Plant Molecular Biology 30: 1153-1168, 1996. © 1996 Kluwer Academic Publishers. Printed in Belgium. 1153

The expression pattern of alfalfa flavanone 3-hydroxylase promoter-gus fusion in Nicotiana benthamiana correlates with the presence of flavonoids detected in situ

B6n6dicte Charrier ~, Christine Leroux ~,3, Adam Kondorosi 1,2 and Pascal Ratet x,, l Institut des Sciences Vdgdtales, Centre National de la Recherche Scientifique, Avenue de la Terrasse, F-91198 Gif-sur-Yvette Cedex, France (*author for correspondence); 2Institute of Genetics, Biological Research Center, Hungarian Academy of Sciences, Szeged P.O. Box 521, H-6701 Hungary; 3 Present address: BSFT, Cirad For& 45 bis Avenue de la Belle Gabrible, F-94736 Nogent-sur Marne, France

Received 27 July 1995; accepted in revised form 27 December 1995

Key words: flavonoid detection, flowers, fluorescence, heterologous expression, stem, trichome

Abstract

Flavanone 3-hydroxylase is an enzyme acting in the central part of the flavonoid biosynthesis pathway. It is generally encoded by a single gene and seems to have a key position for the regulation in this pathway. These two features make a singlef3h promoter-gus fusion a suitable tool to study both the f3h expres- sion and the regulation of this pathway. We present here the spatial and temporal analysis of the ex- pression of an alfalfa flavanone 3-hydroxylase (f3h) promoter-gus fusion introduced into Nicotiana benthamiana. The Medicago sativa (alfalfa) f3h promoter directed gus expression in flowers, stems, leaves and roots. In flowers, GUS activity was observed in pollen grains, in ovules, in ovary placenta and in the epidermis, medullary parenchyma, trichomes and second cortical cellular layer surrounding the vascular bundles of the peduncle. In stems, GUS activity was detected at the same places as in the peduncle except for the medullary parenchyma. In roots, we found GUS staining in root hairs, epidermis and in the vascular bundles of the elongated zone. Finally, in leaves, the f3h promoter expressed essentially in the stalk cells of the multicellular trichomes. The expression pattern of the f3h-gus fusion was correlated to the presence of flavonoids in situ. These data indicate that this construct can be very useful to study factors controlling the production of flavonoids.

Introduction

Flavonoids are polyphenolic compounds that are synthesized in higher plants. They are precursors of the anthocyanins, responsible for the colour of different parts of the plant, like the petals and

seeds. As the flower or the seed colour is easily observable, the flavonoid biosynthesis pathway has extensively been studied as a genetic model system, particularly in petunia, snapdragon and maize [32]. Flavonoids play also roles as UV protectants [23, 25, 26, 29]. In leguminous plants,

The nucleotide sequence data reported will appear in the EMBL, GenBank and DDBJ Nucleotide Sequence Databases under the accession number X81812 (Msf3h2 gene).

1154

flavonoids act in addition as phytoalexins and symbiotic signal molecules (reviewed in [29, 34]). Despite their multiple roles in this plant family, the genetic regulation of their production is still poorly understood [21]. Their recently demon- strated requirement for the fertility in maize and petunia [8, 31, 45 ] is a clue in favour of additional roles other than those played in coloration, UV protection and stress responses.

More than 35 structural or regulatory genes participating in the flavonoid biosynthesis path- way have already been described (for a review, see [46]). The expression of several structural genes of this pathway (Fig. 1) has been studied at the transcriptional level by northern blot analysis and in some cases by using fusions of these gene

3x malonyl CoA /

,/

IF8 isoflavone

I I

pterocarpans

I coumestans ' ~

phenylalanine

~ PAL

cinnamate

4-eoumarate

~ 4CL

4-ooumaroyl CoA \ / '

CH$

chalcone

~ CHI

FS flavanone --~. flavone

FLS dihydroflavonol ~ flavonol

~ DFR

leueoanthocyanindin

I T

anthocyanin

\

lignin synthesis

suberin synthesis

Fig. 1. Phenylpropanoid biosynthesis pathway. PAL, phenyl- alanine ammonia-lyase; C4H, cinnamate 4-hydroxylase; 4CL, 4-coumarate-CoA ligase; CH S, chalcone synthase; CHI, chal- cone isomerase; F3H, flavanone 3-hydroxylase; DFR, dihy- droflavonol 4-reductase. FS, flavone synthase; IFS, isofla- vone synthase; FLS, flavonol synthase. The dashed arrows indicate that a part of the biosynthesis pathway requires sev- eral enzymatic steps.

promoters to the gus reporter gene. Such fusions have been reported for phenylalanine ammonia- lyase (pal [2, 24, 40]), chalcone synthase (chs [20, 39]), chalcone isomerase (chi [47]) and dihy- droflavonol 4-reductase (dfr [17]). These genes often belong to gene families and the pattern of expression of one member is generally different from other members and does not reflect the over- all expression pattern of the gene family. There- fore the study of one such fusion is generally not sufficient to study the different factors controlling flavonoid production.

Flavanone 3-hydroxylase (F3H, EC 1.14.11.9, Fig. 1) has a key position in the biosynthetic path- way. This enzyme acts in the middle part of the pathway (Fig. 1) and is involved in the synthesis of anthocyanins and of flavonols, the latter prod- ucts being required for fertility in maize and pe- tunia [31, 44, 45]. F3H has been shown to be coded by a single gene, as demonstrated by ge- netic analysis in snapdragon [13] or by molecu- lar analysis in petunia [5], maize [10] and Medi- cago sativa (alfalfa) [7]. The expression pattern of the f3h gene has been analysed so far only by northern blot in flowers of snapdragon [18, 28], barley [30] and in different organs in maize, where its expression correlates to the presence of an- thocyanins and flavonols [10]. In addition, we have recently demonstrated that the alfalfa f3h gene was also expressed in roots and nodules of alfalfa [7], where the role of this enzyme is still unknown.

In petunia and snapdragon the early and the late steps of the flavonoid biosynthetic pathway are differently regulated [21 ]. Interestingly, in pe- tunia the f3h gene belongs to the early genes, but in snapdragon to the late genes. In maize the entire pathway is co-regulated in tissues produc- ing anthocyanins, but the f3h gene is the only gene of the pathway whose expression is coordinated with flavonol accumulation in anthers [10]. Therefore, because on the one hand F3H has a key position in the flavonoid pathway, and on the other hand it is encoded by a single gene, the expression analysis of a single f3h promoter-gus fusion may reveal the complete expression pat- tern of the f3h gene in the plant and provide clues

on the factors controlling this pathway. The pur- pose of the work presented here was to analyse the expression pattern of the f3h-gus fusion and to correlate it to flavonoid production.

To elucidate the spatial and temporal expres- sion of the F3H encoding gene, we have con- structed an alfalfa f3h promoter-gus fusion and studied its expression in Nicotiana benthamiana. N. benthamiana provides a combination of inter- esting features for the expression analysis of the f3h promoter-gus fusion: (1) this plant belongs to the Solanaceae family, as do Nicotiana tabacum and Petunia hybrida, allowing us to easily com- pare our data with those previously reported for other genes of the pathway; (2) N. benthamiana is able to flower in 8 weeks, in contrast to N. tabacum which requires at least 5 months, which is par- ticularly convenient for analysing gene expression in flowers; (3)N. benthamiana has a convenient morphology: the large size of the flowers and the trichomes is particularly suitable to study gene expression at the cellular level.

