peau du nourrisson peuvent causer une infection, généralement après une rupture de la peau

(lésion) ou l'intégrité des membranes muqueuses avec des cathéters et des tubes (Fonseca et

al., 1994). Il a été suggéré, depuis les années 1960, que les personnes qui travaillent dans la

santé (corps médicaux des hôpitaux) sont une source majeure d'infection staphylococcique,

mais des données récentes ont montré que la colonisation maternelle augmente également le

risque de colonisation staphylococcique chez les nouveau-nés, par transmission verticale et

allaitement (Jimenez-Truque et al., 2012 ; Leshem).

Dans les services de réanimation néonatale, les infections néonatales tardives (survenant après

3 jours de vie) représentent une cause majeure de mortalité et de morbidité (Stoll et al., 2002 ;

Venkatesh et al., 2006). Ces infections nosocomials sont particulièrement fréquentes chez les

prématurés, qui sont à la fois immatures sur le plan immunitaire et exposés à des

thérapeutiques parfois invasives. Plusieurs facteurs de risque ont été identifiées, notamment le

faible âge gestationnel et le faible poids de naissance (Johnson-Robbins et al., 2011). En cas

CHAPITRE VI

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 155

d’infection néonatale précoce, les germes les plus fréquemment identifiés sont Streptococcus

agalactiae (streptocoque du groupe B) et Escherichia coli, et en cas d’infection tardive, plus

de la moitié des bactéries impliquées sont des cocci à Gram positif, en premier lieu desquels

on retrouve les staphylocoques à coagulase négative et dont l’espèce Staphylococcus

epidermidis est la plus prévalente dans ce contexte (Klingenberg et al., 2007). Parmi les autres

espèces, Staphylococcus capitis est rarement rapporté dans les bactériémies et chez l’adulte, il

est le plus souvent considéré comme un contaminant en cas d’isolement dans les

hémocultures (Ruhe et al., 2004). Les souches présentent généralement une faible virulence et

une résistance aux béta-lactamines, justifiant un traitement par la vancomycine en première

intention (en cas de sepsis) (Krediet et al., 2001 ; Huang et al., 2006 ).

Le CNR des staphylocoques a rapporté en 2012 une fréquence particulièrement élevée des

septicémies nosocomiales à Staphylococcus capitis chez les nouveaux nés de petit poids de

naissance au sein des deux services de réanimation néonatale de Lyon, d’autres villes

françaises et dans de nombreux pays à travers le monde sur une large échelle de temps, alors

qu’il n’est jamais retrouvé chez les adultes. La caractérisation moléculaire (électrophorèse en

champs pulsés « PFGE ») et microbiologique (profil phénotypique, biochimique et résistance

aux antibiotiques) de ces souches avait permis de montrer que l’ensemble des souches

appartenait à un même clone NRCS-A (Van Der Zwet et al., 2002 ; Venkatesh et al., 2006 ;

Rasigade et al., 2012 ; D'mello et al., 2012 ; Boghossian et al., 2013 ; Cui et al., 2013). Les

représentants de NRCS-A présentent un profil de résistance atypique aux antibiotiques,

associant une résistance à l’ensemble des béta-lactamines, aux aminosides, ainsi qu’une

sensibilité diminuée (résistance ou hétérorésistance) aux glycopeptides. Cette multi-résistance

peut avoir des impacts en termes de traitement puisque la vancomycine est l’antibiotique de

choix en cas d’infection néonatale à staphylocoque à coagulase négative. Ces résultats ont

motivé l’étude de ce pathogène qui a fait l’objet d’une collaboration avec le Centre Nationale

de Référence des staphylocoques, Lyon, France, le Laboratoire de Recherche et d’analyse

Médicale de la Fraternelle de la Gendarmerie Royal (LRAM), Rabat et le Laboratoire de

Biotechnologie Médicale (Medbiotech), Rabat. Ce travail de doctorat contribue à la

compréhension du profil multi-résistant de cette espèce habituellement sensible et qui a pu

être isolée dans plusieurs pays à travers le monde, spécifiquement en néonatologie, à la

recherche de facteurs de virulence spécifique et à la compréhension des raisons de

dissémination mondiale dans les NICU de ce clone endémique (S. capitis pulsotype NRCS-

A), ainsi que son affinité pour les nouveau-nés (ne sont actuellement pas élucidées). Ce travail

CHAPITRE VI

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 156

permet également d'étudier plus en profondeur son écologie afin de mieux comprendre

l’évolution et les liens phylogénétiques existants entre ces souches d’origines géographiques

variées par l’approche de séquençage haut débit, typage moléculaire et analyse de génomique

comparative en utilisant plusieurs outils bioinformatiques.

Bien qu’il soit principalement restreint aux études de recherche actuellement, le séquençage

du génome bactérien des isolats cliniques devient de plus en plus utilisé car le coût du

séquençage de l'ADN continue de diminuer (Koser et al., 2012 ; McAdam et al., 2014). En

microbiologie, les technologies de séquençage nouvelle génération ont notamment été

appliquées au séquençage de génomes entiers (par exemple, Mycoplasma pneumoniae ou

Pneumocytis jirovecii), (Kenri et al., 2012 ; Cissé et al., 2012) pour la recherche et

l’identification de mutations associées à la résistance aux antirétroviraux, (Dudley et al.,

2012 ; Larrat et al., 2013) à l’étude de la cinétique d’apparition de ces mutations sous

traitement, à l’étude de populations et de variants minoritaires (exemples des virus HCV

(Lauck et al., 2012 ; et de la grippe (Yasugi et al., 2010)) et à l’étude des microbiomes

intestinaux ou pulmonaires (Monira et al., 2011 ; Delhaes et al., 2013). Le potentiel de

l’utilisation de ces technologies en microbiologie clinique est énorme, en particulier en ce qui

concerne le développement de PCR diagnostiques ou de tests sérologiques, la détection de

facteurs de virulence et de gènes de résistance aux antibiotiques et l’épidémiologie de

bactéries pathogènes (Shields et al., 2012; Larrat et al., 2013).

Actuellement, de nombreux génomes bactériens ont été séquencés entièrement ou

partiellement (plus 219 000 projets) sont mentionnés sur le site GOLD

(http://www.genomesonline.org/). Le montage d’un projet de séquençage d’un génome est un

processus long qui demande du temps pour mobiliser des ressources à la fois financières,

techniques, humaines et informatiques. Ce décalage entre d’une part, les innovations et

progrès des NGS et, d’autre part, la réalité de la recherche, constitue également une difficulté

dans le choix de la stratégie de séquençage et d’assemblage d’un génome comme décrit dans

le chapitre I.

La génomique bactérienne a apporté une meilleure compréhension des mécanismes

d’évolution des génomes bactériens. L’obtention d’une culture pure est une étape essentielle

pour relier le phénotype particulier d’une souche bactérienne à son contenu en gènes,

notamment pour étudier spécifiquement sa virulence, sa pathogénicité ou sa résistance. Ainsi,

les comparaisons génomiques ont montré que le transfert horizontal de gènes était chez les

bactéries le principal moyen d’acquérir de nouvelles fonctions. Ces acquisitions peuvent être

CHAPITRE VI

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 157

suivies d’une réduction génomique drastique lors de l’adaptation à l’environnement. L’étude

des génomes bactériens réduits a également permis de comprendre comment les changements

dans la pression de sélection entrainaient l’évolution. Donc la génomique bactérienne est utile

aux microbiologistes, aux infectiologues et aux spécialistes en hygiène hospitalière (Tettelin,

et al., 2005 ; Deschamps et al., 2009).

Les étapes d’un projet de génomique incluent 6 phases principales: le choix de l’espèce et/ou

de l’échantillon à séquencer, l’extraction d’ADN, le séquençage proprement dit, l’assemblage

des séquences obtenues, la fermeture des trous («gap closure » en anglais), l’annotation et

enfin l’exploitation des données. Notons que l’étape de «gap closure» représente plus de 80%

des efforts d’un projet de génomique. Ainsi, dans un but d’application médicale, il est

particulièrement intéressant d’utiliser un génome sans effectuer cette étape, afin de réduire les

coûts et les efforts jusqu’à l’obtention de l’information utile.

Dans le cas de notre étude pour S. capitis, aucun génome complet et de bonne qualité n’était

disponible dans les bases de données publiques. C'est ainsi que le séquençage et l'assemblage

du génome de S. capitis CR01 que nous avons réalisé, constitue une étape importante dans

l'étude de cette espèce émergente (chapitre II). La majorité des projets de séquençage de

S.capitis au début de ma thèse ont utilisé une seule technique de séquençage (NCBI, Chapitre

I). Dans le cas de la souche S.capitis CR01, le séquençage a été réalisé en combinant deux

technologies : Pyroséquençage (GFLX+Titanuim) et PacBio (SMART). Ainsi, nous avons pu

faire un double contrôle de la séquence génomique, obtenir un génome draft et fermer les

scaffolds de la séquence génomique par la suite donnant le premier génome de référence et

éliminer les erreurs de séquençage liées aux homopolymères (Loman et al., 2012). Ces erreurs

qui surviennent au niveau des régions d'homopolymères peuvent biaiser l'analyse et générer

de faux InDels (Chapitre IV). Durant le processus d'assemblage des génomes, plusieurs

critères et indices sont à prendre en considération pour évaluer la qualité de l'assemblage tel

que le N50 des contigs et scaffolds, la couverture, le taux d'erreurs d'assemblage, le nombre de

contigs et scaffolds, et la taille totale de l'assemblage (Ekblom et Wolf, 2014). La séquence

complète de S.capitis CR01 a été assemblée sous forme d'un seul chromosome circulaire de

2,522,871 bp désigné comme le premier génome de référence publié dans les base de données

et un plasmide de 26.140 bp (chapitre II).

Dans une approche similaire nous avons effectué un projet de séquençage à haut débit (un

seul run) pour 8 isolats cliniques de la souche de S.capitis collecté entre 2000 et 2009 des

CHAPITRE VI

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 158

NICU à partir des origines géographique différentes (Chapitre III). L’annotation

automatique et expert des séquences de génome S.capitis CR01, CR02, CR03, CR04, CR05,

CR06, CR07, CR08 et CR09 ont été réalisé sur la platforme MaGe. La souche CR01 et ces

isolats ont été identifiés préalablement par spectrométrie de masse MALDI TOF (chapitre I).

La séquence génomique de S.capitis CR01 a été ensuite utilisée comme référence dans la

recherche des caractéristiques génomiques et les analyses de génomique comparative par

rapport aux 8 souches de S.capitis (CR02, CR03, CR04, CR05, CR06, CR07, CR08 et CR09)

et les autres staphylocoques disponibles dans les bases de données (Chapitre IV, V). Ce

travail est la première étude dans le monde chez S.capitis d’origine néonatale.

Dans ce contexte, les nouvelles techniques de séquençages (NTS) représentent un moyen

indispensable pour comprendre les différents mécanismes de résistance, leur base génétique et

leur dissémination intercontinentale. L’étude des génomes de pathogènes multirésistants a

ainsi permis de mieux décrire les principaux modes de transmission des déterminants de la

résistance par l’échange d’éléments génétiques mobiles, notamment chez des isolats cliniques

de Staphylococcus aureus, d’Enterobacteriaceae, d’Acinetobacter baumannii et

de Pseudomonas aeruginosa (Fournier et al., 2006 ; Diene et al., 2013). Ces éléments

génétiques mobiles, codant parfois pour de multiples gènes de résistance aux antibiotiques et

aux métaux lourds, permettent à ces bactéries multirésistantes (BMR) de persister dans les

milieux hospitaliers et de résister à presque tous les antibiotiques communément prescrits

(Bush et al., 2011).

Les structures hospitalières sont souvent confrontées à des épidémies bactériennes causées par

des pathogènes nosocomiaux tels que les Staphylococcus aureus résistant à la méticilline

(SARM), les BMR composées principalement des entérobactéries (Klebsiella pneumoniae, E.

coli, Enterobacter cloacae, etc.), et des bacilles non fermentatifs tels qu’A. baumannii et P.

aeruginosa (Witney et al., 2014 ; Lee et al., 2014).

Plusieurs études rapportent l’utilisation des NTS comme outils d’investigation pour

comprendre la dissémination de souches à l’échelle d’un hôpital, d’une région, ou même d’un

continent (Rasko et al., 2011; Lavezzo et al., 2013).

Dans une étude publiée en 2012, Vogel et coll. ont rapporté l’usage des NTS pour étudier et

comprendre la persistance et la diffusion d’une souche clonale de S. aureus ST228 au CHUV

sur une période de dix ans (Vogel et al., 2012). Le séquençage et la comparaison génomique

CHAPITRE VI

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 159

de huit souches de S. aureus isolées entre 2001 et 2008 ont mis en évidence des changements

génétiques tels que l’acquisition d’un plasmide, la perte d’un large fragment génomique et des

insertions de transposases. En 2013, Lavezzo et coll. ont étudié une épidémie de N.

meningitidis caractérisée par un taux de mortalité élevé dans le nord-est de l’Italie. Alors que

l’investigation de cette épidémie avec les méthodes conventionnelles telles que le typage

moléculaire (MLST), l’électrophorèse en champ pulsé (PFGE) et les tests sérologiques

concluaient à la diffusion d’un même clone de N. meningitidis ST-11, le séquençage et la

comparaison génomique de certaines souches ont mis en évidence des différences génomiques

et des acquisitions de gènes ayant significativement contribué à la pathogénicité de ces

souches (Lavezzo et al., 2013). Dans une autre étude comparative publiée en 2014, SenGupta

et al., ont typé un panel de 44 SARM collectés sur une période de trois ans à travers l’état de

Washington aux Etats-Unis à l’aide de plusieurs méthodes dont le séquençage du génome

complet. A la différence des techniques de typage moléculaires, le séquençage du génome

complet a établi le caractère unique de chacune des souches, suggérant que les autres

méthodes comportent le risque d’identifier par erreur des épidémies (SenGupta et al., 2014).

Un autre exemple pour les staphylocoques à coagulase négative Staphylococcus

haemolyticus une cause émergente d'infections nosocomiales, affectant principalement les

patients immunodéprimés, une analyse génomique comparative a été effectuée sur des isolats

cliniques de S. haemolyticus pour étudier leur relation génétique et explorer les séquences

génomiques en ce qui concerne les déterminants de la résistance aux antimicrobiens et

l'adaptation hospitalière (Cavanagh et al., 2014).

Les analyses génomiques réalisées pendant ma thèse avec le génome draft de S.capitis CR01

(dans un premier temps), le génome fermé de la même souche, trois génomes des souches

NRCS-A (CR03, CR04, CR05), les six génomes non-NRCS-A S. capitis et les autres

staphylocoques disponible dans les bases de données ont montré une corrélation entre les

caractéristique microbiologique et typage moléculaire (Chapitre IV).

Nous avons identifié six gènes de résistance aux antimicrobiens, tous portés par des éléments

génétiques mobiles. Les gènes de virulence ont montré qu'aucun des gènes connus de la

virulence staphylococcique n'est exclusivement porté par le clone NRCS-A. Fait intéressant,

le virulome du génome NRCS-A S. capitis était assez similaire à celui de S. epidermidis

RP62A, y compris les opérones icaABDCR et capABC liés au biofilm, les protéases Clp et les

copies multiples de Phenol Soluble Modulin (PSM) bêta type 1b en tandem (75% aa Identité

avec PSMbeta1b de la souche RP62) et un PSM alpha (59% aa identité) (Otto, 2012). Tous

CHAPITRE VI

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 160

les PSM ont été trouvés dans le même environnement génétique que dans le génome RP 62A

de S. epidermidis, avec la conservation des gènes en amont et en aval. Les présents dans les

génomes NRCS-A sont partagés avec les six génomes non-NRCS-A S. capitis. Dans

l'ensemble, 63 gènes sont spécifiques à la lignée NRCS-A, y compris 28 gènes situés dans la

cassette à résistance à la méticilline SCCmec. Parmi les 35 gènes restants, 25 sont de fonction

inconnue et 9 correspondent à un système de modification de restriction de type I

supplémentaire (n = 3), un opéron de méthylation de cytosine (n = 2) et un groupe de gènes

liés à la biosynthèse de teichoic Acides (n = 4). Fait intéressant, un dixième gène correspond à

un déterminant de la résistance à la nisine (gène nsr), une bactériocine sécrétée par des

concurrents de niche de souche NRCS-A potentiels dans le microbiote intestinal. Les

caractéristiques génomiques présentées ici soulignent la contribution des éléments génétiques

mobiles à l'émergence d'une résistance multiple aux antibiotiques dans le clone NRCS-A.

Aucun déterminant de virulence connu spécifique de NRCS-A n'a été détecté, ce qui ne

supporte pas un rôle de virulence en tant que force motrice de l'émergence de NRCS-A dans

les NICU dans le monde entier. Cependant, la présence d'un déterminant de la résistance à la

nisine sur le chromosome NRCS-A, mais pas dans d'autres souches de S. capitis et la plupart

des représentants coagulase négatifs, pourrait conférer un avantage concurrentiel aux souches

NRCS-A pendant les premières étapes de la colonisation intestinale chez les nouveau-nés.

Cela suggère que l'adaptation frappante de NRCS-A à l'environnement NICU pourrait être

liée à sa résistance antimicrobienne spécifique et à une capacité possible accrue de défier les

bactéries concurrentes dans sa niche écologique.

Plusieurs gènes associés à la résistance aux antibiotiques ont été identifiés et corrélés avec le

phénotype de résistance spécifique précédemment rapporté pour le clone NRCS-A (Rasigade

et al., 2012). Tous sont situés sur des éléments génétiques mobiles (MGE). La résistance aux

aminoglycosides est liée à l'aminoglycosidéodification bifonctionnelle gène aacA-aphD, qui

est porté sur le transposon Tn4001 (numéro d'accès GenBank AB682805.1, Lyon et al.,

1984). La résistance à la méthicilline est due à la présence d'une cassette composite SCCmec-

SCCcad / ars / cop exclusivement présente dans le clone NRCS-A, publiée par notre équipe

(Chapitre IV). La comparaison génomique entre les quatre souches NRCS-A a montré que

cet élément mobile est presque identique (100% homologie) et quelques variations de

séquence nucléotidique ne se produisent que dans la région répétée CRISPR, comme cela est

prévu pour ces régions et comme indiqué dans le chapitre IV. Enfin, l'opéron bla, codant

CHAPITRE VI

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 161

pour la bêta-lactamase blaZ et ses régulateurs, est présent dans toutes les souches NRCS-A, à

l'exception de la souche CR05 (UK).

Les analyses bioinformatiques ont montré un prophage intacte a été identifiée dans les quatre

génomes NRCS-A. Cette région montre une homologie (100% d'identité) avec les génomes

des souches CR01, CR03 et CR04, mais elle est dégénérée dans CR05. En outre, ce phage

présente une forte homologie à un phage présent dans la souche VCU116 et moins de 30%

d'homologie avec le phage Staphy_StB20_ (NCBI Ref. Seq. NC_019915), le phage le plus

proche trouvé dans la base de données NCBI. Il est à noter que deux régions de prophage

incomplètes supplémentaires ont également été détectées dans la souche CR05.

Dix-neuf éléments de séquence d'insertion distincte (IS), le regroupement en trois familles

distinctes (type IS256, n = 4; type IS1272, n = 5; IS431mec, n = 10) ont été identifiés dans le

génome CR01. La présence du type IS256 a été confirmée dans les quatre souches NRCS-A.

Le type IS1272 était également trouvé dans les souches CR03 et CR04, mais pas dans la

souche CR05, et leurs emplacements génomiques ne sont pas conservés. Deux cassettes

IS431mec sont présentes dans tous les génomes NRCS-A, car ils sont transportés dans

l'élément SCCmec-SCCcad / ars / cop spécifique à et conservé parmi la lignée NRCS-A

(Chapitre IV). Les IS trouvé chez les 3 souches de S. capitis CR03, CRO4 et CR05 sont

moins car la technologie SMART a corrigé les erreurs de pyroséquençage (homoplymère).

En ce qui concerne les autres familles antimicrobiennes, pour lesquelles la variabilité des

profils de résistance a été observée chez les isolats NRCS-A, les tests de sensibilité aux

antimicrobiens phénotypiques correspondent au contenu spécifique du gène de résistance de

chaque souche NRCS-A. Les gènes plasmidic msrA et tetK, impliqués respectivement dans la

résistance à l'érythromycine (avec un test D négatif) et la résistance à la tetracycline, n'ont été

identifiés que dans la souche CR04 (Australie). Dans la souche CR05 (UK), le gène lointain,

qui est responsable de la fusion Résistance à l'acide, est porté par un phage putatif.

Le nisine, un peptide antimicrobien de 34 aa produit par un groupe d'espèces Lactococcus et

Streptococcus Gram-positives (Shin et al., 2016), est actif contre une large gamme de

bactéries gram-positives, y compris les staphylocoques. Son mode d'action est double,

impliquant l'inhibition de la biosynthèse de la paroi cellulaire (étape de transglycosylation),

puisqu'elle se lie et sèche le lipide II à partir de son emplacement fonctionnel et la formation

des pores (Wiedemann et al., 2001; Peschel and Sahl, 2006; Egan et al., 2016). Le Nisin a été

décrit comme un acteur clé de la barrière intestinale, et il est largement utilisé comme

CHAPITRE VI

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 162

conservateur d'aliments en raison de son activité bactéricide puissante. De plus, il a été montré

que l'expression du gène nsr, identifié dans Streptococcus agalactiae, dans L. lactis ne

produisant pas de nisine induit une résistance à la nisine et la présence de bactéries lactiques à

base de nisine dans l'intestin réduit colonisation intestinale par des entérocoques résistant à la

vancomycine (Millette et al., 2008).

L’ensemble de ces données et nos résultats suggèrent fortement que la résistance à la nisine

pourrait être responsable de l'augmentation potentielle de la capacité du clone NRCS-A à

s'établir dans le cadre de la microflore initiale des nouveau-nés, dans laquelle le genre

Lactococcus est l'un des taxons bactériens dominants (Park et al., 2005; Morelli, 2008).

L'expression de la peptidase NSR pourrait permettre aux isolats NRCS-A de s'établir dans

l'intestin des nouveau-nés et aussi de le coloniser et de survivre plus longtemps que les

bactéries sensibles à la nisine. Cela peut expliquer la surreprésentation de ces isolats dans les

processus de séquesse, soit par translocation directe dans le sang (Taft et al., 2015), soit par la

colonisation de dispositifs d'habitation.

Dans cette étude, nous avons cherché à explorer la possibilité de la distribution mondiale du

clone NRCS-A en appliquant diverses méthodes moléculaires (PFGE Sma et SacII, typage

SCCmec, MLST, Dru typing et analyse phylogénétique des génomes complet après WGS)

d’une part, et à savoir la capacité spécifique in vitro de ce clone NRCS-A à acquérir

l’hétérorésistance à la vancomycine sous pression sélective d’autre part.

Dans le cadre de l’étude de sensibilité diminuée du clone NRCS-A aux glycopeptides, des

travaux d’analyse comparative sur les deux souches de S.capitis CR06, et CR08 a permis de

montrer que le clone NRCS-A était capable de s’adapter rapidement sous pression de

sélection par la vancomycine in vitro. Cette acquisition de résistance à la vancomycine était

associée à une résistance croisée avec la teicoplanine et la daptomycine mais pas le linézolide,

et s’accompagnait d’une augmentation de l’épaisseur de la paroi bactérienne des souches

devenues résistantes.

Le traitement de la vancomycine est institué uniquement si une souche de CoNS isolée

d'hémoculture résistante à l'oxacilline et que la détérioration clinique du patient ne peut être

expliquée autrement. L'utilisation fréquente de vancomycine dans l'NICU pourrait avoir

donné à la souche hétérorésistante un avantage sélectif par rapport aux autres souches non-

résistantes (D'Angio et al., 1989 ; Van Der Zwet et al., 2002). L'étude de la vancomycine a été

décrite dans S. aureus, et il a été démontré qu'elle peut être la prédécesseur de

CHAPITRE VI

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 163

l'homorésistance (Hiramatsu et al., 1997). Le mécanisme de résistance à la vancomycine dans

les staphylocoques est complètement différent de celui des entérocoques résistant à la

vancomycine. Les gènes vanA, vanB et vanC n'ont jamais été trouvés dans les

staphylocoques, bien que, expérimentalement, le gène vanA ait été transféré des entérocoques

à S. aureus (Noble et al., 1992). Bien que le mécanisme génétique précis pour la résistance à

la vancomycine dans les staphylocoques attend l'élucidation, on considère que

l'épaississement de la couche de peptidoglycane de la paroi cellulaire est responsable (Hanki

et al., 1998 ; Sieradzki et al., 1997). La vancomycine est capturée dans la paroi cellulaire

épaissie et il est empêché d'atteindre ses cibles sur la membrane cellulaire.

Nous avons effectué un séquençage de génome entier de deux de souches de capitis NRCS-A

CR06 et CR08 inclues dans le modèle d’acquisition de résistance (souche initiale comparée

avec souches devenue résistante sous pression de sélection). La recherche de mutations

ponctuelles dans des gènes connus comme étant associés à la résistance aux glycopeptides

chez S. aureus (Howden et al., 2011), n’a pas permis de mettre en évidence ce type de

mutation chez S. capitis. En revanche, nous avons de façon surprenante mis en évidence une

délétion d’une fraction importante du génome de la bactérie (110 kb, soit une centaine de

gènes concernés), identique dans nos deux souches. L’analyse des génomes entiers de notre

collection internationale de souches cliniques de S. capitis, confrontée aux CMI de

vancomycine de ces mêmes souches, permettra peut-être de mettre en évidence les bases

génétiques du phénotype de résistance/hétérorésistance à la vancomycine chez NRCS-A.

En parallèle, au sein du CNR la technique de dru typing, qui consiste en la caractérisation

d’une zone hypervariable au sein de la cassette SCCmec et qui permet d’étudier la proximité

génétique de souches au sein d’un même clone. Sur 86 souches de S. capitis isolées chez des

nouveau-nés de 4 pays différents, 83 (96%) présentaient le même dru type dt11c. Ce dru type

dt11c n’était en revanche présent que chez 2 des 14 souches isolées de patients hors

réanimation néonatale (1 patient de 4 ans et 1 adulte), et les 12 souches restantes présentaient

une grande variété de dru types. En outre, un arbre phylogénétique a été construit sur la base

des génomes complets de cinq isolats de SNN. Cette analyse phylogénétique de ces cinq

isolats des différents pays preuve la haute parenté génétique dans le clone NRCS-A

La technique de MLST est reconnue comme une puissante méthode pour l’étude génétique

des populations bactériennes. Elle correspond à l’amplification et au séquençage de plusieurs

gènes dits « de ménage », dont la séquence comporte des fragments hautement conservés au

CHAPITRE VI

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 164

sein de l’espèce et des fragments variables. Les séquences obtenues sont comparées avec une

banque d’allèles établie au préalable, afin de déterminer le profil allélique unique ou «

Sequence Type » (ST) de chaque souche. Les avantages de cette technique sont la bonne

reproductibilité et la possibilité de comparer les souches entre les laboratoires (Maiden et al.,

1998 ; Urwin et al., 2003).

Ces différentes techniques ont permis de confirmer la diffusion mondiale d’un clone unique

de S. capitis, spécifiquement en réanimation néonatale. Cette observation constitue la

première description d’une dissémination internationale d’un clone de staphylocoque à

coagulase négative multi-résistant, phénomène jusque là décrit et connu uniquement pour

l’espèce S. aureus.

Ensemble, ces données démontrent de façon incontestable l'endémicité inhabituelle à l'échelle

mondiale du clone NRCS-A résistant aux médicaments multiples dans les NICU. Une fois

endémique dans une NICU, les souches NRCS-A exposent les nouveau-nés infectés à un

risque d'échec thérapeutique car le traitement de la septicémie néonatale impliquant des

staphylocoques à coagulase négative résistant à la méthicilline est habituellement basé sur la

vancomycine et les aminoglycosides auxquels les isolats NRCS-A ne sont pas susceptibles.

Dans de tels cas, les praticiens sont confrontés à des alternatives inconfortables: l'utilisation

continue de la vancomycine malgré le fait que le pathogène a été déclaré sans ambiguïté

comme étant résistant à cette molécule et l'utilisation d'agents antimicrobiens tels que le

linezolid ou la daptomycine qui conservent une efficacité in vitro contre CoNS, L'utilisation

chez les nouveau-nés n'a pas été approuvée par les autorités sanitaires. Pour faire face à ce

défi émergent, des études cliniques sur la tolérance et l'efficacité relatives de la vancomycine,

du linézolide et de la daptomycine chez les nourrissons infectés par l'infection à l'urine atteints

de ce nouveau syndrome de CoNS résistant à la vancomycine ont été urgentes.

Bien qu'il reste inconnu de savoir comment les souches de S. capitis NRCS-A sont capables

de translocation dans le flux sanguin des nourrissons, on suppose que le point d'entrée

pourrait être le tractus digestif, immature chez les nourrissons très prématurés (Taft et al.,

2015) . D'autres études sont nécessaires pour caractériser pleinement la microflore digestive

des prématurés à très faible poids et son impact potentiel sur le choix et l'avantage de forme

physique pour les isolats NRCS-A. Des études sur le niveau de portage de S. capitis NRCS-A

chez le nouveau-né sont en cours notamment au niveau digestif ainsi que des travaux

CHAPITRE VI

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 165

(modèles cellulaires ex vivo) explorant les mécanismes physiopathologiques à l’origine du

déclenchement des sepsis tardifs nosocomiaux.

REFERENCES

BIBLIOGRAPHIQUES

REFERENCES BIBLIOGRAPHIQUES

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 166

Ahn, S.M., Kim, T.H., Lee, S., Kim, D., Ghang, H., Kim, D.S., Kim, B.C., Kim, S.Y.,

Kim, W.Y., Kim, C. et al. (2009) The first Korean genome sequence and analysis: full

genome sequencing for a socio-ethnic group. Genome Res, 19, 1622-1629.

Altermann, E. (2012) Tracing Lifestyle Adaptation in Prokaryotic Genomes. Front.

Microbiol. 3.:48.

Anderson, S. (1981) Shotgun DNA sequencing using cloned DNase I-generated

fragments.Nucleic Acids Res. 9: 3015–3027.

Ahmadian A, Ehn M & Hober S. (2006). Pyrosequencing: history, biochemistry and future.

Clin Chim Acta. 363: 83-94.

Amaro, A., Duarte, E., Amado, A., Ferronha, H., Botelho, A., (2008) Comparison of three

DNA extraction methods for Mycobacterium bovis, Mycobacterium tuberculosis and

Mycobacterium avium subsp. avium. Lett. Appl. Microbiol. 47, 8-11.

Ameziane N, Bogard M, Lamoril J. (2005). Principes de biologie moléculaire en biologie

clinique. Collection Campus Référence Elsevier;

Altschul, S. F., Madden, T.L., Schaffer, A.A., Ahang, Z., Miller, W., et lipman, D.J.

(1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search

programs Nucleic Acids Res 25, 3389-3402.

Artur J. Sabat, Sandra M. Hermelijn, Viktoria Akkerboom, Amadu Juliana, John E.

Degener, Hajo Grundmann & Alexander W. Friedrich. (2017) Complete-genome

sequencing elucidates outbreak dynamics of CA-MRSA USA300 (ST8 spa t008) in an

academic hospital of Paramaribo, Republic of Suriname. Scientific Reports 7,

Article number: 41050

Aubry-Damon H, Legrand P, Brun-Buisson C, Astier A, Soussy CJ, Leclercq R. (1997)

Reemergence of gentamicin-susceptible strains of methicillin-resistant Staphylococcus

aureus. roles of an infection control program and changes in aminoglycoside use. Clin Infect

Dis, 25 (3) : 647-53.

Avery, O. T., Macleod, C. M., et McCarty, M. (1944) Studies on the chemical of inducing

transformation of pneumoccal types. Induction of transformation by a desoxyriboncleic acid

fraction isolated from Pneumococcus type III. 1944. Journal of Experimental Medcine 79,

137-158.

Azarian, T., Cook, R., Johnson, J., Guzman, N., McCarter, Y., Gomez, N., Salemi, M. (2015). Whole-Genome Sequencing for Outbreak Investigations of Methicillin-Resistant

Staphylococcus aureus in the Neonatal Intensive Care Unit: Time for Routine Practice?

Infection Control &Hospital Epidemiology, 36(7), 777-785.

Aziz RK, Bartels D, Best AA, DeJongh M, Disz T, Edwards RA, Formsma K, Gerdes S,

Glass EM, Kubal M, Meyer F, Olsen GJ, Olson R, Osterman AL, Overbeek RA, McNeil

LK, Paarmann D, Paczian T, Parrello B, Pusch GD, Reich C, Stevens R, Vassieva O,

Vonstein V, Wilke A, Zagnitko O. 2008. The RAST server: Rapid Annotations using

Subsystems Technology. BMC Genomics 9:75.

Baird-Parker, A.C. (1971). The grouping of staphylococci and micrococci. J Clin Pathol.

24, 769-770.

Bannerman T.L., Kloos W.E. (1991) Staphylococcus capitis subsp. ureolyticus subsp. nov.

from human skin, Int. J. Syst. Bacterial. 41: 144-147.

REFERENCES BIBLIOGRAPHIQUES

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 167

Bascomb, S. & Manafi, M. (1998) Use of enzyme tests in characterization and identification

of aerobic and facultative anaerobic Gram-positive cocci. Clin. Microbiol. Rev. 11, 318-340.

Bentley, D.R., Balasubramanian, S., Swerdlow, H.P., Smith, G.P., Milton, J., Brown,

C.G., Hall, K.P., Evers, D.J., Barnes, C.L., Bignell, H.R. et al. (2008) Accurate whole

human genome sequencing using reversible terminator chemistry. Nature, 456, 53-59.

Bentley, D.R. (2006) Whole-genome re-sequencing. Current opinion in genetics &

development, 16, 545-52, 10.1016/j.gde.2006.10.009.

Bertrand X, Costa Y, Pina P. [Surveillance of antimicrobial resistance of bacteria isolated

from bloodstream infections : data of the French National Observatory for Epidemiology of

Bacterial Resistance to Antibiotics (ONERBA), 1998-2003]. Med Mal Infect, 2005, 35 (6) :

329-34.

Berglund EC, Kiialainen A, Syvanen AC. (2011). Next generation sequencing technologies

and applications for human Genetic History and Forensics. Investigative Genetics, 2:23.

Bhattacharyya A, Stilwagen S, Ivanova N, D'Souza M, Bernal A, Lykidis A, Kapatral

V, Anderson I, Larsen N, Los T, Reznik G, Selkov E Jr, Walunas TL, Feil H, Feil

WS, Purcell A, Lassez JL, Hawkins TL, Haselkorn R, Overbeek R, Predki PF, Kyrpides

NC. (2003) Comparison of the genome sequences of Listeria monocytogenes and Listeria

innocua: clues for evolution and pathogenicity,” FEMS Immunol Med Microbiol., vol. 35, no.

3, pp. 207–13.

Bianco C, Arena F, Rossetti B, Tordini G, Migliorini L, Galluzzi P, Cerase A, De Luca

A, Rossolini GM, Montagnani F. (2014) First report of spondylodiscitis due to vancomycin

heteroresistant Staphylococcus capitis in immunocompetent host. J Infect Chemother

20(10):639–642.

Blow. (2008). DNA sequencing: generation next-next. Nat Methods 5:267—74.

Boetzer, M. and Pirovano, W. (2012) Toward almost closed genomes with GapFiller.

Genome Biol. 13: R56.