We show here that in N. benthamiana the Msf3h2 promoter directs gus expression in flow- ers, as already described for other genes of this pathway [18]. Gus expression was also detected in leaves, stems and at a much lower level in roots; in these latter organs and tissues the role of flavonoids is largely unknown. The pattern of gus expression was correlated to the presence of the endogenous N. benthamiana F3H mRNA as well as to the presence of flavonoids in situ, dem- onstrating thereby the accurate expression and regulation of the alfalfa f3h promoter in the het- erologous plant N. benthamiana. Thus the pro- moter region isolated and characterized here con- tains all the elements necessary for proper expression of the f3h gene allowing future stud- ies on factors controlling flavonol and anthocya- nin production in the plant.

Materials and methods

Msf3h2 characterization and sequencing

A Medicago sativa ssp. sativa cv. Nagyszenasi ge- nomic library was screened as previously de-

1155

scribed [7]. The Msf3h2 gene present in the 27A EMBL-4 clone [7] was subcloned in plasmid pBluescript (pB S, Stratagene), and sequenced on both strands by the dideoxy termination method [38]. Sequence analysis and comparisons utilized programs of the GCG software package (Genet- ics Computer Group, Madison, WI).

Plant transformation, regeneration and culture

The binary vector pF(7)G (Results) containing the Msf3h2 promoter-gus fusion was mobilized from Escherichia coli to Agrobacterium tumefaciens LBA4404 by triparental mating using E. coli HB101 containing the helper plasmid pRK2013 [12]. The transconjugants were selected on Yeb agar (5 g/I Bacto beef extract, 5 g/l Bactopeptone, 1 g/l Bacto yeast extract, 240 mg/1 MgSO4, 5 g/l sucrose, pH 7.4) by rifampicine (100 mg/1) and kanamycine (100 mg/1) selection. The presence and the integrity of the chimaeric gene fusion was verified by analysis of the restriction fragments of the pF(7)G DNA [37].

N. benthamiana is a diploid Solanaceae plant found in Australia (illustrated in [19]). Axenic N. benthamiana leaf discs were infected for 30 s with transconjugant LBA4404 strain [3] contain- ing the plasmid pF(7)G, then put on medium I (Murashige and Skoog salts, [Sigma, M5519], 30g/1 sucrose pH5.8, 0.9)'0 agar, 0.1mg/1 naphthalene-acetic acid [NAA], 1 mg/l benzy- lamino purine [BAP]) for 2 days. The leaf discs were then transfered on medium II (medium I plus 70 mg/1 kanamycin and 500 mg/1 cefotaxime) once every 10 days until the development of buds. The buds were then transfered on medium III (medium II without NAA and BAP) for root de- velopment and growth. After 6 weeks, the in vitro plantlets were transfered to vermiculite and grown in a 24 °C greenhouse, and were regularly wa- tered with a nutritive solution [4]. The flowers developed in the in vitro culture conditions and in the greenhouse culture conditions were largely photoperiod-independent (data not shown).

Mature flowers, leaves, stems, roots and seeds of plants grown in the greenhouse were harvested

1156

and frozen in liquid nitrogen. Before freezing, the roots were washed with mineralized water. The seeds were harvested from several ovaries.

Genomic DNA analysis

Genomic DNA was isolated according to Del- laporta et al. [ 11]. After enzymatic restriction, 15 #g DNA were subjected to electrophoresis through a 0.7~o agarose gel and transfered to Hybond TM-N (Amersham) nylon membranes by capillary blotting according to the manufac- turer's protocol. Hybridizations were done suc- cessively with a GUS probe and a NPTII probe in 5 x SSPE, 0.1~o SDS at 65 °C overnight and washed in 0.1 x SSPE, 0.1~o SDS at 65 °C for 30 rnin [37]. The membranes were then exposed to an autoradiography film.

Reverse transcription and polymerase chain reaction (RT-PCR)

Total RNA was extracted from the frozen organs (see above) by the guanidine thiocyanate-CsC1 purification method according to S ambrook et al. [37], and quantified spectrophotometrically.

Multiple transcript analysis by RT-PCR was performed according to modified protocols of Sambrook etal. [37]. Total RNA (2#g) were reverse transcribed for 1.5 h at 37 °C by 50 units MMLV H-superscript reverse transcriptase (Gibco-BRL) in a 30 gl reaction mixture contain- ing 100 pmol oligo-pdT12_ls, buffer xl (Gibco- BRL), 10 mM DTT, 0.8 mM dNTP and 14.4 units RNAguard (Pharmacia).

Equal amounts ofcDNAs (in general one tenth of the reaction mix) were used for amplification in 50 #1 of the corresponding buffer (Appligene), complemented with 0.12 mM dNTP, 150 pmol of the required 5' and 3' primers, 10 pmol EF prim- ers (see below) and 0.5 units of Taq polymerase (Appligene). Amplification was performed during 25 cycles of 1 rain denaturation at 92 ° C, 1 min primer annealing at 50 °C and 1 rain elongation at 72 °C. After 25 cycles the amplification rate was in a linear range for all PCR products (data not shown).

To amplify the F3H products, we used de- generate primers corresponding to positions 2071-2087 and 2565-5277 of the Msf3h2 gene (GenBank accession number X81812) whose se- quences are 5'-GC(TA)TG(CT)GA(GA)GAA- TGGGG-3' overlapping exon 1 of the Msf3h2 gene and 5'-GGTTT(GA)TC(TA)GGCCA(CT)- CT-3' overlapping exon 2 of the Msf3h2 gene. The expected PCR product for the Msf3h2 cDNA was 263 bp long.

Degenerate primers corresponding to positions 1447-1466 and 2083-2102 of the Arabidopsis thaliana EF-I~ A1 gene ([1], Genbank acces- sion number X16430) were used also to amplify the EF products; their sequences are 5'- GA(CT)TT(CT)AT(CT)AAGAA(CT)ATG- AT-3' and 5'-TG(GA)TGCAT(CT)TC(AT)A- C(AT)GA(CT)TT-3'. The size of the expected PCR product is around 560 bp long.

We noted that in N. benthamiana, the sizes of the genomic amplified products were bigger than the size of the cDNA amplificated products, for both the F3H and EF products. Thus, the puta- tive presence of introns between the position of the primers in the N. benthamiana genome allowed us to discriminate between cDNA amplification and genomic amplification. EF amplification served as controls for cDNA synthesis and PCR efficiency in the different tissue samples. In order to avoid an out-titration of the F3H PCR frag- ments by highly abundant control PCR products, the concentration of the control primers used was one tenth of the F3H primers. Such a competition effect was described by Murphy et al. [33]. The products of the PCR experiments were subjected to electrophoresis through a 2~o agarose gel and transfered as described in Sambrook et aL [37]. Hybridization was performed using specific N. benthamiana F3H and EF probes obtained by RT-PCR amplification from N. benthamiana flower cDNA.

Fluorometric assay for G US activity

Flowers, leaves, stem, roots and seeds were har- vested as previously described above. The analy-

sis was repeated on 5 samples for each tissue as following: 5 flowers and 5 leaves of the same plant, the pool of seeds was separated in 5 samples, the stem and roots of the plant were cut in 5 equal parts and analysed separately. Samples were ground in 50 mM sodium phosphate buffer pH 7, 10 mM EDTA, 10 mM 2-mercaptoethanol, 0.1~/o Sarcosyl and 1~o polyclar AT to prevent oxidation of the polyphenolic compounds present in the flowers. Supernatants were assayed fluori- metrically for GUS activity by measuring the en- zyme kinetics (Fluoroskan II Biosystems) at 37 °C for 1 h, using 1 mM 4-methylumbelliferyl glucuronide as substrate and 50 mM sodium phosphate buffer pH 7, 10 mM EDTA, 10 mM 2-mercaptoethanol as reaction buffer. The protein concentrations in the extracts were measured by the method of Bradford (BioRad).

GUS histochemical staining

Material was harvested from plants grown in the greenhouse. The tissues were incubated at 37 °C overnight in 50 mM sodium phosphate buffer pH7, l m M EDTA, 0.1~/o SDS and l m M 5-bromo-4-chloro-3-indolyl glucuronide (X-Glue; Extrasynthese). In order to prevent the endog- enous GUS-like activity present in N. benthami- ana flowers, 20~o methanol is added to the incu- bation buffer as described by Kosugi et al. [22]. Intact tissues or 80 to 100 gm sections were then cleared in 75 ~o ethanol before observation.

Detection of flavonoids by histofluorescence

In order to specifically detect flavonoids, the 80 to 100/~m sections ofN. benthamiana tissue were immersed for at least 48 h in 5 % aluminium chlo- ride (AICI~) in ethanol (aluminium chloride re- agent [15]). The A1C13 extinguishes the fluores- cence of polyphenolic compounds other than flavonoids. The fluorescence was observed using an epi-illumination microscope (Polyvar, Re- ichert) with one set of filters: 340-380nm excitation/430 nm suppression for sections

1157

treated with the aluminium chloride reagent. Con- trois were done with sections incubated for the same time in absolute ethanol. In this case, a high level of fluorescence was observed all over the tissues. Similar results were obtained using an- other flavonoid-specific reagent (diphenylborinic acid, ethanolamine ester, Aldrich).

Results

We have isolated two copies of the f3h gene from the allotetraploid M. sativa: Msf3hl (accession number X78994 [7]) and Msf3h2 (accession number X81812). The promoter of each gene was fused to the gus reporter gene and introduced into N. benthamiana. As the Msf3hl promoter-gus fusion was not functional (data not shown), we present here only the characterization of the Msf3h2 gene.

Molecular characterization of Msf3h2 gene

The location of the promoter region and the cod- ing sequence of the Msf3h2 gene have been de- termined by comparing them with the F3H cDNA sequences isolated from other plants [5, 6, 9, 28, 30, 41]. The transcribed region contains 3 exons separated by two introns of 244bp and 815 bp, respectively, and codes for a putative protein of 358 amino acids, sharing 98.8~/o identity with the previously described MsF3H1 amino acid se- quence ([7], data not shown). Thus, the organi- zations of the coding region of the two genes are almost identical. The promoter region of the Msf3h2 gene (Fig. 2) shares 97 ~ sequence iden- tity with the corresponding Msf3hl region. Msf3h2 displays a 177 bp insertion, starting at position - 1 1 5 7 upstream from the start codon and a 193bp deletion between position -538 and - 537. This promoter region contains several re- peated sequences, including three 14 bp long AT- rich repeats located at positions -665, -635 and -611, respectively, and multiple TG repeats lo- cated between - 1084 and - 1038 upstream from the start codon. Sequences showing different

1158

- 1 8 8 1

- 1 8 3 1

- 1 7 8 1

- 1 7 3 1

- 1 6 8 1

- 1 6 3 1

- 1581

- 1531 - 1482

- 1431

- 1381

- 1331

- 1281 - 1231 - i181

- 1131

- 1081

- 1031

981

931

881

831 781 731

681

631

581

531

481

431 381

331 281 231 181

131

81

31

GAATTCATAAATGTTATTGATTCAAGAATATTAGAACAACCCAGAATTTT

TTTCAAGATGTTTATTGGATTGAGAGTGAAATTAAACCATAAAAATATAA ATTTGCATGAAAAGAGAGAATTTTTTTTTTACTGACTTGAAAGTGGAATG

*******

GTGTTGGTGAGAGTTGTTGTGGATGATGGGGTTTCCATTGAAAGTGATTG ACGATTGAGAAATAGAAAAAAGTAGAAAGCTTTGTATGAATTTTGCAGAG ATAAAAAAGATTGAATAGAGAATAATGAAAAGAAGTGAAGAAGGTGAAAG

*******

TATATATATAGAGTTTATAGAATGAATGTAACCGTTGGTGAATGCGCGTT *******

TCCCAATATGGAAGGAGCCGTTGGTTTTGAATTGGGTCTTTTCTTTGGGC TATTTGGCCCATTATTGGTTTCGAGAAAATGGGCCATAGAAGTGCATGCC TAAGGTCTCGTGGGGATTGCTTGTTAGACGCCTAACAATTGCTCACATAC

*****

AACTCAAATTTTCGAAAATACCTGTGCCGATAATTAACTATCATTCACCA *

ATGAACGGGAGTTAACTACCGTTCAGTGCAGGAGTCACCCTTTGTTGGTA *******

AGTGACTTCAAATGCTGCAAGCCAATGACCAACCATGATCCCTACATTGA ATGAATTTAACTCTTGTTCAGTAGTGAACGGTAGTTAACTATTGTCGGAG ATAACCCATTTGGGTTGGCTTAGTGGTATTGACGGGAAATACTTCAGTGA

******

CTTAGCTTAGGTGCCATTGGTGCCATTGGAGAAATCCTGGCCGTTGATGT ** *****

GTGTGAATGTGTGTGGGAATGTGT~TGTGATGTGTGTGTGTGTGGTGGAG *******

ATGTAATGGTATGGTGACATTGGTGCCATTAATGGCACCAAAGTGGTTCC

CGGTATTGACTTGAGATTTGGGAGTGTGCTCCTCCTTGAGGTCTCAGGTT

CGATTCTCTCTAGTGTCAATTTAGGTGGGCTAATTTAGCTTCTTCAAAAA

CTATTGTTGGAGATATTTTTGGATATTTGAGGTGGTTGTGAGCGATTGCT * * * * *

AGGTGTCTAAAGAAATTTTTTGGGTCTTGTTATTCTTTGTACGTCTAAAG CAATTGAAATTAGATCTTTTAAAGAGATAGTAGCATAAAAATTCATTAGT TACATATATGTATGAAAAAAATTGATAGGTCAACATTTAGAAGGTTTTAA ATCATAACGTTCTATCAAAATTATTTTAATTTTTTTTGAAGAGATCAAAA TTATTTTAATGTATAGCCCTAAAATTATTTTAATGGCATAGCGTGTATTC ******

AAACCTAGGCCGACTTACACACTTACACTCTCTCTACAAAGCAAAACAAA * * * * * * * *****

AATTAGTCGCTAGCCTCAGGTTTTTCCACAAACATTTAATACCTTATATT ***** *

GATTTTAAAGGACTTAAATACTCTTTTATGATCTTAAGTTAGCATAATGA CAAATATGATGTGATTTTTTTTTTATGAACAATGATAATGTGATATTATC CAGTTAAGATTACTCAATACTTTGTACATTTTAAAACTAATAAATACAAA

***** *

GATATTCACCTCAAAAAAATAAAGATTGCGAAAAATGATAAACTTTACTT TATCTAGTTTTAGTACAAATCTACATTGATATTTGCCTTTGCCCCAAAAA AGGAAACATATCACTATCTATAAATAGTTACTGGATTTGTGGTAAAGGGA AACATCTTATAATCCATTCATTCATTACATACTTTCATCCTCTTATTACA

*** *** ******

AAAAAAACACAACATGCATGCTATCTTCCATTCCCGAACCAATTAATCCA *** **** ** .