Boghossian NS, Page GP, Bell EF, et al. (2013) Late-onset sepsis in very low birth weight

infants from singleton and multiple-gestation births. J Pediatr. 162(6):1120–1124. 1124–e1.

Brochier, C., Forterre, P., and Gribaldo, S. (2004) Archaeal phylogeny based on proteins

of the transcription and translation machineries: tackling the Methanopyrus kandleri paradox.

Genome Biol. 5: R17.

Bronner S, Monteil H, Prevost G. (2004) Regulation of virulence determinants in

Staphylococcus aureus: complexity and applications. FEMS Microbiol Rev 28, 183-200.

Bryson K, Loux V, Bossy R, Nicolas P, Chaillou S, van de Guchte M, Penaud S, Maguin

E, Hoebeke M, Bessières P, and Gibrat JF. (2006) AGMIAL: implementing an annotation

strategy for prokaryotegenomes as a distributed system. Nucleic Acids Research. Jan vol. 34,

no. 12, pp. 3533–45.

Bush K, Courvalin P, Dantas G, et al. (2011) Tackling antibiotic resistance. Nat Rev

Microbiol, 9:894-6.

Buchrieser C, Rusniok C, Kunst F, Cossart P, Glaser P, and Consortium L. (2003)

Comparison of the genome sequences of Listeria monocytogenes and Listeria innocua: clues

for evolution and pathogenicity,” FEMS Immunol Med Microbiol., vol. 35, no. 3, pp. 207–13.

REFERENCES BIBLIOGRAPHIQUES

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 168

Cavanagh JP, Hjerde E, Holden MTG, Kahlke T, Klingenberg C, Flaegstad T, Parkhill

J, Bentley SD, Ericson Sollid JU. (2014) Whole-genome sequencing reveals clonal

expansion of multiresistant Staphylococcus heamolyticus in European hospitals. J Antimicrob

Chemother. 69:2920-7.

Chin, C.-S., Alexander, D.H., Marks, P., Klammer, A.A., Drake, J., Heiner, C., et al. (2013) Nonhybrid, finished microbial genome assemblies from long-read SMRT sequencing

data. Nat. Methods 10: 563–569.

Chiu, R.W., Chan, K.C., Gao, Y., Lau, V.Y., Zheng, W., Leung, T.Y., Foo, C.H., Xie, B.,

Tsui, N.B., Lun, F.M. et al. (2008) Noninvasive prenatal diagnosis of fetal chromosomal

aneuploidy by massively parallel genomic sequencing of DNA in maternal plasma. Proc Natl

Acad Sci U S A, 105, 20458-20463.

Cissé OH, Pagni M, Hauser PM. (2012) De novo assembly of the Pneumocystis jirovecii

genome from a single bronchoalveolar lavage fluid specimen from a patient. MBio.

4(1):e00428–00412.

Cochrane, G., Akhtar, R., Boniefld, J., Bower, L., Demiralp, F., Faruque, N., Gibson, R.,

Hoad, G., Hubbard, T., Hunter, C., et al. (2009a) Petabyte-scale innovations at the

European Nucleotide Archive. Nucleic Acids Res 37, D19-25.

Combes A, Luyt CE, Fagon JY, et al. (2004).Impact of methicillin resistance on outcome of

Staphylococcus aureus ventilator-associated pneumonia. Am J Respir Crit Care Med, 170 (7)

: 786-92.

Conlan S, Thomas PJ, Deming C, Park M, Lau AF, et al. (2014) Single-molecule

sequencing to track plasmid diversity of hospital-associated carbapenemase-producing

Enterobacteriaceae. Sci Transl Med 6: 254ra126.

Cui B, Smooker PM, Rouch DA, Daley AJ, Deighton MA. (2013) Differences between two

clinical Staphylococcus capitis subspecies as revealed by biofilm, antibiotic resistance, and

pulsed-field gel electrophoresis profiling. J Clin Microbiol. 51(1):9–14.

Darling A. E., Mau B., Perna N. T. (2010). progressiveMauve: multiple genome alignment

with gene gain, loss and rearrangement. PLoS ONE 5:e11147. 10.1371/journal.pone.0011147.

de Souza Rugolo LM, Bentlin MR, Mussi-Pinhata M, de AlmeidaMF, Lopes JM, Marba

ST, et al. (2014) Late-onset sepsis in very low birthweight infants: a Brazilian Neonatal

Research Network Study. JTrop Pediatr. 60:415---21.

D'Angio, C. T., K. L. McGowan, S. Baumgart, J. St. Geme, and M. C. Harris. 1989.

Surface colonization with coagulase-negative staphylococci in premature neonates. J.

Pediatr. 114:1029-1034.

Delhaes L, Botterel F. Que peut-on attendre du microbiote pulmonaire notamment du

mycobiome dans les pathologies pulmonaires chroniques telles que la mucoviscidose ?

Congrès de la Société Française de Mycologie Médicale - Dijon, France; 2013.

Deshpande P, Rodrigues C, Shetty A, Kapadia F, Hedge A, Soman R. (2010) New Delhi

Metallo-β-lactamase (NDM-1) in Enterobacteriaceae: treatment options with carbapenems

compromised. JAssoc Physicans I 58: 14 –149.

Diene SM, Rolain JM. (2013) Investigation of antibiotic resistance in the genomic era of

multidrug-resistant Gram-negative bacilli, especially Enterobacteriaceae, Pseudomonas and

Acinetobacter. Expert Rev Anti Infect Ther. 11:277-96.

REFERENCES BIBLIOGRAPHIQUES

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 169

D’Mello D, Daley AJ, Rahman MS, Qu Y, Garland S, Pearce C, Deighton MA. 2008.

Vancomycin heteroresistance in bloodstream isolates of Staphylococcus capitis. J. Clin.

Microbiol. 46:3124 –3126.

Dufour P, Gillet Y, Bes M, et al. (2002) Community-acquired methicillin-resistant

Staphylococcus aureus infections in France : emergence of a single clone that produces

Panton-Valentine leukocidin. Clin Infect Dis, 35 (7) : 819-24.

Dudley DM, Chin EN, Bimber BN, Sanabani SS, Tarosso LF, Costa PR, et al. (2012)

Low-cost ultra-wide genotyping using Roche/454 pyrosequencing for surveillance of HIV

drug resistance. Plos One. 7(5):e36494.

Egan K., Field D., Rea M. C., Ross R. P., Hill C., Cotter P. D. (2016). Bacteriocins: novel

solutions to age old spore-related problems? Front. Microbiol. 7:e461.

10.3389/fmicb.2016.00461.

Eid, J., Fehr, A., Gray, J., Luong, K., Lyle, J., Otto, G., et al. (2009) Real-Time DNA

Sequencing from Single Polymerase Molecules. Science 323: 133–138.

Ekblom, R. and Wolf, J.B.W. (2014) A field guide to whole-genome sequencing, assembly

and annotation. Evol. Appl. 7: 1026–1042.

Farhat MR, Shapiro BJ, Kieser KJ, Sultana R, Jacobson KR, et al. (2013) Genomic

analysis identifies targets of convergent positive selection in drug-resistant Mycobacterium

tuberculosis. Nat Genet 45: 1183–1189.

Fedurco M, Romieu A, Williams S, Lawrence I & Turcatti G. (2006) BTA, a novel

reagent forDNA attachment on glass and efficient generation of solid-phase amplified DNA

colonies.Nucleic Acids Res. 34: 22.

Ferry T, Perpoint T, Vandenesch F, Etienne J. (2005) Virulence determinants in

Staphylococcus aureus and their involvement in clinical syndromes. Curr Infect Dis Rep, 7

(6) : 420-8.

Ferry T, Bes M, Dauwalder O, et al. (2006) Toxin gene content of the Lyon methicillin-

resistant Staphylococcus aureus clone compared with that of other pandemic clones. J Clin

Microbiol, 44 (7) : 2642-4.

Fleischmann, R.D., Adams, M.D., White, O., Clayton, R.A., Kirkness, E.F., Kerlavage,

A.R., Bult, C.J., Tomb, J.-F., Dougherty, B.A., Merrick, J.M., et al. (1995) Whole-

genome random sequencing and assembly of Haemophilus influenzae Rd. Science, 269, 496-

512.

Fonseca SN, Ehrenkranz RA, Baltimore RS. (1994) Epidemiology of antibiotic use in a

neonatal intensive care unit. Infect Control Hosp Epidemiol. 15(3):156–62. 12.

Fournier PE, Vallenet D, Barbe V, et al. (2006) Comparative genomics of multidrug

resistance in Acinetobacter baumannii. PLoS Genet 2:e7.

Froggatt, J. W., J. L. Johnston, D. W. Galetto, and G. L. Archer. 1989. Antimicrobial

resistance in nosocomial isolates of Staphylococcus haemolyticus. Antimicrob. Agents

Chemother. 33:460-466.

Gram H (1884) Über die isolirte Färbung der Schizomyceten in Schnitt- und

Trockenpräparaten. Fortschritte der Medizin 2.

Gras-Le Guen C, Fournier S, Andre-Richet B, Caillon J, Chamoux C, et al. (2007)

Almond oil implicated in a Staphylococcus capitis outbreak in a neonatal intensive care unit. J

Perinatol 27: 713-717.

REFERENCES BIBLIOGRAPHIQUES

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 170

Greub G. (2013) Genomics of medical importance. Clin Microbiol Infect. 19:781-3.

Gaynor, A.M., Nissen, M.D., Whiley, D.M., Mackay, I.M., Lambert, S.B., Wu, G.,

Brennan, D.C., Storch, G.A., Sloots, T.P. and Wang, D. (2007) Identification of a novel

polyomavirus from patients with acute respiratory tract infections. PLoS Pathog, 3, e64.

Gill,S.R., Fouts,D.E., Archer,G.L., Mongodin,E.F., Deboy, R.T., Ravel, J., et al.

(2005).Insights on evolution of virulence and resistance from the complete genome analysis

of anearly methicillin-resistant Staphylococcus aureus strain and a biofilm-producing

methicillin-resistant Staphylococcus epidermidis strain. J.Bacteriol. 187,2426–2438.

Gonzalez BE, Rueda AM, Shelburne SA, 3rd, Musher DM, Hamill RJ, Hulten KG. (2006). Community-associated strains of methicillin-resistant Staphylococccus aureus as the

cause of healthcare-associated infection. Infect Control Hosp Epidemiol, 27 (10) : 1051-6.

Gupta PK. (2008) Single-molecule DNA sequencing technologies for future genomics

research. Trends Biotechnol. 26: 602-611.

Heilbronner,S., Holden,M.T., vanTonder,A., Geoghegan,J.A., Foster,T.J., Parkhill,J., et

al.(2011).Genome sequence of Staphylococcus lugdunensis N920143 allows identification of

putative colonization and virulence factors. FEMSMicrobiol.Lett. 322,60–67.

Hanaki H, Kuwahara-Arai K, Boyle-Vavra S, Daum RS, Labischinski H, Hiramatsu K.

(1998). Activated cell-wall synthesis is associated with vancomycin resistance in methicillin-

resistant Staphylococcus aureus clinical strains Mu3 and Mu50. J Antimicrob Chemother, , 42

(2) : 199-209.

Hanaki H, Labischinski H, Inaba Y, Kondo N, Murakami H, Hiramatsu K. (1998)

Increase in glutamine-non-amidated muropeptides in the peptidoglycan of vancomycin-

resistant Staphylococcus aureus strain Mu50. J Antimicrob Chemother, 42 (3) : 315-20.

Hanssen AM, Sollid JU. (2007). Multiple staphylococcal cassette chromosomes and allelic

variants of cassette chromosome recombinases in Staphylococcus aureus and coagulase-

negative staphylococci from Norway. Antimicrob Agents Chemother. May;51(5):1671-7.

Harris, T.D., Buzby, P.R., Babcock, H., Beer, E., Bowers, J., Braslavsky, I., et al. (2008)

Single-Molecule DNA Sequencing of a Viral Genome. Science 320: 106–109.

Harris SR, Feil EJ, Holden MT, Quail MA, Nickerson EK, et al. (2010) Evolution of

MRSA during hospital transmission and intercontinental spread. Science 327: 469–474

Higuchi W, Takano T, Teng LJ, Yamamoto T. (2008). Structure and specific detection of

staphylococcal cassette chromosome mec type VII. Biochem Biophys Res Commun. Dec

19;377(3):752-6.

Hiramatsu K, Katayama Y, Yuzawa H, Ito T. (2002) Molecular genetics of methicillin-

resistant Staphylococcus aureus. Int J Med Microbiol. Jul;292(2):67-74.

Hiramatsu, K., N. Aritaka, H. Hanaki, S. Kawasaki, Y. Hosoda, S. Hori, Y. Fukuchi,

and I. Kobayashi. 1997. Dissemination in Japanese hospitals of strains of Staphylococcus

aureus. heterogeneously resistant to vancomycin. Lancet 350:1670-1673.

Holden MT, Feil EJ, Lindsay JA, et al. (2004) Complete genomes of two clinical

Staphylococcus aureus strains: evidence for the rapid evolution of virulence and drug

resistance. Proc Natl Acad Sci USA 101, 9786-9791.

Holden MT, Hsu LY, Kurt K, Weinert LA, Mather AE, Harris SR, Strommenger

B, Layer F, Witte W, de Lencastre H, Skov R, Westh H, Zemlicková H, Coombs

G, Kearns AM, Hill RL, Edgeworth J, Gould I, Gant V, Cooke J, Edwards

REFERENCES BIBLIOGRAPHIQUES

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 171

GF, McAdam PR, Templeton KE, McCann A, Zhou Z, Castillo-Ramírez S, Feil

EJ, Hudson LO, Enright MC, Balloux F, Aanensen DM, Spratt BG, Fitzgerald

JR, Parkhill J, Achtman M, Bentley SD, Nübel U. (2013) A genomic portrait of the

emergence, evolution, and global spread of a methicillin-resistant Staphylococcus aureus

pandemic. Genome Res. Apr;23(4):653-64. doi: 10.1101/gr.147710.112.

Holley, R.W., Apgar, J., Everett, G.A., Madison, J.T., Marquisee, M., Merrill, S.H.,

Penswick, J.R. and Zamir, A. (1965) Structure of a ribonucleic acid. Science, 147, 1462-5.

Holley, R.W., Everett, G.A., Madison, J.T. and Zamir, A. (1965) Nucleotide sequence in

the yeast alanine transfer ribonucleic acid. The Journal of biological chemistry, 240, 2122-8.

Howden BP, McEvoy CR, Allen DL, et al. (2011) Evolution of multidrug resistance during

Staphylococcus aureus infection involves mutation of the essential two component regulator

WalKR. PLOS Pathog.7:e1002359.

Huang Y, Wang YH, Chou YH, Lien RI. (2006) Significance of coagulase-negative

staphylococci isolated from a single blood culture from neonates in intensive care. Ann Trop

Paediatr. 26:311–318.

Huber JA, Mark Welch DB, Morrison HG, Huse SM, Neal PR, Butterfield DA, et al. (2007). Microbial population structures in the deep marine biosphere. Science 318:97-100

Hutchison, C.A. (2007) DNA sequencing: Bench to bedside and beyond. Nucleic acids

research, 35, 6227-37, 10.1093/nar/gkm688.

Hyman ED. (1988). A new method of sequencing DNA. Anal Biochem. 174: 423-436.

IHGSC (2004). Finishing the euchromatic sequence of the human genome. Nature 431, 931-

945.

International Working Group on the Classification of Staphylococcal Cassette

Chromosome Elements (IWG-SCC). 2009. Classification of staphylococcal cassette

chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements. Antimicrob.

Agents Chemother. 53:4961-4967.

Imbeaud S, Graudens E, Boulanger V, Barlet X, Zaborski P, Eveno E, Mueller O,

Schroeder A, Auffray C (2005) Towards standardization of RNA quality assessment using

user-independent classifiers of microcapillary electrophoresis traces. Nucleic Acids Res 30:

e56.

Ito T, Katayama Y, Hiramatsu K. (1999). Cloning and nucleotide sequence determination

of the entire mec DNA of pre-methicillin-resistant Staphylococcus aureus N315. Antimicrob

Agents Chemother. Jun;43(6):1449-58.

Ito T, Ma XX, Takeuchi F, Okuma K, Yuzawa H, Hiramatsu K. (2004). Novel type V

staphylococcal cassette chromosome mec driven by a novel cassette chromosome

recombinase, ccrC. Antimicrob Agents Chemother. Jul;48(7):2637-51.

Jarraud S, Mougel C, Thioulouse J, et al. (2000) Relationships between Staphylococcus

aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect

Immun 70, 631-641.

Jimenez-Truque N, Tedeschi S, Saye EJ, et al. (2012) Relationship between maternal and

neonatal Staphylococcus aureus colonization. Pediatrics. 129(5):e1252–9. 13.

REFERENCES BIBLIOGRAPHIQUES

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 172

Johnson-Robbins LA, el-Mohandes AE, Simmens SJ, Keiser JF. (1996) Staphylococcus

epidermidis sepsis in the intensive care nursery: a characterization of risk associations in

infants < 1,000 g. Biol Neonate. 69(4):249–256

Jordens JZ, Duckworth GJ, Williams RJ. (1989). Production of « virulence factors » by

« epidemic» methicillin-resistant Staphylococcus aureus in vitro. J Med Microbiol, , 30 (4) :

245-52.

Juhas, M., van der Meer, J.R., Gaillard, M., Harding, R.M., Hood, D.W., and Crook,

D.W. (2009) Genomic islands: tools of bacterial horizontal gene transfer and evolution.

FEMS Microbiol. Rev. 33: 376–393.

Junemann S, Sedlazeck FJ, Prior K, Albersmeier A, John U, Kalinowski J, et al. (2013).

Updating benchtop sequencing performance comparison. Nat. Biotechnol. Apr;31(4):294–6.

Katayama, Y., T. Ito, and K. Hiramatsu. 2001. Genetic organization of the chromosome

region surrounding mecA in clinical staphylococcal strains: role of IS431-

mediated mecI deletion in expression of resistance in mecA-carrying, low-level methicillin-

resistant Staphylococcus haemolyticus. Antimicrob. Agents Chemother. 45:1955-1963.

Kenri T, Horino A, Matsui M, Sasaki Y, Suzuki S, Narita M, et al. (2012) Complete

genome sequence of Mycoplasma pneumoniae type 2a strain 309, isolated in Japan. J.

Bacteriol. Mar;194(5):1253–4.

Kim, J.I., Ju, Y.S., Park, H., Kim, S., Lee, S., Yi, J.H., Mudge, J., Miller, N.A., Hong, D.,

Bell, C.J. et al. (2009) A highly annotated whole-genome sequence of a Korean individual.

Nature, 460, 1011-1015.

Klingenberg C, Ronnestad A, Anderson AS, et al. Persistent strains of coagulase-negative

staphylococci in a neonatal intensive care unit: virulence factors and invasiveness. Clin

Microbiol Infect 2007;13:1100–11.

Kondo Y, Ito T, Ma XX, Watanabe S, Kreiswirth BN, Etienne J, et al. (2007).

Combination of multiplex PCRs for staphylococcal cassette chromosome mec type

assignment: rapid identification system for mec, ccr, and major differences in junkyard

regions. Antimicrob Agents Chemother. Jan;51(1):264-74.

Koonin, E.V., Makarova, K.S., and Aravind, L. (2001) Horizontal gene transfer in

prokaryotes: quantification and classification. Annu. Rev. Microbiol. 55: 709–742.

Kos VN, Desjardins CA, Griggs A, Cerqueira G, Van Tonder A, Holden MT, Godfrey P,

Palmer KL, Bodi K, Mongodin EF, Wortman J, Feldgarden M, Lawley T, Gill SR, Haas

BJ, Birren B, Gilmore MS. (2012 ). "Comparative genomics of vancomycin-resistant

Staphylococcus aureus strains and their positions within the clade most commonly associated

with Methicillin-resistant S. aureus hospital-acquired infection in the United States." mBio.

3(3): Epub 2012 May 22.

Koser CU, Ellington MJ, Cartwright EJ, Gillespie SH, Brown NM, et al. (2012) Routine

use of microbial whole genome sequencing in diagnostic and public health microbiology.

PLoS Pathog 8: e1002824.

Krediet TG, Jones ME, Janssen K, et al. (2011) Prevalence of molecular types and mecA

gene carriage of coagulase-negative Staphylococci in a neonatal intensive care unit: relation

to nosocomial septicemia. J Clin Microbiol, 39:3376–8.

Kuroda,M., Yamashita,A., Hirakawa,H., Kumano,M., Morikawa,K., Higashide, M., et

al. (2005). Whole genome sequence of Staphylococcus saprophyticus reveals the

REFERENCES BIBLIOGRAPHIQUES

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 173

pathogenesis of uncomplicated durinary tract infection. Proc.Natl. Acad.Sci.U.S.A.

102,13272–13277.

Lander, E.S., Linton, L.M., Birren, B., Nusbaum, C., Zody, M.C., Baldwin, J., Devon,

K., Dewar, K., Doyle, M., FitzHugh, W., et al. (2001) Initial sequencing and analysis of the

human genome. Nature, 409, 860-921, 10.1038/35057062.

Larrat S. Did Ultra-Deep pyrosequencing of the NS3 region can help to predict sustained

virological response to pegylated interferon-ribavirine-anti-protease triple therapy in

previously treated chronic HCV genotype 1 infection? 64th annual meeting of the American

Association for the Study of Liver Diseases - Washington DC, USA; 2013.

Latreille P, Norton S, Goldman BS, Henkhaus J, Miller N, Barbazuk B, Bode HB,

Darby C, Du Z, Forst S, Gaudriault S, Goodner B, Goodrich-Blair H, and SlaterS.

(2007) Optical mapping as a routinetool for bacterial genome sequence finishing,” BMC

genomics, vol. 8, p. 321.

Lauck M, Alvarado-Mora MV, Becker EA, Bhattacharya D, Striker R, Hughes AL, et

al. (2012) Analysis of hepatitis C virus intrahost diversity across the coding region by

ultradeep pyrosequencing. J. Virol. Apr;86(7):3952–60.

Lee H, Kim ES, Choi C, et al. (2014) Outbreak among healthy newborns due to a new

variant of USA300-related meticillin-resistant Staphylococcus aureus. J Hosp Infect 87:145-

51.

Lavezzo E, Toppo S, Franchin E, et al. (2013) Genomic comparative analysis and gene

function prediction in infectious diseases: Application to the investigation of a meningitis

outbreak. BMC Infect Dis. 13:554.

Leshem E, Maayan-Metzger A, Rahav G, et al. (2012) Transmission of Staphylococcus

aureus from mothers to newborns. Pediatr Infect Dis J 31(4):360–3.

Levinthal C, Davison PF. (1961). Degradation of deoxyribonucleic acid under

hydrodynamic shearing forces. J. Mol.Bio 3, 674-683.

Levy S, Sutton G, Ng PC, Feuk L, Halpern AL, Walenz BP, et al. (2007). The diploid

genome sequence of an individual human. PLoS Biol 5:e254.

Lim A, Dimalanta ET, Potamousis KD, Yen G, Apodoca J, Tao C, Lin J, Qi R, Skiadas

J, Ramanathan A, Perna NT, Iii GP, Burland V, Mau B, Hackett J, Blattner FR,

Anantharaman TS, Mishra B, and Schwartz DC. (2001) Shotgun Optical Maps of the

Whole Escherichia coli O157!: H7Genome. Genome Research, pp. 1584–1593.

Lina G, Piemont Y, Godail-Gamot F, et al. (1999). Involvement of Panton-Valentine

leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin

Infect Dis, 29 (5) : 1128-32.

Lindsay J.A and Holden M.T. (2004) Staphylococcus aureus: superbug, super genome.

Trends Microbiol. 12: 378-385.

Loman NJ, Misra RV, Dallman TJ, Constantinidou C, Gharbia SE, Wain J, et al. (2012).Performance comparison of benchtop high-throughput sequencing platforms. Nat.

Biotechnol. May;30(5):434–9.

Lowy FD. (1998) Staphylococcus aureus infections. N Engl J Med, 339 (8) : 520- 32.

Ludwig W, Strunk O, Westram R, et al. (2004). ARB: a software environment for sequence

data. Nucleic Acids Res. 32: 1363-1371.

REFERENCES BIBLIOGRAPHIQUES

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 174

Margulies, M., Egholm, M., Altman, W.E., Attiya, S., Bader, J.S., Bemben, L.A., Berka,

J., Braverman, M.S., Chen, Y.-ju, Chen, Z., et al. (2005) Genome sequencing in

microfabricated high-density picolitre reactors. Nature, 437, 376-81, 10.1038/nature03959.

Maxam, A.M. and Gilbert, W. (1977) A new method for sequencing DNA. Proceedings of

the National Academy of Sciences of the United States of America, 74, 560-4.

McAdam P, Richardson EJ, Fiztgerald JR. (2014) High throughput sequencing for the

study of bacterial pathogen biology. Curr Opin Microbiol. 19:106-13

McGinn S, Gut IG. (2013). DNA sequencing - spanning the generations. New Biotechnol.

May 25;30(4):366–72.

Medini D, Donati C, Tettelin H, Masignani V, and Rappuoli R. (2005) The microbial pan-

genome. Current opinion in genetics & development. Dec vol. 15, no. 6, pp. 589–94.

Maiden MC, Bygraves JA, Feil E, et al. (March 1998). "Multilocus sequence typing: A

portable approach to the identification of clones within populations of pathogenic

microorganisms". Proc. Natl. Acad. Sci. U.S.A. 95 (6): 3140–5

Mellmann, A., Harmsen, D., Cummings, C.A., Zentz, E.B., Leopold, S.R., Rico, A.,

Prior, K., Szczepanowski, R., Ji, Y., Zhang, W. et al. (2011) Prospective genomic

characterization of the German enterohemorrhagic Escherichia coli 0104:H4 outbreak by

rapid next generation sequencing technology. PLoS One, 6, e22751.

Metzker, M.L. (2010) Sequencing technologies - the next generation. Nat Rev Genet, 11, 31-

46.

Miller, J.R., Koren, S., and Sutton, G. (2010) Assembly algorithms for next-generation

sequencing data. Genomics 95: 315–327.

Millette M., Cornut G., Dupont C., Shareck F., Archambault D., Lacroix M.

(2008). Capacity of human nisin- and pediocin-producing lactic Acid bacteria to reduce

intestinal colonization by vancomycin-resistant enterococci. Appl. Environ. Microbiol. 74,

1997–2003. 10.1128/AEM.02150-07.

Mishaan AM, Mason EO, Jr, Martinez-Aguilar G, et al. (2005) Emergence of a

predominant clone of community-acquired Staphylococcus aureus among children in

Houston, Texas. Pediatr Infect Dis J, 24 (3) : 201-6.

Monira S, Nakamura S, Gotoh K, Izutsu K, Watanabe H, Alam NH, et al. (2011) Gut

microbiota of healthy and malnourished children in bangladesh. Front. Microbiol. 2:228.

Mullis, K. (1994) The Polymeras chain reaction. (Boston,birkhaïsur). Pearson, W. R., et

Lipman, D.J. (1998). Improved tools for biological sequence comparaison. Proc. Nati. Acad.

Sci. U.S.A 85, 2444-2448.

Nan Qin, Wenchao Dingb, Jian Yao, Kunkai Su

a, Lingjiao Wu and Lanjuan Li. (2012).

Genome Sequence of Staphylococcus capitis QN1, Which Causes Infective Endocarditis.

10.1128/JB.00827-12 J. Bacteriol. August vol. 194 no. 16 4469-4470.

Noble, W. C., Z. Virani, and R. G. A. Cree. 1992. Co-transfer of vancomycin and other

resistance genes from Enterococcus faecalis NCTC 12201 to Staphylococcus aureus. FEMS

Microbiol. Lett. 93:195-198.

REFERENCES BIBLIOGRAPHIQUES

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 175

Noto MJ, Kreiswirth BN, Monk AB, Archer GL. (2008) Gene acquisition at the insertion

site for SCCmec, the genomic island conferring methicillin resistance in Staphylococcus

aureus. J Bacteriol. Feb;190(4):1276-83.

Ogston A (1882) Microccocus poisoning. J Anat 17, 24-58.

Okuma K, Iwakawa K, Turnidge JD, et al. (2002) Dissemination of New Methicillin-

Resistant Staphylococcus aureus Clones in the Community. Journal of Clinical Microbiology.

40(11):4289-4294.

Oliveira DC, de Lencastre H. (2002) Multiplex PCR strategy for rapid identification of

structural types and variants of the mec element in methicillin-resistant Staphylococcus

aureus. Antimicrob Agents Chemother. Jul;46(7):2155-61.

Oliveira DC, Milheirico C, de Lencastre H. (2006). Redefining a structural variant of

staphylococcal cassette chromosome mec, SCCmec type VI. Antimicrob Agents Chemother.

Oct;50(10):3457-9.

Orlando, L. et al. (2011). True single-molecule DNA sequencing of a pleistocene horse

bone. Genome Res. 21, 1705–1719.

Park H.-K., Shim S.-S., Kim S.-Y., Park J.-H., Park S.-E., Kim H.-J., et al. (2005). Molecular analysis of colonized bacteria in a human newborn infant gut. J.

Microbiol. 43, 345–353.

Peschel A., Sahl H.-G. (2006). The co-evolution of host cationic antimicrobial peptides and

microbial resistance. Nat. Rev. Microbiol. 4, 529–536. 10.1038/nrmicro1441.

Pevzner, P. A. and Tang, H. and Waterman, M. S. (2001) An Eulerian path approach to

DNA fragment assembly. Proc Natl Acad Sci U S A doi:10.1073/pnas.171285098.

Procopio, R. E., I. R. Silva, M. K. Martins, J. L. Azevedo, and J. M. Araujo. (2012)

Antibiotics produced by Streptomyces. The Brazilian journal of infectious diseases : an

official publication of the Brazilian Society of Infectious Diseases 16:466-471.

Pulverer, G., Peters, G. & Schumacher-Perdreau, F. (1987). Coagulase-negative

staphylococci. Zentralbl Bakteriol Mikrobiol Hyg [A]. 264, 1-28.

Pushkarev, D., Neff, N.F. and Quake, S.R. (2009) Single-molecule sequencing of an

individual human genome. Nat Biotechnol, 27, 847- 852.

Qin N, Ding W, Yao J, Su K, Wu L, Li L. (2012) Genome sequence of Staphylococcus

capitis QN1, which causes infective endocarditis. J Bacteriol.194:4469–4470. doi:

10.1128/JB.00827-12

Rasigade JP, Raulin O, Picaud JC, Tellini C, Bes M, Grando J, Ben Saïd M, Claris O,

Etienne J, Tigaud S, Laurent F. (2012). Methicillin-Resistant Staphylococcus capitis with

Reduced Vancomycin Susceptibility Causes Late-Onset Sepsis in Intensive Care Neonates.

PLoS One. 7(2): e31548.

Rasko DA, Webster DR, Sahl JW, et al. (2011) Origins of the E. coli strain causing an

outbreak of hemolytic-uremic syndrome in Germany. N Engl J Med, 365:709-17.

Reinhardt J, Baltrus D, Nishimura M, Jeck W, Jones C, and Dangl J. (2009) De novo

assembly using lowcoverage short read sequence data from the rice pathogen Pseudomonas

syringae pv. oryzae,” Genome Research. Feb vol. 19, no. 2, pp. 294–305.

Renaud F, Hansen Willy, Freney Jean. (2007). Manuel de bactériologie clinique. Ed

Elsevier, 2ème

édition,

REFERENCES BIBLIOGRAPHIQUES

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 176

Reslewic S, Zhou S, Place M, Zhang Y, Briska A, Goldstein S, Churas C, Runnheim

R, Forrest D, Lim A, Lapidus A, Han CS, Roberts GP, Schwartz DC. (2005) Whole-

Genome Shotgun OpticalMapping of Rhodospirillum rubrum,” Applied and Environmental

Microbiology, vol. 71, no. 9, pp. 5511–5522.

Rhee M, Burns MA. (2006). Nanopore sequencing technology: research trends and

applications. Trends Biotechnol;24: 580—6.

Roach DJ, Burton JN, Lee C, Stackhouse B, Butler-Wu SM, Cookson BT, et al. (2015) A

Year of Infection in the Intensive Care Unit: Prospective Whole Genome Sequencing of

Bacterial Clinical Isolates Reveals Cryptic Transmissions and Novel Microbiota. PLoS Genet

11(7): e1005413.

Robert J, Bismuth R, Jarlier V. (2002). Decreased susceptibility to glycopeptides in

methicillin resistant Staphylococcus aureus : a 20 year study in a large French teaching

hospital, 1983-J Antimicrob Chemother, 2006, 57 (3) : 506-10.

Robinson DA, Enright MC. (2004). Multilocus sequence typing and the evolution of

methicillin-resistant Staphylococcus aureus. Clin Microbiol Infect, 10 (2) : 92-7.

Rosenbach FJ (1884) Microorganismen bei den Wund-Infections-Krankheiten des Menschen,

Wiesbaden.

Ruhe J, Menon A, Mushatt D, et al. Non-epidermidis coagulasenegative staphylococcal

bacteremia: clinical predictors of true bacteremia. Eur J Clin Microbiol Infect Dis

2004;23:495–8.

Ryan D, Rahimi M, Lund J, Mehta R, Parviz BA. (2007). Toward nanoscale genome

sequencing. Trends Biotechnol 25:385—9.

Sabat, A. J., Hermelijn, S. M., Akkerboom, V., Juliana, A., Degener, J. E., Grundmann,

H., & Friedrich, A. W. (2017). Complete-genome sequencing elucidates outbreak dynamics

of CA-MRSA USA300 (ST8-spa t008) in an academic hospital of Paramaribo, Republic of

Suriname. Scientific Reports, 7, 41050.

Salipante SJ, Roach DJ, Kitzman JO, Snyder MW, Stackhouse B, et al. (2014) Large-

scale genomic sequencing of extraintestinal pathogenic Escherichia coli strains. Genome Res

25: 119–128.

Sanger, F. and Coulson, A.R. (1975) A rapid method for determining sequences in DNA by

primed synthesis with DNA polymerase. Journal of molecular biology, 94, 441-8.

Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating

inhibitors. Proceedings of the National Academy of Sciences of the United States of America,

74, 5463-7.

Sanger, F., Coulson, A.R., Hong, G.F., Hill, D.F. and Petersen, G.B. (1982) Nucleotide

sequence of bacteriophage lambda DNA. Journal of molecular biology, 162, 729-73.

Schwalbe, R. S., W. J. Ritz, P. R. Verma, E. A. Barranco, and P. H. Gilligan. 1990.

Selection for vancomycin resistance in clinical isolates of Staphylococcus haemolyticus. J.

Infect. Dis. 161:45-51.

Seemann T. (2014). Prokka: rapid prokaryotic genome annotation. Bioinformatics 30:2068 –

2069.

REFERENCES BIBLIOGRAPHIQUES

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 177

Sengenès, J. (2012) Développement de méthodes de séquençage de seconde génération

pourl’analyse des profils de méthylation de l’ADN. Thèse de doctorat, Université Pierre et

Marie Curie,216p.

SenGupta DJ, Cummings LA, Hoogestraat DR, Butler-Wu SM, Shendure J, Cookson

BT, et al. Whole-genome sequencing for high-resolution investigation of methicillinresistant

Staphylococcus aureus epidemiology and genome plasticity. J Clin Microbiol.

Aug;52(8):2787–96.

Shendure, J. and Ji, H. (2008) Next-generation DNA sequencing. Nature Biotechnology, 26,

1135-45, 10.1038/nbt1486.

Shendure J. (2008). The beginning of the end for microarrays? Nat Methods. 5: 585-587.