TCATCATATTTCGATTTATACACAAAACCACAATATAAATAAGAGGAACA

AACAT AACAAATTAAACAACATATAATACTAAT G

+1

Fig. 2. Nucleotide sequence of the Msf3h2 promoter and po- sition of the putative P boxes. The sequence of the promoter of the Msf3h2 gene is shown from the EcoRI site ( -1881) to the start codon ( + 1, indicated in bold letters). The repeated sequences are underlined. The sequences sharing homology with the consensus P box described in Slabowski et aL [36] are indicated by an asterisk over each homologous nucleotide.

levels of identity (75 ~o or 87 ~o) to the 8 bp P-box (A/C A C C T/A A A/C C), the consensus bind- ing site for myb-mediated gene activation [36] found in several genes of the flavonoid biosyn- thesis pathway, are present in the Msf3h2 pro- moter sequence (Fig. 2).

Construction of the alfalfa f3h promoter-gus fusion

In order to remove the 5' coding region of Msf3h2, the EcoRI-EcoRI Msf3h2 subclone (see Fig. 3) containing the promoter and the 5' part of the coding region was digested by NsiI (present in the promoter) and ClaI (present in the polylinker of the vector pBS, Stratagene), submitted to a T4 D N A polymerase-blunting treatment and reli- gated. The resulting 1.8 kb EcoRI-KpnI restric- tion fragment, containing only the promoter re- gion of Msf3h2, was introduced in between the EcoRI and KpnI restriction sites of the plasmid pLP100 [43], to form the plasmid pF(7)G (Fig. 3). Plasmid pLP100 is a derivative of plas- mid pLP17 [42] and carries a T-DNA contain- ing a selectable NPTII gene and a multicloning site upstream from the uidA (gus) coding se- quence.

Generation of transgenic N. benthamiana plants expressing the alfalfa f3h promoter-gus fusion

The alfalfa f3h promoter-gus fusion was intro- duced into N. benthamiana plants as described in Materials and methods. Out of 15 plants that

I k b

EooRI Ndl EcoRI Clal Kpnl

Msf3h2 ;,S subclone

- 1882. -111 .1.1 +275

RB LB T-DNA • _m v l / i ! I ~ n

f rom p L P I O 0 MC$

Fig. 3. Construction of the binary vector pF(7)G containing the chimaeric Msf3h2 promoter-gus fusion. Black box: f3h EcoRI-EcoRl subclone. The nucleotide position of the rel- evant restriction sites is referred to the + I position of the start codon. Thin line: multicloning sites region of pBS. The re- striction sites present in the pB S subclone are indicated. White box: T-DNA present in the pLP100 vector. RB, right border; LB, left border. MCS, multicloning sites region.

were regenerated on selective medium, 12 ex- pressed the gus gene in the flowers. Seven regen- erated plants were analysed by genomic Southern blot for the presence of the T-DNA. Digestion of genomic DNA by HindlII and SstI generated an internal restriction fragment of 3.5 kb of the transferred DNA, containing the gus gene and the major part of the Msf3h2 promoter, and a restric- tion fragment of variable size, bigger than 2.7 kb and carrying the nptlI gene and a segment of the adjacent N. benthamiana genome (Fig. 4). The DNA was subjected to electrophoresis, blotted and hybridized successively using the GUS and NPTII probes. Two independent, regenerated, untransformed N. benthamiana plants were used as negative controls (data not shown). The GUS probe hybridized specifically (Fig. 4) to the inter- nal 3.5 kb restriction fragment in 6 lanes corre- sponding to 6 of the 7 analysed plants, demon- strating the integrity of the HindlII-SstI fragment carrying the f3h promoter-gus fusion in these plants (Fig. 4). In contrast, the NPTII probe hy- bridized specifically to several restriction frag-

Fig. 4. Genomic Southern blot analysis of N. benthamiana plants. The restriction map of the pF(7)G T-DNA is shown. The positions of the right border (RB), left border (LB), NPTII and GUS encoding genes and Msf3h2 promoter (pF3H) are indicated. The NPTII and GU S probes used for hybridization are represented by a black thin line below the corresponding gene. The corresponding genomic Southern blots are shown below each probe. The size in kilobases of size markers is indicated by an arrow on the side of the Southern blots. C, non-untransformed control plant; 1 to 7, regenerated trans- formed plants.

1159

ments of variable size and bigger than 2.7 kb, as expected. Plant 5 did not contain gus sequence whereas the nptlI sequences were present: it probably resulted from incomplete or rearranged T-DNA integration. The data demonstrate that each of the 7 plants are independent transfor- mants, allowing us to exclude the influence of a common N. benthamiana genomic sequence adja- cent to the site of T-DNA integration on the tissue-specific expression of the f3h promoter-gus fusion.

The six plants containing the complete gus se- quence expressed the fusion at different levels but with the same pattern. In further experiments, plants 2, 6 and 7 were analysed in detail and data on the plant 6 are presented below. A similar pattern of expression was found in the progeny of the plant 6 (data not shown).

Determination of the GUS activity by fluorometric assays

The values of GUS activity, measured in non- transgenic plants (3 plants) or in transformed plants not expressing the gus gene (2 plants), were close to zero in all the tested organs except for the roots. Flowers, leaves, stems, roots and seeds of the selected transgenic plant 6 expressing the gus gene were assayed fluorometrically for GUS ac- tivity as described in Materials and methods (Fig. 5a). In contrast to the results obtained in roots, seeds, flowers and leaves, the values cor- responding to the stem for a single plant exhibited a high degree of variation, as shown by the value of the standard deviation (Fig. 5a). This variation may result from the heterogeneity of the stem samples containing bases of sectioned petioles or peduncles at each nodal zone of the stem, that may contribute to the GUS activity, normally low in the internodal zones. The strongest expression levels of the f3h promoter-gus fusion were de- tected in seeds and white flowers (Fig. 5a), in agreement with previous studies on the expres- sion of the f3h gene in snapdragon flowers [ 18, 28]. The low level of expression detected in roots of N. benthamiana showed good correlation with that of the f3h gene in roots of alfalfa [7].

1160

Fig. 5. a. Analysis of the transcriptional activity of the Msf3h2 promoter in N. benthamiana organs. The GU S activity in plant organs, reflecting the transcriptional activity of the Msf3h2 promoter cloned in the plasmid pF(7)G, was measured fluo- rimetrically. The values are given in units of fluorescence per minute per ng protein. The average of the values of the con- trol plants was removed from the values of the transformed plant. Standard deviation is indicated for each value, b. Analy- sis of the endogenous F3H mRNA level in N. benthamiana organs. The endogenous F3H mRNA level was measured using the RT-PCR method (see Materials and methods). F, flowers; L, leaves; S, stem; R, roots; EF, EF cDNA amplifi- cation; F3H, F3H cDNA amplification.