Shields RK, Nguyen MH, Press EG, Kwa AL, Cheng S, Du C, et al. (2012) The presence

of an FKS mutation rather than MIC is an independent risk factor for failure of echinocandin

therapy among patients with invasive candidiasis due to Candida glabrata. Antimicrob.

Agents Chemother. Sep;56(9):4862–9.

Shin J. M., Gwak J. W., Kamarajan P., Fenno J. C., Rickard A. H., Kapila Y. L.

(2016). Biomedical applications of nisin. J. Appl. Microbiol. 120, 1449–1465.

10.1111/jam.13033.

Shukla SK, Kislow J, Briska A, Henkhaus J, Dykes C (2009) Optical mapping reveals a

large geneticinversion between two methicillin-resistant Staphylococcus aureus strains,”

Journal of Bacteriology,vol. 191, no. 18, pp. 5717–23.

Spicer W.J. (2003). Pratique clinique en bactériologie mycologie et parasitologie

Flammarion Médecine-Sciences, Paris. 28-29.

Sieradzki, K., and A. Tomasz. 1997. Inhibition of cell wall turnover and autolysis by

vancomycin in a highly vancomycin-resistant mutant of Staphylococcus aureus. J.

Bacteriol. 179:2557-2566.

Stoll BJ, Hansen N, Fanaroff AA, et al. (2002) late-onset sepsis in very low birth weight

neonates: the experience of the NICHD Neonatal Research Network. Pediatrics. 110:285–291.

Taft D. H., Ambalavanan N., Schibler K. R., Yu Z., Newburg D. S., Deshmukh H., et al. .

(2015). Center variation in intestinal Microbiota prior to late-onset sepsis in preterm

infants. PLoS ONE10:e0130604. 10.1371/journal.pone.0130604

Tettelin, H., V. Masignani, M.J. Cieslewicz, C. Donati, D. Medini, N.L. Ward, S.V.

Angiuoli, J. Crabtree, A.L. Jones, A.S. Durkin, R.T. Deboy, T.M. Davidsen, M. Mora,

M. Scarselli, I. Margarit y Ros, J.D. Peterson, C.R. Hauser, J.P. Sundaram, W.C.

Nelson, R. Madupu, L.M. Brinkac, R.J. Dodson, M.J. Rosovitz, S.A. Sullivan, S.C.

Daugherty, D.H. Haft, J. Selengut, M.L. Gwinn, L. Zhou, N. Zafar, H. Khouri, D.

Radune, G. Dimitrov, K. Watkins, K.J. O'Connor, S. Smith, T.R. Utterback, O. White,

C.E. Rubens, G. Grandi, L.C. Madoff, D.L. Kasper, J.L. Telford, M.R. Wessels, R.

Rappuoli, and C.M. Fraser. (2005) Genome analysis of multiple pathogenic isolates of

Streptococcus agalactiae: implications for the microbial "pangenome". Proc Natl Acad Sci U

S A, 102(39): p. 13950-5

Taj Azarian, Robert L. Cook, Judith A. Johnson, Nilmarie Guzman, Yvette S.

McCarter, Noel Gomez, Mobeen H. Rathore, J. Glenn Morris, Jr. and Marco Salemi.

(2015) Whole-Genome Sequencing for Outbreak Investigations of Methicillin Resistant

REFERENCES BIBLIOGRAPHIQUES

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 178

Staphylococcus aureus in the Neonatal Intensive Care Unit: Time for Routine Practice?.

Infection Control & Hospital Epidemiology / FirstView Article / May 2015, pp 1 – 9.

Takeuchi,F., Watanabe,S., Baba,T., Yuzawa,H., Ito,T., Morimoto,Y., et al. (2005).

Whole-genome sequencing of Staphylococcus haemolyticus uncovers the extreme plasticity of

its genome and the evolution of human-colonizing staphylococcal species. J.Bacteriol.

187,7292–7308.

Tevell S,

Hellmark B,

Nilsdotter-Augustinsson A,

and Söderquist B. (2017)

Staphylococcus capitis isolated from prosthetic joint infections. Eur J Clin Microbiol Infect

Dis. 36(1): 115–122.

Thompson, J. D., Higgins, D. G., et Gibson, T.J., (1994). CLUSTL W: improving the

sensitivity of progressive multiple sequence alignment through sequence weighting position-

specific gap penalities and weight matrix choice. Nucleic Acids Res 22, 4673-4680.

Tong SY, Holden MT, Nickerson EK, Cooper BS, Koser CU, et al. (2015) Genome

sequencing defines phylogeny and spread of methicillin-resistant Staphylococcus aureus in a

high transmission setting. Genome Res 25: 111–118.

Urwin R, Maiden MC; Maiden (October 2003). "Multi-locus sequence typing: a tool for

global epidemiology". Trends Microbiol. 11 (10): 479–87.

Vallenet D, Labarre L, Rouy Z, Barbe V, Bocs S, Cruveiller S, Lajus A, Pascal G,

Scarpelli C, Médigue C. 2006. MaGe: a microbial genome annotation system supported by

synteny results. Nucleic Acids Res 34:53– 65.

Vallenet D, Belda E, Calteau A, Cruveiller S, Engelen S, Lajus A, Le Fèvre F, Longin C,

Mornico D, Roche D et al. MicroScope—an integrated microbial resource for the curation

and comparative analysis of genomic and metabolic data. Nucleic Acids Res 2013

Jan;41(Database issue):D636-D647.

Vandenesch F, Naimi T, Enright MC, et al. (2003). Community-acquired

methicillinresistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes.

worldwide emergence. Emerg Infect Dis, 9 (8) : 978-84.

Vandenesch F., Bes M., Etienne J. (2007). Staphylocoques. EMC (Elsevier Masson SAS,

Paris, Encydopédie Médico-Biologique, 90-05-0255,

Van Der Zwet WC, Debets-Ossenkopp YJ, Reinders E, et al (Juillet 2002). "propagation

nosocomiale d'une souche de Staphylococcus capitis hétérorésistance à la vancomycine dans

une unité néonatale de soins intensifs" . J. Clin. . Microbiol 40 (7):

Van den Eede A, Martens A, Lipinska U, Struelens M, Deplano A, et al. (2009) High

occurrence of methicillin-resistant Staphylococcus aureus ST398 in equine nasal samples. Vet

Microbiol 133: 138-144.

Venkatesh MP, Placencia F, Weisman LE. (2006) Coagulase-negative staphylococcal

infections in the neonate and child: an update. Semin Pediatr Infect Dis, 17:120–7.

Vincent JL, Bihari DJ, Suter PM, Bruining HA, White J, Nicolas-Chanoin MH, et al. (1995). The prevalence of nosocomial infection in intensive care units in Europe. Results of

the European Prevalence of Infection in Intensive Care (EPIC) Study. JAMA 274 : 639-44.

Wang, J., Wang, W., Li, R., Li, Y., Tian, G., Goodman, L., Fan, W., Zhang, J., Li, J.,

Guo, Y. et al. (2008) The diploid genome sequence of an Asian individual. Nature, 456, 60-

65.

REFERENCES BIBLIOGRAPHIQUES

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 179

Vogel V, Falquet L, Calderon-Copete SP, Basset P, Blanc DS. (2012) Short term evolution

of a highly transmissible methicillin-resistant Staphylococcus aureus clone (ST228) in a

tertiary care hospital. PLoS One. 7: e38969.

Waterston, R.H., Lindblad-Toh, K., Birney, E., Rogers, J., Abril, J.F., Agarwal, P.,

Agarwala, R., Ainscough, R., Alexandersson, M., An, P., et al. (2002) Initial sequencing

and comparative analysis of the mouse genome. Nature, 420, 520-62, 10.1038/nature01262.

Watson, J. D., et Crick, F. H. (1953). Molecular structure of nucleic acids, a structure for

deoxyribose nucleic acid. Nature 171, 737-738.

Wiedemann I., Breukink E., van Kraaij C., Kuipers O. P., Bierbaum G., de Kruijff B., et

al. (2001). Specific binding of nisin to the peptidoglycan precursor lipid II combines pore

formation and inhibition of cell wall biosynthesis for potent antibiotic activity. J. Biol.

Chem. 276, 1772–1779.

Willner D, Daly J, Whiley D, Grimwood K, Wainwright CE, Hugenholtz P. (2012).

Comparison of DNA Extraction Methods for Microbial Community Profiling with an

Application to Pediatric Bronchoalveolar Lavage Samples. PLoS ONE 7(4):

e34605. doi:10.1371/journal.pone.0034605.

Witney AA, Gould KA, Pope CF, et al. (2014) Genome sequencing and characterization of

an extensively drugresistant sequence type 111 serotype O12 hospital outbreak strain of

Pseudomonas aeruginosa. Clin Microbiol Infect. Oct;20(10):O609-18.

Wu, R. (1970). Nucleotide sequence analysis of DNA. I. Partial sequence of the cohesive

ends of bacteriophage lambda and 186 DNA. Journal of molecular biology, 51, 501-21.

Wu, R. and Taylor, E. (1971). Nucleotide sequence analysis of DNA. II. Complete

nucleotide sequence of the cohesive ends of bacteriophage lambda DNA. Journal of

molecular biology, 57, 491-511.

Yarwood JM, Schlievert PM. (2003). Quorum sensing in Staphylococcus infections. J Clin

Invest 112, 1620-1625.

Yasugi M, Nakamura S, Daidoji T, Kawashita N, Ramadhany R, Yang C-S, et al. (2012)

Frequency of D222G and Q223R hemagglutinin mutants of pandemic (H1N1) 2009 influenza

virus in Japan between 2009 and 2010. Plos One. 7(2):e30946.

Zahar JR, Clec’h C, Tafflet M, et al. (2005). Is methicillin resistance associated with

aworse prognosis in Staphylococcus aureus ventilator-associated pneumonia ? Clin Infect Dis,

41 (9) : 1224-31.

Zahlane, K. H. (2007). Staphylocoque: état actuel de l’épidémiologie et de l’antibiorésistance

au CHU de Rabat. Maroc Médical, tome 29 n°4 , 279-285.

Zhang, K., J. A. McClure, S. Elsayed, and J. M. Conly. 2009. Novel staphylococcal

cassette chromosome mec type, tentatively designated type VIII, harboring class A mec and

type 4 ccr gene complexes in a Canadian epidemic strain of methicillin-

resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 53:531-540.

Zhang,Y.Q., Ren,S.X., Li,H.L., Wang,Y.X., Fu,G., Yang,J., et al. (2003). Genome-based

analysis of virulence genes in anon-biofilm- forming Staphylococcus epidermidis strain

(ATCC12228). Mol.Microbiol. 49, 1577–1593.

REFERENCES BIBLIOGRAPHIQUES

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 180

Webgraphie

http://www.genomesonline.org

http://departments.oxy.edu/biology/Stillman/bi221/092200/lecture_notes.htm

http://www.appliedbiosystems.com/

www.genoscope.cnr.fr

http://www.454.com

www.sccmec.org/Pages/SCC_TypesEN.html

http://www.bio.davidson.edu/COurses/genomics/method/shotgun.html.

http://www.ncbi.nlm.nih.gov/genome/genomes/2054?details=on&)

http://bioinformatics.ws/index.php/History_of_Biology,

http://bioinformatics.ws/index.php/History_of_Bioinformatics,

http://en.wikipedia.org/wiki/Timeline_of_computing,

http://www.thocp.net/timeline/timeline.htm,

http://seqanswers.com/et http://www.genomesonline.org

http://www.genome.gov/sequencingcosts/

ANNEXES

ANNEXES

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 181

ANNEXE 1

Chronologie non exhaustive des événements marquants survenus en biologie (Rose),

et en bioinformatique (Incolore).

http://bioinformatics.ws/index.php/History_of_Biology,

http://bioinformatics.ws/index.php/History_of_Bioinformatics,

http://en.wikipedia.org/wiki/Timeline_of_computing,

http://www.thocp.net/timeline/timeline.htm,

http://seqanswers.com/ et http://www.genomesonline.org

ANNEE AUTEUR EVENEMENT

1944 Avery Démonstration de l’ADN en tant que support de l’information

génétique (Avery et al., 1994)

1953 Sanger, Thompson Détermination de la séquence des chaines A et B de l’insuline

(Sanger et Tompson, 1953a, 1953b)

Watson, Crick Modèle de la structure en double hélice de l’ADN (Watson et

al., 1953)

1958 Crick Enonciation du dogme central de la biologie moléculaire (Crick,

1958)

1962 Matthaei Déchiffrage du code génétique (Matthaei et al., 1962)

1965 Dayhoff Premier atlas de la séquence et de la structure des protéines

(Dayhoff et national Biomedical Research Foundation., 1965)

1967 Fitch Construction d’arbre phylogénétique (Fitch et Margoliash,

1967)

1970 Smith, Wilcox Première enzyme de restriction spécifique isolée (Smith et

Wilocox, 1970)

1970 Needleman, Wusnch Algorithme d’alignement global optima entre deux séquences

(Needleman, Wusnch, 1970)

1973 Annonce de la protéine Data Bank (PDB), (Protein Data Bank,

1973)

1974 Chou, Fasman Algorithme de prédiction des structures secondaires des

protéines (Chou et Fasman, 1974)

1977 Sanger Méthode de séquençage par synthèse enzymatique de l’ADN

(Sanger, Nicklen, et al., 1977)

Sanger, Air Premier génome complet séquencé : phage X174

Maxam, Gilbert Méthode de séquençage chimique de l’ADN

Staden Suite d’analyse de séquences d’ADN Staden

1980 EMBL Première banque de séquences nucléiques

Anderson Séquence du génome mitochondrial humain

Smith, Waterman Algorithme d’alignement local optimal entre deux séquences

1982 GenBank Banque américaine de séquences nucléique

1983 Mullis Invention de la réaction en chaine de la polymérase (PCR)

1985 Lipman FASTA, programme de recherche de séquences par similarité

Gouy ACNUC, programme d’interrogation des banques de séquences

Bairoch SWISS-PORT, Banque de séquences protéiques

DDBJ Banque Japonaise de séquences protéiques

1987 Applied Biosystems Premier séquenceur automatique (ABI 370)

Burke Création du vecteur de clonage Yeast Artificial Chromosome

(YAC)

Kulesh Apparition de la technologie des puces d’ADN

ANNEXES

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 182

1988 Lancement du projet international de séquençage du génome

humaine (National Research Council (U.S), 1998)

Higgins, Sharp CLUSTAL, programme d’alignement multiple

1989 O’Connor Création du vecteur de clonage Bacterial Artificial Chromosome

(BAC)

1990 Altschul BLAST, programme de recherche de séquences par similarité

1991 Adams Création et utilisation à grande échelle du séquençage partiel

d’ADNc (EST)

Roberts GRAIL, programme de localisation de gène

1993 Etzold, Argos SRS, programme d’interrogation des banques de séquences

1994 Thompson CLUSTALW

1995 Fleischmann Premier organisme vivant séquencé : Haemophilus influenzae

(1.8 Mb)

Fraser Plus petit organisme vivant séquencé : Mycoplasma gentalium

(580 Kb)

1996 Walsh, Barrell Premier organisme eucaryote séquencé : Saccharomyces

cerevisiae (12.1 Mb)

Affymetrix Commercialisation de la première puce d’ADN

1997 Blattner Génome complet de Escherchia coli (4.7 Mb)

Altschul Gapped BLAST et PSI-BLAST

Burge, Karlin GenScan, prediction de la structure complete des gènes dans

l’AND génomique humain

1998 Premier organisme pluricellulaire séquencé : Caenorhabditis

elegans (Mp)

2000 Dennis, Surridge Génome d’Arabidopsis thaliana (100Mb)

Adams Génome de drosophila melanogaster (180 Mb

2001 Lander Publication préliminaire du génome humaine par le Human

Genome Project (2.9 Gb)

Venter Publication préliminaire du génome humain par Celera

Genomics (2.9 Gb)

Ensembl Navigateur de génome Ensembl (Hubbared et al., 2009)

NCBI Navigateur de génome du NCBI

DEBUT DE L’ERE POST-GENOMIQUE

2002 Waterson Séquence préliminaire du génome de la souris (2.5 Gb)

UCSC Navigateur de génome de l’UCSC (Kuhn et al., 2009)

2004 IHGSC Finalisation du génome humaine (IHGSC, 2004) (3.4 Gb)

ENCODE PC ENCODES, projet d’identification de tous les élements

fonctionnels du génome humain (ENCODE Project

Consortium, 2004)

2005 Roche, 454 Séquenceur automatique haut-débit de 2ème

génération par

pyroséquençage : GS20

2007 Illumina, Solexa Séquenceur automatique haut- débit de 2ème

génération par

synthèse microfluidique : Genome Analyzer

Applied Biosystems Séquenceur haut-débit de 2ème

génération par ligation : système

SOLID

2008 Helicos Séquenceur haut-débit de 2ème

génération par synthèse sans

pré-amplification

2009 PRES DE 1000 PROJETS DE SEQUENÇAGE DE GENOME EUCARYOTES EN

COURS…

ANNEXES

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 183

ANNEXE 2

Espèces et sous-espèces du genre Staphylococcus et hôtes associés (Vandenesch et al.,

2007)

Espèce Coagulase Hôte ou source S. arletti - Caprin, volaille

S. aureus subsp. anaerobius S. aureus subsp.aureus

+ Ovin Homme, animaux, environnement

S. auricularis - Homme

S. capitis subsp. capitis

S. capitis subsp. ureolyticus -

- Homme

Homme, primates S. caprae - Homme, caprins

S. carnosus subsp. carnosus

S. carnosus subsp. utilis

- Produits carnés

Aliments S. chromogenes - Animaux, lait S. cohnii subsp. cohnii

S. cohnii subsp. urealyticum

- Homme

Homme, animaux S. condimenti - Sauce au soja

S. delphini + Dauphins S. epidermidis - Homme, animaux, environnement S. equorum subsp. equorum S. equorum subsp. linens

- Chevaux, bétail Surface fromage affiné

S. felis - chats

S. fleurettii - Fromage lait de chèvre S. gallinarum - Volailles, oiseaux S. haemolyticus - Homme, animaux domestique, environnement S. hominis subsp. hominis S. hominis subsp. novobiosepticus

- Homme Homme

S. hyicus +/- Animaux, aliments

S. intermedius + Mammifère, oiseaux, rarement Homme S. kloosii - Animaux sauvages S. lentus - Animaux, rarement Homme S. lugdunensis - Homme S. lutrae + Loutre S. muscae - Mouches, porcs S. nepalensis - chèvre S. pasteuri - Homme, animaux, aliments

S. pettenkoferi - Homme S. piscifermentans - Poisson fermenté S. pseudintermedius (Devriese et al., 2005) + Animaux S. saccharolyticus - Homme S. saprophyticus subsp. bovis

S. saprophyticus subsp. saprophyticus -

- Animaux

Homme, animaux S. schleiferi subsp. coagulans S. schleiferi subsp. schleiferi

+ -

Chiens Homme

S. sciuri subsp. carnaticus

S. sciuri subsp. lentus

S. sciuri subsp. rodentium

S. sciuri subsp. sciuri

-

-

-

-

Produits carnés

Animaux

Rongeurs, animaux

Homme, animaux S. simiae (Pantucek et al., 2005) - Singe

S. simulans - Homme, mammifère

S. succinus subsp. casei - Surface de fromage affiné S. succinus subsp. succinus - ambre S. vitulinus (anciennement S. pulvereri) - Animaux, aliments

ANNEXES

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 184

S. warneri - Homme, primates S. xylosus - Homme, animaux, environnement

ANNEXES

H. Lemriss Thèse de doctorat Université Mohammed V-Rabat 185

ANNEXE 3

Principales caractéristiques des différentes techniques de séquençage

Technologie Génération Méthode

d’amplification

Méthode se

séquençage

Détection Particularité

Sanger 1 PCR Synthèse

(terminaison dideoxy)

Radioactivité ou

Fluorescence Technique de référence

Faible débit – Cout élève

Maxam-Gilbert 1 / Dégradation Radioactivité Utilisation confidentielle

454 – Roche

2

PCR en émulsion

Synthèse

(pyroséquencage)

Chimiluminescence

Séquences ≪ longues ≫ : 400-1000 pb

Durée de séquençage : 10-24h

Homopolymères : taux d’erreur élève

Cout relativement élève par rapport aux autres

technologies de 2ème génération

Principal type d’erreur : insertions et délétions

Solexa - Illumina

2

bridge-PCR

Synthèse

(terminaison réversible)

Fluorescence Séquences ≪ courtes ≫ : 100 à 150 pb

Durée de séquençage : 1 - 10j

Faible cout – Faible taux d’erreur

Principal type d’erreur : substitutions

HeliScope –

Helicos

2

/

Synthèse

Fluorescence Séquençage a partir d’une seule molécule

d’ADN : taux d’erreur important. Non

commercialise

SOLiD

Life Technologies PCR en émulsion Ligation (octamères) Fluorescence Séquences ≪ courtes ≫ : 35 à 50 pb

Codage a 2 bases : taux d’erreur limite

Principal type d’erreur : substitutions

Ion Torrent

Life Technologies 2 PCR en émulsion Synthèse Mesure du pH

(détection H+) Fiable cout (1er système < 100 000 $)

Principal type d’erreur : insertions et délétions SMRT

Pacific Biosciences

3

/

Synthèse

Fluorescence

Séquençage en temps réel a partir d’une seule

molécule d’ADN : taux d’erreur important

Séquences longues : 3000 pb

Starlight

Life Technologies 4 /

Synthèse

Fluorescence

Séquençage a partir d’une seule molécule

d’ADN

Possibilité de renouveler l’ADN polymérase

pour des séquences longues. En développement

Nanopores 3 / Variable Nanopores solides ou

biologiques

Séquences longues

Nombreux développements en cours

Sequencage in situ 4 / Synthèse Fluorescence En développement

Publications et

Communications

Standards in Genomic Sciences (2014) 9:1118-1127 DOI:10.4056/sigs.5491045

The Genomic Standards Consortium

Non-contiguous finished genome sequence of Staphylococcus capitis CR01 (pulsetype NRCS-A)

H. Lemriss1,2, Martins Simões P2,3, S. Lemriss1, M. Butin3, A. Ibrahimi4, S. El Kabbaj1, JP Rasigade2,3, F. Laurent2,3,5

1Department of Biosecurity PCL3, Laboratory of Research and Medical Analysis of the Fra-ternal of Gendarmerie Royale, Rabat, Morocco.

2International Centre for Research in Infectious diseases, INSERM U1111, University of Lyon, Lyon, France.

3Department of Clinical Microbiology, Northern Hospital Group, Hospices Civils de Lyon, Lyon, France.

4Medical Biotechnology lab. (MedBiotech), Medical and Pharmacy School, University Mo-hammed V Souissi, Rabat, Morocco.

5National Reference Center for Staphylococci, Hospices Civils de Lyon, Lyon, France.

Correspondence:

Keywords:

frederic.laurent@chu-lyon.fr

Staphylococcus capitis (NCRS-A), draft-genome, methicillin resistance, late-onset sepsis

Staphylococcus capitis is a coagulase-negative staphylococci (CoNS) commonly found in the human microflora. Recently, a clonal population of Staphylococcus capitis (denominated NRCS-A) was found to be a major cause of late-onset sepsis (LOS) in several neonatal inten-sive care units in France. Here, we report the complete genome sequence and annotation of the prototype Staphylococcus capitis NCRS-A strain CR01. The 2,504,472 bp long genome (1 chromosome and no plasmids) exhibits a G+C content of 32.81%, and contains 2,468 pro-tein-coding and 59 tRNA genes and 4 rRNA genes.

Abbreviations: EMBL- European Molecular Biology Laboratory, NCBI- National Center for Biotechnology Information (Bethesda, MD, USA), RDP- Ribosomal Database Project (East Lansing, MI, USA)

IntroductionA frequent cause of low-weight newborns mortali-ty and morbidity in Neonatal Intensive Care Units (NICUs) are late-onset sepsis (LOS), that are de-fined as sepsis occurring after 3 days of age. The most frequently encountered pathogens are coag-ulase-negative staphylococci (CoNS) and within those Staphylococcus epidermidis has been shown to be the most prevalent [1,2]. However, a few studies have reported the emergence of Staphylo-coccus capitis as a main CoNS- and LOS- causative pathogen in NICU settings [2-4]. A study in French NICUs [2] has demonstrated the spread of a single clonal population of methicillin-resistant S. capitis (pulsotype NRCS-A) associated to reduced suscep-tibility to vancomycin, the first line of antibiotics used in cases of LOS. Moreover, this clone has also been recently identified in NICUs in Belgium, United Kingdom and Australia, which suggests a worldwide distribution. In contrast, in adult bac-

teremia, S. capitis are rarely found and when de-tected, it presents a bigger diversity in terms of genotypes as well as antimicrobial susceptibility profiles than neonates bacteremia. In order to elucidate the molecular mechanisms behind the wide spreading of the S. capitis NRCS-A clone in NICUs throughout the world, we se-quenced a prototype strain (CR01).

Classification and information A strain belonging to the clonal population of Staphylococcus capitis NCRS-A pulsetype (Table 1) was isolated from the blood culture of a preterm infant with LOS, hospitalized in the NICU of the Northern Hospital Group Center (Hospices Civils de Lyon, Lyon, France) and suffering of LOS. Species identification of the bacterial isolates and antimicrobial susceptibility testing (AST) were performed, respectively, using Vitek MS

Lemriss et al.

http://standardsingenomics.org 1119

(bioMérieux, Marcy l’Etoile), 16S rDNA sequenc-ing, the automated BD Phoenix system (Becton Dickinson, Sparks, MD) and with Shimadzu-MALDI-TOF MS system (Shimadzu Corporation), as implemented on [21]. The strain was identified as being aStaphylococcus capitis by VITEK MS with 99.9% and at 93.7% by the MALDI-TOF MS, using the Shimadzu Launchpad software program and the SARAMIS database application (AnagnosTec GmbH) for au-tomatic measurement and identification (Figure 1). Based on the information provided by the manufacture, when the score is ≥70%, identifica-tion is considered of high confidence.

The antimicrobial susceptibility test (AST) results were analyzed according to the recommendations of the French Microbiology Society [22]. The S. capitis bacteremia was considered positive based on a single positive blood culture [2,23]. The S. capitis NCRS-A isolate CR01, as all isolates from this clone, is resistant to penicillin, methicillin, gentamicin, rifampicin, hetero-resistant to vancomycin and sensitive to fusidic acid and fluoroquinolones. Table 1, Figure 2 and Figure 3 show detailed in-formation concerning general features of Staphy-lococcus capitis strain (CR01) and position within the genus Staphylococcus.

Table 1. Classification and general features of Staphylococcus capitis strain CR01, pulsetype-NRCS-A ac-cording the MIGS recommendation [5].

MIGS ID Property Term Evidence codea Current classification

Domain Bacteria Phylum Firmicutes Class Bacilli Order Bacillales Family Staphylococcaceae Genus Staphylococcus Species Staphylococcus capitis Strain CR01, pulsetype-NRCS-A

TAS [6] TAS [7,8] TAS [9,10] TAS [11,12] TAS [13,14] TAS [11,15,16] TAS [17] TAS [2,18]

Gram stain Positive TAS [19] Cell shape Coccoid TAS [17] Motility Non-motile TAS [19] Sporulation Non-sporuating TAS [19] Temperature range Mesophilic IDA Optimum temperature 37°C TAS [17] Carbon source Carbohydrates, (glucose, sacharose,

fructose, manitol, mannose) TAS [17]

Energy source Chemoorganotropic TAS [17] Terminal electron recep-

tor O2 TAS [17]

MIGS-6 Habitat Skin of humans TAS [17] MIGS-6.3 Salinity Physiological TAS [17] MIGS-22 Oxygen Facultative anaerobes TAS [17] MIGS-15 Biotic relationship Free-living TAS [17] MIGS-14 Pathogenicity Opportunistic pathogen (Nosocom-

ial bacteremia in premature neo-nates)

TAS [2]

MIGS-4 Geographic location NICU Lyon, France TAS [2] MIGS-5 Sample collection time 2007 IDA MIGS-4.1 MIGS-4.2

Latitude – Longitude 45° 45' 35" N 4° 50' 32" E IDA

MIGS-4.3 Depth Not applicable IDA MIGS-4.4 Altitude 162 m IDA

a) Evidence codes - IDA: Inferred from Direct Assay; TAS: Traceable Author Statement (i.e., a direct re-port exists in the literature); NAS: Non-traceable Author Statement (i.e., not directly observed for the liv-ing, isolated sample, but based on a generally accepted property for the species, or anecdotal evidence). These evidence codes are from the Gene Ontology project [20].

Staphylococcus capitis

1120 Standards in Genomic Sciences

Figure 1. Reference mass spectrum from Staphylococcus capitis strain (CR01).

Figure 2. Transmission electron microscopy of Staphylococcus capitis strain (CR01) using a JEOL 1400. The scale bar represents 200 nm.

Lemriss et al.

http://standardsingenomics.org 1121

Figure 3. 16S rRNA Phylogenetic tree highlighting the position of Staphylococcus capitis strain CR01 (indicated by the yellow circle) relative to other type strains within the genus Staphylococcus. All 16S rRNA sequences were obtained from the RDP database using as filtering criteria: sequences with more than 1200 nt and classified as “good” quality sequences. The tree uses sequences aligned with the MUSCLE software, with the default parameters as implemented on Seaview version 4 [24], and a tree was inferred based on 1285 sites using the distance model of observed diver-gence, as implemented in the BioNJ algorithm.

The 16S rRNA sequences were aligned using the MUSCLE software, with the default parameters as implemented on Seaview version 4 [24], and a tree was inferred based on 1285 sites using the distance model of observed divergence, as imple-

mented in the BioNJ algorithm, and a bootstrap-ping process repeated 500 times. The final tree was rooted using the 16S rRNA se-quence of Macrococcus equipercicus Type strain that belongs to a closely-related sister genus.

Staphylococcus capitis

1122 Standards in Genomic Sciences

Genome sequencing information The genome sequence of S. capitis strain CR01 was determined by high-throughput sequencing per-formed on a Genome Sequencer FLX + system (454 Life Sciences/Roche) using FLX Titanium re-agents according to the manufacturer's protocols and instructions, with approximately 47-fold cov-erage of the genome. This platform provides long-er read lengths than other sequencing platforms to obtain raw sequences. De novo assemblies were performed using the Roche Newbler (v 2.7) soft-ware package.

Genome project history Table 2 presents the project information and its association with MIGS version 2.0 compliance [5].

Growth conditions and DNA isolation The sample was prepared for sequencing by grow-ing S. capitis CR01, aerobically at 37°C in Blood Agar for 24-48 hours. Genomic DNA was extracted using the PureLinkTM genomic DNA kit (InvitrogenTM) according to the manufacturer’s recommended protocol. The quantity of DNA ob-tained was determined using a NanoVue TM Plus (HVD Life Sciences), and 1 µg of DNA was used for sequencing of whole-genome of this strain.

Genome sequencing and assembly The isolated DNA of S. capitis CR01, was used to create 454-shotgun libraries following the GS Rap-id library protocol (Roche 454, Roche). The result-ing 454 DNA libraries were sequenced using a whole-genome shotgun strategy by GS FLX Titani-um sequencing kit XL+ [25] (202,108 reads total-ing 2.5 Mb, X48 fold coverage of the genome). Ge-nome sequences were processed by Roche’s se-quencing software according to the manufactur-er's instructions (454 Life Science). The resulting shotgun reads were assembled de novo using the Roche Newbler assembly software 2.7 (454 Life

Science) and 26 large contigs (Contig00001 to Contig00026) were obtained. The N50 was 176239 bp.

Genome annotation An automatic syntactic and functional annotation of the draft genome was performed using the Mi-croScope platform pipeline [26,27]. The syntactic analysis combines a set of programs including AMIGene [28], tRNAscan-SE [29], RNAmmer [30], Rfam scan [31] and Prodigal software [32] to pre-dict genomic objects that are mainly CDSs and RNA genes. More than 20 bioinformatics methods are then used for functional and relational anal-yses: homology search in the generalist databank UniProt [33] and in more specialized databases as COG [34], InterPro [35], PRIAM profiles for enzy-matic classification [36], prediction of protein lo-calization using TMHMM [37], SignalP [38] and PsortB [39] tools.

Genome properties The genome includes one circular chromosome of 2,504,472 bp (32.81% GC content). A total of 2,565 genes were predicted with 2,453 being pro-tein-coding genes, 59 tRNA-enconding genes, 4 rRNA-encoding genes (including 2 copies of 5S rRNA, 1 copy of both the large and the small-subunits, respectively, 23S and 16S rRNA) and 34 other RNA related ORFs. No plasmid was detected. Of the 2,453 protein-coding genes, 1,892 genes (76.7%) were assigned to a putative function with the remaining annotated as hypothetical proteins. The predicted coding density in S. capitis strain CR01 was 86%. Table 3 and Figure 4 detailed description of the properties and the statistics of Staphylococcus capitis strain CR01 genome. The distribution of the genes into COGs functional categories is pre-sented in Table 4.

Table 2. Project information MIGS ID Property Term MIGS-31 Finishing quality Non-contiguous finished

MIGS-28 Libraries used 454 pyrosequence rapid li-brary

MIGS-29 Sequencing platforms 454 GS FLX+

MIGS-31.2 Fold coverage 47.0 × pyrosequence

MIGS-30 Assemblers Newbler Assembler 2.7

GenBank CBUB000000000.1

Lemriss et al.

http://standardsingenomics.org 1123

Table 3. Nucleotide content and gene count levels of the genome Attribute Value % of totala Genome size (bp) 2.504.472 100.00%

DNA G+C content (bp) 821.717 32.81%

DNA coding region (bp) 2.158.855 6.2%

Number of Scaffolds 26 -

Total genesb 2566 100.00%

RNA genes 97 4.00%

tRNA-enconding genes 59 2.30%

rRNA-encoding genes 4 0.20%

Protein-coding genes (CDS) 2454 96.00%

Genes assigned to COGs 1999 81.00%

Genes of unknown function 561 23.34%

Genes with transmembrane helicesc 630 25.70%

CRISPR repeats 1 -

a) The total is based on either the size of the genome in base pairs or the total number of protein coding genes in the annotated genome. b) Total number of genes includes CDS, RNA genes and pseudogenes. c) Detection of transmembrane helices was performed using TMHMM v. 2.0 [40]

Table 4. Number of genes associated with general COG functional categories.

Code Value %agea Description

J 178 7.21 Translation K 184 7.46 Transcription L 169 6.85 Replication, recombination and repair D 29 1.18 Cell cycle control, mitosis and meiosis V 85 3.44 Defense mechanisms T 89 3.61 Signal transduction mechanisms M 113 4.58 Cell wall/membrane biogenesis N 23 0.9 Cell motility W 1 0.04 Extracellular structures U 33 1.34 Intracellular trafficking and secretion

O 86 3.48 Posttranslational modification, protein turnover, chaper-

ones C 144 5.83 Energy production and conversion G 210 8.51 Carbohydrate transport and metabolism E 370 14.99 Amino acid transport and metabolism F 92 3.73 Nucleotide transport and metabolism H 109 4.42 Coenzyme transport and metabolism I 92 3.73 Lipid transport and metabolism P 270 10.94 Inorganic ion transport and metabolism

Q 56 2.27 Secondary metabolites biosynthesis, transport and catabo-

lism R 425 17.22 General function prediction only S 203 8.23 Function unknown - 469 19.00 Not in COGs

a) The total is based on the total number of protein coding genes in the annotated genome.

Staphylococcus capitis

1124 Standards in Genomic Sciences

Figure 4. Graphical circular map of the chromosome. From outside to the center: Genes on the forward strand (colored by COG categories), genes on the reverse strand colored by COG categories), RNA genes (tRNAs green, rRNAs blue), GC content, and GC skew

ConclusionHere, we described a new genome sequence of Staphylococcus capitis (strain CR01 belonging to NRCS-A clone) as a first step toward comparing its content with other sequenced Staphylococcus capitis genomes as well as CoNS genomes of spe-cies associated with late-onset sepsis. Detailed analyses are in progress to identify virulence fac-tors and mobile genetic elements (MBE), such as the staphylococcal chromosome cassette (SCCmec) [18], potentially related to the high

specificity of the NRCS-A clone to the NICU envi-ronment.

Acknowledgements This work was supported by a grant from the Fondation pour la Recherche Médicale (FRM, grant ING20111223510) and by the Institut Na-tional de la Recherche Médicale (INSERM) and the French Ministry of Health.

Lemriss et al.

http://standardsingenomics.org 1125

References1. Klingenberg C, Rønnestad A, Anderson AS, Abra-

hamsen TG, Zorman J, Villaruz A, Flægstad T, Ot-to M. Sollid, Ericson J. Persistent strains of coagu-lase-negative staphylococci in a neonatal inten-sive care unit: virulence factors and invasiveness. Clin Microbiol Infect 2007; 13:1100-1111. Pub-Med http://dx.doi.org/10.1111/j.1469-0691.2007.01818.x

2. Rasigade JP, Raulin O, Picaud JC, Tellini C, Bes M, Grando J, Ben Saïd M, Claris O, Etienne J, Tigaud S, Laurent F. Methicillin-ResistantStaphylococcus capitis with Reduced Vancomycin Susceptibility Causes Late-Onset Sepsis in Intensive Care Neonates. PLoS ONE 2012; 7:e31548. PubMed http://dx.doi.org/10.1371/journal.pone.0031548

3. Ng PC, Chow VC, Lee CH, Ling JM, Wong HL, Chang RCY. Persistent Staphylococcus capitis septicemia in a preterm infant. Pediatr Infect Dis J 2006; 25:652-654. PubMed http://dx.doi.org/ 10.1097/01.inf.0000225785.32137.d3

4. de Silva GDI, Kantzanou M, Justice A, Massey RC, Wilkinson AR, Day NPJ, Peacock SJ. The ica Operon and Biofilm Production in Coagulase-Negative Staphylococci Associated with Carriage and Disease in a Neonatal Intensive Care Unit. J Clin Microbiol 2002; 40:382-388. PubMed http://dx.doi.org/10.1128/JCM.40.02.382-388.2002

5. Field D, Garrity G, Gray T, Morrison N, Selengut J, Sterk P, Tatusova T, Thomson N, Allen MJ, Angiuoli et al. The minimum information about a genome sequence (MIGS) specification. Nat Biotechnol 2008; 26:541-547. PubMed http://dx.doi.org/10.1038/nbt1360

6. Woese CR, Kandler O, Wheelis ML. Towards a nat-ural system of organisms: proposal for the do-mains Archaea, Bacteria, and Eukarya. Proc Natl Acad Sci USA 1990; 87:4576-4579. PubMed http://dx.doi.org/10.1073/pnas.87.12.4576

7. Gibbons NE, Murray RGE. Proposals Concerning the Higher Taxa of Bacteria. Int J Syst Bacteriol 1978; 28:1-6; http://dx.doi.org/10.1099/00207713-28-1-1.

8. Murray RGE. The Higher Taxa, or, a Place for Everything...? In: Holt JG (ed), Bergey's Manual of Systematic Bacteriology, First Edition, Volume 1, The Williams and Wilkins Co., Baltimore, 1984, p. 31-34.

9. List of new names and new combinations previ- ously effectively, but not validly, published. List

no. 132. Int J Syst Evol Microbiol 2010; 60:469-472. http://dx.doi.org/10.1099/ijs.0.022855-0

10. Ludwig W, Schleifer KH, Whitman WB. Class I. Bacilli class nov. In: De Vos P, Garrity G, Jones D, Krieg NR, Ludwig W, Rainey FA, Schleifer KH, Whitman WB (eds), Bergey's Manual of Systemat- ic Bacteriology, Second Edition, Volume 3, Springer-Verlag, New York, 2009, p. 19-20.

11. Skerman VBD, McGowan V, Sneath PHA. Ap- proved Lists of Bacterial Names. Int J Syst Bacteriol 1980; 30:225-420. http://dx.doi.org/10.1099/00207713-30-1-225

12. Prévot AR. In: Hauderoy P, Ehringer G, Guillot G, Magrou. J., Prévot AR, Rosset D, Urbain A (eds), Dictionnaire des Bactéries Pathogènes, Second Edition, Masson et Cie, Paris, 1953, p. 1-692.

13. List Editor. List of new names and new combina- tions previously effectively, but not validly, pub- lished. List no. 132. Int J Syst Evol Microbiol 2010; 60:469-472. http://dx.doi.org/10.1099/ijs.0.022855-0

14. Schleifer KH, Bell JA. Family VIII.Staphylococcaceae fam. nov. In: De Vos P, Garrity G, Jones D, Krieg NR, Ludwig W, Rainey FA, Schleifer KH, Whitman WB (eds), Bergey's Manual of Systematic Bacteriology, Second Edi- tion, Volume 3, Springer-Verlag, New York, 2009, p. 392.

15. Rosenbach FJ. In: Bergmann JF (ed), Microorganismen bei den Wund-Infections- Krankheiten des Menschen., Wiesbaden, 1884, p. 1-122.

16. Judicial Commission. Opinion 17. Conservation of the Generic name Staphylococcus Rosenbach, Designation of Staphylococcus aureus Rosenbach as the Nomenclatural Type of the Genus Staphy- lococcus Rosenbach, and Designation of the Neotype culture of Staphylococcus aureus Rosenbach. Int Bull Bacteriol Nomencl Taxon 1958; 8:153-154.

17. Kloos WE, Musselwhite MS. Distribution and Per-sistence of Staphylococcus and Micrococcus Spe-cies and Other Aerobic Bacteria on Human Skin. Appl Microbiol 1975; 30:381-385. PubMed

18. Martins Simões P, Rasigade JP, Lemriss H, Butin M, Ginevra C, Lemriss S, Goering RV, Ibrahimi A, Picaud JC, Vandenesch FEL, et al. Characteriza-tion of a novel staphylococcal chromosome cas-sette (SCCmec) within a composite SCC island in neonatal sepsis-associated Staphylococcus capitis pulsotype NRCS-A. Antimicrob Agents

Staphylococcus capitis

1126 Standards in Genomic Sciences

Chemother 2013; 57:6354. PubMed http://dx.doi.org/10.1128/AAC.01576-13

19. Schleifer KH, Bell JA. Family VIII.Staphylococcaceae fam. nov. In: De Vos P, Garrity G, Jones D, Krieg NR, Ludwig W, Rainey FA, Schleifer KH, Whitman WB (eds), Bergey's Manual of Systematic Bacteriology, Second Edi- tion, Volume 3, Springer-Verlag, New York, 2009, p. 392.

20. Ashburner M, Ball CA, Blake JA, Botstein D, But-ler H, Cherry JM, Davis AP, Dolinski K, Dwight SS, Eppig JT, et al. Gene ontology: tool for the unification of biology. The Gene Ontology Con-sortium. Nat Genet 2000; 25:25-29. PubMed http://dx.doi.org/10.1038/75556

21. Cherkaoui A, Hibbs J, Emonet S, Tangomo M, Girard M, Francois P, Schrenzel J. Comparison of two matrix-assisted laser desorption ionization-time of flight mass spectrometry methods with conventional phenotypic identification for routine identification of bacteria to the species level. J Clin Microbiol 2010; 48:1169-1175. PubMed http://dx.doi.org/10.1128/JCM.01881-09

22. French Society for Microbiology. Recommandations du Comite de l'Antibiogramme de la Société Française de Microbiologie. 2009. Available at: wwwsfmasofr/doc/downloadphp?doc=DiU8C&fic =casfm_2009pdf. Accessed 22 February 2009.

23. Hall KK, Lyman JA. Updated review of blood cul-ture contamination. Clin Microbiol Rev 2006; 19:788-802. PubMed http://dx.doi.org/10.1128/CMR.00062-05

24. Gouy M, Guindon S, Gascuel O. SeaView Ver-sion 4: A Multiplatform Graphical User Interface for Sequence Alignment and Phylogenetic Tree Building. Mol Biol Evol 2010; 27:221-224. Pub-Med http://dx.doi.org/10.1093/molbev/msp259

25. Fleischmann RD, Adams MD, White O, Clayton RA, Kirkness EF, Kerlavage AR, Bult CJ, Tomb JF, Dougherty BA, Merrick JM, et al. Whole-genome random sequencing and assembly ofHaemophilus influenzae Rd. Science 1995; 269:496-512. Pub-Med http://dx.doi.org/10.1126/science.7542800

26. Vallenet D, Belda E, Calteau A, Cruveiller S, Engelen S, Lajus A, Le Fèvre F, Longin C, Mornico D, Roche D, et al. MicroScope—an integrated microbial resource for the curation and compara-tive analysis of genomic and metabolic data. Nu-cleic Acids Res 2013; 41:D636-D647. PubMed http://dx.doi.org/10.1093/nar/gks1194

27. Vallenet D, Labarre L, Rouy Z, Barbe V, Bocs S, Cruveiller S, Lajus A, Pascal G, Scarpelli C, Médigue C. MaGe: a microbial genome annota-tion system supported by synteny results. Nucleic Acids Res 2006; 34:53-65. PubMed http://dx.doi.org/10.1093/nar/gkj406

28. Bocs S, Cruveiller S, Vallenet D, Nuel G, Médigue C. AMIGene: Annotation of MIcrobial Genes. Nucleic Acids Res 2003; 31:3723-3726. PubMed http://dx.doi.org/10.1093/nar/gkg590

29. Lowe TM, Eddy SR. tRNAscan-SE: a program for improved detection of transfer RNA genes in ge-nomic sequence. Nucleic Acids Res 1997; 25:955-964. PubMed http://dx.doi.org/10.1093/nar/25.5.0955

30. Lagesen K, Hallin P, Rødland EA, Staerfeldt HH, Rognes T, Ussery DW. RNAmmer: consistent and rapid annotation of ribosomal RNA genes. Nucle-ic Acids Res 2007; 35:3100-3108. PubMed http://dx.doi.org/10.1093/nar/gkm160

31. Gardner PP, Daub J, Tate JG, Nawrocki EP, Kolbe DL, Lindgreen S, Wilkinson AC, Finn RD, Grif-fiths-Jones S, Eddy SR, Bateman A. Rfam: updates to the RNA families database. Nucleic Acids Res 2009; 37:D136-D140. PubMed http://dx.doi.org/10.1093/nar/gkn766

32. Hyatt D, Chen GL, Locascio PF, Land ML, Lar-imer FW, Hauser LJ. Prodigal: prokaryotic gene recognition and translation initiation site identifi-cation. BMC Bioinformatics 2010; 11:119. Pub-Med http://dx.doi.org/10.1186/1471-2105-11-119

33. UnitProt Consortium. The Universal Protein Re-source (UniProt) 2009. Nucleic Acids Res 2009; 37:D169-D174. PubMed http://dx.doi.org/10.1093/nar/gkn664

34. Tatusov RL, Fedorova ND, Jackson JD, Jacobs AR, Kiryutin B, Koonin EV, Krylov DM, Mazumder R, Mekhedov SL, Nikolskaya AN, et al. The COG database: an updated version includes eukary-otes. BMC Bioinformatics 2003; 4:41. PubMed http://dx.doi.org/10.1186/1471-2105-4-41

35. Hunter S, Apweiler R, Attwood TK, Bairoch A, Bateman A, Binns D, Bork P, Das U, Daugherty L, Duquenne L, et al. InterPro: the integrative pro-tein signature database. Nucleic Acids Res 2009; 37:D211-D215. PubMed http://dx.doi.org/10.1093/nar/gkn785

36. Claudel-Renard C, Chevalet C, Faraut T, Kahn D. Enzyme-specific profiles for genome annotation: PRIAM. Nucleic Acids Res 2003; 31:6633-6639. PubMed http://dx.doi.org/10.1093/nar/gkg847

Lemriss et al.

http://standardsingenomics.org 1127

37. Sonnhammer EL, von Heijne G, Krogh A. A hid-den Markov model for predicting transmembrane helices in protein sequences. Proc Int Conf Intell Syst Mol Biol 1998; 6:175-182. PubMed

38. Bendtsen JD, Nielsen H, von Heijne G, Brunak S. Improved prediction of signal peptides: SignalP 3.0. J Mol Biol 2004; 340:783-795. PubMed http://dx.doi.org/10.1016/j.jmb.2004.05.028

39. Gardy JL, Laird MR, Chen F, Rey S, Walsh CJ, Es-ter M, Brinkman FS. PSORTb v.2.0: expanded prediction of bacterial protein subcellular locali-zation and insights gained from comparative pro-

teome analysis. Bioinformatics 2005; 21:617-623. PubMed http://dx.doi.org/10.1093/bioinformatics/bti057

40. Moller S, Croning MDR, Apweiler R. Evaluation of methods for the prediction of membrane span-ning regions. Bioinformatics 2001; 17:646-653. PubMed http://dx.doi.org/10.1093/bioinformatics/17.7.646

Genome Sequences of Four Staphylococcus capitis NRCS-A Isolatesfrom Geographically Distant Neonatal Intensive Care Units

H. Lemriss,a S. Lemriss,b P. Martins-Simoes,c,d,e M. Butin,c L. Lahlou,a J.-P. Rasigade,c,d A. Kearns,f O. Denis,g M. Deighton,h

A. Ibrahimi,a F. Laurent,c,d,e S. El Kabbajb

Biotechnology Laboratory (Medbiotech), Medical and Pharmacy School, University Mohammed V de Rabat, Rabat, Moroccoa; Department of Biosecurity PCL3, Laboratoryof Research and Medical Analysis of the Fraternal of Gendarmerie Royale, Rabat, Moroccob; International Centre for Research in Infectious diseases, INSERM, University ofLyon, Lyon, Francec; Department of Clinical Microbiology, Northern Hospital Group, Hospices Civils de Lyon, Lyon, Franced; National Reference Center for Staphylococci,Hospices Civils de Lyon, Lyon, Francee; Public Health England, Colindale, London, United Kingdomf; Erasme Hospital, Université Libre de Bruxelles, Brussels, Belgiumg;RMIT University, Bundoora, Victoria, Australiah

Staphylococcus capitis pulsotype NRCS-A was previously reported as a frequent cause of late-onset sepsis in neonatal intensivecare units (NICUs) worldwide. Here, we report the whole-genome shotgun sequences of four S. capitis pulsotype NCRS-Astrains, CR03, CR04, CR05, and CR09, isolated from Belgium, Australia, the United Kingdom, and France, respectively.

Received 15 April 2015 Accepted 16 June 2015 Published 6 August 2015

Citation Lemriss H, Lemriss S, Martins-Simoes P, Butin M, Lahlou L, Rasigade J-P, Kearns A, Denis O, Deighton M, Ibrahimi A, Laurent F, El Kabbaj S. 2015. Genome sequences offour Staphylococcus capitis NRCS-A isolates from geographically distant neonatal intensive care units. Genome Anounc 3(4):e00501-15. doi:10.1128/genomeA.00501-15.

Copyright © 2015 Lemriss et al. This is an open-access article distributed under the terms of the Creative Commons Attribution 3.0 Unported license.

Address correspondence to S. Lemriss, lemrisssanaa@hotmail.com.

Coagulase-negative staphylococci (CoNS) are the most fre-quently encountered pathogens in neonatal intensive care

units (NICUs) (1). However, in the NICU setting, recent studieshave indicated that methicillin-resistant Staphylococcus capitismight emerge as a significant pathogen, causing late-onset sepsis(LOS) in several neonatal intensive care units in France, the Neth-erlands, and Australia (2–4).

A study in French NICUs demonstrated the spread of a singleclonal population of methicillin-resistant S. capitis (pulsotypeNRCS-A) associated with reduced susceptibility to vancomycin,which is the first line of antibiotics used in cases of LOS. Moreover,this clone has also been recently identified in NICUs in Belgium,the United Kingdom, and Australia, suggesting a worldwide dis-tribution (5, 6).

In this report, we present the draft genome sequences of four S.capitis (pulsotype NRCS-A) strains (CR03, CR04, CR05, andCR09) isolated from blood cultures from four neonates hospital-ized in NICUs in Belgium, Australia, the United Kingdom, andFrance, respectively.

All S. capitis strains were grown in blood agar at 37°C, andgenomic DNA was extracted using the PureLink genomic DNA kit(Invitrogen), according to the manufacturer’s recommended pro-tocol. The quantity of DNA was determined using a NanoVue Plus(HVD Lifesciences), and 1 �g of DNA was used to sequence the

whole genome of each strain. The 454-shotgun libraries were pre-pared from the extracted genomic DNA following GS rapid libraryprotocol (Roche 454; Roche).

The genome sequence of each S. capitis strain was determinedby high-throughput sequencing performed on a Genome Se-quencer FLX� system (454 Life Sciences/Roche) using FLX Tita-nium reagents, according to the manufacturer’s protocols and in-structions. De novo assemblies were performed using the RocheNewbler (version 2.9) software package, and the sequencing re-sults are summarized in Table 1.

An automatic syntactic and functional annotation of the draftgenome was performed using the MicroScope platform pipeline(7, 8). The syntactic analysis combines a set of programs, includ-ing AMIGene (9), tRNAscan-SE (10), RNAmmer (11), Rfam scan(12), and Prodigal software (13) to predict genomic objects thatare mainly coding sequences (CDSs) and RNA genes. More than20 bioinformatics methods were used for functional and relationalanalyses. The homology search was performed in the generalistdatabank UniProt (14) and in more specialized databases, such asCOG (15), InterPro (16), PRIAM profiles for enzymatic classifi-cation (17), prediction of protein localization using TMHMM(18), SignalP (19), and PSORTb (20) tools.

The chromosome of strain CR03 (ENA accession no.CTEB01000000) contains 2,575 genes, 2,466 coding sequences

TABLE 1 Summary of genome sequencing results in the present study

S. capitisstrain Country source

Reads(Mb)

Foldcoverage (�)

No. ofcontigs

Genomesize (bp)

G�Ccontent (%) Accession no.

CR03 Belgium 141,728 30 31 2,508,352 32.81 CTEB01000000CR04 Australia 132,280 30 38 2,512,289 32.80 CTEM01000000CR05 United Kingdom 139,569 31 39 2,543,917 32.84 CTEO01000000CR09 France 132,205 30 34 2,490,458 32.82 CTEL01000000

crossmark

Genome AnnouncementsJuly/August 2015 Volume 3 Issue 4 e00501-15 genomea.asm.org 1

on Novem

ber 15, 2015 by guesthttp://genom

ea.asm.org/

Dow

nloaded from

(CDSs), 4 rRNAs, and 61 tRNAs; the chromosome of strain CR04(accession no. CTEM01000000) contains 2,566 genes, 2,457CDSs, 4 rRNAs, and 60 tRNAs; the chromosome of strain CR05(accession no. CTEO01000000) contains 2,624 genes, 2,508 CDSs,4 rRNAs, and 60 tRNAs; and the chromosome of strain CR09(accession no. CTEL01000000) contains 2,540 genes, 2,432 CDSs,4 rRNAs, and 59 tRNAs.

Nucleotide sequence accession numbers. This whole-genomeshotgun project has been deposited at the ENA database under theaccession numbers listed in Table 1. The versions described in thispaper are in the first versions, under BioProject designation no.PRJEB8618.

ACKNOWLEDGMENTS

This work was supported by a grant from the Fondation pour la RechercheMédicale (FRM) (grant ING20111223510) and by the Institut National dela Recherche Médicale (INSERM) and the French Ministry of Health. Thiswork was also supported by a grant from the NIH for H3Africa BioNet.

REFERENCES1. Klingenberg C, Rønnestad A, Anderson AS, Abrahamsen TG, Zorman

J, Villaruz A, Flægstad T, Otto M, Sollid JE, Ericson J. 2007. Persistentstrains of coagulase-negative staphylococci in a neonatal intensive careunit: virulence factors and invasiveness. Clin Microbiol Infect 13:1100 –1111. http://dx.doi.org/10.1111/j.1469-0691.2007.01818.x.

2. Rasigade J-P, Raulin O, Picaud J-C, Tellini C, Bes M, Grando J, BenSaïd M, Claris O, Etienne J, Tigaud S, Laurent F. 2012. Methicillin-resistant Staphylococcus capitis with reduced vancomycin susceptibilitycauses late-onset sepsis in intensive care neonates. PLoS One 7:e31548.http://dx.doi.org/10.1371/journal.pone.0031548.

3. Van Der Zwet WC, Debets-Ossenkopp YJ, Reinders E, Kapi M,Savelkoul PH, Van Elburg RM, Hiramatsu K, Vandenbroucke-GraulsCM. 2002. Nosocomial spread of a Staphylococcus capitis strain with het-eroresistance to vancomycin in a neonatal intensive care unit. J Clin Mi-crobiol 40:2520 –2525. http://dx.doi.org/10.1128/JCM.40.7.2520-2525.2002.

4. D’mello D, Daley AJ, Rahman MS, Qu Y, Garland S, Pearce C,Deighton MA. 2008. Vancomycin heteroresistance in bloodstream iso-lates of Staphylococcus capitis. J Clin Microbiol 46:3124 –3126. http://dx.doi.org/10.1128/JCM.00592-08.

5. Cui B, Smooker PM, Rouch DA, Daley AJ, Deighton MA. 2013. Differ-ences between two clinical Staphylococcus capitis subspecies as revealed bybiofilm, antibiotic resistance, and pulsed-field gel electrophoresis profil-ing. J Clin Microbiol 51:9 –14. http://dx.doi.org/10.1128/JCM.05124-11.

6. Butin M, Martins Simoes P, Lemriss H, Lemriss S, Vandenesch F, ClarisO, Picaud JC, Rasigade JP, Laurent F. 2014. Staphylococcus capitis inneonatal late-onset sepsis: unexpected worldwide dissemination of an en-demic multi-resistant clone, poster 011. 5th Cong Eur Acad Pediatr Soc,17 to 21 October 2014, Barcelona, Spain.

7. Vallenet D, Belda E, Calteau A, Cruveiller S, Engelen S, Lajus A, LeFèvre F, Longin C, Mornico D, Roche D, Rouy Z, Salvignol G, ScarpelliC, Thil Smith AA, Weiman M, Médigue C. 2013. MicroScope—an

integrated microbial resource for the curation and comparative analysis ofgenomic and metabolic data. Nucleic Acids Res 41:D636 –D647. http://dx.doi.org/10.1093/nar/gks1194.

8. Vallenet D, Labarre L, Rouy Z, Barbe V, Bocs S, Cruveiller S, Lajus A,Pascal G, Scarpelli C, Médigue C. 2006. MaGe: a microbial genomeannotation system supported by synteny results. Nucleic Acids Res 34:53– 65. http://dx.doi.org/10.1093/nar/gkj406.

9. Bocs S, Cruveiller S, Vallenet D, Nuel G, Médigue C. 2003. AMIGene:annotation of microbial genes. Nucleic Acids Res 31:3723–3726. http://dx.doi.org/10.1093/nar/gkg590.

10. Lowe TM, Eddy SR. 1997. tRNA scan-SE: a program for improved detec-tion of transfer RNA genes in genomic sequence. Nucleic Acids Res 25:955–964. http://dx.doi.org/10.1093/nar/25.5.0955.

11. Lagesen K, Hallin P, Rødland EA, Staerfeldt HH, Rognes T, UsseryDW. 2007. RNAmmer: consistent and rapid annotation of ribosomalRNA genes. Nucleic Acids Res 35:3100 –3108. http://dx.doi.org/10.1093/nar/gkm160.

12. Gardner PP, Daub J, Tate JG, Nawrocki EP, Kolbe DL, Lindgreen S,Wilkinson AC, Finn RD, Griffiths-Jones S, Eddy SR, Bateman A. 2009.Rfam: updates to the RNA families database. Nucleic Acids Res 37:D136 –D140. http://dx.doi.org/10.1093/nar/gkn766.

13. Hyatt D, Chen GL, Locascio PF, Land ML, Larimer FW, Hauser LJ.2010. Prodigal: prokaryotic gene recognition and translation initiation siteidentification. BMC Bioinformatics 11:119. http://dx.doi.org/10.1186/1471-2105-11-119.

14. UnitProt Consortium. 2009. The Universal Protein Resource (UniProt)2009. Nucleic Acids Res 37:D169 –D174. http://dx.doi.org/10.1093/nar/gkn664.

15. Tatusov RL, Fedorova ND, Jackson JD, Jacobs AR, Kiryutin B, KooninEV, Krylov DM, Mazumder R, Mekhedov SL, Nikolskaya AN, Rao BS,Smirnov S, Sverdlov AV, Vasudevan S, Wolf YI, Yin JJ, Natale DA.2003. The COG database: an updated version includes eukaryotes. BMCBioinformatics 4:41. http://dx.doi.org/10.1186/1471-2105-4-41.

16. Hunter S, Apweiler R, Attwood TK, Bairoch A, Bateman A, Binns D,Bork P, Das U, Daugherty L, Duquenne L, Finn RD, Gough J, Haft D,Hulo N, Kahn D, Kelly E, Laugraud A, Letunic I, Lonsdale D, Lopez R,Madera M, Maslen J, McAnulla C, McDowall J, Mistry J, Mitchell A,Mulder N, Natale D, Orengo C, Quinn AF, Selengut JD, Sigrist CJ,Thimma M, Thomas PD, Valentin F, Wilson D, Wu CH, Yeats C. 2009.InterPro: the integrative protein signature database. Nucleic Acids Res37:D211–D215. http://dx.doi.org/10.1093/nar/gkn785.

17. Claudel-Renard C, Chevalet C, Faraut T, Kahn D. 2003. Enzyme-specificprofiles for genome annotation: PRIAM. Nucleic Acids Res 31:6633– 6639. http://dx.doi.org/10.1093/nar/gkg847.

18. Sonnhammer EL, von Heijne G, Krogh A. 1998. A hidden Markov modelfor predicting transmembrane helices in protein sequences. Proc Int ConfIntell Syst Mol Biol 6:175–182.

19. Bendtsen JD, Nielsen H, von Heijne G, Brunak S. 2004. Improvedprediction of signal peptides: SignalP 3.0. J Mol Biol 340:783–795. http://dx.doi.org/10.1016/j.jmb.2004.05.028.

20. Gardy JL, Laird MR, Chen F, Rey S, Walsh CJ, Ester M, Brinkman FS.2005. PSORTb v.2.0: expanded prediction of bacterial protein subcellularlocalization and insights gained from comparative proteome analysis.Bioinformatics 21:617– 623. http://dx.doi.org/10.1093/bioinformatics/bti057.

Lemriss et al.

Genome Announcements2 genomea.asm.org July/August 2015 Volume 3 Issue 4 e00501-15

on Novem

ber 15, 2015 by guesthttp://genom

ea.asm.org/

Dow

nloaded from

Genome Sequences of Multiresistant Staphylococcus capitis PulsotypeNRCS-A and Methicillin-Susceptible S. capitis Pulsotype NRCS-C

H. Lemriss,d Y. Dumont,c S. Lemriss,a P. Martins-Simoes,b,c,e M. Butin,c L. Lahlou,d J. P. Rasigade,b,c S. El Kabbaj,a F. Laurent,b,c,e

A. Ibrahimid

Department of Biosecurity PCL3, Research and Medical Analysis Laboratory of Gendarmerie Royale, Rabat, Moroccoa; International Centre for Research in InfectiousDiseases, INSERM U1111, University of Lyon, Lyon, Franceb; Department of Clinical Microbiology, Northern Hospital Group, Hospices Civils de Lyon, Lyon, Francec;Biotechnology Laboratory (Medbiotech), Medical and Pharmacy School, University Mohammed V de Rabat, Rabat, Moroccod; National Reference Center forStaphylococci, Hospices Civils de Lyon, Lyon, Francee

Here, we report the draft genome sequences of methicillin-susceptible Staphylococcus captis pulsotype NCRS-C (CR02 strain)and multiresistant Staphylococcus captis pulsotype NCRS-A (CR07 strain).

Received 28 April 2016 Accepted 29 April 2016 Published 9 June 2016

Citation Lemriss H, Dumont Y, Lemriss S, Martins-Simoes P, Butin M, Lahlou L, Rasigade JP, El Kabbaj S, Laurent F, Ibrahimi A. 2016. Genome sequences of multiresistantStaphylococcus capitis pulsotype NRCS-A and methicillin-susceptible S. capitis pulsotype NRCS-C. Genome Announc 4(3):e00541-16. doi:10.1128/genomeA.00541-16.

Copyright © 2016 Lemriss et al. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International license.

Address correspondence to S. Lemriss, lemrisssanaa@hotmail.com.

Staphylococcus capitis is a Gram-positive coccus belonging tothe coagulase-negative staphylococcus group (CoNS) that is

frequently found on the human skin and mucosa (1). Recently, afew studies have reported the emergence of S. capitis, which wasfound to be a major cause of late-onset sepsis (LOS) in severalneonatal intensive care units (NICUs) (2, 3). A clonal populationof methicillin-resistant S. capitis NRCS-A strains has spread intoseveral geographically distant NICUs (4). These isolates exhibitreduced susceptibility to vancomycin, which is the most widelyused antimicrobial agent in the NICU setting (5, 6).

In order to elucidate the molecular mechanisms behind thewide-spreading of methicillin-resistant S. capitis and methicillin-susceptible S. capitis in NICUs in France, we sequenced two dif-ferent pulsotypes (NRCS-A and NRCS-C) of S. capitis strains(CR07 and CR02).

In this report, we present the draft genome sequences ofmultiresistant S. capitis pulsotype NRCS-A and methicillin-susceptible S. capitis pulsotype NRCS-C isolated from bloodcultures from NICUs in Lyon, France.

These two pulsotype strains were grown in blood agar at 37°C,and genomic DNA was extracted using the PureLink genomicDNA kit (Invitrogen), according to the manufacturer’s recom-mended protocol. The DNA libraries were prepared from 1 �gDNA genomic extracted following GS rapid library protocol(Roche 454; Roche).

The genome sequence of each S. capitis strain was determinedby high-throughput sequencing performed on a Genome Se-quencer FLX � system (454 Life Sciences/Roche) using FLX Tita-nium reagents, according to the manufacturer’s protocols and in-structions. De novo assemblies were performed using RocheNewbler assembly software (version 2.9).

An automatic syntactic and functional annotation of the draftgenome was performed using the MicroScope platform pipeline(7). The syntactic analysis combines a set of programs includingAMIGene (8), tRNAscan-SE (9), RNAmmer (10), Rfam scan (11),and Prodigal software (12) to predict genomic objects that are

mainly coding sequences (CDSs) and RNA genes. More than 20bioinformatics methods were used for functional and relationalanalyses. The homology search was performed in the generalistdatabank UniProt (13) and in more specialized databases such asCOG (14), InterPro (15), PRIAM profiles for enzymatic classifi-cation (16), prediction of protein localization using TMHMM(17), SignalP (18), and PsortB (19) tools.

The draft genome sequence of methicillin-susceptible S. capitisNRCS-C (CR02 strain) has 33.05% G�C content, is 2,344,750 bpin length which is distributed in 320 contigs (average coverage,7.0�) with 2,415 genes, 2,476 CDSs, 42 pseudo genes, 4 rRNAs(5S,16S, 23S), and 59 tRNAs.

The draft genome sequence of methicillin-resistant S. capitisNRCS-A (CR07 strain) has 32.83% G�C content, is 2,477,101 bpin length which is distributed in 26 contigs (average coverage,31�) with 2,411 CDSs, 4 rRNAs (5S,16S, 23S), and 61 tRNAs.

Nucleotide sequence accession numbers. These whole-genome sequences were deposited at GenBank under the acces-sion numbers CZWI00000000 and CZWH00000000 for amethicillin-susceptible S. capitis NRCS-C strain (CR02) and amultiresistant S. capitis NRCS-A strain (CR07), respectively. Theversions described in this paper are the first versions.

ACKNOWLEDGMENTS

This work was supported by a grant from the Fondation pour la RechercheMédicale (FRM, grant ING20111223510) and by the Institut National dela Recherche Médicale (INSERM) and the French Ministry of Health. Thiswork was also supported by a grant from the NIH for H3Africa BioNet.

REFERENCES1. Li X, Lei M, Song Y, Gong K, Li L, Liang H, Jiang X. 2014. Whole

genome sequence and comparative genomic analysis of multidrug-resistant Staphylococcus capitis subsp. urealyticus strain LNZR-1. GutPathog 6:45. http://dx.doi.org/10.1186/s13099-014-0045-x.

2. Klingenberg C, Rønnestad A, Anderson AS, Abrahamsen TG, ZormanJ, Villaruz A, Flaegstad T, Otto M, Sollid JE, Ericson J. 2007. Persistentstrains of coagulase negative staphylococci in neonatal intensive care unit:

crossmark

Genome AnnouncementsMay/June 2016 Volume 4 Issue 3 e00541-16 genomea.asm.org 1

virulence factors and invasiveness. Clin Microbiol Infect 13:1100 –1111.http://dx.doi.org/10.1111/j.1469-0691.2007.01818.x.

3. Rasigade J-P, Raulin O, Picaud J-C, Tellini C, Bes M, Grando J, BenSaïd M, Claris O, Etienne J, Tigaud S, Laurent F. 2012. Methicillin-resistant Staphylococcus capitis with reduced vancomycin susceptibilitycauses late-onset sepsis in intensive care neonates. PLoS One 7:e31548.http://dx.doi.org/10.1371/journal.pone.0031548.

4. Butin M, Rasigade JP, Martins-Simões P, Meugnier H, Lemriss H,Goering RV, Kearns A, Deighton MA, Denis O, Ibrahimi A, Claris O,Vandenesch F, Picaud JC, Laurent F. 2016. Wide geographical dissemi-nation of the multiresistant Staphylococcus capitis NRCS-A clone in neo-natal intensive-care units. Clin Microbiol Infect 22:46 –52. http://dx.doi.org/10.1016/j.cmi.2015.09.008.

5. Cui B, Smooker PM, Rouch DA, Daley AJ, Deighton MA. 2013. Differ-ences between two clinical Staphylococcus capitis subspecies as revealed bybiofilm, antibiotic resistance, and pulsed-field gel electrophoresis profil-ing. J Clin Microbiol 51:9 –14. http://dx.doi.org/10.1128/JCM.05124-11.

6. Vallenet D, Belda E, Calteau A, Cruveiller S, Engelen S, Lajus A, LeFèvre F, Longin C, Mornico D, Roche D, Rouy Z, Salvignol G, ScarpelliC, Thil Smith AA, Weiman M, Médigue C. 2013. MicroScope—anintegrated microbial resource for the curation and comparative analysis ofgenomic and metabolic data. Nucleic Acids Res 41:D636 –D647. http://dx.doi.org/10.1093/nar/gks1194.

7. Vallenet D, Labarre L, Rouy Z, Barbe V, Bocs S, Cruveiller S, Lajus A,Pascal G, Scarpelli C, Médigue C. 2006. MaGe: amicrobial genome an-notation system supported by synteny results. Nucleic Acids Res 34:53– 65. http://dx.doi.org/10.1093/nar/gkj406.

8. Bocs S, Cruveiller S, Vallenet D, Nuel G, Médigue C. 2003. AMIGene:annotation of microbial genes. Nucleic Acids Res 31:3723–3726. http://dx.doi.org/10.1093/nar/gkg590.