Determination of the endogenous F3H mRNA level by R T-PCR assays in wild-type N. benthamiana plants

We found that the alfalfa f3h promoter directed gus expression in leaves and stems at levels com- parable to those detected in white flowers. As f3h expression has never been reported in these or- gans, we decided to analyse the steady-state level of the endogenous F3H mRNA in leaves and stems of non-transgenic N. benthamiana plants. The endogenous N. benthamiana F3H transcripts were not detectable in the total RNA by using the

northern blot method in conjunction with a probe derived from the Msf3h2 gene (data not shown). Therefore, we used the RT-PCR technique to measure the level of the F3H mRNA in flowers, leaves, stems and roots. The elongation factor EF-17 (EF) amplification was used as a control for the cDNA amount incorporated as template [27]. The results are presented in Fig. 5b. We noted that the levels of the F3H mRNA in N. benthamiana flowers and roots were propor- tional to the levels of GUS activity (Fig. 5a) de- tected in these two organs, respectively. In roots, F3H mRNA was undetected, indicating that f3h was either not expressed or weakly expressed in this organ, whereas in flowers, the N. benthami- ana F3H mRNA was abundant, as observed in other plants [18]. In leaves and stems, the N. benthamiana F3H mRNA was detected at levels comparable to that of flowers confirming the fluorimetric assays of GUS activity in these two organs.

In situ localization of the G US activity from the f3h-gus fusion correlates with in situ flavonoid localization

In order to determine the tissue-specific expres- sion of thef3h-gus fusion, the GUS activity was localized in flowers, leaves, stems, petioles, and roots, on the whole organ and/or on 80 to 100 #m sections using histochemical techniques. GUS staining was never observed in non-transformed plants or transformed plants that do not express gus in the organs and tissues tested, except for the stamen. In this latter case, the addition of 20~o methanol in the reaction buffer (Materials and methods) abolished the endogenous GUS-like activity. In some cell types, the pattern of GUS activity directed by the alfalfa f3h promoter was different to that previously reported for other genes of the flavonoid biosynthesis pathway (see below). Therefore the presence of endogenous fla- vonoids, which are subtrates and products of F3H, was tested in these tissues by a histofluo- rescence method using A1C13 (see Materials and methods).

GU S activity was detected in brown-pigmented N. benthamiana seeds as shown on Fig. 6a and b. The brown pigment is indicative of the presence of anthocyanins, which are essentially ubiquitous in plant seeds (reviewed in [ 14, 29]). Therefore in this case, it was not necessary to use the fluores- cence method.

In flowers, GUS activity was detected in the stamens, ovaries and sepals. No staining was ob- served in petals, correlating with the absence of anthocyanins in N. benthamiana white flowers (not shown). Dissection of the stamen showed that only the pollen grains were stained (Fig. 6c and d). The intensity of the GUS staining was constant during pollen grain development. The yellow-green fluorescence of the pollen grains in- cubated in the A1C13 reagent confirmed the pres- ence of flavonoids in this tissue (Fig. 6e). Dissec- tion of the ovaries revealed that several tissues expressed the f3h-gus fusion: the ovules (Fig. 6f) were stained depending either on their develop- mental stage and or on their presumably variable genotypes (number of T-DNA copies carried by the genome after meiosis and fertilization). In the later stage of ovule development, the blue stain- ing was more intense (not shown). The ovary placenta displayed GUS staining of the cells in contact with the ovules, and in a network prob- ably corresponding to vascular tissue (not shown). In the sepals, GUS activity was detected in trichomes (not shown), as observed in leaves (see below). Finally, the peduncle displayed a blue staining which was particularly intense at the junction with the placenta (not shown). A trans- versal section of a blue stained peduncle is shown on Fig. 6g; the pattern of staining was very similar to that of the stems (Fig. 6g). In the peduncles (Fig. 6g), like in the stems (Fig. 6h), GUS activ- ity was detected in the epidermis, in the cortical cellular layer surrounding the vascular tissues and in the protoxylem. However, in the protoxylem tissue the blue staining was not located in the cytosol as in the other tissues but in the wall of the lignified dead ceils. In order to rule out ex- perimental artefacts, we repeated the staining after dissection of the stem separating the cortex from the central cylinder. The staining of the pro-

1161

toxylem cells was no longer detectable, demon- strating that the blue staining observed in the wall of the protoxylem cells of a non-dissected stem was an artefact, probably resulting from diffusion of the product of the GUS reaction in our experi- mental conditions. In the peduncle, the GUS ac- tivity was also detectable in the medullary paren- chyma. Fig. 6i shows that flavonoids are present in N. benthamiana stems, in a specific way, in comparison with an ethanol incubation (Fig. 6j). The f3h promoter-mediated GUS activity corre- lated well with the localization of the yellow-green fluorescence characteristic of flavonoids in this organ. The epidermis and the cortical cellular layer exhibited yellow-green fluorescence both in the stem (Fig. 6i) and the peduncle (not shown). Flavonoids were also detected in the medullary parenchyma of the peduncle (not shown).

GUS activity was detected in N. benthamiana leaves, albeit only in certain cell types: some of the big multi-cellular trichomes were stained mainly in the stalk cells (Fig. 6k). Histofluores- cence with AIC13 revealed a strong yellow-green fluorescence in the stalk cells of the trichome (Fig. 61), characteristic of the presence of fla- vonoids. This pattern was also observed for the big trichomes present on the surface of the sepals (not shown). The smaller trichomes, generally composed of only one thin stalk cell and one glandular cell and present on the surface of the leaves, the sepals, the stem and the peduncle (Fig. 6g), expressed the f3h promoter-gus fusion both in the stalk and glandular cells (Fig. 6g). GUS activity was particularly strong in the stem trichomes where the yellow-green fluorescence, indicating the presence of flavonoids, was also demonstrated (Fig. 6m).

In mature axenic roots, we could detect GUS activity all over the mature zone of the roots and in the root hairs (Fig. 6n). Staining was also ob- served in the meristematic region of some roots (not shown). Moreover, the GUS activity was mainly located in the epidermis and in the vas- cular tissues (not shown). The presence of fla- vonoids in these cell types was confirmed by the histofluorescence technique (Fig. 60).

1162

1163

Discussion

Expression of the Msf3h2 promoter-gus fusion is properly controlled in the heterologous host N. benthamiana

We have studied the expression of the alfalfa f3h promoter-gus fusion in the heterologous host plant N. benthamiana because of the rapidity of regen- eration and flowering of this plant (2 months). To validate the results obtained with the gus reporter gene, we showed that the expression of this fusion was properly controlled in N. benthamiana. The endogenous F3H mRNA levels detected by the RT-PCR technique in flowers, stems, leaves and roots, correlated with the level of GUS activity measured in these organs. Moreover, at the cel- lular level, the specificity of expression of the alfalfa f3h-gus fusion correlated well with the presence of flavonoids, indicating that in N. benthamiana tissues, expression of the alfalfa f3h promoter-gus fusion was properly regulated.