9. Lowe TM, Eddy SR. 1997. tRNA scan-SE: a program for improved detec-tion of transfer RNA genes in genomic sequence. Nucleic Acids Res 25:955–964. http://dx.doi.org/10.1093/nar/25.5.0955.

10. Lagesen K, Hallin P, Rødland EA, Staerfeldt H-H, Rognes T, UsseryDW. 2007. RNAmmer: consistent and rapid annotation of ribosomalRNA genes. Nucleic Acids Res 35:3100 –3108. http://dx.doi.org/10.1093/nar/gkm160.

11. Gardner PP, Daub J, Tate JG, Nawrocki EP, Kolbe DL, Lindgreen S,

Wilkinson AC, Finn RD, Griffiths-Jones S, Eddy SR, Bateman A. 2009.Rfam: updates to the RNA families database. Nucleic Acids Res 37:D136 –D140. http://dx.doi.org/10.1093/nar/gkn766.

12. Hyatt D, Chen GL, Locascio PF, Land ML, Larimer FW, Hauser LJ.2010. Prodigal: prokaryotic gene recognition and translation initiation siteidentification. BMC Bioinformatics 11:119. http://dx.doi.org/10.1186/1471-2105-11-119.

13. UnitProt Consortium. 2009. The universal protein Re-source (UniProt)2009. Nucleic Acids Res 37:D169 –D174. http://dx.doi.org/10.1093/nar/gkn664.

14. Tatusov RL, Fedorova ND, Jackson JD, Jacobs AR, Kiryutin B, KooninEV, Krylov DM, Mazumder R, Mekhedov SL, Nikolskaya AN, Rao BS,Smirnov S, Sverdlov AV, Vasudevan S, Wolf YI, Yin JJ, Natale DA.2003. The COG database: an updated version includes eukaryotes. BMCBioinformatics 4:41. http://dx.doi.org/10.1186/1471-2105-4-41.

15. Hunter S, Apweiler R, Attwood TK, Bairoch A, Bateman A, Binns D,Bork P, Das U, Daugherty L, Duquenne L, Finn RD, Gough J, Haft D,Hulo N, Kahn D, Kelly E, Laugraud A, Letunic I, Lonsdale D, Lopez R,Madera M, Maslen J, McAnulla C, McDowall J, Mistry J, Mitchell A,Mulder N, Natale D, Orengo C, Quinn AF, Selengut JD, Sigrist CJ,Thimma M, Thomas PD, Valentin F, Wilson D, Wu CH, Yeats C. 2009.InterPro: the integrative protein signature database. Nucleic Acids Res37:D211–D215. http://dx.doi.org/10.1093/nar/gkn785.

16. Claudel-Renard C, Chevalet C, Faraut T, Kahn D. 2003. Enzyme-specificprofiles for genome annotation: PRIAM. Nucleic Acids Res 31:6633– 6639. http://dx.doi.org/10.1093/nar/gkg847.

17. Sonnhammer EL, von Heijne G, Krogh A. 1998. A hidden Markov modelfor predicting transmembrane helices in protein sequences. Proc Int ConfIntell Syst Mol Biol 6:175–182.

18. Bendtsen JD, Nielsen H, von Heijne G, Brunak S. 2004. Improvedprediction of signal peptides: SignalP 3.0. J Mol Biol 340:783–795. http://dx.doi.org/10.1016/j.jmb.2004.05.028.

19. Gardy JL, Laird MR, Chen F, Rey S, Walsh CJ, Ester M, Brinkman FS.2005. PSORTb v.2.0: expanded prediction of bacterial protein subcellularlocalization and insights gained from comparative proteome analysis.Bioinformatics 21:617– 623. http://dx.doi.org/10.1093/bioinformatics/bti057.

Lemriss et al.

Genome Announcements2 genomea.asm.org May/June 2016 Volume 4 Issue 3 e00541-16

  Published Ahead of Print 23 September 2013. 10.1128/AAC.01576-13.

2013, 57(12):6354. DOI:Antimicrob. Agents Chemother. S. El Kabbaj, F. Vandenesch and F. Laurent

Picaud,Ginevra, S. Lemriss, R. V. Goering, A. Ibrahimi, J. C. P. Martins Simões, J.-P. Rasigade, H. Lemriss, M. Butin, C. Staphylococcus capitis Pulsotype NRCS-ANeonatal Sepsis-Associated

) in thecop/ars/cad-SCCmec (SCCmecStaphylococcal Cassette Chromosome Characterization of a Novel Composite

http://aac.asm.org/content/57/12/6354Updated information and services can be found at:

These include:

SUPPLEMENTAL MATERIAL Supplemental material

REFERENCEShttp://aac.asm.org/content/57/12/6354#ref-list-1at:

This article cites 22 articles, 14 of which can be accessed free

CONTENT ALERTS more»articles cite this article),

Receive: RSS Feeds, eTOCs, free email alerts (when new

http://journals.asm.org/site/misc/reprints.xhtmlInformation about commercial reprint orders: http://journals.asm.org/site/subscriptions/To subscribe to to another ASM Journal go to:

on Novem

ber 14, 2013 by guesthttp://aac.asm

.org/D

ownloaded from

on N

ovember 14, 2013 by guest

http://aac.asm.org/

Dow

nloaded from

Characterization of a Novel Composite Staphylococcal CassetteChromosome mec (SCCmec-SCCcad/ars/cop) in the NeonatalSepsis-Associated Staphylococcus capitis Pulsotype NRCS-A

P. Martins Simões,a,b,c J.-P. Rasigade,a,b,c H. Lemriss,d,e M. Butin,a,c C. Ginevra,a S. Lemriss,d R. V. Goering,g A. Ibrahimi,e J. C. Picaud,f

S. El Kabbaj,d F. Vandenesch,a,b F. Laurenta,b,c

International Centre for Research in Infectious diseases, INSERM U1111, University of Lyon, Lyon, Francea; Department of Clinical Microbiology, Northern Hospital Group,Hospices Civils de Lyon, Lyon, Franceb; National Reference Center for Staphylococci, Hospices Civils de Lyon, Lyon, Francec; Department of Biosecurity PCL3, Laboratory ofResearch and Medical Analysis of the Fraternal of Gendarmerie Royale, Rabat, Moroccod; Medical and Pharmacy School, University Mohammed V Souissi, Rabat,Moroccoe; Department of Neonatology, Northern Hospital Group, Hospices Civils de Lyon, Lyon, Francef; Department of Medical Microbiology and Immunology,Creighton University School of Medicine, Omaha, Nebraska, USAg

Multiresistant Staphylococcus capitis pulsotype NRCS-A has been reported to be a major pathogen causing nosocomial bactere-mia in preterm infants. We report that the NRCS-A strain CR01 harbors a novel 60.9-kb composite staphylococcal cassette chro-mosome mec (SCCmec) element, composed of an SCCmec with strong homologies to Staphylococcus aureus ST398 SCCmec andof an SCCcad/ars/cop harboring resistance genes for cadmium, arsenic, and copper. Whole-genome-based comparisons of pub-lished S. capitis strains suggest that strain CR01 acquired the two elements independently.

Coagulase-negative staphylococci (CoNS) are common com-mensals of the human skin and mucosa that are now recog-

nized as important opportunistic pathogens that cause nosoco-mial bloodstream and indwelling medical device-related infections(1). Recent studies have reported the emergence of methicillin-resistant, vancomycin-heteroresistant Staphylococcus capitis as animportant cause of late-onset sepsis (LOS) in neonatal intensivecare units (NICUs) in France and other countries (2–6). Surpris-ingly, all S. capitis strains from intensive care neonates were re-ported to belong to a single pulsed-field gel electrophoresis pulso-type, NRCS-A, and to harbor a type V-related staphylococcalcassette chromosome mec (SCCmec) element (6). In contrast, S.capitis bloodstream isolates from adult patients belong to severaldistinct, non-NRCS-A pulsotypes. To gain insights into the ge-netic characteristics of this LOS-specific multiresistant S. capitisclone, we sequenced and characterized the SCCmec element ofone representative strain (CR01) with the NRCS-A pulsotype.

Strain CR01 was isolated from the blood cultures of an infantdiagnosed with LOS in 2007 in the NICU of the Hospices Civils deLyon, France. The strain was part of a previously published col-lection (6), had the pulsotype NRCS-A, and harbored a type V-re-lated SCCmec element. We performed whole-genome pyrose-quencing (454 Life Sciences/Roche) for this strain and usedbioinformatics tools to identify and characterize a novel 60.9-kbcomposite SCCmec element (DDBJ/EMBL/GenBank accessionno. KF049201). The cassette was found to be inserted into thecharacteristic 3= end of the orfX gene (7, 8). To define the SCCregion, we searched for SCC-specific insertion site sequences(ISSs) (9, 10). Three ISSs were found, with the furthest down-stream from orfX being partially deleted. Because the predictedSCC region was found in two different contigs, the SCC sequencewas closed using PCR.

SCCmec characterization and similarities to SCCmec ele-ments of livestock-associated Staphylococcus aureus. A 38.8-kbSCCmec element was identified immediately downstream of orfX.This element harbored a type V (5C2&5) SCCmec and contained42 open reading frames (ORFs; orf1 to orf42 in Table S1 in the

supplemental material), as predicted using the syntactic and func-tional annotation implemented in the MicroScope/MaGe plat-form pipeline (11, 12). Using the MicroScope genome browser,the sequence of the CR01 SCCmec element was aligned with 22genomes of methicillin-resistant Staphylococcus strains, which areavailable in the MaGe database. Two genomes in this databasecarried SCCmec elements showing a remarkable similarity to theNRCS-A strain CR01 SCCmec in terms of gene content, gene or-der, and nucleotide identity. Both SCCmec elements were carriedby livestock-associated methicillin-resistant S. aureus (LA-MRSA)strains, namely, the S0385 and 08BA02176 strains, which belongto the highly prevalent LA-MRSA sequence type 398 (ST398) (Fig.1; see also Table S1). A detailed comparison of gene organizationin these three SCCmec elements revealed that the structures of thejoining regions J3 and J2 and the mec and ccr complexes wereidentical to those found in the ST398 LA-MRSA strain S0385,whereas the joining region J1 was identical to that of the ST398LA-MRSA strain 08BA02176. In both the CR01 and the08BA02176 SCCmec elements, the J1 region contained clusteredregularly interspaced short palindromic repeat (CRISPR) lociwith their associated cas genes. CRISPR loci are the sole prokary-otic defense mechanism against foreign DNA conferring an adap-tive immune response, inversely to other defense mechanismssuch as restriction-modification (R-M) systems (13). Using theonline CRISPRFinder software tool (14), we identified twoCRISPR elements in the NRCS-A strain CR01 located immedi-

Received 24 July 2013 Returned for modification 21 August 2013Accepted 25 August 2013

Published ahead of print 23 September 2013

Address correspondence to P. Martins Simões, patrica.martins-simoes@inserm.fr.

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AAC.01576-13.

Copyright © 2013, American Society for Microbiology. All Rights Reserved.

doi:10.1128/AAC.01576-13

6354 aac.asm.org Antimicrobial Agents and Chemotherapy p. 6354 – 6357 December 2013 Volume 57 Number 12

on Novem

ber 14, 2013 by guesthttp://aac.asm

.org/D

ownloaded from

ately before the second ISS (Fig. 1). The first CRISPR elementconsisted of 16 direct repeats (DRs) and 15 spacers. The secondCRISPR element consisted of three nonconserved DRs and twospacers. This subtype III-A CRISPR locus (15) (including the 2CRISPRs and the cas genes) showed a high similarity to the ele-ment found in the ST398 LA-MRSA strain 08BA02176 SCCmecelement (see Fig. S1 in the supplemental material).

To further investigate the relationships between the CR01SCCmec elements and those of ST398 S. aureus (strains S0385 and08BA02176), we characterized the SCCmec-associated direct re-peat units (dru) using the scheme described by Goering et al.,which has been described as a discriminant epidemiological toolfor differentiating highly uniform epidemic methicillin-resistantstrains (16). dru analysis showed that the SCCmec cassettes of boththe CR01 strains and the ST398 08BA02176 strain shared the samedru type (5a-2d-4a-0-2d-5b-3a-2g-4b-4e-3e), namely, dt11c,which further highlighted the close genetic proximity betweenthese SCCmec elements. Strain S0385 harbored a different drutype, namely, dt10a (dt10a, 5a-2d-4a-0-2d-5b-3a-2g-3b-4e), but

presenting only one mutation in the ninth repeat and one repeatfewer. The dru type found in strain CR01 was identical to the onesfound in other S. capitis NRCS-A strains (n � 12, data not shown),further corroborating the clonality within this lineage.

Collectively, these findings suggest that the S. capitis NRCS-Astrain CR01 and ST398 LA-MRSA strains have undergone a recenthorizontal transfer of SCCmec elements originating from a com-mon source.

SCCcad/ars/cop characterization and relationships to otherSCC elements. Immediately downstream of the SCCmec domain,we identified a second, 22.2-kb-long SCC domain (SCCcad/ars/cop) harboring 29 predicted ORFs (orf43 to orf70 in Table S1 inthe supplemental material), including a type 8 ccrA1B3 complexwith 90% similarity to the ccr complex recently described in S.aureus strain LGA251 carrying a type IX SCCmec and the novelmecC allele (17). A comparison of the overall structure of theSCCcad/ars/cop with other SCC elements revealed only two re-gions with partial similarities to previously described SCC ele-ments. The first region encompassed nine ORFs (orf47 to orf56 in

FIG 1 Comparative structure analysis of the composite staphylococcal cassette chromosome mec SCCmec-SCCcad/asr/cop element of Staphylococcus capitisstrain CR01. The sequence of the SCCmec-SCCcad/asr/cop element of strain CR01 was aligned against whole genomes of ST398 S. aureus strains S0385 and08BA02176 and of S. capitis strain SK14. Open reading frames (ORFs) are shown as arrows indicating the transcription direction and colored according to theSCCmec region to which they belong (J3, mec complex, J2, ccr complex, or J1). Homologous gene clusters in different strains have similar colors. Thechromosomal orfX gene and the transposase IS431 are represented by black and yellow arrows, respectively. Insertion site sequences (ISSs) are indicated byvertical lines and colored stars as follows: light yellow star, ccrC recombinase ISS; dark yellow star, ccrAB recombinase ISS with associated direct repeat (DR)sequences; red star, vestigial ccrAB ISS and DR sequences. The CRISPR-associated genes (cas genes) are indicated in light green within the J3 region, while the ccrcomplex in the SCCcad/ars/cop element is colored in turquoise and the resistance genes in dark red.

Novel Composite SCCmec Element in S. capitis NRCS-A

December 2013 Volume 57 Number 12 aac.asm.org 6355

on Novem

ber 14, 2013 by guesthttp://aac.asm

.org/D

ownloaded from

Table S1), including the ccrA1B3 gene complex; this region had anorganization similar to the regions found in the SCCpbp4 elementof the Staphylococcus epidermidis strain ATCC 12228 and in thetype II SCCmec elements of the S. aureus strains MRSA252 andN315 (18). The second region encompassed 11 ORFs (orf58 toorf69 in Table S1) and included genes for the detoxification ofheavy metals, namely, cadmium (cadDC), arsenic (arsCBR), andcopper (copB). All 11 ORFs were highly homologous to thosefound in the J1 regions of the SCCmec element of CC398 MRSA S.aureus JCSC6943 (19) and of the �SCCmec(h1435) domain inStaphylococcus haemolyticus JCSC1435 (18), with nucleotide iden-tities greater than 97.5%.

Of note, previously published NRCS-A strains have been re-ported to harbor only a type V-related SCCmec element (ccrCcomplex), as determined using the multiplex PCRs described byKondo et al. (6, 20). To understand why these PCRs failed todetect the SCCcad/ars/cop type 8-related ccrAB complex, Kondo’sprimer sequences were aligned to the NRCS-A strain CR01 ccrA1and ccrB3 alleles. Several mismatches were observed between theccrA primers and their target sequence, which likely preventedamplification of the ccrAB complex and so explain the misinter-pretation of Kondo’s scheme.

To assess whether SCC elements are present in other S. ca-pitis strains, we performed a BLAST search (http://blast.ncbi.nlm.nih.gov) of the composite SCCmec-SCCcad/ars/cop se-quence against publicly available genomes from methicillin-susceptible S. capitis isolates, namely, those of strains QN1(GenBank accession no. AJJH00000000) (21), SK14 (GenBank

accession no. ACFR00000000), and VCU116 (GenBank acces-sion no. AFTX00000000). None of these strains harbored anSCCmec element. Interestingly, whereas strain QN1 had an in-tact orfX gene, both the SK14 and the VCU116 strains carriedhomologous SCCcad/ars/cop elements inserted into the 3= endof orfX. These latter elements were highly similar to the SCCcad/ars/cop found in the NRCS-A strain CR01 (Fig. 1; see also Table S1 inthe supplemental material), except for the first seven ORFs afterthe insertion at the end of orfX. Gene organization and nucleotidesequences were identical in 22 remaining ORFs (orf47 to orf49and orf53 to orf70 in Table S1).

Evolutionary history of SCCcad/ars/cop and SCCmec acqui-sition by S. capitis NRCS-A. To assess the phylogenetic relation-ships between the S. capitis strains CR01 (NRCS-A clone), QN1,SK14, and VCU116, we performed a whole-genome-based singlenucleotide polymorphism (SNP) analysis and constructed a max-imum likelihood (ML) SNP tree using the snpTree online webserver (22) and PhyML (23), respectively (see the supplementalmaterial). Interestingly, all SCCcad/ars/cop-positive strains clus-tered on a monophyletic clade, separate from the SCC-negativestrain QN1. Furthermore, the sole SCCmec-positive strain (CR01)was the most divergent compared with strains SK14 and VCU116(Fig. 2a). These results suggest the occurrence of at least two in-dependent SCC acquisition events within the S. capitis species(Fig. 2b). The first acquisition of the SCCcad/ars/cop occurred inthe ancestral lineage of strains CR01, SK14, and VCU116, whichwas followed by later acquisition of the SCCmec element in theancestor lineage of the NRCS-A clone.

FIG 2 Phylogenetic analysis of whole-genome-sequenced S. capitis strains and proposed evolutionary history of SCC element acquisition in S. capitis. (a)SNP-based maximum likelihood tree of the 4 S. capitis whole-genome sequences. A total of 27,836 SNPs (indels excluded) were obtained by alignment againstthe reference strain S. epidermidis ATCC 12228. Numbers at the branching points represent the aLRT branch support score obtained. Proposed acquisition eventsof SCCcad/ars/cop and SCCmec elements are indicated by dark and light gray arrows, respectively. (b) Proposed model of sequential acquisition of SCC elementsin the S. capitis clade: in a first event, the SCCcad/ars/cop element harboring multiple resistance genes to heavy metals was inserted via site-specific recombinationat the end of the orfX gene; a second insertion occurred in the SCCcad/ars/cop-positive strain CR01 with the insertion of SCCmec at the 3= end of orfX.Abbreviations: Ancest1, first ancestor; Ancest2, second ancestor (of CR01, SK14, and VCU116).

Martins Simões et al.

6356 aac.asm.org Antimicrobial Agents and Chemotherapy

on Novem

ber 14, 2013 by guesthttp://aac.asm

.org/D

ownloaded from

Conclusions. The highly clonal population of S. capitisNRCS-A, which is endemic in NICUs in several countries distantfrom one another (5), harbors a novel SCCmec-SCCcad/ars/copcomposite island that has likely emerged from two independentacquisition events.

The high degree of structural similarity of the SCCmec type Velement and the partial conservation of genes for heavy metaldetoxification strongly suggest the occurrence of genetic shufflinginvolving S. capitis and CC398 MRSA strains. Whether SCC ele-ment exchanges occurred directly between these strains or indi-rectly via a common SCC element donor is presently unclear andwarrants further investigation.

ACKNOWLEDGMENTS

This work was supported by the Institut National de la Recherche Médi-cale (INSERM) and the French Ministry of Health and by a grant from theFondation pour la Recherche Médicale (FRM) (grant ING20111223510).

REFERENCES1. Otto M. 2009. Staphylococcus epidermidis—the “accidental” pathogen.

Nat. Rev. Microbiol. 7:555–567.2. Gras-Le Guen C, Fournier S, Andre-Richet B, Caillon J, Chamoux C,

Espaze E, Richet H, Roze JC, Lepelletier D. 2007. Almond oil implicatedin a Staphylococcus capitis outbreak in a neonatal intensive care unit. J.Perinatol. 27:713–717.

3. Ng PC, Chow VC, Lee CH, Ling JM WH, Chang R. 2006. PersistentStaphylococcus capitis septicemia in a preterm infant. Pediatr. Infect. Dis. J.25:652– 654.

4. De Silva GDI, Kantzanou M, Justice A, Massey RC, Wilkinson AR, DayNPJ, Peacock SJ. 2002. The ica operon and biofilm production in coag-ulase-negative staphylococci associated with carriage and disease in a neo-natal intensive care unit. J. Clin. Microbiol. 40:382–388.

5. Rasigade J-P, Goering R, Kearns A, Hill R, Deighton M, Meugnier H,Bes M, Ben Saïd M, Claris O, Picaud J-C, Vandenesch F, Etienne J,Laurent F. 2012. Worldwide epidemic methicillin-resistant Staphylococ-cus capitis with reduced vancomycin susceptibility causes late-onset sepsisin intensive care neonates, p 06-075. 15th Int. Symp. Staphylococci Staph-ylococcal Infect., Lyon, France, 26 to 30 August 2012.

6. Rasigade J-P, Raulin O, Picaud J-C, Tellini C, Bes M, Grando J, BenSaïd M, Claris O, Etienne J, Tigaud S, Laurent F. 2012. Methicillin-resistant Staphylococcus capitis with reduced vancomycin susceptibilitycauses late-onset sepsis in intensive care neonates. PLoS One 7:e31548.doi:10.1371/journal.pone.0031548.

7. Ito T, Katayama Y, Asada K, Mori N, Tsutsumimoto K, Tiensasitorn C,Hiramatsu K. 2001. Structural comparison of three types of staphylococ-cal cassette chromosome mec integrated in the chromosome in methicil-lin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 45:1323–1336.

8. Ma XX, Ito T, Tiensasitorn C, Jamklang M, Chongtrakool P, Boyle-Vavra S, Daum RS, Hiramatsu K. 2002. Novel type of staphylococcalcassette chromosome mec identified in community-acquired methicillin-resistant Staphylococcus aureus strains. Antimicrob. Agents Chemother.46:1147–1152.

9. Ito T, Ma XX, Takeuchi F, Okuma KYH, Hiramatsu K. 2004. Novel typeV staphylococcal cassette chromosome mec driven by a novel cassette

chromosome recombinase, ccrC. Antimicrob. Agents Chemother. 48:2637–2651.

10. Noto MJ, Archer GL. 2006. A subset of Staphylococcus aureus strainsharboring staphylococcal cassette chromosome mec (SCCmec) type IV isdeficient in CcrAB-mediated SCCmec excision. Antimicrob. Agents Che-mother. 50:2782–2788.

11. Vallenet D, Labarre L, Rouy Z, Barbe V, Bocs S, Cruveiller S, Lajus A,Pascal G, Scarpelli C, Médigue C. 2006. MaGe: a microbial genome anno-tation system supported by synteny results. Nucleic Acids Res. 34:53–65.

12. Vallenet D, Engelen S, Mornico D, Cruveiller S, Fleury L, Lajus A, RouyZ, Roche D, Salvignol G, Scarpelli C, Médigue C. 2009. MicroScope: aplatform for microbial genome annotation and comparative genomics.Database 2009:bap021. doi:10.1093/database/bap021.

13. Sorek R, Lawrence CM, Wiedenheft B. 2013. CRISPR-mediated adaptiveimmune systems in Bacteria and Archaea. Annu. Rev. Biochem. 82:237–266.

14. Makarova KS, Haft DH, Barrangou R, Brouns SJJ, Charpentier E,Horvath P, Moineau S, Mojica FJM, Wolf YI. 2011. Evolution andclassification of the CRISPR-Cas systems. Nat. Rev. Microbiol. 9:467– 477.

15. Grissa I, Vergnaud G, Pourcel C. 2007. CRISPRFinder: a web tool toidentify clustered regularly interspaced short palindromic repeats. NucleicAcids Res. 35:W52–W57.

16. Goering RV, Morrison D, Al-Doori Z, Edwards GFS, Gemmell CG.2008. Usefulness of mec-associated direct repeat unit (dru) typing in theepidemiological analysis of highly clonal methicillin-resistant Staphylo-coccus aureus in Scotland. Clin. Microbiol. Infect. 14:964 –969.

17. Shore AC, Deasy EC, Slickers P, Brennan G, O’Connell B, Monecke S,Ehricht R, Coleman DC. 2011. Detection of staphylococcal cassette chro-mosome mec type XI carrying highly divergent mecA, mecI, mecR1, blaZ,and ccr genes in human clinical isolates of clonal complex 130 methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 55:3765–3773.

18. Mongkolrattanothai K, Boyle S, Murphy TV, Daum RS. 2004. Novelnon-mecA-containing staphylococcal chromosomal cassette compositeisland containing pbp4 and tagF genes in a commensal staphylococcalspecies: a possible reservoir for antibiotic resistance islands in Staphylo-coccus aureus. Antimicrob. Agents Chemother. 48:1823–1836.

19. Li S, Skov RL, Han X, Larsen AR, Larsen J, Sørum M, Wulf M, Voss A,Hiramatsu K, Ito T. 2011. Novel types of staphylococcal cassette chro-mosome mec elements identified in clonal complex 398 methicillin-resistant Staphylococcus aureus strains. Antimicrob. Agents Chemother.55:3046 –3050.

20. Kondo Y, Ito T, Ma XX, Watanabe S, Kreiswirth BN, Etienne J,Hiramatsu K. 2007. Combination of multiplex PCRs for staphylococcalcassette chromosome mec type assignment: rapid identification system formec, ccr, and major differences in junkyard regions. Antimicrob. AgentsChemother. 51(1):264 –274.

21. Qin N, Ding W, Yao J, Su K, Wu L, Li L. 2012. Genome sequence ofStaphylococcus capitis QN1, which causes infective endocarditis. J. Bacte-riol. 194:4469 – 4470.

22. Leekitcharoenphon P, Kaas RS, Thomsen MCF, Friis C, Rasmussen S,Aarestrup FM. 2012. snpTree—a web-server to identify and constructSNP trees from whole genome sequence data. BMC Genomics 13(Suppl7):S6. doi:10.1186/1471-2164-13-S7-S6.

23. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, GascuelO. 2010. New algorithms and methods to estimate maximum-likelihoodphylogenies: assessing the performance of PhyML 3.0. Syst. Biol. 59:307–321.

Novel Composite SCCmec Element in S. capitis NRCS-A

December 2013 Volume 57 Number 12 aac.asm.org 6357

on Novem

ber 14, 2013 by guesthttp://aac.asm

.org/D

ownloaded from

ORIGINAL RESEARCHpublished: 15 December 2016

doi: 10.3389/fmicb.2016.01991

Frontiers in Microbiology | www.frontiersin.org 1 December 2016 | Volume 7 | Article 1991

Edited by:

Benoit Doublet,

National Institute for Agricultural

Research (INRA), France

Reviewed by:

Olin Silander,

Massey University, New Zealand

Ravi Ranjan,

University of Illinois at Chicago, USA

*Correspondence:

Patrícia Martins Simões

patricia.martins-simoes01@chu-lyon1.fr

Specialty section:

This article was submitted to

Evolutionary and Genomic

Microbiology,

a section of the journal

Frontiers in Microbiology

Received: 07 September 2016

Accepted: 28 November 2016

Published: 15 December 2016

Citation:

Martins Simões P, Lemriss H,

Dumont Y, Lemriss S, Rasigade J-P,

Assant-Trouillet S, Ibrahimi A,

El Kabbaj S, Butin M and Laurent F

(2016) Single-Molecule Sequencing

(PacBio) of the Staphylococcus capitis

NRCS-A Clone Reveals the Basis of

Multidrug Resistance and Adaptation

to the Neonatal Intensive Care Unit

Environment. Front. Microbiol. 7:1991.

doi: 10.3389/fmicb.2016.01991

Single-Molecule Sequencing(PacBio) of the Staphylococcuscapitis NRCS-A Clone Reveals theBasis of Multidrug Resistance andAdaptation to the Neonatal IntensiveCare Unit EnvironmentPatrícia Martins Simões 1, 2, 3*, Hajar Lemriss 4, Yann Dumont 5, Sanâa Lemriss 6,

Jean-Philippe Rasigade 2, 3, Sophie Assant-Trouillet 1, 2, Azeddine Ibrahimi 4,

Saâd El Kabbaj 6, Marine Butin 1, 7 and Frédéric Laurent 1, 2, 3

1Department of Clinical Microbiology, Northern Hospital Group, Hospices Civils de Lyon, Lyon, France, 2 International Centre

for Research in Infectious Diseases, Institut National de la Santé et de la Recherche Médicale U1111, University of Lyon,

Lyon, France, 3National Reference Center for Staphylococci, Hospices Civils de Lyon, Lyon, France, 4Biotechnology

Laboratory (Medbiotech), Medical and Pharmacy School, University Mohammed V de Rabat, Rabat, Morocco, 5Department

of Clinical Microbiology, Eastern Hospital Group, Hospices Civils de Lyon, Lyon, France, 6Department of Biosecurity PCL3,

Laboratory of Research and Medical Analysis of the Fraternal of Gendarmerie Royale, Rabat, Morocco, 7Neonatal Intensive

Care Unit, Eastern Hospital Group, Hospices Civils de Lyon, Lyon, France

The multi-resistant Staphylococcus capitis clone NRCS-A has recently been described

as a major pathogen causing nosocomial, late-onset sepsis (LOS) in preterm neonates

worldwide. NRCS-A representatives exhibit an atypical antibiotic resistance profile.

Here, the complete closed genome (chromosomal and plasmid sequences) of NRCS-A

prototype strain CR01 and the draft genomes of three other clinical NRCS-A strains from

Australia, Belgium and the United Kingdom are annotated and compared to available

non-NRCS-A S. capitis genomes. Our goal was to delineate the uniqueness of the

NRCS-A clone with respect to antibiotic resistance, virulence factors and mobile genetic

elements. We identified 6 antimicrobial resistance genes, all carried by mobile genetic

elements. Previously described virulence genes present in the NRCS-A genomes are

shared with the six non-NRCS-A S. capitis genomes. Overall, 63 genes are specific to

the NRCS-A lineage, including 28 genes located in the methicillin-resistance cassette

SCCmec. Among the 35 remaining genes, 25 are of unknown function, and 9 correspond

to an additional type I restriction modification system (n = 3), a cytosine methylation

operon (n = 2), and a cluster of genes related to the biosynthesis of teichoic acids

(n = 4). Interestingly, a tenth gene corresponds to a resistance determinant for nisin

(nsr gene), a bacteriocin secreted by potential NRCS-A strain niche competitors in the

gut microbiota. The genomic characteristics presented here emphasize the contribution

of mobile genetic elements to the emergence of multidrug resistance in the S. capitis

NRCS-A clone. No NRCS-A-specific known virulence determinant was detected, which

does not support a role for virulence as a driving force of NRCS-A emergence in

NICUs worldwide. However, the presence of a nisin resistance determinant on the

Martins Simões et al. Genomic Characterization of the NRCS-A Clone

NRCS-A chromosome, but not in other S. capitis strains and most coagulase-negative

representatives, might confer a competitive advantage to NRCS-A strains during the

early steps of gut colonization in neonates. This suggests that the striking adaptation of

NRCS-A to the NICU environment might be related to its specific antimicrobial resistance

and also to a possible enhanced ability to challenge competing bacteria in its ecological

niche.

Keywords: bacteremia, multiple drug resistance, late-onset sepsis, SMRT, nisin, comparative genomics,

Staphylococcus capitis

INTRODUCTION

Coagulase-negative staphylococci (CoNS) are commoncommensals of the human skin and mucosa and are alsoopportunistic pathogens responsible for infections associatedwith indwelling medical devices and bloodstream infections(Otto, 2009). Among CoNSs, Staphylococcus epidermidis is themost prevalent species and is classically involved in nosocomialbacteremia in patients with co-morbidities including verylow-birth weight preterm infants (Otto, 2009). However, theStaphylococcus capitis has also been incriminated in sepsisthroughout the world in neonatal intensive care units (NICUs)(Van Der Zwet et al., 2002; Venkatesh et al., 2006; D’melloet al., 2008; Rasigade et al., 2012; Boghossian et al., 2013; Cuiet al., 2013). We recently reported that a group of closelyrelated multidrug-resistant (MDR) S. capitis strains belongingto the same clone, named NRCS-A, were present in mostFrench NICUs but absent in the other pediatric or adult ICUs(Rasigade et al., 2012). In subsequent work, we demonstrated thedissemination of NRCS-A strains in distant NICUs throughoutthe world (Butin et al., 2016). This dissemination is of majorconcern because of the extensive drug resistance of NRCS-Aas well as its ability to become highly endemic in some NICUs,representing up to 40% of all bacteremia cases (Stoll et al., 2002,2005; Rasigade et al., 2012). Due to the presence of the typeV-related staphylococcal chromosome cassette mec (SCCmec),all S. capitis NRCS-A strains are resistant to beta-lactams andexhibit reduced susceptibility to other antimicrobial agents incommon use in NICUs, including resistance to aminoglycosidesand resistance or heteroresistance to vancomycin (Venkateshet al., 2006; Rasigade et al., 2012). Overall, the worldwidediffusion of a multidrug-resistant S. capitis clone that is highlyadapted to NICU antibiotic selective pressure raises questionsabout the potential genetic support of its epidemiological success.

Few genome sequences of S. capitis are publicly availableto date. In addition, only a single study using the genome ofa S. capitis isolate collected from a bloodstream infection inan adult has reported the genomic comparison of virulencefactors between S. capitis and S. epidermidis (Cameron et al.,2015). Considering the specific importance NRCS-A in theNICU setting and its international dissemination, we presenthere the first closed genome sequence of the French NRCS-A prototype strain CR01, a comparison of the whole-genomesequences (WGS) of three other NRCS-A strains collected fromdistant countries (Australia, Belgium, the United Kingdom), anda description of the genomic features of this NRCS-A clone.

METHODS

Genome Sequencing and AssemblyThe four strains of S. capitis, CR01, CR03, CR04, and CR05, usedin this study were part of a previously published collection, withall strains being of the international S. capitis NRCS-A clone(Butin et al., 2016). The strains were isolated from blood culturesof preterm infants diagnosed with neonatal sepsis in NeonatalIntensive Care Units (NICUs) from four different countries:France (isolate CR01), Belgium (isolate CR03), Australia (isolateCR04) and the United Kingdom (isolate CR05) (for furtherdetails see Supplementary Data).

Initially, whole-genome pyrosequencing (454 LifeSciences/Roche) was performed for all 4 isolates, as previouslyreported (Lemriss et al., 2014, 2015). Single-molecule real-time(SMRT) sequencing was then performed for strain CR01 toobtain a closed reference genome for this clone (SupplementaryData).

Sequencing for de novo assembly was performed using PacBioRS II (Menlo Park, CA, USA). High molecular weight DNA wassheared in a Covaris g-TUBE (Covaris, Woburn, MA, USA) toobtain 20 kb fragments. After shearing, the DNA size distributionwas checked using a Fragment Analyzer (Advanced AnalyticalTechnologies, Ames, IA, USA), and 5µg of the sheared DNAwas used to prepare a SMRTbell library with PacBio SMRTbellTemplate Prep Kit 1 (Pacific Biosciences, Menlo Park, CA, USA)according to the manufacturer’s recommendations. The resultinglibrary was size selected using a BluePippin system (Sage Science,Inc. Beverly, MA, USA) for molecules larger than 11 kb. Therecovered library was sequenced using 1 SMRT cell with P6-C4 chemistry and MagBeads with a PacBio RSII system (PacificBiosciences, Menlo Park, CA, USA) at 240 min movie length.

Based on the SMRT cell sequencing, we generated 50,876 post-filter polymerase reads with an average read length of 15.6 kb andanN50 read length of 21.1 kb. The average coverage was 265X; forde novo assembly, the PacBio module “RS_HGAP_Assembly.2”in SMRTpipe version v2.3.0 was used for continuous long reads(CLR) after polishing and error correction with Quiver, asdescribed previously (Chin et al., 2013). DNA methylation wasdetermined using the RS_Modification_and_Motif_Analysisprotocol within SMRT Portal v2.30, with a standardizedin silico false positive error of ∼1%. Only motifs with amean modification quality value (QV) >50 and a meancoverage of >100X were validated as being modified (https://github.com/PacificBiosciences/Bioinformatics-Training/wiki/Methylome-Analysis-Technical-Note). Two polished contigs,

Frontiers in Microbiology | www.frontiersin.org 2 December 2016 | Volume 7 | Article 1991

Martins Simões et al. Genomic Characterization of the NRCS-A Clone

one corresponding to the chromosome and the other to theplasmid, were obtained. Circularization of both contigs wasachieved by manual comparison and removal of regions ofoverlaps.

Computational AnalysisAutomatic syntactic and functional annotation of theclosed, reference genome of strain CR01 [EMBL accessionnumber: LN866849 (chromosome) and LN866850 (plasmid)]was performed using the MicroScope platform pipeline(Vallenet et al., 2006, 2013). The annotations of the draftgenomes of strains CR03 (EMBL accession number:CVUF01000001-CVUF01000031), CR04 (EMBL accessionnumber: CTEM01000001-CTEM01000038) and CR05 (EMBLaccession number: CTEO01000001-CTEO01000039) were alsoperformed using the MicroScope platform pipeline, as publishedpreviously (Lemriss et al., 2014). Visual inspection and manualcuration were carried out using the MaGe platform and BLASTsearches against NCBI databases.

Virulence factors were identified using the Virulence Factorsdatabase (VFDB; http://www.mgc.ac.cn/VFs/, Chen et al., 2012)and tblastn (using the ncbi-blast-2.2.27+ suite, Camacho et al.,2009) searches against in-house databases of known virulencegenes of staphylococci.

Prophage regions were identified using the PHAST server(http://phast.wishartlab.com, Zhou et al., 2011). The predictedresults were confirmed using the MaGe platform.

For comparison, we obtained publicly available assembliesfor six additional whole-genome sequences of S. capitis:strains QN1 (NCBI Ref. Seq.: NZ_AJTH00000000.1),VCU116 (NCBI Ref. Seq.: NZ_AFTX00000000.1), SK14(NCBI Ref. Seq.: NZ_ACFR00000000.1), LNZR-1 (NCBIRef. Seq.: NZ_JGYJ00000000.1), C87 (NCBI Ref. Seq.:NZ_ACRH00000000.1), and AYP1020 (NCBI Ref. Seq.:NZ_CP007601.1). All six genomes were aligned against theclosed genome of isolate CR01 using Mauve Progressive v.2.3.1(Darling et al., 2010) with default settings.

Resistance genes were identified by a combination ofResFinder v.2.1 (Kleinheinz et al., 2014) and tblastn searchesusing the complete, curated Antibiotic Resistance Proteinsdatabase (multifasta file) available at the ComprehensiveAntibiotic Resistance Database (CARD) (McArthur et al., 2013).For ResFinder, cutoffs of 80% minimum length and 90% identitywere used to search for resistance genes in CR03, CR04, andCR05 assemblies previously performed against the referenceCR01 using Mauve Progressive to determine their locationand genomic context. For detection of resistance genes usingthe CARD complete, curated Antibiotic Resistance Proteinsdatabase, tblastn searches against a database composed of thefour genomes of strains CR01, CR03, CR04, and CR05 wereperformed.

Genes specific to the NRCS-A clone were identified using theMaGe platform “Gene Phyloprofiler” tool (Vallenet et al., 2013)and the four annotated genomes of NRCS-A and public S. capitisgenomes. Briefly, genomes were compared in terms of genecontent using pre-computed homologies and synteny groups.Pairwise comparisons between predicted protein sequences of

the studied genome and the proteins of another genomeallowed computation of ranked hits and determination ofbidirectional best hits (BBH) (for each protein, the three besthits were retained). Putative orthologous relationships betweentwo genomes were defined as gene couples satisfying the BBHcriterion and an alignment threshold for homology set as aminimum of 50% sequence identity along 80% of the lengthof the smallest protein. Mauve alignments were also used tocomplement the genomic context, followed by manual curationof the putative genes exclusively found in only the four NRCS-Agenomes.

Insertion sequences (IS) in the genomes were identified usingthe ISfinder analysis tool (Siguier et al., 2006). Both blastn andblastp queries were performed with default settings. Matcheswith an e-value smaller than 0.5 were manually curated. Toconfirm whether a given IS position was conserved in theother genomes analyzed, the closed genome of isolate CR01 wasaligned with the three other NRCS-A genomes and with the sixpublic genomes using Mauve Progressive v.2.3.1 (Darling et al.,2010) with default settings. ORFs within immediate proximityof conserved IS loci in the NRCS-A genomes were comparedwith the S. capitis reference genome to check for potentialalterations in coding sequences, using both Mauve Progressiveand Mage platform. genomic islands (GIs) were predictedusing IslandViewer 3 (Dhillon et al., 2015) and confirmedby alignment with the three NCRS-A genomes and the sixpublic S. capitis genomes using Mauve Progressive. IS insertionswithin GIs were predicted as mentioned above. NRCS-A-specificGIs were searched in the NCBI database using megablast(Camacho et al., 2009) query, limiting to the Staphylococcustaxon (taxid: 1279). Published GIs from reference genomeswere searched against Staphylococcus aureus Mu50 (NCBIReference Sequence: NC_002758.2), COL (NCBI ReferenceSequence: NC_002951.2), MW2 (NCBI Reference Sequence:NC_003923.1), N315 (NCBI Reference Sequence: NC_002745.2),FPR3757 (NCBI Reference Sequence: NC_007793.1) and S0385(NCBI Reference Sequence: NC_017333.1), and S. epidermidisRP62A (NCBI Reference Sequence: NC_002976.3) using theMage platform [15]. Syntonomes of more than 3 ORFs and withidentity greater than 33% were considered to be GIs.

Investigation of nsr Gene Presence inClinical Bacterial StrainsA panel of 15 strains (Table 1) comprising clinical strains ofS. capitis (NRCS-A and non-NRCS-A) were used for nisinsusceptibility testing. All staphylococcal species were originallyisolated from blood, and species assignment was determinedusing Matrix-Assisted Laser Desorption/Ionization Time ofFlight Mass Spectrometry (MALDI-TOF Vitek MS, Biomerieux,France). After isolation, the strains were cultured on HorseBlood Agar (Biomerieux) and then stored at −80◦. Testing forsusceptibility to nisin was performed using the disk diffusiontest adapted from EUCAST1. Briefly, nisin solutions were

1European Committee on antimicrobial Susceptibility Testing, 2015, http://www.

eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Disk_test_documents/

Manual_v_5.0_EUCAST_Disk_Test.pdf

Frontiers in Microbiology | www.frontiersin.org 3 December 2016 | Volume 7 | Article 1991

Martins Simões et al. Genomic Characterization of the NRCS-A Clone

TABLE 1 | Bacterial strains used in the nisin susceptibility test.

Species NRCS-A clone Strain Setting Country nsr gene

SC yes CR01 NICU FR +

SC yes CR03 NICU BE +

SC yes CR04 NICU AUS +

SC yes CR05 NICU UK +

SC yes CR07 NICU FR +

SC yes BC69 NICU South K +

SC yes AQ62 NICU NO +

SC yes AW77 NICU NZ +

SC yes BI76 NICU USA +

SC no AB51 ICU AUS −

SC no CR02 ICU FR −

SC no AR22 ICU DK −

SC no AY18 ICU GR −

SC no AZ72 ICU Sing −

SC no BA24 ICU USA −

SC, Staphylococcus capitis; FR, France; BE, Belgium; UK, United Kingdom; AUS,

Australia; South K, South Korea; NO, Norway; NZ, New Zealand; USA, United States

of America; DK, Denmark; GR, Greece; Sing, Singapore; NICU, neonatal intensive care

unit; ICU, intensive care unit (adults).

prepared using 2.5% nisin powder (Sigma Aldrich, USA)according to a previously described protocol (Piper et al.,2009). Sterile paper disks (Thermofisher Diagnostics, France)were soaked with 30µg of nisin solution. After an overnightincubation at 36◦C on Horse blood Agar (Biomerieux, France),a 0.5 McF was seeded on Mueller Hinton agar (MHE) plates(Biomerieux, France). A disk containing 30µg of nisin wasplaced in the middle of the plate. The diameter of theinhibition zones was measured after overnight incubation ofthe inoculated MHE plates at 36◦C. The average diameter ofinhibition and SEM were determined from four independentexperiments.

PCRs for detecting the nsr gene were performed usingconsensus primers: pF—5′GGAGATATGGGACCTATGATTGCA 3′ and pR—5′GCTGTAAkTTCwCCkGAACTkGC 3′. These primers were designed based on alignment ofthe nsr gene sequence found in strain CR01 (S. capitis cloneNRCS-A) and sequences retrieved from NCBI after a blastn(ref) search for homologous sequences in staphylococcalWGS genomes [S. hyicus ATCC 11249 (acc. num. CP008747),Staphylococcus sp. TE8 (acc. num. NZ_JMGB00000000.1),S. epidermidis MC28 (acc. num. NZ_ATCZ00000000.2),S. epidermidis VCU128 (acc. num. NZ_AHLI00000000.1)].PCR amplification was conducted in a final volume of 25µL,with 2.0µL bacterial DNA (QuickExtract kit, Qiagen), 2.5µL10x Reaction Buffer, 0.75µL 50mM MgCl2, 1 µL 10mMforward primer, 1µL 100mM reverse primer, 4µL 5mMdNTPs, 1 µL each primer and 0.125µL Taq polymerase(Eurobio, France). The cycling parameters were as follows:(i) initial denaturation for 3 min at 95◦C; (ii) 34 cycles,with 1 cycle consisting of 30 s at 95◦C, 60 s at 60◦C,and 90 s at 72◦C; and (iii) a final extension for 10 min at72◦C.

RESULTS

WGSs of four strains belonging to S. capitis clone NRCS-Aand originating from NICUs in four distant countries wereobtained to investigate lineage-specific virulomes, resistomes,and mobilomes as well as the presence of unshared genes using454 pyrosequencing technology, as reported previously (Lemrisset al., 2014, 2015). Depending on the isolate, assembly of thedraft genomes produced 26 to 39 contigs. Re-sequencing ofstrain CR01 using SMRT technology (PacBio) allowed for thegeneration of closed complete sequences for the chromosomeand the single plasmid that was subsequently used to producescaffolds for the three remaining WGSs.

The length of CR01’s chromosome is 2,522,871 bp and exhibitsa low G + C content (33.02%), as is expected for staphylococci.We identified and annotated 2419 protein-coding regions, 19rRNAs, 62 tRNAs, 34 ncRNAs (including RNAIII), and 20transposases associated with insertion sequence elements andtransposons. Of note, gaps (identified in the draft genomeassemblies of the four NRCS-A isolates (based on 454 pyro-sequencing)) frequently occur within the vicinity of transposases,suggesting that some of the 454 short read assemblies wereunable to bridge the gaps associated with repetitive genomicelements. These data clearly emphasize the suitability of third-generation sequencing technologies, such as PacBio SMRT,for obtaining fully defined de novo assemblies and, thus,for overcoming the issue of both local and global repeats(Koren and Phillippy, 2015). The genomic characteristics ofthe NRCS-A isolates tested in this study are summarized inTable 2.

VirulomeThe presence of virulence-associated genes in the closed genomeof strain CR01 and subsequently the draft genomes of strainsCR03 (Be), CR04 (Aus), and CR05 (UK) were inferred bycomparison with known virulence factors previously reportedfor S. aureus, S. epidermidis, and S. haemolyticus using the VFDBdatabase (Chen et al., 2012). The findings were augmented withBLAST searches of well-characterized staphylococcal virulencefactors and key regulators (Table 3). Comparison of the fourNRCS-A genomes with the six published genomes of non-NRCS-A S. capitis, including QN1, VCU116, SK14, LNZR-1, C87, andAYP1020 strains, showed that none of the known staphylococcalvirulence genes are exclusively carried by the NRCS-Aclone.

Interestingly, the virulome of the NRCS-A S. capitis genomewas quite similar to that of S. epidermidis RP62A, including theicaABDCR and capABC biofilm-related operons, Clp proteasesand multiple copies of PSM beta type 1b in tandem (75% aaidentity to PSMbeta1b of strain RP62) and one PSM alpha (59%aa identity) (Otto, 2012). All PSMs were found in the samegenetic environment as in the S. epidermidisRP62A genome, withconservation of upstream and downstream genes.

As previously observed for the fully closed S. epidermidisRP62a and S. epidermidis ATCC 12228 genomes (Zhang et al.,2003; Gill et al., 2005), no S. aureus toxins, except beta- and delta-hemolysins, were identified in any of the 10 S. capitis genomes

Frontiers in Microbiology | www.frontiersin.org 4 December 2016 | Volume 7 | Article 1991

Martins Simões et al. Genomic Characterization of the NRCS-A Clone

TABLE 2 | General genomic features of S. capitis strain CR01 compared with another three WGS NRCS-A genomes.

Features S. capitis strain CR01 (Fr) S. capitis strain CR03 (Be) S. capitis strain CR04 (Aus) S. capitis strain CR05 (UK)

GC% content 33.02 32.81 32.80 32.84

Nb of phages 1 1 1 3

Nb of plasmids 1 1a 1a 0

Nb and type of insertion

sequence

(nb on chromosome + nb on

plasmid)

IS256: 10 + 0 IS256: 1b+ 0 IS256: 1b+ 0 IS256: 1b

IS1272: 3 + 1 IS1272: 1 + 0 IS1272: 1 + 0 IS1272: 0

IS431mec-like: 2 + 3 IS431mec-like: 2 + 4 IS431mec-like: 2 + 0 IS431mec-like: 2

aPutative plasmid, no definitive data about circularization.b Insertion sequence isolated in a small contig, indicating probable multiple insertions in the complete genome.

(four NRCS-A and six public non-NRCS-A). Similarly, none ofthe genes associated with secretion systems (esxA, esxB, esaA,esaB, esaC, essA, essB, and essC) or S. aureus serine proteases(splA, B, C, D, E, and F) are present in the S. capitis genomes.

ResistomeSeveral antibiotic resistance-associated genes were identified andcorrelated with the specific resistance phenotype previouslyreported for the NRCS-A clone (Rasigade et al., 2012; Table 4).All are located on mobile genetic elements (MGEs). Resistanceto aminoglycosides is related to the bifunctional aminoglycoside-modifying gene aacA-aphD, which is carried on the transposonTn4001 (GenBank accession no. AB682805.1; Lyon et al.,1984). Resistance to methicillin is due to the presence of acomposite SCCmec-SCCcad/ars/cop cassette exclusively presentin the NRCS-A clone, as recently published by our team (MartinsSimões et al., 2013). Genomic comparison between the fourNRCS-A strains showed that this mobile element is nearlyidentical: all ORFs are conserved (100% aa homology), and thefew nucleotide sequence variations occur only in the CRISPRrepeat region, as is expected for these regions. As previouslyreported (Martins Simões et al., 2013), no other antibioticresistance genes were detected for this composite SCC element.Finally, the plasmidic bla operon, coding for blaZ beta-lactamaseand its regulators, is present in all NRCS-A strains, except strainCR05 (UK).

With regard to other antimicrobial families, for whichvariability in resistance profiles have been observed amongNRCS-A isolates, phenotypic antimicrobial susceptibility testingmatched the specific resistance gene contents of each NRCS-Astrain. Plasmidic msrA and tetK genes, respectively involved inerythromycin resistance (with a negative D-test) and tetracyclineresistance, were only identified in strain CR04 (Australia). Instrain CR05 (UK), the gene far1, which is responsible for fusidicacid resistance, is carried by a putative phage.

Mobile ElementsAsmentioned previously, the shortest circular sequence obtainedby SMRT for strain CR01 corresponds to a plasmid of 26.140bp (GC content of 29.25%). It harbors 35 ORFs, including (i)the bla operon coding for penicillinase resistance to penicillins(see above) and (ii) copper resistance-related genes such as copZ,copA, and csoR (copper transcriptional repressor; Figure 1).

Genome comparison of strain CR01’s plasmid with the threeother NRCS-A draft genomes revealed that the plasmid is notconserved in all NRCS-A strains (Figure 1). In strain CR03(Belgium), one contig presents 31 of the 35 ORFs identified onthe CR01 plasmid. Conversely, in strain CR04 (Australia), only 9of the 35 ORFs (corresponding to the blaZRI operon and copperresistance operon) were detected in a contig corresponding toa putative plasmid. Finally, no putative plasmid was detected instrain CR05 (UK).

One intact prophage region was identified in all four NRCS-A genomes. This region shows 100% aa identity to the genomesof strains CR01, CR03, and CR04, but it is degenerate inCR05 (Figure 2). Moreover, this phage exhibits strong homologyto a phage present in strain VCU116 [57.1, 90.2, 76.2% aahomology for regions 1, 2 and 3, respectively (Figure 2)] andless than 30% homology with phage Staphy_StB20_(NCBI Ref.Seq. NC_019915), the closest phage found in the NCBI database.Of note, two additional incomplete prophage regions were alsodetected in strain CR05.

Nineteen distinct insertion sequence (IS) elements, clusteringinto three distinct families (type IS256, n = 4; type IS1272, n= 5; IS431mec, n = 10), were identified in the CR01 genome.The presence of type IS256 was confirmed in all four NRCS-A strains, with two IS256 elements being associated with theaminoglycosides resistance gene aacA-aphD (′aac(6′)-aph(2′′) ontransposon Tn4001. Type IS1272 was also found in strains CR03and CR04 but not in strain CR05, and their genomic locations arenot conserved. Two IS431mec cassettes are present in all NRCS-Agenomes, as they are carried within the SCCmec-SCCcad/ars/copelement that is specific to and conserved among the NRCS-Alineage (Martins Simões et al., 2013).

Finally, other GIs (n = 5) were predicted for CR01 (Table 2)and found in the CR03, CR04, and CR05 strains. However, onlyone was found exclusively in the NRCS-A lineage. This GI (bpposition: 150,780–158,140 in the strain CR01 genome) containssix ORFs: one putative phosphoglycolate phosphatase, oneconserved protein of unknown function and three pseudogenesof phage proteins (bp position: 151,470–152,238). Unexpectedly,two of these pseudogenes present 40 and 46.5% aa identity toListeria monocytogenes phage B025 protein gp27 and the thirdpseudogene presents 60.6% aa identity to L. monocytogenes phageB025 protein gp28. Both gp27 and gp28 proteins have unknownfunctions.

Frontiers in Microbiology | www.frontiersin.org 5 December 2016 | Volume 7 | Article 1991

Martins Simões et al. Genomic Characterization of the NRCS-A Clone

TABLE 3 | Comparison of virulence factors in S. capitis NRCS-A, non-NRCS-A, and S. epidermidis after exclusion of virulence factors present only in S.

aureus.

Function Gene S. epidermidis S. capitis NRCS-A clone S. capitis non-NRCS-A

ATCC 12228 RP62A CR01 (Fr) CR03 (Be) CR04 (Aus) CR05 (UK) SK14 VCU116 C87 QN1 LNZR-1

Adherence atl + + + + + + + + + + +

ebh + + + + + + + + + + +

ebp + + + + + + + + + + +

icaR 0 + + + + + + + + + +

icaA 0 + + + + + + + + + +

icaD 0 + + + + + + + + + +

icaB 0 + + + + + + + + + +

icaC 0 + + + + + + + + + +

sdrF + + 0 0 0 0 0 0 0 0 0

sdrG + + 0 0 0 0 0 0 0 0 0

sdrH + + + + + + + + + + +

Exozymes sspB + + 0 0 0 0 0 0 0 0 0

sspC 0 + 0 0 0 0 0 0 0 0 0

lip + + + + + + + + + + +

geh + + + + + + + + + + +

sspA + + 0 0 0 0 0 0 0 0 0

nuc + + + + + + + + + + +

Host immune invasion capABC + + + + + + + + + + +

Toxins hlb + + + + + + + + + + +

hld + + + + + + + + + + +

hemolysin 0 + + + + + + + + + +

hlIII + + + + + + + + + + +

Proteases ClpP + + + + + + + + + + +

ClpB + + + + + + + + + + +

ClpC + + + + + + + + + + +

ClpX + + + + + + + + + + +

Phenol-soluble modulins psm α + + + + + + + + + + +

psm β1a + + 0 0 0 0 0 0 0 0 0

psm β1B + + + + + + + + + + +

psm β2 + + + + + + + + + + +

psm β3 + + 0 0 0 0 0 0 0 0 0

psm δ + + + + + + + + + + +

psmε + + + + + + + + + + +

psm-mec + + 0 0 0 0 0 0 0 0 0

Esterases esterase1 + + + + + + + + + + +

esterase2 + + + + + + + + + + +

HTH transcription factors SarA + + + + + + + + + + +

SarR + + + + + + + + + + +

SarV + + + + + + + + + + +

SarX + + + + + + + + + + +

SarZ + + + + + + + + + + +

MgrA + + + + + + + + + + +

Rot + + + + + + + + + + +

The presence of virulence genes is indicated by the “+” sign.

Frontiers in Microbiology | www.frontiersin.org 6 December 2016 | Volume 7 | Article 1991

Martins Simões et al. Genomic Characterization of the NRCS-A Clone

TABLE 4 | Genomic profiles of antibiotic resistance for clone NRCS-A strains from four different countries.

Antibiotic Gene Strains Genomic context

CR01 (FR) CR03 (Be) CR04 (Aus) CR05 (UK)

Penicillin blaZ + + + − Plasmid

Methicillin mecA + + + + Chromosome

Tetracycline tetK − − + − Plasmid*

Aminoglycosides aac(6′)-aph(2′′) + + + + Chromosome

Macrolide, Lincosamide and Streptogramin B msr(A) − − + − Plasmid*

Fusidic acid far/fusB − − − + Phage (chromosome)*

All antibiotic resistance genes were found in MGEs. Putative regions in the draft genomes are indicated by an *.

FIGURE 1 | Comparison of the genetic content of the strain CR01 plasmid with the draft genomes of the other three NRCS-A strains. Open reading

frames (ORFs) are shown as arrows indicating the direction of transcription. Homologous gene clusters are indicated by a light gray shadow connecting ORFs present

in distinct plasmid sequences. Light gray arrows represent unknown proteins, unless specified otherwise. Arrows with dotted lines represent partial or truncated

ORFs. Antibiotic resistance genes are colored with a gray gradient; genes associated with resistance to heavy metals are colored in dark gray. Abbreviations: tnp,

transposase; copZ, copper insertion chaperone and transporter component; copA, copper transporter ATPase; csoR, copper-sensing transcriptional repressor; czcD,

potassium/proton-divalent cation antiporter; rep, replication-associated family protein; repA, replication-associated protein RepA; blaZ, beta-lactamase resistance

gene; blaR, regulatory protein BlaR1; blaI, penicillinase repressor; mntH, divalent metal cation transporter MntH, tetK, tetracycline resistance gene.

Methylome and Restriction ModificationSystemsSMRT technology (PacBio) allows for genome-wide detectionof modified nucleotides based on the rate at which DNApolymerase incorporates bases during sequencing (Flusberget al., 2010, Nat. Methods; Roberts et al., 2013). Analysis

of polymerase kinetic profiles in strain CR01 identified 1333methylated positions (Table S2) including 94% (n = 1253)

corresponding to adenine methylations (m6A) and 0.006% (n =

8) to cytosine methylations (m4C). The adenine modifications

observed correlate with the presence of two adenine restriction-

modification systems (hsdMSR 1 pos: 476,473–482,360 bp;

Frontiers in Microbiology | www.frontiersin.org 7 December 2016 | Volume 7 | Article 1991

Martins Simões et al. Genomic Characterization of the NRCS-A Clone

FIGURE 2 | Comparison of the genetic content of the strain CR01 intact prophage present in the other three draft genomes of NRCS-A strains.

Prophage prediction was performed using PHAST software; cR01’s prophage is divided into three regions according to the degree of conservation compared to the

other strains. The mean percent of aa identity in each region is indicated, and a gray gradient is also used to represent the percent similarity.

hsdMSR 2 pos: 686,750–691,866 bp) in the strain CR01 genome,whereas the presence of an mcrBC 5-methylcytosine restrictionsystem (bp position 487,030–492,276) correlates with thecytosine modifications detected. Interestingly, the latter isassociated in tandem with the specific additional hdsMSR 1operon located immediately after the SCCmec-SCCcad/ars/copelement (see above).

NRCS-A Clone Specific GenesComparison of the closed genome of strain CR01 with thedraft genomes of the three other NRCS-A genomes and withthe six public non-NRCS-A genomes revealed a unique setof 63 genes present exclusively in the NRCS-A clone genome(Table S1). Of these, 28 ORFS are carried by the compositeSCCmec-SCCcad/ars/copmobile element, which is related to theacquisition of methicillin resistance (mecA gene). Interestingly,within this cassette, the CRISPR element is specific to the NRCS-A lineage (Martins Simões et al., 2013). Of note, both theclone-specific cassette (28 genes) and its genetic environment(downstream and upstream regions) are fully conserved in thefour NRCS-A strains, which confirmed that the four isolatesbelong to the same clonal population, even though they wereisolated from distant countries/continents. Indeed, it is highlyunlikely that the same SCCmec element (100% identity) could beacquired in four independent events in four distant countries.

Among the 35 remaining genes found exclusively in theNRCS-A lineage, 25 are of unknown function, and 10 correspondto the following: (i) an additional type I restriction modificationsystem (hsdMSR, n= 3 genes), (ii) a cytosine methylation operon(mcrBC, n = 2), (iii) a cluster of four genes known to be

involved in the biosynthesis of teichoic acids [ispD (2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase), tarJ (ribitol-5-phosphate dehydrogenase), tarK (Glycosyl glycerophosphate),and tagF (CDP-glycerol glycerophosphotransferase), n = 4].Of note, the tenth gene encodes a 316 aa protein presenting41% aa homology with the determinant for resistance to nisin(nsr gene) that is present in some Lactococcus lactis strains(Froseth and McKay, 1991; Liu et al., 2005) and which showsprotease activity. Contrary to the plasmidic localization of thensr gene in nisin-resistant L. lactis strains, the nsr gene in theNRCS-A clone is located on the chromosome (position: 521,747–522,694 bp) immediately upstream from the potassium (K+)transporter kdpEDABC operon conserved in all S. capitis isolatesand downstream from the four teichoic acid biosynthesis genes(ispD, tarJ, tarK, and tagF; see above). No IS or transposon-likeregion was identified near the nsr gene.

Phenotypic Assay of Clone NRCS-A NisinResistanceTo assess functional expression of the nisin resistance gene(nsr) found exclusively in the NRCS-A clone, we performed adisk diffusion test with nisin-charged disks using a collection ofS. capitis strains, including nine strains belonging to the NRCS-Aclone and six nsr-negative, non-NRCS-A strains. The S. capitisstrains belonging to the NRCS-A clone presented significantlylower nisin inhibition zones (mean of four independentmeasurements± SEM: 8.81mm± 1.31) than the strains isolatedfrom adults that do not carry the nsr gene (16.5 ± 1.5; theStudent t-test, p < 0.001 vs. 8.8mm ± 1.3 in NRCS-A). Thisconfirms that the nsr gene found exclusively in S. capitis strains

Frontiers in Microbiology | www.frontiersin.org 8 December 2016 | Volume 7 | Article 1991

Martins Simões et al. Genomic Characterization of the NRCS-A Clone

belonging to the neonatal NRCS-A clone is functional andconfers resistance to nisin. Nonetheless, it is known (i) thatS. aureus (SA) can modulate its resistance to nisin and othersmall antibacterial peptides via two-component systems (TCSs)GraSR, NsaSR, BraSR in association with ABC transporters(Howden et al., 2010; Blake et al., 2011; Falord et al., 2011;Kolar et al., 2011; Kawada-Matsuo et al., 2013) and (ii) thatSA strains resistant or heteroresistant to vancomycin (VISAand hVISA) usually present increased cell wall thickening (Cuiet al., 2003). The same mechanisms have been observed inL. lactis resistant to nisin (Kramer et al., 2006; Shin et al.,2016). Thus, to assess whether the resistance to nisin observedin the NRCS-A strains is due exclusively to expression ofthe nsr gene and not to a cell wall-thickening adaptation,complementary experiments are required using nsr+/nsr−isogenic isolates. Such analyses are beyond the scope of thepresent paper.

DISCUSSION

The NRCS-A clone is of major interest due to its worldwidehigh dissemination in NICUs and its prevalence as an agentof neonatal sepsis in preterm newborns (Butin et al., 2016).Comparison between the complete genome of the prototypestrain belonging to the S. capitis NRCS-A clone (strain CR01,France) with the draft genomes of clinical S. capitis isolatesbelonging or not to the NRCS-A clone revealed the presenceof multiple MGEs mediating the atypical antibiotic resistanceprofile of this clone. These data confirm (i) the ability of theNRCS-A clone to adapt to the specific selective pressure of theantibiotics used in NICUs and (ii) emphasize the ability of WGSto provide accurate predictions of the resistance phenotypes ofstaphylococci and to become a promising alternative for culturemethods.

Based on genomic comparisons using previouslycharacterized staphylococcal virulence genes, the NRCS-Avirulome is highly similar to that of other non-NRCS-A S. capitisas well as S. epidermidis RP62A strains, which suggests that thesuccess of this clone in neonates is likely not due to increasedvirulence. Nonetheless, we identified the exclusive presence ofa gene encoding a functional nisin resistance (nsr) gene in theNRCS-A lineage that is seldom found in staphylococci.

Nisin, a 34 aa antimicrobial peptide produced by a group ofgram-positive Lactococcus and Streptococcus species (Shin et al.,2016), is active against a wide range of gram-positive bacteria,including staphylococci. Its mode of action is dual, involving (i)inhibition of cell wall biosynthesis (transglycosylation step), asit binds to and sequesters lipid II from its functional location,and (ii) pore formation (Wiedemann et al., 2001; Peschel andSahl, 2006; Egan et al., 2016). Nisin has been described as akey player of the gut barrier, and it is widely used as foodpreservative due to its potent bactericidal activity. Moreover, ithas been shown that (i) expression of the nsr gene, identifiedin Streptococcus agalactiae, in L. lactis not producing nisininduces resistance to nisin and (ii) the presence of human

nisin-producing lactic acid bacteria in the gut reduces intestinalcolonization by vancomycin-resistant enterococci (Millette et al.,2008).

Taken together, these data and our results strongly suggestthat nisin resistance might be responsible for the potentialincrease in the ability of the NRCS-A clone to establishitself as part of the initial microflora of neonates, in whichthe Lactococcus genus is one of the dominant bacterial taxa(Park et al., 2005; Morelli, 2008). Expression of the NSRpeptidase might enable NRCS-A isolates to establish themselvesin the gut of neonates and also to colonize it and survivelonger than nisin-susceptible bacteria. This may explain theover-representation of these isolates in sepsis processes, eitherthrough direct translocation in blood (Taft et al., 2015) orvia colonization of indwelling devices. Although it remainsunknown how S. capitis NRCS-A strains are able to translocateinto the bloodstream of infants, it is hypothesized that theentry point might be the digestive tract, which is immaturein very preterm infants (Taft et al., 2015). Further studiesare needed to fully characterize the digestive microflora ofvery low-weight preterm-infants and its potential impacton the selection of and the fitness advantage to NRCS-Aisolates.

AUTHOR CONTRIBUTIONS

PM: work, study design, data analysis, and manuscriptpreparation. HL: data analysis and manuscript preparation.YD: data analysis, work, and manuscript preparation. SL: workand manuscript preparation. JR, SA, AI, and SE: manuscriptpreparation. MB and FL: study design and manuscriptpreparation.

FUNDING

The present work was financed by the French Ministry ofHealth and the French Institute for Public Health Surveillance(INVS) - Santé publique France in the framework of theNational Reference Center of Staphylococci and by the grantING20111223510 from the Fondation pour la RechercheMedical(FRM).

ACKNOWLEDGMENTS

We would like to thank Michele Bes and Helene Meugnierat the National Reference Center for Staphylococci in Lyon(France), and our colleagues at the National Reference Center ofStaphylococci in Belgium (Olivier Denis), in the United Kingdom(Angela Kearns) and in Australia (Margaret Deighton).

SUPPLEMENTARY MATERIAL

The Supplementary Material for this article can be foundonline at: http://journal.frontiersin.org/article/10.3389/fmicb.2016.01991/full#supplementary-material

Frontiers in Microbiology | www.frontiersin.org 9 December 2016 | Volume 7 | Article 1991

Martins Simões et al. Genomic Characterization of the NRCS-A Clone

REFERENCES

Blake, K. L., Randall, C. P., and O’Neill, A. J. (2011). In vitro studies indicate a

high resistance potential for the lantibiotic nisin in Staphylococcus aureus and

define a genetic basis for nisin resistance. Antimicrob. Agents Chemother. 55,

2362–2368. doi: 10.1128/AAC.01077-10

Boghossian, N. S., Page, G. P., Bell, E. F., Stoll, B. J., Murray, J. C., Cotten,

C. M., et al. (2013). Late-onset sepsis in very low birth weight infants from

singleton and multiple-gestation births. J. Pediatr. 162, 1120–1124, 1124.e1.

doi: 10.1016/j.jpeds.2012.11.089

Butin, M., Rasigade, J.-P., Simões, P. M., Meugnier, H., Lemriss, H., Goering, R. V.,

et al. (2016). Wide geographical dissemination of multiresistant Staphylococcus

capitis NRCS-A clone in neonatal intensive-care units. Clin. Microbiol. Infect.

22, 46–52. doi: 10.1016/j.cmi.2015.09.008

Camacho, C., Coulouris, G., Avagyan, V., Ma, N., Papadopoulos, J., Bealer, K., et al.

(2009). BLAST+: architecture and applications. BMC Bioinformatics 10:421.

doi: 10.1186/1471-2105-10-421

Cameron, D. R., Jiang, J.-H., Hassan, K. A., Elbourne, L. D., Tuck, K. L., Paulsen,

I. T., et al. (2015). Insights on virulence from the complete genome of

Staphylococcus capitis. Front. Microbiol. 6:980. doi: 10.3389/fmicb.2015.00980

Chen, L., Xiong, Z., Sun, L., Yang, J., and Jin, Q. (2012). VFDB 2012 update: toward

the genetic diversity and molecular evolution of bacterial virulence factors.

Nucleic Acids Res. 40, D641–D645. doi: 10.1093/nar/gkr989

Chin, C.-S., Alexander, D. H., Marks, P., Klammer, A. A., Drake, J., Heiner, C.,

et al. (2013). Nonhybrid, finished microbial genome assemblies from long-read

SMRT sequencing data. Nat. Methods 10, 563–569. doi: 10.1038/nmeth.2474

Cui, B., Smooker, P. M., Rouch, D. A., Daley, A. J., and Deighton, M. A. (2013).