At the organ level, the expression pattern of the Msf3h2-gus fusion did not always correlate with

that observed in alfalfa where no F3H mRNA was detected in leaves [7]. Different plant species produce a different range of flavonoids that can be used as markers for taxonomic studies [16, 49]. In addition, the alfalfa Cultivar used in the previous study contains few trichomes on the leaves, in contrast to N. benthamiana. Therefore, the content and range of flavonoids in the leaves of these two genera (Nicotiana and Medicago) be- longing to two taxonomically distant families (Solanaceae and Leguminoseae, respectively) may be different and the expression off3h may be required only in N. benthamiana.

Comparison of the f3h-gus expression pattern with previously reported gus expression patterns directed by pal, chs, chi and dfr gene promoters

In order to see whether the expression pattern described here is consistent with those previously observed using promoter-gus fusions of other genes involved in the flavonoid biosynthesis path- way (pal, chs, chi and dfr), we compared the re-

Fig. 6. In situ localization of GUS activity and flavonoids presence in different organs of N. benthamiana, a. Wild type seeds of N. benthamiana showing the presence of anthocyanins in mature seeds. Bar scale: 1 mm. b. X-Gluc stained seeds ofN. benthamiana expressing the f3h-gus fusion. Bar scale: 1 ram. c. X-Gluc-stained stamen from a f3h-gus transformant showing GUS activity only in pollen grains, a, anther wall. Bar scale: 0.5 mm. d. X-gluc-stained section of a stamen from af3h-gus transformant showing GUS activity only in pollen grains, a, anther wall. Bar scale: 0.5 mm. e. Histofluorescence offlavonoids present in wild-type pollen grains treated with A1C13. Bar scale: 50 ~tm. f. X-Gluc stained ovary of f3h-gus transformant showing the variation of GUS activity in ovules in relation to their maturation stage. Bar scale: 0.5 mm. g. 80 #m transversal section of a X-Gluc stained peduncle from a f3h-gus transformant showing GU S activity in the medullary parenchyma, in a cortical cellular layer near to the vascular bundle, in epidermis and in the trichomes. This stem section contains few big trichomes (on the right upper side) and numerous small trichomes (on the right lower side) expressing all GUS activity. Bar scale: 0.2 mm. h. 80 #m transversal section of a X-Gluc stained stem from a f3h-gus transformant showing GUS activity in a cortical cellular layer (CCL) near to the vascular bundle (V), in epidermis (E) and in the trichomes (T). The presence of blue-staining in the xylem cells (X) wall was found to be an artefact (see the text). Bar scale: 0.2 ram. i. Histofluorescence of flavonoids present in an A1C13-treated 80 #m transverse section of a wild-type stem. The yellow-green fluorescence characteristic of flavonoids is seen in the cortical cellular layer (CCL), in the epidermis (E) and in the trichomes (T). The blue fluorescence of the vascular tissues is due to the presence of lignin in the xylem cell wall (X). Bar scale: 0.2 mm. j, Histofluorescence present in an absolute ethanol treated 80/~m transverse section of a wild-type stem. A fluorescence is seen overall the section. Bar scale: 0.2 ram. k. X-Gluc stained multicellular leaftrichome from af3h-gus transformant showing GUS activity in the stalk cells. Bar scale: 0.2 ram. 1. Yellow-green histofluorescence of flavonoids present in the stalk cells of a big leaf wild-type trichome treated with AICI 3. Bar scale: 0.2 mm. m. Yellow-green histofluorescence of flavonoids present in the glandular cell and the stalk cells of small leaf trichomes from wild-type plants treated with AIC13. Bar scale: 50 #m. n. X-Gluc stained root of a f3h-gus transformant showing GUS activity only in the mature zone of the root. Bar scale: 1 mm. o. Histofluo- rescence of flavonoids present in a AIC13-treated 100 #m transversal section of wild-type N. bentharniana roots. The yellow-green fluorescence is seen in the vascular bundles as indicated by the arrows. The blue fluorescence is due to the presence of other types of phenolic compounds. Bar scale: 0.6 ram.

1164

-~&~

~ 4- 4- ~

4- ~ ~ 4- , ~

9 - 4 - 4 - ~ ~Z~

4- + ~ 4'-

+ 4 - + 4- + +

o ~

A

r~

4- +

+ 4-

+ 4-

+ ¢Z

+ +

ported data with ours. In Table 1 we summarize the analysis of gus gene expression, directed by pal, chs, chi and dfr promoters isolated from dif- ferent species, in tissues where we observed f3h- gus expression. In the flavonoid biosynthesis pathway, the PAL, CHS and CHI enzymes act upstream from F3H (Fig. 1) and therefore their genes should be expressed at least at the same sites as the f3h gene. On the same basis, the f3h should be expressed at least at the same sites as the dfr gene.

In N. benthamiana flowers, the alfalfa f3h- promoter-gus fusion was expressed in the pollen grains and ovules. The expression of pal, chs, chi and f3h in pollen grains and ovary (Table 1) is required for the synthesis of flavonols [10, 20, 47], that are necessary for the fertility of this plant [31, 44, 45]. The expression off3h in pollen grains and ovules is in agreement with this hypothesis since F3H participates in the synthesis of fla- vonols (see Fig. 1). Moreover, in maize, F3H was recently shown to play a central role in the syn- thesis of these compounds [ 10]. However, in pe- tunia ovules and pollen grains (Table 1), dfr ex- pression was not assigned to any function [ 17]. Thus, we cannot exclude the possibility that other compounds resulting from the expression of these genes (from pal to dfr) might play a role in these organs, in addition to the reported role of fla- vonols in plant fertility. The f3h gene was not expressed in N. benthamiana petals, in contrast to the pal, chs, chi and dfr genes in petunia, probably because the N. benthamiana petals are colourless and therefore do not require the expression of genes involved in anthocyanin biosynthesis. The petunia chs and dfr genes were expressed in pe- tunia peduncles, like the alfalfa f3h promoter-gus fusion gene in N. benthamiana (Table 1). The ex- pression of the f3h-gus fusion in N. benthamiana peduncle will be discussed below with data ob- tained for the stem. In summary, the expression pattern of the alfalfa f3h promoter-gus fusion in N. benthamiana flowers is in agreement with data observed for other genes of the flavonoid biosyn- thesis pathway.

In roots, the f3h promoter-gus fusion was ex- pressed in the elongating zone, root hairs, vascu-

1165

lar bundles and epidermis. While some similarity with the expression pattern of pal and chs (Table 1) is observed, no data are available in the literature on the spatial expression of the chi ofdfr genes in roots. Thus, in this organ comparison of the expression patterns of the different fusions is problematic. We have previously shown that f3h is expressed in alfalfa roots and nodules [7]. Ex- pression studies of the Msf3h-gus fusion in alfalfa, combined with the chemical analysis of phenolic compounds present in the roots, may help us elu- cidate the role of F3H in the roots.

In the stem, as in the peduncle, the f3h promoter-gus fusion was expressed in the epider- mis and in the cortical cellular layer surrounding the vascular tissues. In the peduncle, expression was also detected in the medullary parenchyma. The bean gpal2 and gpal3 promoters also directed GUS activity to the epidermis of the stem. In addition, the gpal3 promoter-gus fusion was ex- pressed in what was called 'endodermis' probably corresponding to the cortical layer described in this paper, and in the medullary parenchyma of the tobacco stem (Table 1). In petunia, the chi-gus fusion was also expressed in the stem (Table 1), but cellular localization was not reported in this plant. Thus, the alfalfa f3h promoter-gus fusion is expressed in N. benthamiana stems at the same sites as the bean gpal2 and gpal3 promoter-gus fusion in tobacco, except for the vascular tissues (Table 1). As suggested before [2, 40], the pres- ence of F3H and PAL in the epidermis of the stem could be explained by the requirement of anthocyanins and UV protectants in these tis- sues. Contrary to PAL, the presence of F3H in the cortical cellular layer and in the medullary parenchyma of the peduncle cannot be related to the synthesis of suberin because F3H is not in- volved in the synthesis of this compound (see Fig. 1).