Differences between two clinical Staphylococcus capitis subspecies as revealed

by biofilm, antibiotic resistance, and pulsed-field gel electrophoresis profiling.

J. Clin. Microbiol. 51, 9–14. doi: 10.1128/JCM.05124-11

Cui, L., Ma, X., Sato, K., Okuma, K., Tenover, F. C., Mamizuka, E. M.,

et al. (2003). Cell wall thickening is a common feature of vancomycin

resistance in Staphylococcus aureus. J. Clin. Microbiol. 41, 5–14. doi: 10.1128/

JCM.41.1.5-14.2003

D’mello, D., Daley, A. J., Rahman,M. S., Qu, Y., Garland, S., Pearce, C., et al. (2008).

Vancomycin heteroresistance in bloodstream isolates of Staphylococcus capitis.

J. Clin. Microbiol. 46, 3124–3126. doi: 10.1128/JCM.00592-08

Darling, A. E., Mau, B., and Perna, N. T. (2010). progressiveMauve: multiple

genome alignment with gene gain, loss and rearrangement. PLoS ONE

5:e11147. doi: 10.1371/journal.pone.0011147

Dhillon, B. K., Laird, M. R., Shay, J. A., Winsor, G. L., Lo, R., Nizam,

F., et al. (2015). IslandViewer 3: more flexible, interactive genomic island

discovery, visualization and analysis. Nucleic Acids Res. 43, W104–W108.

doi: 10.1093/nar/gkv401

Egan, K., Field, D., Rea, M. C., Ross, R. P., Hill, C., and Cotter, P. D.

(2016). Bacteriocins: novel solutions to age old spore-related problems? Front.

Microbiol. 7:e461. doi: 10.3389/fmicb.2016.00461

Falord, M., Mäder, U., Hiron, A., Débarbouillé, M., and Msadek, T. (2011).

Investigation of the Staphylococcus aureus GraSR regulon reveals novel links

to virulence, stress response and cell wall signal transduction pathways. PLoS

ONE 6:e21323. doi: 10.1371/journal.pone.0021323

Flusberg, B. A., Webster, D. R., Lee, J. H., Travers, K. J., Olivares, E. C., Clark, T.

A., et al. (2010). Direct detection of DNA methylation during single-molecule,

real-time sequencing. Nat. Methods 7, 461–465. doi: 10.1038/nmeth.1459

Froseth, B. R., and McKay, L. L. (1991). Molecular characterization of the nisin

resistance region of Lactococcus lactis subsp. lactis biovar diacetylactis DRC3.

Appl. Environ. Microbiol. 57, 804–811.

Gill, S. R., Fouts, D. E., Archer, G. L., Mongodin, E. F., Deboy, R. T., Ravel, J., et al.

(2005). Insights on evolution of virulence and resistance from the complete

genome analysis of an early methicillin-resistant Staphylococcus aureus

strain and a biofilm-producing methicillin-resistant Staphylococcus epidermidis

strain. J. Bacteriol. 187, 2426–2438. doi: 10.1128/JB.187.7.2426-2438.2005

Howden, B. P., Davies, J. K., Johnson, P. D., Stinear, T. P., and Grayson, M.

L. (2010). Reduced Vancomycin Susceptibility in Staphylococcus aureus,

including Vancomycin-Intermediate and Heterogeneous Vancomycin-

Intermediate Strains: resistance mechanisms, laboratory detection, and

clinical implications. Clin. Microbiol. Rev. 23, 99–139. doi: 10.1128/CMR.

00042-09

Kawada-Matsuo, M., Yoshida, Y., Zendo, T., Nagao, J., Oogai, Y., Nakamura, Y.,

et al. (2013). Three distinct two-component systems are involved in resistance

to the class I bacteriocins, Nukacin ISK-1 and nisin A, in Staphylococcus

aureus. PLoS ONE 8:e69455. doi: 10.1371/journal.pone.0069455

Kleinheinz, K. A., Joensen, K. G., and Larsen,M. V. (2014). Applying the ResFinder

and VirulenceFinder web-services for easy identification of acquired antibiotic

resistance and E. coli virulence genes in bacteriophage and prophage nucleotide

sequences. Bacteriophage 4:e27943. doi: 10.4161/bact.27943

Kolar, S. L., Nagarajan, V., Oszmiana, A., Rivera, F. E., Miller, H. K., Davenport,

J. E., et al. (2011). NsaRS is a cell-envelope-stress-sensing two-component

system of Staphylococcus aureus. Microbiol. Read. Engl. 157, 2206–2219.

doi: 10.1099/mic.0.049692-0

Koren, S., and Phillippy, A. M. (2015). One chromosome, one contig: complete

microbial genomes from long-read sequencing and assembly. Curr. Opin.

Microbiol. 23, 110–120. doi: 10.1016/j.mib.2014.11.014

Kramer, N. E., van Hijum, S. A., Knol, J., Kok, J., and Kuipers, O. P.

(2006). Transcriptome analysis reveals mechanisms by which Lactococcus

lactis acquires nisin resistance. Antimicrob. Agents Chemother. 50, 1753–1761.

doi: 10.1128/AAC.50.5.1753-1761.2006

Lemriss, H., Lemriss, S., Martins-Simoes, P., Butin, M., Lahlou, L., Rasigade, J.-P.,

et al. (2015). Genome sequences of four Staphylococcus capitisNRCS-A isolates

from geographically distant neonatal intensive care units. Genome Announc. 3,

e00501–e00515. doi: 10.1128/genomeA.00501-15

Lemriss, H., Martins Simões, P., Lemriss, S., Butin, M., Ibrahimi, A., El

Kabbaj, S., et al. (2014). Non-contiguous finished genome sequence of

Staphylococcus capitis CR01 (pulsetype NRCS-A). Stand. Genomic Sci. 9,

1118–1127. doi: 10.4056/sigs.5491045

Liu, C.-Q., Su, P., Khunajakr, N., Deng, Y.-M., Sumual, S., Kim, W. S., et al. (2005).

Development of food-grade cloning and expression vectors for Lactococcus

lactis. J. Appl. Microbiol. 98, 127–135. doi: 10.1111/j.1365-2672.2004.02441.x

Lyon, B. R., May, J. W., and Skurray, R. A. (1984). Tn4001: a gentamicin and

kanamycin resistance transposon in Staphylococcus aureus. Mol. Gen. Genet.

193, 554–556.

Martins Simões, P., Rasigade, J.-P., Lemriss, H., Butin, M., Ginevra, C., Lemriss,

S., et al. (2013). Characterization of a novel composite staphylococcal cassette

chromosome mec (SCCmec-SCCcad/ars/cop) in the neonatal sepsis-associated

Staphylococcus capitis pulsotype NRCS-A. Antimicrob. Agents Chemother. 57,

6354–6357. doi: 10.1128/AAC.01576-13

McArthur, A. G., Waglechner, N., Nizam, F., Yan, A., Azad, M. A., Baylay, A. J.,

et al. (2013). The comprehensive antibiotic resistance database. Antimicrob.

Agents Chemother. 57, 3348–3357. doi: 10.1128/AAC.00419-13

Millette, M., Cornut, G., Dupont, C., Shareck, F., Archambault, D., and Lacroix, M.

(2008). Capacity of human nisin- and pediocin-producing lactic Acid bacteria

to reduce intestinal colonization by vancomycin-resistant enterococci. Appl.

Environ. Microbiol. 74, 1997–2003. doi: 10.1128/AEM.02150-07

Morelli, L. (2008). Postnatal development of intestinal microflora as influenced

by infant nutrition. J. Nutr. 138, 1791S–1795S. Available online at: http://jn.

nutrition.org/content/138/9/1791S.full#fn-1

Otto, M. (2009). Staphylococcus epidermidis: the “accidental” pathogen. Nat. Rev.

Micro. 7, 555–567. doi: 1038/nrmicro2182

Otto, M. (2012). Molecular basis of Staphylococcus epidermidis infections. Semin.

Immunopathol. 34, 201–214. doi: 10.1007/s00281-011-0296-2

Park, H.-K., Shim, S.-S., Kim, S.-Y., Park, J.-H., Park, S.-E., Kim, H.-J., et al.

(2005). Molecular analysis of colonized bacteria in a human newborn infant

gut. J. Microbiol. 43, 345–353.

Peschel, A., and Sahl, H.-G. (2006). The co-evolution of host cationic

antimicrobial peptides and microbial resistance. Nat. Rev. Microbiol. 4,

529–536. doi: 10.1038/nrmicro1441

Piper, C., Draper, L. A., Cotter, P. D., Ross, R. P., and Hill, C. (2009). A comparison

of the activities of lacticin 3147 and nisin against drug-resistant Staphylococcus

aureus and Enterococcus species. J. Antimicrob. Chemother. 64, 546–551.

doi: 10.1093/jac/dkp221

Rasigade, J.-P., Raulin, O., Picaud, J.-C., Tellini, C., Bes, M., Grando, J., et al.

(2012). Methicillin-resistant Staphylococcus capitis with reduced Vancomycin

susceptibility causes late-onset sepsis in intensive care neonates. PLoS ONE

7:e31548. doi: 10.1371/journal.pone.0031548

Roberts, R. J., Carneiro, M. O., and Schatz, M. C. (2013). The advantages of SMRT

sequencing. Genome Biol. 14:405. doi: 10.1186/gb-2013-14-6-405

Frontiers in Microbiology | www.frontiersin.org 10 December 2016 | Volume 7 | Article 1991

Martins Simões et al. Genomic Characterization of the NRCS-A Clone

Shin, J. M., Gwak, J. W., Kamarajan, P., Fenno, J. C., Rickard, A. H., and Kapila, Y.

L. (2016). Biomedical applications of nisin. J. Appl. Microbiol. 120, 1449–1465.

doi: 10.1111/jam.13033

Siguier, P., Perochon, J., Lestrade, L., Mahillon, J., and Chandler, M. (2006).

ISfinder: the reference centre for bacterial insertion sequences. Nucleic Acids

Res. 34, D32–D36. doi: 10.1093/nar/gkj014

Stoll, B. J., Hansen, N., Fanaroff, A. A., Wright, L. L., Carlo, W. A., Ehrenkranz,

R. A., et al. (2002). Late-onset sepsis in very low birth weight neonates: the

experience of the NICHDNeonatal Research Network. Pediatrics 110, 285–291.

doi: 10.1542/peds.110.2.285

Stoll, B. J., Hansen, N. I., Higgins, R. D., Fanaroff, A. A., Duara, S.,

Goldberg, R., et al. (2005). Very low birth weight preterm infants with

early onset neonatal sepsis: the predominance of gram-negative infections

continues in the National Institute of Child Health and Human Development

Neonatal Research Network, 2002-2003. Pediatr. Infect. Dis. J. 24, 635–639.

doi: 10.1097/01.inf.0000168749.82105.64

Taft, D. H., Ambalavanan, N., Schibler, K. R., Yu, Z., Newburg, D. S.,

Deshmukh, H., et al. (2015). Center variation in intestinal Microbiota

prior to late-onset sepsis in preterm infants. PLoS ONE 10:e0130604.

doi: 10.1371/journal.pone.0130604

Vallenet, D., Belda, E., Calteau, A., Cruveiller, S., Engelen, S., Lajus, A., et al. (2013).

MicroScope–an integratedmicrobial resource for the curation and comparative

analysis of genomic and metabolic data. Nucleic Acids Res. 41, D636–D647.

doi: 10.1093/nar/gks1194

Vallenet, D., Labarre, L., Rouy, Z., Barbe, V., Bocs, S., Cruveiller, S., et al. (2006).

MaGe: a microbial genome annotation system supported by synteny results.

Nucleic Acids Res. 34, 53–65. doi: 10.1093/nar/gkj406

Van Der Zwet, W. C., Debets-Ossenkopp, Y. J., Reinders, E., Kapi, M., Savelkoul,

P. H., Elburg, R. M., et al. (2002). Nosocomial spread of a Staphylococcus capitis

strain with heteroresistance to vancomycin in a neonatal intensive care unit. J.

Clin. Microbiol. 40, 2520–2525. doi: 10.1128/JCM.40.7.2520-2525.2002

Venkatesh, M. P., Placencia, F., and Weisman, L. E. (2006). Coagulase-negative

staphylococcal infections in the neonate and child: an update. Semin. Pediatr.

Infect. Dis. 17, 120–127. doi: 10.1053/j.spid.2006.06.005

Wiedemann, I., Breukink, E., van Kraaij, C., Kuipers, O. P., Bierbaum, G.,

de Kruijff, B., et al. (2001). Specific binding of nisin to the peptidoglycan

precursor lipid II combines pore formation and inhibition of cell wall

biosynthesis for potent antibiotic activity. J. Biol. Chem. 276, 1772–1779.

doi: 10.1074/jbc.M006770200

Zhang, Y.-Q., Ren, S.-X., Li, H.-L., Wang, Y.-X., Fu, G., Yang, J., et al.

(2003). Genome-based analysis of virulence genes in a non-biofilm-

forming Staphylococcus epidermidis strain (ATCC 12228). Mol. Microbiol. 49,

1577–1593. doi: 10.1046/j.1365-2958.2003.03671.x

Zhou, Y., Liang, Y., Lynch, K. H., Dennis, J. J., and Wishart, D. S. (2011).

PHAST: a fast phage search tool. Nucleic Acids Res. 39, W347–W352.

doi: 10.1093/nar/gkr485

Conflict of Interest Statement: The authors declare that the research was

conducted in the absence of any commercial or financial relationships that could

be construed as a potential conflict of interest.

Copyright © 2016 Martins Simões, Lemriss, Dumont, Lemriss, Rasigade,

Assant-Trouillet, Ibrahimi, El Kabbaj, Butin and Laurent. This is an open-access

article distributed under the terms of the Creative Commons Attribution License (CC

BY). The use, distribution or reproduction in other forums is permitted, provided the

original author(s) or licensor are credited and that the original publication in this

journal is cited, in accordance with accepted academic practice. No use, distribution

or reproduction is permitted which does not comply with these terms.

Frontiers in Microbiology | www.frontiersin.org 11 December 2016 | Volume 7 | Article 1991

ORIGINAL ARTICLE BACTERIOLOGY

Wide geographical dissemination of the multiresistant Staphylococcuscapitis NRCS-A clone in neonatal intensive-care units

M. Butin1,2, J.-P. Rasigade1,2,3,4, P. Martins-Simões1,2,3, H. Meugnier2,3, H. Lemriss5, R. V. Goering6, A. Kearns7, M. A. Deighton8,

O. Denis9, A. Ibrahimi5, O. Claris4,10, F. Vandenesch2,3,4, J.-C. Picaud4,11 and F. Laurent1,2,3,4

1) Department of Clinical Microbiology, Northern Hospital Group, Hospices Civils de Lyon, 2) International Centre for Research in Infectious Diseases (CIRI),

INSERM U1111, CNRS UMR5308, Université Lyon 1, ENS de Lyon, 3) National Reference Centre for Staphylococci, Hospices Civils de Lyon, Lyon, 4) Claude

Bernard University Lyon 1, Villeurbanne, France, 5) Laboratory of Biotechnology, Faculty of Medicine and Pharmacy of Rabat, Mohamed V University of Rabat,

Rabat, Morocco, 6) Creighton University, Omaha, NE, USA, 7) Public Health England, Staphylococcus Reference Service, Colindale, London, UK, 8) RMIT

University, Bundoora, Victoria, Australia, 9) Erasme Hospital, Université Libre de Bruxelles, Laboratoire de Référence MRSA, Staphylocoques, Department of

Microbiology, Brussels, Belgium, 10) Neonatal Intensive Care Unit, Eastern Hospital Group, Hospices Civils de Lyon, Bron and 11) Neonatal Intensive Care Unit,

Northern Hospital Group, Hospices Civils de Lyon, Lyon, France

Abstract

Nosocomial late-onset sepsis represents a frequent cause of morbidity and mortality in preterm neonates. The Staphylococcus capitis clone

NRCS-A has been previously described as an emerging cause of nosocomial bacteraemia in French neonatal intensive-care units (NICUs).

In this study, we aimed to explore the possible unrecognized dissemination of this clone on a larger geographical scale. One hundred

methicillin-resistant S. capitis strains isolated from neonates (n = 86) and adult patients (n = 14) between 2000 and 2013 in four different

countries (France, Belgium, the UK, and Australia) were analysed with SmaI pulsed-field gel electrophoresis (PFGE) and dru typing. The

vast majority of NICU strains showed the NRCS-A pulsotype and the dt11c type (96%). We then randomly selected 14 isolates (from

neonates, n = 12, three per country; from adult patients, n = 2), considered to be a subset of representative isolates, and performed

further molecular typing (SacII PFGE, SCCmec typing, and multilocus sequence typing-like analysis), confirming the clonality of the

S. capitis strains isolated from neonates, despite their distant geographical origin. Whole genome single-nucleotide polymorphism-based

phylogenetic analysis of five NICU isolates (from the different countries) attested to high genetic relatedness within the NRCS-A clone.

Finally, all of the NRCS-A strains showed multidrug resistance (e.g. methicillin and aminoglycoside resistance, and decreased vancomycin

susceptibility), with potential therapeutic implications for infected neonates. In conclusion, this study represents the first report of clonal

dissemination of methicillin-resistant coagulase-negative Staphylococcus clone on a large geographical scale. Questions remain regarding the

origin and means of international spread, and the reasons for this clone’s apparent predilection for neonates.

Clinical Microbiology and Infection © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All

rights reserved.

Keywords: Antibiotic resistance, clone, coagulase-negative Staphylococcus, neonatology, vancomycin

Original Submission: 20 March 2015; Revised Submission: 3 September 2015; Accepted: 8 September 2015

Editor: P.T. Tassios

Article published online: 25 September 2015

Corresponding author: M. Butin, Department of ClinicalMicrobiology, CIRI, INSERM U1111, Hôpital de la Croix Rousse, 103grande rue de la Croix Rousse, 69004 Lyon, FranceE-mail: marine.butin@chu-lyon.fr

Introduction

Every year, approximately 15 million children are born pre-

maturely worldwide (defined as all live births before 37completed weeks). In developed countries, preterm birth is the

leading cause of death in children aged <5 years [1]. In recent

Clin Microbiol Infect 2016; 22: 46–52Clinical Microbiology and Infection © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reservedhttp://dx.doi.org/10.1016/j.cmi.2015.09.008

decades, technical and medical advances in neonatal intensive-

care units (NICUs) have allowed for an improvement in theglobal survival of neonates. Nevertheless, preterm birth-related

complications still remain the major cause of neonatal death [2].In this context, nosocomial late-onset sepsis (LOS) (occurring

after 3 days of life) represents a frequent cause of morbidity andmortality [3]. Twenty per cent to 30% of very low birthweightpreterm babies develop at least one episode of LOS during

their hospitalization in a NICU, resulting in respiratory orneurological impairment [4]. Catheter-related bloodstream in-

fections constitute the most frequent cause of LOS in thesevulnerable neonates, owing to multiple indwelling devices and

invasive procedures. Consequently, skin-associated commensalcoagulase-negative staphylococci are the most frequently

involved pathogens in LOS, most commonly involving Staphy-lococcus epidermidis [3,5].

However, the predominance of Staphylococcus capitis in

several French NICUs has been reported, whereas this speciesis rarely reported as a pathogen in adult patients [6]. This

phenomenon is of major concern, for several reasons: first, wehave recently shown that all methicillin-resistant S. capitis

strains from NICUs in France belong to a unique clone(designated NRCS-A), suggesting a high potential for dissemi-

nation, whereas S. capitis isolates from adult patients belong tomany distinct clones; second, NRCS-A has been highly preva-

lent in our institution (Hospices Civils de Lyon) since at least2004, underscoring its ability to persist and become endemicwhen introduced into NICUs; and third, NRCS-A strains show

decreased susceptibility to all antimicrobial agents that arecommonly used in NICUs [6]. NRCS-A isolates harbour a type

V-related staphylococcal chromosome cassette mec (SCCmec)element conferring resistance to β-lactams [7], and show a

multidrug resistance profile, including resistance or hetero-resistance to vancomycin, the first-line antimicrobial agent in

LOS cases [5,6].As multiresistant S. capitis LOS cases have been reported in

several countries [6–9], we sought to explore the possible

unrecognized dissemination of the multiresistant NRCS-Aclone on a larger geographical scale. To this end, we

collected and characterized S. capitis bloodstream isolates fromNICUs located in geographically diverse countries, by per-

forming molecular typing and antimicrobial susceptibilitytesting.

Materials and methods

Bacterial isolatesThe strain collections of four national reference centres forstaphylococci (Australia, Belgium, France, and the UK) were

screened to identify methicillin-resistant S. capitis isolates from

neonatal LOS in NICUs, and from blood cultures of non-neonatal patients (adult or paediatric). For the period

2000–2013, methicillin-resistant and multiresistant S. capitisisolates were isolated in NICUs in at least 12 (France), eight

(UK), six (Australia) and four (Belgium) hospitals. Each yearduring this time period, between two and 70 neonatal LOScases involving S. capitis were identified in each of these hos-

pitals (personal communication). Each reference laboratoryprovided a sample of methicillin-resistant S. capitis strains iso-

lated from its country during the period 2000–2013. In total,100 S. capitis strains were included in our analysis: 86 from

NICUs (France, n = 48; Belgium, n = 3, Australia, n = 20; andthe UK, n = 15) and 14 from other units (paediatric or adult

patients) (France, n = 7; Belgium, n = 3; and Australia, n = 4).These 100 strains were initially characterized by pulsed-field gelelectrophoresis (PFGE) and dru typing.

To confirm our initial results and avoid method-linked bias,we more thoroughly characterized a subset of isolates

belonging to the NRCS-A clone, as it was not feasible to analyseevery isolate in the complete strain collections. Thus, of the 86

NICU isolates, 12 were randomly selected (three NRCS-Aisolates per country), and two methicillin-resistant S. capitis

bloodstream isolates from adult patients from France that didnot belong to the NRCS-A clone were selected.

PFGEPFGE, the reference standard staphylococcal typing and

outbreak investigation method, was performed initially withSmaI restriction digestion, and also with SacII, which has been

recently reported to show increased discriminatory power forS. capitis [6,9,10]. Cluster analysis was performed with Bio-

Numerics software 7.1 (Applied Maths NV, Sint-Martens-Latem, Belgium). Pattern similarities of >80% (UPGMA, Dice

coefficient) were used to define a pulsotype as previouslydescribed [11].

dru typingdru typing, a recently developed method based on sequence

analysis of a 40-bp variable-number tandem-repeat regionwithin SCCmec (the mobile genetic element (MGE) harbouring

the mecA gene), was performed as previously described [12].

SCCmec typingThe SCCmec typing was performed as described by Kondo

et al. [13].

Multilocus sequence typingThe genetic relationship between the 14 selected S. capitisisolates was further explored by multilocus sequence typing

CMI Butin et al. Multiresistant S. capitis clone in NICUs 47

Clinical Microbiology and Infection © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved, CMI, 22, 46–52

100

8060

noitalosi foraeYyrtnuoCgnittes tneitaPetalosIepytosluPsnrettap EGFPegatnecrepytiralimiS dru type

NRCS-A BACAD80 NICU France 2008 dt11cNRCS-A BACAE01 NICU France 2008 dt11cNRCS-A BACAD81 NICU France 2009 dt11cNRCS-A ST20111689 NICU France 2011 dt11cNRCS-A ST20111690 NICU France 2011 dt11cNRCS-A ST20111691 NICU France 2011 dt11cNRCS-A ST20111693 NICU France 2011 dt11cNRCS-A ST20111694 NICU France 2011 dt11cNRCS-A ST20111771 NICU UK 2010 dt11cNRCS-A ST20111772 * NICU Belgium 2009 dt11cNRCS-A ST20111773 NICU Belgium 2009 dt11cNRCS-A ST20111774 NICU Belgium 2010 dt11cNRCS-A ST20111732 NICU France 2011 dt11cNRCS-A ST20111734 NICU France 2011 dt11cNRCS-A BACAE06 NICU France 2008 dt11cNRCS-A BACAE03 NICU France 2008 dt11cNRCS-A BACAE12 NICU France 2008 dt11cNRCS-A BACAD75 NICU France 2005 dt11cNRCS-A BACAD78 NICU France 2006 dt11cNRCS-A BACAD73 NICU France 2007 dt11cNRCS-A BACAD74 NICU France 2007 dt11cNRCS-A BACAD76 NICU France 2009 dt11cNRCS-A ST20131580 NICU France 2009 dt11cNRCS-A BACAD71 NICU France 2009 dt11cNRCS-A ST20111775 * NICU France 2009 dt11cNRCS-A ST20141717 NICU France 2008 dt11cNRCS-A ST20141733 NICU France 2009 dt11baNRCS-A ST20141734 NICU France 2008 dt11cNRCS-A ST20141735 NICU France 2009 dt11cNRCS-A ST20141736 NICU France 2009 dt11cNRCS-A ST20141730 NICU France 2007 dt10hNRCS-A ST20141752 NICU France 2007 dt11cNRCS-A ST20141732 NICU France 2008 dt11cNRCS-A ST20141731 NICU France 2008 dt11cNRCS-A ST20090910 France 2009 dt11cNRCS-A ST20111733 NICU France 2011 dt11cNRCS-A ST20141720 NICU UK 2009 dt11cNRCS-A ST20141741 NICU France 2008 dt11cNRCS-A ST20141739 NICU France 2008 dt11cNRCS-A ST20141716 NICU Australia 2000 dt11cNRCS-A ST20141742 NICU France 2008 dt11cNRCS-A ST20141743 NICU France 2008 dt11cNRCS-A ST20141744 NICU France 2008 dt11cNRCS-A ST20141745 NICU France 2008 dt11cNRCS-A ST20141740 NICU France 2008 dt11cNRCS-A ST20090909 NICU France 2008 dt11cNRCS-A ST20090908 NICU France 2008 dt11cNRCS-A BACAD72 NICU France 2009 dt11cNRCS-A ST20111769 NICU UK 2009 dt11cNRCS-A ST20111770 * NICU UK 2009 dt11cNRCS-A ST20141751 NICU France 2006 dt12rNRCS-A BACAE26 NICU France 2008 dt11cNRCS-A BACAC01 NICU UK 2010 dt11cNRCS-A BACAE25 NICU France 2008 dt11cNRCS-A ST20141738 NICU France 2009 dt11cNRCS-A ST20141737 NICU France 2009 dt11cNRCS-A ST20121276 NICU Australia 2012 dt11cNRCS-A BACAC09 NICU UK 2010 dt11cNRCS-A BACAC15 NICU UK 2010 dt11cNRCS-A ST20141727 NICU UK 2010 dt11cNRCS-A BACAB80 NICU UK 2010 dt11cNRCS-A ST20141726 NICU UK 2010 dt11cNRCS-A ST20141722 NICU UK 2009 dt11cNRCS-A ST20141729 NICU UK 2011 dt11cNRCS-A ST20141728 NICU UK 2010 dt11cNRCS-A ST20121261 NICU Australia 2012 dt11cNRCS-A ST20121264 NICU Australia 2012 dt11cNRCS-A ST20121265 NICU Australia 2012 dt11cNRCS-A ST20121268 NICU Australia 2012 dt11cNRCS-A ST20121269 NICU Australia 2012 dt11cNRCS-A ST20121270 NICU Australia 2012 dt11cNRCS-A ST20121273 NICU Australia 2012 dt11cNRCS-A ST20121274 NICU Australia 2012 dt11cNRCS-A ST20121275 NICU Australia 2012 dt11cNRCS-A ST20131582 * NICU France 2002 dt11cNRCS-A ST20121263 NICU Australia 2012 dt11cNRCS-A ST20121272 NICU Australia 2012 dt11cNRCS-A ST20141721 NICU UK 2009 dt11cNRCS-A ST20121262 Adult se ng Australia 2012 dt10aNRCS-A ST20121575 NICU Australia 2002 dt11cNRCS-A ST20111692 NICU France 2011 dt11cNRCS-A ST20121573 * NICU Australia 2000 dt11cNRCS-A ST20121574 NICU Australia 2001 dt11cNRCS-A ST20121576 NICU Australia 2004 dt11cNRCS-A ST20141719 NICU Australia 2001 dt11c

Non-NRCS-A ST20121267 Adult se ng Australia 2012 dt11aNon-NRCS-A ST20121271 Adult se ng Australia 2012 dt11cNon-NRCS-A ST20091315 Adult se ng France 2008 dt11bdNon-NRCS-A ST20111767 NICU Australia 2003 dt11cNon-NRCS-A ST20141724 NICU UK 2010 dt11cNon-NRCS-A ST20111766 NICU Australia 2011 dt11cNon-NRCS-A ST20121260 Adult se ng Australia 2012 dt12afNon-NRCS-A BACAE37 Adult se ng France 2008 dt3cNon-NRCS-A BACAY43 Adult se ng Belgium 2013 dt11aNon-NRCS-A ST20091319 Adult se ng France 2007 dt11aNon-NRCS-A BACAY44 Adult se ng Belgium 2013 dt1bNon-NRCS-A BACAY42 Adult se ng Belgium 2013 dt9boNon-NRCS-A ST20091316 Adult se ng France 2009Non-NRCS-A ST20090912 Adult se ng France 2008 dt3cNon-NRCS-A ST20090917 Adult se ng France 2009

Paediatric ICU

Non-typeable

Non-typeable

48 Clinical Microbiology and Infection, Volume 22 Number 1, January 2016 CMI

Clinical Microbiology and Infection © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved, CMI, 22, 46–52

(MLST) based on the published S. epidermidis MLST scheme

[14], with appropriately designed consensus primers foramplification of seven housekeeping genes (Table S1). For each

allele, sequences were aligned, and single-nucleotide poly-morphisms (SNPs) were detected and compared.

Whole genome sequencing and SNP-basedphylogenetic analysisToexplore the genetic conservation inside theNRCS-Aclone,five

NRCS-A isolateswere selected, including: (a) isolate ST20131582,corresponding to the oldest French isolate available in our

collection (2002) (genome CR09; ENA accession numberCTEL01000003) [15]; and (b) four isolates (one per country)

randomly selected from the 12 previously fully analysed iso-lates— isolate ST20111775 from France (genome CR01, alreadypublished [16] and considered to be the prototype of theNRCS-A

clone; ENA accession number LN866849), isolate ST20111772from Belgium (genome CR03; ENA accession number

CTEB01000001) [15], isolate ST20121573 from Australia(genome CR04; ENA accession number CTEM01000001) [15],

and isolate ST20111770 from the UK (genome CR05; ENAaccession number CTEO01000001) [15]. Whole genome

sequencing of these five isolates was performed with pyrose-quencing (454; Life Sciences/Roche, Branford, CT, USA). More-over, we performed single-molecule real-time sequencing

(PacBio, Menlo Park, CA, USA) for one of these five isolates(ST20111775) to obtain a closed genome (genome CR01). The

mean coverage obtained with the 454 pyrosequencing was 24×,21×, 20× and 20× for genomes CR03, CR04, CR05 and CR09,

respectively. For the single-molecule real-time sequencing(genome CR01), a mean coverage of 265× was obtained.

The whole genome sequences (WGSs) of these NRCS-AS. capitis strains were compared with publicly available

S. capitis genomes, which correspond to either skin commensalor pathogen isolates from adult patients : SK14 (GenBankReference Sequence: ACFR00000000.1), VCU116 (GenBank

Reference Sequence: AFTX00000000.1), QN1 (GenBankReference Sequence: AJTH00000000.1), LNZR-1 (GenBank

Reference Sequence: NZ_JGYJ00000000.1), and C87 (GenBankReference Sequence: ACRH00000000.1). To assess the phylo-

genetic relationships between all S. capitis strains, we used theREALPHY 1.10 online pipeline [17], with default parameters, to

infer phylogenetic trees from assembled WGS data. We used

the closed genome of the S. capitis NRCS-A strain ST20111775

as the reference genome (genome CR01; ENA accessionnumber LN866849).

Antimicrobial susceptibility profileAntimicrobial susceptibility testing of the 14 selected S. capitisisolates (NICU, n = 12; adult patients, n = 2) was performed

with the standard agar diffusion technique as recommended bythe French Society for Microbiology (www.sfmasso.fr/doc/

download.php?doc=DiU8C&fic=casfm_2009.pdf). MICs ofvancomycin, linezolid and daptomycin were determined with

the Etest. Strains with a vancomycin MIC of >2 mg/L wereconsidered to be resistant, and strains with MICs of �2 mg/L

were tested for vancomycin heteroresistance with thebrain–heart infusion agar method, as previously described[6,18].

Results

SmaI PFGE profileOf the 86 S. capitis isolates from the NICU, all but three (96%)were of the NRCS-A strain pulsotype (i.e. shared >80% simi-

larity with each other and the NRCS-A pattern) [6] (Fig. 1). Thethree non-NRCS-A strains originated from NICUs in Australia.

In contrast, the 14 non-NICU methicillin-resistant S. capitisisolates showed a diversity of pulsotypes, only two of which

(14%) were NRCS-A: one from a 4-year-old patient hospital-ized in a paediatric intensive-care unit in France, and one from

an adult patient in Australia (Fig. 1).

dru typeWith more clonal organisms, PFGE tends to generate related

macrorestriction patterns, causing problems in epidemiologicaldiscrimination [12]. Therefore, the 100 S. capitis isolates were

additionally analysed with dru typing for characterization of theMGE harbouring mecA. Among the 86 NICU isolates, 83 har-

boured a unique dt11c profile (96%), regardless of their pul-sotype (NRCS-A or not NRCS-A) (Fig. 1). The three remaining

NICU isolates (all NRCS-A) were dt12r, dt11ba, and dt10h(n = 1 each). Conversely, among the 14 non-NICU isolates,only two were dt11c (14%), including the NRCS-A paediatric

isolate. The other dru types in non-NICU isolates were diverse:

FIG. 1. Dendrogram and schematic representation of pulsotypes and dru types of 100 Staphylococcus capitis isolates from neonatal intensive-care units

(NICUs) (n = 86) or other settings (n = 14). The pulsed-field gel electrophoresis (PFGE) dendrogram was generated from SmaI PFGE patterns with

Bionumerics software 7.1, as previously described [6,10]. The vertical dotted line represents the 80% limit of similarity. The pulsotype NRCS-A was

defined previously [6]. dru typing was performed as previously described [12]. *Available genomes.

CMI Butin et al. Multiresistant S. capitis clone in NICUs 49

Clinical Microbiology and Infection © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved, CMI, 22, 46–52

dt10a (n = 1), dt11a (n = 3), dt12af (n = 1), dt11bd (n = 1), dt3c

(n = 2), dt1b (n = 1), and dt9bo (n = 1). Two isolates were non-typeable.

PFGE with SacII, SCCmec typing, and MLSTTo strengthen and complete the data obtained with the set of100 clinical isolates, we performed additional analysis on a

subset of 14 randomly selected strains: 12 NRCS-A strains fromNICU patients (n = 3 from each country) and two non-NRCS-A

strains from adult patients.As observed with SmaI, SacII PFGE restriction profiles

confirmed the clustering of the 12 NICU isolates into a uniquepulsotype (Fig. S1). Conversely, isolates from adult patients

belonged to two distinct pulsotypes, and shared <80% similaritywith NICU isolates. SCCmec analysis confirmed the geneticcloseness of this MGE in the 12 NICU isolates: indeed, all of

these 12 isolates harboured a type V-related SCCmec element,whereas the isolates from adults harboured a non-typeable

SCCmec element (a combination of a mec complex type Cand ccr genes A2/B2/C) (Fig. S1). Finally, when an MLST model

encompassing a total of 3020 bp of housekeeping genes wasused, the sequence comparison of the 12 NICU isolates

showed that these isolates differed by no more than two SNPs(Table S2), whereas sequences of the two isolates from adultpatients showed 32 and 33 SNPs, as compared with the NICU

isolates.

Whole genome SNP-based phylogenetic analysis ofS. capitis strainsA total of 2 080 323 bp (including coding and intergenic re-

gions) were found to be shared by all ten genomes (five S. capitisNRCS-A genomes and the five publicly available S. capitis ge-

nomes), and constituted the core genome used for the phylo-genetic reconstruction shown in Fig. 2. When each genome wascompared with the reference genome of S. capitis NRCS-A

CR01, we found a maximum of 162 SNPs and a minimum of65 SNPs (indels excluded) between the NRCS-A genomes,

whereas the non-NRCS-A genomes harboured at least 7910SNPs and up to 50 723 SNPs (for LNZR-1 and QN1, respec-

tively). As seen in Fig. 2, all five NRCS-A genomes clustered inone clade, which suggests that they belong to a clonal

population.

Antimicrobial susceptibility profilesAntimicrobial susceptibility profiles of the 14 S. capitis strains

are shown in Table 1. All 12 NICU isolates showed methicillinand aminoglycoside resistance, and either resistance or heter-

oresistance to vancomycin, the first-line antimicrobial agentused for LOS. The 12 NICU isolates remained susceptible to

fluoroquinolones.

Discussion

Collectively, our data highlight the unexpected multinational

geographical distribution of a clonal population of multidrug-resistant S. capitis (NRCS-A) that shows high specificity forthe NICU environment.

PFGE and dru typing performed on a large number of S. capitisisolates, representing wide temporal and geographical diversity,

revealed that almost all of the S. capitis NICU isolates collectedin four distant countries were of the NRCS-A pulsotype and

dt11c (within a common SCCmec cassette acquired only once).These results suggest the emergence and widespread dissemi-

nation of a unique S. capitis strain. The slight discrepancy be-tween the pulsotype and the dru type of the isolates could be

explained by the fact that the SCCmec cassette, an MGE, can betransferred between different isolates when present in the sameenvironment, such as an NICU. Note that, in our collection,

two strains from adult patients were non-typeable by dru typing.This phenomenon has also been observed in rare methicillin-

resistant S. aureus strains, and has been interpreted as anabsence of the dru region in this minority of strains [12].

Genetic relatedness within the NRCS-A clone was alsoillustrated by the low mutation level seen in the MLST-like

analysis (at most, two SNPs over 3020 bp), and confirmed bythe few SNPs found in the comparison of core genomes of fiveS. capitis NRCS-A strains despite their geographical and tem-

poral diversity. This high conservation of the NRCS-A genomesince at least 2000 (the year of isolation of the Australian strain,

the oldest strain included in the WGS comparison) suggestshigh adaptation of this clone towards the NICU environment,

resulting in few genetic changes inside the clonal population ofNICU isolates. This interesting observation requires further

investigation focusing on the mutation rate, the molecularclock, and the fitness of clinical NRCS-A isolates.

All tested NRCS-A isolates had the same multidrug resis-tance profile, including resistance to all antimicrobial agentswidely used in the NICU setting. Unexpectedly, these NICU

isolates remained susceptible to fluroroquinolones, whereasmultiresistant coagulase-negative Staphylococcus strains are

typically fluoroquinolone resistant. This atypical antimicrobialsusceptibility profile is similar to that of previously described

NRCS-A strains [6], and probably reflects the specific antimi-crobial selective pressure of NICUs, where β-lactams, vanco-

mycin, and aminoglycosides, but not fluoroquinolones, arewidely used [19]. In our study, all NRCS-A isolates were eitherresistant or heteroresistant to vancomycin. Studies of S. capitis

isolates from NICUs have reported constant vancomycin het-eroresistance [7,8], and Van der Zwet et al. initially proposed

that this could be an intrinsic feature of S. capitis [8]. However,

50 Clinical Microbiology and Infection, Volume 22 Number 1, January 2016 CMI

Clinical Microbiology and Infection © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved, CMI, 22, 46–52

our recent results obtained by comparing S. capitis isolates fromneonates and adult patients suggest that vancomycin hetero-

resistance is more likely to be a specific feature of the NRCS-Aclone [7]. This heteroresistance might have contributed to

S. capitis NRCS-A establishment in NICUs. Alternatively, thefrequent use of vancomycin in neonates might have induced/

selected this heteroresistance in the NRCS-A clone. The clinicalsignificance of vancomycin heteroresistance is controversial,but therapeutic failures of vancomycin in S. capitis-related LOS

have been reported [8]. Thus, the multidrug resistance profileof this emerging clone raises therapeutic concerns in cases of

LOS, and requires substantiation in a clinical study focusing onS. capitis LOS.

Taken together, these data demonstrate the clonality ofS. capitis isolates from neonates, despite their distant

geographical origin, in contrast to the high level of genetic di-versity seen in isolates from non-NICU patients. Thus, this

larger dataset, involving an international collection of strains,mirrors our previous observation of isolates within France [6].

The geographical spread of a clonal population of S. capitis indistant NICUs, although unexpected, is reminiscent of theextensive diffusion of clonal group B Streptococcus ST-17 causing

meningitis and septicaemia in neonates [20]. However, althoughthe global dissemination of methicillin-resistant Staphylococcus

aureus clones has been well described, to the best of ourknowledge this study represents the first report of widespread

FIG. 2. Single-nucleotide polymorphism (SNP)-

based maximum-likelihood tree with whole

genome sequences of neonatal Staphylococcus

capitis isolates from four distinct countries and

publicly available S. capitis genomes. A total of

2 080 323 homologous sites from all ten ge-

nomes (polymorphic and non-polymorphic

sites) were obtained by use of the REALPHY

1.10 online pipeline with the closed chromo-

some of S. capitis NRCS-A CR01 (ENA acces-

sion number LN866849) as reference. A

maximum-likelihood tree was built by the use

of PhyML with default parameters as imple-

mented in REALPHY 1.10. For each strain, the

number of SNPs between each strain and the

reference is indicated in grey in parentheses.

Aus, Australia; Be, Belgium; Fr, France.

TABLE 1. Antimicrobial susceptibility profile of Staphylococcus capitis bloodstream isolates from neonates (n [ 12) and adults

(n [ 2)

StrainPatientsetting Country

Year ofisolation Oxa Kan Tob Gen Rif Cip Ery Fof

Van susceptibility(MIC in mg/L)

Lzd susceptibility(MIC in mg/L)

Dap susceptibility(MIC in mg/L)

ST20091315 AdultICU

France 2008 R R R S S S S R S (0.75) S (0.75) S (0.19)

ST20090912 AdultMedicine

France 2008 R R R S S R S R S (1.0) S (1.0) S (0.19)

ST20111769 NICU UK 2009 R R R R S S S R HR (1.0) S (1.0) S (1.0)ST20111770a NICU UK 2009 R R R R S S S R HR (0.75) S (1.0) S (0.19)ST20121575 NICU Australia 2002 R R R R S S R R HR (1.5) S (1.5) S (0.5)ST20111771 NICU UK 2010 R R R R S S S R HR (2.0) S (1.5) S (0.75ST20111773 NICU Belgium 2009 R R R S S S S R HR (1.5) S (1.5 S (1.0)ST20131580 NICU France 2009 R R R R R S S R R (3.0) S (2.0) S (1.0)ST20121573a NICU Australia 2000 R R R R S S S R HR (1.5) S (2.0) S (0.75)ST20121574 NICU Australia 2001 R R R R S S R R HR (2.0) S (2.0) S (0.75)ST20111772a NICU Belgium 2009 R R R R S S S R HR (1.5) S (1.0) S (0.75)ST20111774 NICU Belgium 2010 R R R R S S S R HR (2.0) S (1.5) S (0.75)ST20111775a NICU France 2009 R R R R R S S R HR (1.5) S (1.5) S (0.25)BACAD74 NICU France 2007 R R R R R S S R HR (1.5) S (1.5) S (0.5)

Cip, ciprofloxacin; Dap, daptomycin; Ery, erythromycin; Fof, fosfomycin; Gen, gentamicin; HR, heteroresistant; ICU, intensive-care unit; Kan, kanamycin; Lzd, linezolid; NICU,neonatal intensive-care unit; Oxa, oxacillin; R, resistant; Rif, rifampin; S, susceptible; Tob, tobramycin; Van, vancomycin.aAvailable genomes.

CMI Butin et al. Multiresistant S. capitis clone in NICUs 51

Clinical Microbiology and Infection © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved, CMI, 22, 46–52

diffusion of methicillin-resistant coagulase-negative staphylococci.

This observation raises important and as yet unsolved questionsregarding the origin and the dissemination routes involved in the

international spread of NRCS-A S. capitis, as well as the under-lying mechanism(s) of apparent predilection for neonates.

Conclusion

In conclusion, we have demonstrated that a methicillin-resistantand multidrug-resistant S. capitis clone is involved in LOS in

NICUs from four distant countries. A better understanding ofthe epidemiology and pathophysiology of S. capitis NRCS-Ainfections in preterm infants is now warranted.

Transparency declaration

The authors have no conflicts of interest or funding to disclose.

Acknowledgements

This work was supported by the French Ministry of Health and

the Institut National de la Santé et de la Recherche Médicale(Inserm). The funders had no role in study design, datacollection, analysis, decision to publish, or preparation of the

manuscript.

Appendix A. Supplementary data

Supplementary data related to this article can be found at http://

dx.doi.org/10.1016/j.cmi.2015.09.008.

References

[1] Liu L, Johnson HL, Cousens S, Perin J, Scott S, Lawn JE, et al. Global,regional, and national causes of child mortality: an updated systematicanalysis for 2010 with time trends since 2000. Lancet 2012;379:2151–61.

[2] Howson CP, Kinney MV, McDougall L, Lawn JE. Born Toon Soon:preterm birth matters. Reprod Health 2013;10(Suppl. 1):S1.

[3] Boghossian NS, Page GP, Bell EF, Stoll BJ, Murray JC, Cotten CM, et al.Late-onset sepsis in very low birth weight infants from singleton andmultiple-gestation births. J Pediatr 2013;162:1120–4.

[4] Cohen-Wolkowiez M, Moran C, Benjamin DK, Cotten CM, Clark RH,Benjamin Jr DK, et al. Early and late onset sepsis in late preterm infants.Pediatr Infect Dis J 2009;28:1052–6.

[5] Venkatesh MP, Placencia F, Weisman LE. Coagulase-negative staphy-lococcal infections in the neonate and child: an update. Semin PediatrInfect Dis 2006;17:120–7.

[6] Rasigade J-P, Raulin O, Picaud J-C, Tellini C, Bes M, Grando J, et al.Methicillin-resistant Staphylococcus capitis with reduced vancomycinsusceptibility causes late-onset sepsis in intensive care neonates. PLoSONE 2012;7:e31548.

[7] D’mello D, Daley AJ, Rahman MS, Qu Y, Garland S, Pearce C, et al.Vancomycin heteroresistance in bloodstream isolates of Staphylococcuscapitis. J Clin Microbiol 2008;46:3124–6.

[8] Van Der Zwet WC, Debets-Ossenkopp YJ, Reinders E, Kapi M,Savelkoul PH, Van Elburg RM, et al. Nosocomial spread of a Staphylo-coccus capitis strain with heteroresistance to vancomycin in a neonatalintensive care unit. J Clin Microbiol 2002;40:2520–5.

[9] Cui B, Smooker PM, Rouch DA, Daley AJ, Deighton MA. Differencesbetween two clinical Staphylococcus capitis subspecies as revealed bybiofilm, antibiotic resistance, and pulsed-field gel electrophoresisprofiling. J Clin Microbiol 2013;51:9–14.

[10] Goering RV. Molecular epidemiology of nosocomial infection: analysisof chromosomal restriction fragment patterns by pulsed-field gelelectrophoresis. Infect Control Hosp Epidemiol 1993;14:595–600.

[11] Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE,Persing DH, et al. Interpreting chromosomal DNA restriction patternsproduced by pulsed-field gel electrophoresis: Criteria for bacterialstrain typing. J Clin Microbiol 1995;33:2233–9.

[12] Goering RV, Morrison D, Al-Doori Z, Edwards GFS,Gemmell CG. Usefulness of mec-associated direct repeat unit (dru)typing in the epidemiological analysis of highly clonal methicillin-resistant Staphylococcus aureus in Scotland. Clin Microbiol Infect2008;14:964–9.

[13] Kondo Y, Ito T, Ma XX, Watanabe S, Kreiswirth BN, Etienne J, et al.Combination of multiplex PCRs for staphylococcal cassette chromo-some mec type assignment: Rapid identification system for mec, ccr, andmajor differences in junkyard regions. Antimicrob Agents Chemother2007;51:264–74.

[14] Thomas JC, Vargas MR, Miragaia M, Peacock SJ, Archer GL,Enright MC. Improved multilocus sequence typing scheme for Staph-ylococcus epidermidis. J Clin Microbiol 2007;45:616–9.

[15] Lemriss H, Lemriss S, Martins-Simoes P, Butin M, Lahlou L, Rasigade JP,et al. Genome sequences of four Staphylococcus capitis NRCS-A isolatesfrom geographically distant neonatal intensive care units. GenomeAnnounc 2015;3:e00501–15.

[16] Lemriss H, Martins Simões P, Lemriss S, Butin M, Ibrahimi A,El Kabbaj S, et al. Non-contiguous finished genome sequence ofStaphylococcus capitis CR01 (pulsetype NRCS-A). Stand Genomic Sci2014;9:1118–27.

[17] Bertels F, Silander OK, Pachkov M, Rainey PB, van Nimwegen E.Automated reconstruction of whole-genome phylogenies from short-sequence reads. Mol Biol Evol 2014;31:1077–88.

[18] Satola SW, Farley MM, Anderson KF, Patel JB. Comparison of detec-tion methods for heteroresistant vancomycin-intermediate Staphylo-coccus aureus, with the population analysis profile method as thereference method. J Clin Microbiol 2011;49:177–83.

[19] Clark RH, Bloom BT, Spitzer AR, Gerstmann DR. Reported medica-tion use in the neonatal intensive care unit: data from a large nationaldata set. Pediatrics 2006;117:1979–87.

[20] Poyart C, Réglier-Poupet H, Tazi A, Billoët A, Dmytruk N, Bidet P,et al. Invasive group B streptococcal infections in infants, France.Emerg Infect Dis 2008;14:1647–9.

52 Clinical Microbiology and Infection, Volume 22 Number 1, January 2016 CMI

Clinical Microbiology and Infection © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved, CMI, 22, 46–52

Caractérisation moléculaire par séquençage PacBio du clone endémique mondial S.

capitis NRCS-A responsable de sepsis en réanimation néonatale : résistances, virulence

et avantage sélectif

P. Martins-Simões3-6-1

, Y. Dumont3-6

, M. Butin5-3-6

, H. Lemriss8, S. Lemriss

7, A. Ibrahimi

7, S.

El Kabbaj7, F. Vandenesch

2-6-1, J.P. Rasigade

6-1-4, F. Laurent

3-6-1

1Centre National de Référence des Staphylocoques

2Laboratoire de Bactériologie,

Groupement Hospitalier Est3Laboratoire de Bactériologie, Groupement Hospitalier

Nord 4Laboratoire de Bactériologie, Groupement Hospitalier Sud

5Service de Réanimation

Néonatale, Groupement Hospitalier Est, Hospices Civils de Lyon6Centre International de

Recherche en Infectiologie, Unité Inserm U1111, Université de Lyon, Lyon,

France7Département de Biosécurité PCL3, Laboratoire de Recherche et d’Analyses

Médicales de la Gendarmerie Royale (LRAM) 8Laboratoire de Biotechnologie Médicale,

École de Médecine et de Pharmacie, Université Mohammed V - Souissi, Rabat, Morocco

Le clone de Staphylococcus capitis NRCS-A a été décrit comme un pathogène nosocomial

majeur responsable de sepsis chez des nouveau-nés prématurés dans de nombreux pays du

monde. Les représentants de ce clone présentent un profil de multirésistance atypique incluant

une sensibilité diminuée à la vancomycine, antibiotique de première ligne pour le traitement

de ces sepsis néonataux. Objectif : explorer les caractéristiques génomiques de ce clone,

(résistance aux antibiotiques, facteurs de virulence et gènes spécifiques).

Le séquençage par SMRT (Single-Molecule Real-Time) de la souche prototype du clone

NRCS-A (CR01) a permis d’obtenir 2 séquences fermées, un chromosome et un plasmide.

Ces séquences ont été corrigées, annotées, puis comparées à i) 3 génomes assemblés de

souches du clone NRCS-A isolées en Australie, Belgique et Royaume-Uni, et séquencées par

pyroséquençage 454, ii) 6 génomes publiques de S. capitis n’appartenant pas au clone NRCS-

A.

Nous avons pu mettre en évidence au sein du clone NRCS-A : i) des gènes de résistance

(mecA, aacA-aphD, ...) associés à des éléments génétiques mobiles ou contenus dans le core-

genome, expliquant le profil de résistance de ce clone, ii) des facteurs de virulence dans le

core-genome comprenant des Phenol Soluble Modulins, des hémolysines, des protéines de la

paroi fixant le fibrinogène ou la fibronectine, et l'opéron ica, iii) la présence spécifique d’un

gène de résistance à la nisine (nsr), absent des génomes non-NRCS-A et de la plupart des

génomes de S. aureus et de staphylocoques à coagulase négative (SCN).

Nos résultats soulignent le rôle des éléments génétiques mobiles dans l'émergence du

phénotype multirésistant du clone NRCS-A, lui conférant un profil de résistance parfaitement

adapté à la pression de sélection existant en réanimation néonatale. Par ailleurs le gène de

résistance à la nisine, bactériocine "large-spectre" active sur de nombreuses bactéries à Gram

positif et sécrétée par les bactéries de la flore commensale digestive (Lactococcus,

entérocoques, BGN…), pourrait contribuer à un meilleur fitness au clone NRCS-A et lui

conférer un avantage sélectif au sein du microbiote des prématurés par rapport aux autres

souches de S. capitis et plus largement aux autres souches de SCN ne possédant pas ce gène.

Abstract Preview - Step 3/4- print version -

Topic: 34 Mobile genetic elements

Title: STAPHYLOCOCCUS CAPITIS NRCS-A: SCC, SCCMEC AND THEIR EVOLUTIONARYHISTORY

Author(s): P. Martins Simoes1,2, H. Lemriss3, J.-P. Rasigade1,2, S. Lemriss3, F. Vandenesch2, S. El Kabbaj3,

F. Laurent1,2

Institute(s): 1Laboratoire de Bactériologie - Hôpital de la Croix-Rousse, Hospices Civils de Lyon, 2CentreInternational de Recherche en Infectiologie (CIRI), INSERM U1111 - Centre National de Référence

des Staphylocoques, Lyon, France, 3Département de Biosécurité PCL3, Laboratoire de Rechercheet d'Analyses Médicales de la Fraternelle de la Gendarmerie Royale, Rabat, Morocco

Text: Background. We have recently shown that Staphylococcus capitis pulsotype NRCS-A is widelyspread worldwide as a cause of late-onset sepsis in intensive care neonates. NRCS-A strainsexhibit methicillin resistance, encoded by mecA gene harbored by a mobile genetic element, thestaphylococcal chromosome cassette mec (SCCmec).Objectives. To gain insights into the evolutionary history of NRCS-A strains, we characterized theSCCmec element of the prototype NRCS-A strain CR01.Methods. Whole-genome sequencing of strain CR01 was performed using 454 pyrosequencing.Available genome sequences of S. capitis and S. aureus strains were collected from the GenBankdatabase and aligned using software Mauve and the MaGe platform. Phylogeny of strain CR01 andof S. capitis strains QN1, SK14 and VCU116 was built using a 10-gene set derived from thestandard multi-locus sequence type approach.Results. Two contiguous SCC elements were found in strain CR01, one mecA-harboring 37kbSCCmec element and one 22,1kb pseudo-SCC element without mecA gene. The SCCmec elementcontained a CRISPR element and was closely related to type V SCCmec of livestock-associated S.aureus ST398, while the pseudo-SCC element was partially identical to those found in methicillin-susceptible S. capitis strains SK14 and VCU116. Phylogenetic analysis suggested the pseudo-SCCelement was first acquired by strains CR01, SK14 and VCU116, and the SCCmec element waslater acquired exclusively by strain CR01.Conclusions. We report the first description of SCC elements harbored by the clinically relevantNRCS-A/CR01 strain. This description could be used in future phylogeographical studies comparingNRCS-A strains.

Author Keywords: Staphylococcus capitis, NICU, SCCmec, CRISPR, evolutionary history

Conference: FEMS2013 - 5th Congress of European Microbiologists · Abstract: A-527-0034-03168 · Status: Draft

FEMS2013 - 5th Congress of European Microbiologists -... http://www.abstractserver.com/fems2013/absmgm/print...

1 of 1 02/18/2013 02:11 PM

Diffusion mondiale du clone Staphylococcus capitis NRCS-A en réanimation néonatale : caractérisation moléculaire, analyse génomique et histoire évolutive. M. Butin1-2, P. Martins Simões1-2, J.P. Rasigade1-2-3, S. Lemriss4, H. Lemriss4, S. El Kabbaj4, A. Ibrahimi4, S. Tigaud1, F. Vandenesch1-2-3, O. Claris1-3, J.C. Picaud1-3, F. Laurent1-2-3 1Hospices Civils de Lyon 2CIRI (Centre International de Recherche en Infectiologie), Inserm U1111, Lyon3Université Claude Bernard Lyon 1, Villeurbanne, France 4Laboratoire de Recherche et analyse clinique, Police Royale, Rabat, Maroc

Introduction : Staphylococcus capitis NRCS-A est un clone endémique impliqué dans les septicémies nosocomiales néonatales (SNN) à l’échelle mondiale. Ce clone multirésistant porte un déterminant de résistance à la méticilline (staphylococcal cassette chromosome mec, SCCmec) de type V. Nous avons exploré la phylogénie de ce clone chez plusieurs souches d’origines géographiques variées, caractérisé son élément SCCmec et précisé son histoire évolutive. Matériels et Méthodes : Douze souches NRCS-A isolées de SNN en Angleterre, Australie, Belgique et France, et 2 souches de S. capitis non-NRCS-A isolées d’adultes, ont été caractérisées par électrophorèse en champs pulsés (ECP) avec les enzymes SmaI et SacII. Un arbre phylogénétique a été construit sur la base des séquences de 7 gènes de ménage. Enfin, l’élément SCCmec de la souche prototype NRCS-A CR01 a été séquencé, caractérisé et comparé à ceux d’autres staphylocoques. Résultats : Les 12 souches NRCS-A appartenaient en ECP SmaI et SacIIà un unique pulsotype (>80% de similarité), différent de ceux des souches d’adultes. Sur 3020 pb séquencées sur 7 gènes de ménage, les souches NRCS-A présentaient au maximum 2 SNPs entre elles, contre 32 ou 33 par-rapport aux souches non-NRCS-A, et étaient regroupées sur un même clade. Le séquençage de l’élément SCCmec de la souche NRCS-A CR01 a révélé une structure composite originale comprenant i) une cassette SCCmec fortement homologue à celle des S. aureus résistants à la méticilline ST398, et portant de façon surprenante un élément CRISPR d’immunité adaptative ; et ii) une cassette SCC portant des gènes de résistance aux métaux lourds (SCCcad/ars/cop). La comparaison avec d’autres génomes de S. capitis a permis de proposer un schéma évolutif avec acquisition successive indépendante des 2 cassettes. Conclusion : La combinaison de plusieurs techniques de typage moléculaire a permis d’affirmer la diffusion internationale de S. capitis NRCS-A, présentant un caractère hautement clonal et portant un élément composite original SCCmec-SCCcad/ars/cop. L’analyse détaillée du génome de la souche prototype CR01 est en cours afin de mettre en évidence des facteurs de virulence pouvant expliquer la pathogénie particulière de ce clone et sa diffusion mondiale atypique.

Worldwide distribution of an endemic multi-resistant NRCS-A

Staphylococcus capitis clone in NICU: molecular typing, whole

genome analysis and evolutionary history

Martins Simões P #(a,b), Butin M (a,b), Lemriss H(c,d), Lemriss S(c),

Deighton MA(e), Kearns A(f), Denis O(g), Goering R (h), Ginevra C (a),

Picaud JC (i), Ibrahimi A (d), Vandenesch F (a), Rasigade J-P(a,b), Laurent

F(a,b)

(a) Centre International de Recherche en Infectiologie (CIRI) - INSERM

U1111, Lyon, France

(b) Centre National de Référence des Staphylocoques, Hôpital de la Croix-

Rousse, Hospices Civils de Lyon, Lyon, France

(c) Département de Biosécurité PCL3, Laboratoire de Recherche et

d'Analyses Médicales de la Fraternelle de la Gendarmerie Royale, Rabat,

Morocco

(d) Equipe de Recherche en Biotechnologie Médicale (MedBiotech), UPR de

#

Corresponding author: patrica.martins-simoes@inserm.fr

Pharmacologie & Toxicologie, Faculté de Médecine & Pharmacie, Université

Mohammed V Souissi, Rabat, Morocco.

(e) School of Applied Sciences, RMIT University, Bundoora, Victoria,

Australia

(f) Staphylococcus Reference Unit, Microbiology Services Colindale, Health

Protection Agency, London, UK

(g) Reference MRSA-Staphylococci Laboratory, Microbiology unit, Erasme

Hospital, Université Libre de Bruxelles, Brussels, Belgium

(h) Department of Medical Microbiology and Immunology, Creighton

University, Omaha, Nebraska, USA

(i) Department of Neonatology, Northern Hospital Group, Hospices Civils de

Lyon, Lyon, France

Objective: Staphylococcus capitis pulsotype NRCS-A is an emerging cause

of nosocomial bacteremia in French neonatal intensive care units (NICUs)

and showed to be multi-resistant (methicillin, aminoglycosides, vancomycin).

In order to investigate the worldwide distribution of NRCS-A clone, we

applied various molecular methods to study S. capitis isolates from several

countries.

Methods: Twelve NICU S. capitis isolates from neonates septicemia

(Australia, Belgium, France, United Kingdom, n=3 each) and 2 S. capitis

isolates from adult patients were analyzed using PFGE (SmaI and SacII),

SCCmec typing and dru-typing. A MLST-like analysis, based on 7 house-

keeping genes, was also performed. After whole-genome sequencing of one

of our clinical NRCS-A strains, we performed a phylogenetic analysis with

other publicly available S. capitis genomes to assess the evolutionary history

of SCC elements acquisition in S. capitis.

Results:All neonatal S. capitis (i) shared >80% similarity when characterized

by SmaI and SacII PFGE and were similar to NRCS-A pulsotype, (ii)

harbored a type V-related SCCmec element, (iii) exhibited the same dru-type

(dt11c), and (iv) formed a monophyletic group using the 7 house keeping

genes. The molecular profiles of both adult isolates differed from those of

NICU strains. Unexpectedly, a CRISPR region was found within the SCCmec

cassette and was detected by PCR, targeting the direct-repeats, in all NICUs

isolates and one adult patient isolate. Finally, sequencing of the SCCmec

element of one of the NICU isolates revealed the presence of a composite

element including a SCCmec cassette and a second SCC carrying genes

related to detoxification of heavy metals (SCCcad/ars). Phylogenetic analysis

of all the 4 available whole-genome sequenced S. capitis strains suggests that

the 2 SCC elements were acquired independently by the NRCS-A clone.

Conclusion: Our analysis demonstrates an unexpected worldwide

distribution of the S. capitis NRCS-A clonal population involved in neonatal

bacteremia. These results suggest that this multi-resistant clone is highly

successful in the specific environment of NICUs. This raises the questions of

the molecular mechanisms behind this success and the way of spreading of

this clonal population. Both questions are currently being addressed by

combining whole genome sequencing, phenotypic features and cellular

models.

Conclusions EOS in term infants is associated with significantlylower maternal and neonatal 25-OHD levels. We also found thatlevels of 25-OHD in neonates were positively correlated withthose in mothers. These data suggest that adequate vitamin Dsupplementation during pregnancy may be helpful to preventEOS in term neonates.

PS-222 STAPHYLOCOCCUS CAPITIS IN NEONATAL LATE-ONSETSEPSIS: UNEXPECTED WORLDWIDE DISSEMINATION OFAN ENDEMIC MULTI-RESISTANT CLONE

1M Butin, 2P Martins Simoes, 3H Lemriss, 3S Lemriss, 2F Vandenesch, 4O Claris, 4JC Picaud,1JP Rasigade, 1F Laurent. 1Clinical Microbiology, Hospices Civils de Lyon, Lyon, France;2U1111 - CIRI, Inserm, Lyon, France; 3Laboratoire de Recherche Et d’Analyses Médicales,Fraternelle de La Gendarmerie Royale, Rabbat, Morocco; 4NICU, Hospices Civils de Lyon,Lyon, France

10.1136/archdischild-2014-307384.521

Background Multi-resistant Staphylococcus capitis NRCS-A isinvolved in late-onset sepsis (LOS) in French NICUs.Aims To investigate the geographical distribution of NRCS-A,and to precise its susceptibility profile.Methods Twelve S. capitis isolates from distant NICUs (Aus-tralia, Belgium, France, United Kingdom, n = 3 each) and 2 S.capitis isolates from adult patients were analysed using PFGE,SCCmec typing, dru-typing, a MLST-like analysis, and antimicro-bial susceptibility testing. To explore impact of vancomycinselective pressure, after 15 daily subcultures with vancomycin,we determined vancomycin, daptomycin and linezolid minimalinhibitory concentrations (MICs).Results All NICU S. capitis (i) shared >80% similarity of PFGEprofile and were similar to NRCS-A profile, (ii) harboured atype V-related SCCmec element, (iii) exhibited the same dru-type, (iv) formed a monophyletic group, (v) harboured a sameantimicrobial susceptibility profile including aminoglycosides andmethicillin resistance, and vancomycin heteroresistance. Thesemolecular and antimicrobial susceptibility profiles differed fromthose of adult isolates. An increase of vancomycin and daptomy-cin (but not linezolid) MICs was observed, significantly faster(p < 0.05) for NRCS-A isolates than other tested strains.Conclusion Our analysis demonstrates an unexpected worldwidedistribution of S. capitis NRCS-A, specifically in NICUs.Recently, we collected complementary NICU isolates belongingto NRCS-A from Norway, Denmark, the Netherlands, USA, Bra-zil, New Zealand and Canada, confirming the worrisome dissem-ination of NRCS-A. Its multi-resistant profile and its ability torapidly adapt to vancomycin selective pressure, constitute aselective advantage to NRCS-A in NICUs, and raise the issue ofpotential therapeutic failure and the need for alternative antimi-crobial regimens.

Neonatology Clinical

PS-223 IMPROVING STAFF COMPETENCE AND CONFIDENCEFOR NEONATAL RESUSCIATION, A QUALITYIMPROVEMENT INITIATIVE

S Hackett, M Casssidy, S Gormally. Neonatal Intensive Care Unit, Our Lady of LourdesHosptial Drogheda Co. Louth, Drogheda, Ireland

10.1136/archdischild-2014-307384.522

Aims To introduce a Quality Improvement Initiative aimed atinstilling confidence and competence with Neonatal Resuscita-tion in Labour Ward (LW) and Neonatal Unit (NICU) staff.Methods A Neonatal Resuscitation Initiative Team (NRIT) con-sisted of LW and NICU midwives, an Advanced Nurse Practi-tioner (ANP) and a Paediatric Consultant. LW, NICU andpaediatric staff were invited to attend a presentation to outlinethe aims and methodology of the initiative. Emphasis was placedon teamwork with effective leadership and communication. Thiswas followed by a demonstration of 2 low fidelity simulatedneonatal resuscitations performed by the NRIT.

Midwifery and NICU staff were then invited to partake in aSimulated Team Response (STR) to 2 simulated resuscitations.

A random selection of participants completed a closed ques-tionnaire before and after the NRIT demonstration and beforeand after their STR. Levels of confidence in all aspects of neona-tal resuscitation, including teamwork and leadership skills wereevaluated using a Likert Scale.Results One hundred and thirteen staff participated in the qual-ity initiative from January 2013 to August 2013. Seventy fourstaff participated in the NRIT demonstrations and 39 in theSTR. Forty three questionnaires were completed following theNRIT and 13 following the STR. Using a Wilcoxon test the pre-post gain in confidence score was statistically significant (p =0.0020) for doctors and midwives.Conclusion Simulation training is a valuable means of maintain-ing skills and enhancing confidence for neonatal resuscitation.This study quantifies the positive impact of a Quality Improve-ment Initiative aimed at improving performance at neonatalresuscitation.

PS-224 VIDEO EDUCATION TO IMPROVE BAG MASKVENTILATION DURING SIMULATED NEWBORNRESUSCITATION

1P Deindl, 2J Schwindt, 2A Berger, 3G Schmoelzer. 1Department of Neonatology andPediatric Intensive Care Medicine, University Medical Center Hamburg-Eppendorf,Hamburg, Germany; 2Department of Pediatrics and Adolescent Medicine Division ofNeonatology Pediatric Intensive Care and Neuropediatrics, Medical University of Vienna,Vienna, Austria; 3Department of Pediatrics and Adolescent Medicine Division ofNeonatology Pediatric Intensive Care and Neuropediatrics, Royal Alexandra Hospital,Edmonton, Canada

10.1136/archdischild-2014-307384.523

Aim To evaluate if video based education could improve qualityof positive pressure ventilation (PPV) performed by novicehealth care providers during neonatal resuscitation.Methods Twenty-eight 4th year medical students were randomlypaired and instructed to give PPV to a modified manikin as sin-gle-person resuscitators, then as two-person paired resuscitatorsusing either an anatomical shaped neonatal face mask with anair cushion rim (IS) or a Laerdal round face mask (LM). Afterwatching a video-tutorial they randomly repeated each maskventilation performance. Airway pressure, gas flow, tidal volume,and mask leak were recorded. PPV performance quality was ana-lysed using video recording.Results Mask leak was lower during one-person ventilationwhen using IS (56 ± 16%) compared to LM (71 ± 19%). LMmask leak during one-person ventilation was significantly lowerwhen using the two point top hold in contrast to the ok rimhold (before training: 63 ± 22% vs. 72 ± 18%, after training:57 ± 17% vs. 77 ± 12%, respectively). Watching a video-tuto-rial improved correct head position (score: 1.4 ± 0.7 vs. 3.8 ±

Poster symposium

Arch Dis Child 2014;99(Suppl 2):A1–A620 A193

group.bmj.com on June 28, 2017 - Published by http://adc.bmj.com/Downloaded from

CloneDissemination Of An Endemic Multi-resistantLate-onset Sepsis: Unexpected Worldwide

Staphylococcus Capitis In Neonatal PS-222

Claris, JC Picaud, JP Rasigade and F LaurentM Butin, P Martins Simoes, H Lemriss, S Lemriss, F Vandenesch, O

doi: 10.1136/archdischild-2014-307384.5212014 99: A193 Arch Dis Child 

http://adc.bmj.com/content/99/Suppl_2/A193.1Updated information and services can be found at:

These include:

serviceEmail alerting

box at the top right corner of the online article. Receive free email alerts when new articles cite this article. Sign up in the

CollectionsTopic Articles on similar topics can be found in the following collections

(965)Drugs: infectious diseases (229)Neonatal intensive care

(388)Neonatal and paediatric intensive care

Notes

http://group.bmj.com/group/rights-licensing/permissionsTo request permissions go to:

http://journals.bmj.com/cgi/reprintformTo order reprints go to:

http://group.bmj.com/subscribe/To subscribe to BMJ go to:

group.bmj.com on June 28, 2017 - Published by http://adc.bmj.com/Downloaded from