Interestingly, the alfalfa f3h promoter-gus fusion was expressed in the trichomes of N. benthamiana leaves, sepals, peduncles and stems. In the small and simple trichomes of the stems and peduncles, f3h expression seems to be ho- mogenous. In contrast, in leaves and sepals, the fusion was expressed only in the stalk cells of the

1166

few multicellular trichomes. In both cases, the expression correlated with the presence of fla- vonoids. For the other genes studied, the expres- sion pattern differs with the plant used for the transformation (Table 1), indicating that the ex- pression pattern of flavonoid biosynthesis genes in trichomes depends on the plant investigated. Together these results suggest that flavonoids are present in trichomes, either in the glandular cells (tobacco, petunia and N. benthamiana) and/or in the stalk cells (tobacco and N. benthamiana). In- deed, flavone aglycones were found in the glan- dular cells of the leaf trichomes of Helianthus an- nuus [35] and of Mentha piperita [48]. The synthesis of flavonoids requires the activity of en- zymes like PAL and DFR. Shufflebottom et al. [40] have suggested that gpal3 expression in to- bacco trichome stalk cells (Table i) is required for lignin or suberin synthesis (Fig. 1). However F3H, produced in the stalk cells of the N. benthamiana trichomes, is not involved in the syn- thesis of these compounds and may rather be involved in the synthesis of flavonoids that could be transported from the stalk ceils to the glan- dular cells as hypothesized by Rieseberg et al. [ 35 ]. However, fluorescence characteristic of fla- vonoids was not detected in the glandular cells of the big N. benthamiana trichomes. Moreover, no fluorescent gradient was observed along the stalk cells to the glandular cell, indicating that the transport of flavonoids from the stalk cells to the glandular cell is unlikely. Thus, at the cellular level, the F3H expression is correlated with the presence of the flavonoids.

In summary we have shown that f3h gene ex- pression measured by the use of a f3h promoter- gus fusion, correlates with the presence of fla- vonoids detected in situ, and these data are largely consistent with the expression pattern of other genes of the flavonoid pathway. At the same time, we note that the expression of the Msf3h-gus fu- sion in the medullary parenchyma of the peduncle, in one of the cortical cellular layers surrounding the vascular bundles of the stem, and in the stalk cells of the big trichomes cannot be explained by functions already assigned to the flavonoids. The discovery of the requirement of flavonol com-

pounds for the fertility of petunia and maize erased the consideration that flavonoids were only secondary optional compounds in plants. Thus, we can speculate that flavonoids may play still unknown functions in the tissues identified above.

Regulation of the Msf3h2 promoter

Several regulatory genes possibly controlling the expression of the structural genes of the flavonoid biosynthesis pathway have been characterized (for a review, see [46]). In maize seeds and other organs, the Myb-like proteins C1 and P1 have been shown to control the synthesis of anthocya- nins (reviewed in [46]). In snapdragon, the Myb- 305 protein is thought to be able to activate the expression of several genes of the flavonoid path- way [36]. The comparison of the promoter se- quences of these genes [36] defined a consensus sequence, the P box, which may be the target site for the Myb proteins. The Msf3h2 promoter re- gion used to construct the gus fusion does not contain a perfect P box, although it directs gus expression in an accurate way, demonstrating that this promoter is able to respond to the N. benthamiana regulatory machinery in the same way as the endogenous N. benthamiana f3h pro- moter does. However, in the promoter of the Msf3h2 gene, several sequences sharing between 75 to 87 ~o nucleotide identity with this consensus P box (Fig. 2) were found. A detailed deletion analysis of the Msf3h2 promoter region will be necessary to determine the sequences required for the expression of the Msf3h2 gene in the different cell types described here.

Acknowledgements

We thank Chantal David for providing N. benthamiana wild-type plants and advice for plant transformation, Herv6 Vaucheret for his help and advice about the GUS fluorimetric assays and Val6rie Vaudequin-Dransart for her help in the tissue-section analysis. C.B. was supported by a grant of the French Minist6re de la Recherche et de l'Espace.

References

1. Axelos M, Bardet C, Liboz T, Thai ALV, Curie C, Lescure B: the gene family encoding the Arabidopsis thaliana trans- lation elongation factor EF<t: molecular cloning, charac- terization and expression. Mol Gen Genet 219:106-112 (1989).

2. Bevan MW, Shufflebottom D, Edwards K, Jefferson R, Schuch W: Tissue- and cell-specific activity of a phenyl- alanine ammonia-lyase promoter in transgenic plants. EMBO J 8 :1899-1906 (1989).

3. Bevan MW: Binary Agrobacterium vectors for plant trans- formation. Nucl Acids Res 12:8711-8712 (1984).

4. Blondon F: Contribution ~ l'ttude du developpement de gramintes fourragtres: ray-grass et dactyle. Rev Gen Bot 71:293-381 (1964).

5. Britsch L, Ruhnau-Brich L, Forkmann G: Molecular cloning, sequence analysis, and in vitro expression of flavanone-3 fl-hydroxylase from Petunia hybrida. J Biol Chem 267:5380-5387 (1992).

6. Britsch L, Dedio J, Saedler H, Forkmann G: Molecular characterization of flavanone 3fl-hydroxylases: consen- sus sequence, comparison with related enzymes and the role of conserved histidine residues. Eur J Biochem 217: 745-754 (1993).

7. Charrier B, Coronado C, Kondorosi A, Ratet P: Molecu- lar characterization and expression of alfalfa (Medicago sativa L.) flavanone 3-hydroxylase and dihydrolflavonol 4-reductase encoding genes. Plant Mol Biol 29:773-786 (1995).

8. Coe EH, McCormick SM, Modena SA: White pollen in maize. J Hered 72:318-320 (1981).

9. Davis K: A cDNA clone for flavanone-3-hydroxylase from Malus. Plant Physiol 103:291 (1993).

10. Deboo BG, Albertsen MC, Taylor LP: Flavanone 3-hydroxylase transcripts and flavonol accumulation are temporally coordinated in maize anthers. Plant J 7: 703- 713 (1995).

11. Dellaporta SL, Wood J, Hicks JB: A plant DNA mini- preparation: Version II. Plant Mol Biol Rep 1:19-21 (1983).

12. Ditta G, Stanfield S, Corbin D, Helinski DR: Broad host range DNA cloning system for gram-negative bacteria: Construction of gene bank of Rhizobium meliloti. Proc Natl Acad Sci USA 77:7347-7351 (1980).

13. Forkmann G, Stotz G: Genetic control of flavanone 3-hydroxylase activity and flavonoid 3'-hydroxylase ac- tivity in Antirrhinum majus (snapdragon). Z Naturforsch 36:411-416 (1981).

14. Harborne JB, Grayer ILl: The anthocyanins. In: Har- borne J (ed) The Flavonoids: Advances in Research Since 1980, pp. 1-20. New York/London (1988).

15. Hariri EB, Salle G, Andary C: Involvement offlavonoids in the resistance of two poplar cultivars to mistletoe (Vis- cure album L.). Protoplasma 162:20-26 (1991).

16. Hegnauer R, Grayer-Barkmeijer ILl: Relevance of seed

1167

polysaccharides and flavonoids for the classification of the Leguminosae: a chemotaxonomic approach. Phy- tochemistry 34 (1): 3-16 (1993).

17. Huits HSM, Gerats AGM, Kreike MM, Mol JNM, Koes RE: Genetic control of dibydroflavonol 4-reductase gene expression in Petunia hybrida. Plant J 6:295-310 (1994).

18. Jackson D, Roberts K, Martin C: Temporal and spatial control of expression of anthocyanin biosynthetic genes in developing flowers ofAntirrhinum majus. Plant J 2: 425- 434 (1992).

19. Illustrated Book of the Genus Nicotiana, pp. 206-207. Japan Tobacco Inc, Plant Breeding and Genetic Research Laboratory (1990).

20. Koes RE, van Blokland R, Quattrocchio F, van Tunen AJ, Mol JNM: Chalcone synthase promoters in petunia are active in pigmented and unpigmented cell types. Plant Cell 2:379-392 (1990).

21. Koes RE, Quattrocchio F, Mol JNM: The flavonoid bio- synthetic pathway in plants: function and evolution. BioEssays 16:123-132 (1993).

22. Kosugi S, Ohashi Y, Nakajima K, Arai Y: An improved assay for fl-glucuronidase in transformed cells: methanol almost completely suppresses a putative endogenous fl-glucuronidase activity. Plant Sci 70:133-140 (1990).

23. Li J, Ou-Lee TM, Raba R, Amundson RG, Last RL: Arabidopsis flavonoid mutants are hypersensitive to UV-B irradiation. Plant Cell 5:171-179 (1993).

24. Liang X, Dron M, Schmid J, Dixon RA, Lamb CJ: De- velopmental and environmental regulation of a phenyl- alanine ammonia-lyase-fl-glucuronidase gene fusion in transgenic tobacco plants, Proc Natl Acad Sci USA 86: 9284-9288 (1989).

25. Lois R: Accumulation of UV-absorbing flavonoids in- duced by UV-B radiation inArabidopsis thaliana L. Planta 194:498-503 (1994).

26. Lois R, Buchanan BB: Severe sensitivity to ultraviolet radiation in an Arabidopsis mutant deficient in flavonoid accumulation. Planta 194:504-509 (1994),

27. Mahe A, Grisvard J, Dron M: Fungal- and plant-specific gene markers to follow the bean anthracnose infection process and normalize a bean chitinase mRNA induc- tion. Mol Plant-Microbe Interact 5:242-248 (1992).

28. Martin C, Prescott A, Mackay S, Bartlett J, Vrijlandt E: Control of anthocyanin biosynthesis in flowers of Anti- rrhinum majus. Plant J 1:37-49 (1991).

29. McClure JW: Physiology and functions of flavonoids. In: Harborne JB, Mabry H (eds) The Flavonoids, pp. 990- 1055. New York/San Francisco, (1975).

30. Meldgaard M: Expression of chalcone synthase, difiy- droflavonol reductase, and flavanone-3-hydroxylase in mutants of barley deficient in anthocyanin and proantho- cyanidin biosynthesis. Theor Appl Genet 83:695-706 (1992).

31. Mo Y, Nagel C, Taylor LP: Biochemical complementa- tion of chalcone synthase mutants defines a role for fla-

1168

vonols in functional pollen. Proc Natl Acad Sci USA 89: 7213-7217 (1992).

32. Mol JNM, Stuitje AR, van der Krol A: Genetic manipu- lation of floral pigmentation genes. Plant Mol Biol 13: 287-294 (1989).

33. Murphy LD, Herzog CE, Rudick JB, Fojo AT, Bates SE: Use of the polymerase chain reaction in the quantitation ofmdr-1 gene expression. Biochemistry 29:10351-10356 (1990).

34. Peters NK, Verma DPS: Phenolic compounds as regu- lators of gene expression in plant-microbe interactions. Mol Plant-Microbe Interact 3:4-8 (1990).

35. Rieseberg LH, Soltis DE, Arnold D: Variation and localization of flavonoid aglycones in Helianthus annuus (Compositae). Am J Bot 74:224-233 (1987).

36. Sablowski RWM, Moyano E, Culianez-Macia FA, Schuch W, Bevan M: A flower-specific Myb protein ac- tivates transcription of phenylpropanoid biosynthetic genes. EMBO J 13:128-137 (1994).

37. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A Laboratory Manual. Cold Spring Harbor New York Press, Cold Spring Harbor, NY (1989).

38. Sanger F, Nicklen S, Coulson AR: DNA sequencing with chain terminating inhibitors. Proc Natl Acad Sci USA 74: 5463-5477 (1977).

39. Schmid J, Doerner PW, Clouse SD, Dixon RA, Lamb CJ: Developmental and environmental regulation of a bean chalcone synthase promoter in transgenic tobacco. Plant Cell 2:619-631 (1990).

40. Shufflebottom D, Edwards K, Schuch W, Bevan M: tran- scription of two members of a gene family encoding phenylalanine ammonia-lyase leads to remarkably differ- ent cell specificities and induction patterns. Plant J 3: 835-845 (1993).

41. Sparvoli F, Martin C, Scienza A, Gavazzi G, Tonelli C: Cloning and molecular analysis of structural genes in- volved in flavonoid and stilbene biosynthesis in grape (Vitis vinifera L.). Plant Mol Biol 24:743-755 (1994).

42. Szabados L, Ratet P, Grunenberg B, de Bruijn F: Func- tional analysis of the Sesbania rostrata leghemoglobin glb3 gene 5'-upstream region in transgenic Lotus corniculatus and Nicotiana tabacum plants. Plant Cell 2:973-986 (1990).

43. Szabados L, Charrier B, Kondorosi A, de Bruijn F, Rater P: New plant promoter and enhancer testing vectors. Mol Breed 1:419-423 (1995).

44. Taylor LP, Jorgensen R: Conditional male fertility in chalcone synthase-deficient petunia. J Hered 83:11-17 (1992).

45. van der Meer IM, Stam ME, van Tunen AJ, Mol JNM: Antisense inhibition of flavonoid biosynthesis in petunia anthers results in male sterility. Plant Cell 4:253-262 (1992).

46. van der Meer IM, Stuitje AR, Mol JNM: Regulation of general phenylpropanoid and flavonoid gene expression. In: Control of Plant Gene Expression, pp. 125-155. CRC Press, Boca Raton, FL (1993).

47. van Tunen AJ, Mur LA, Brouns GS, Rienstra JD, Koes RE, Mol JNM: Pollen- and anther-specific chi promoters from petunia: tandem promoter regulation of the chiA gene. Plant Cell 2:393-401 (1990).

48. Voirin B, Bayet C, Colson M: Demonstration that flavone aglycones accumulate in the peltate glands of Mentha × piperita leaves. Phytochemistry 34:85-87 (1993).

49. Williams CA, Richardson J, Greenham J, Eagles J: cor- relations between leaf flavonoids, taxonomy and plant geography in the genus Disporum. Phytochemistry 34: 197-203 (1993).