targeting of macrophages and hepatic stellate cells for the ...

TARGETING OF MACROPHAGES AND HEPATIC STELLATE CELLS FOR THE TREATMENT OF LIVER DISEASES

Dhadhang Wahyu Kurniawan

TARGETING OF MACROPHAGES AND HEPATIC STELLATE CELLS FOR THE TREATMENT OF LIVER DISEASES

DISSERTATION

to obtain the degree of doctor at the University of Twente,

on the authority of the Rector Magnificus, Prof. Dr. Ir. A. Veldkamp,

on account of the decision of the graduation committee, to be publicly defended

on Wednesday the 11th of May 2022 at 16.45 hours

by

DHADHANG WAHYU KURNIAWAN

Born on the 21st of March 1979

in Lamongan, Indonesia

This thesis has been approved by:

Promotors: Prof. Dr. Jai Prakash, University of Twente

Prof. Dr. Gert Storm, University of Twente

Co-promotor: Dr. Ruchi Bansal, University of Twente

Cover design: Arfin Deri Listiandi Printed by: Ipskampp printing Lay-out: Dhadhang Wahyu Kurniawan ISBN: 978-90-365-5344-5 DOI: 10.3990/1.9789036553445

© 2022 Dhadhang Wahyu Kurniawan, The Netherlands. All rights reserved. No parts of this thesis may be reproduced, stored in a retrieval system or transmitted in any form or by any means without permission of the author. Alle rechten voorbehouden. Niets uit deze uitgave mag worden vermenigvuldigd, in enige vorm of op enige wijze, zonder voorafgaande schriftelijke toestemming van de auteur.

Graduation Committee

Chairman: Prof. Dr. J.L. Herek University of Twente, The Netherlands

Supervisors: Prof. Dr. Gert Storm University of Twente, The Netherlands

Prof. Dr. Jai Prakash University of Twente, The Netherlands

Co-supervisor: Dr. Ruchi Bansal University of Twente, The Netherlands

Committee Members: Prof. Dr. H.B.J. Karperien University of Twente, The Netherlands

Prof. Dr. A. Kocer University of Twente, The Netherlands

Prof. Dr. K. Poelstra University of Groningen, The Netherlands

Prof. Dr. P. Olinga University of Groningen, The Netherlands

Prof. Dr. R. Weiskirchen RWTH Aachen University, Germany

The work in this thesis have been performed at the Department of Advanced Organ Bioengineering and Therapeutics (AOT), formerly known as Biomaterials Science and Technology (BST), University of Twente, The Netherlands.

The research in this thesis was financially supported by the Indonesia Endowment Fund for Education (Lembaga Pengelola Dana Pendidikan, LPDP Indonesia, grant no. 20151022024584) and the Netherlands Organization for Health Research and Development (ZonMW, NWO)-funded VENI innovation grant 916.151.94 (awarded to Dr. Ruchi Bansal).

The printing of this thesis was financially supported by the Department of Advanced Organ Bioengineering and Therapeutics, Faculty of Science and Technology, University of Twente, The Netherlands.

Paranymphs:

Iqbal Yulizar Mukti

Ahmed Mohamed Ramadan Hamza Mostafa

Dedicated to my wife, my sons, my parents, my family, friends, and colleagues

TABLE OF CONTENTS

CHAPTER 1 9 General Introduction, Aim and Outline

CHAPTER 2 23 Role of Spleen Tyrosine Kinase in Liver Diseases

CHAPTER 3 49 Therapeutic Inhibition of Spleen Tyrosine Kinase in Inflammatory Macrophages using PLGA nanoparticles for the Treatment of Non-alcoholic Steatohepatitis

CHAPTER 4 81 Src Kinase as a Potential Therapeutic Target in Non-alcoholic and Alcoholic Steatohepatitis

CHAPTER 5 123 Fibroblast growth factor 2 (FGF2) conjugated superparamagnetic iron oxide nanoparticles (SPIONs) ameliorate hepatic stellate cells activation in vitro and acute liver injury in mice

CHAPTER 6 157 Summary

APPENDIX 164

A: Nederlandse Samenvatting

B: Ringkasan Bahasa Indonesia

C: List of Publications

D: Acknowledgements

E: About the Author

9

Chapter 1

General Introduction, Aim and Outline

10

1.1 Introduction

The liver is a vital organ in our body that plays a key role in metabolism and blood

detoxification. Disruption or failure of these functions can result in drastic and lethal

consequences. In general, liver damage can be categorized into different stages, the diagnosis,

treatability, and eventual patient survival is dependent on the stage. The first stage of liver

disease is known as hepatitis (liver inflammation). If this condition is diagnosed early and

treated successfully, the inflammation may vanish. But, if the inflammation continues over a

longer period or upon repeated injury, it can lead to the scarring of the liver (fibrosis) that

eventually leads to chronic liver diseases such as cirrhosis (end-stage liver disease) and

hepatocellular carcinoma (HCC, primary liver cancer) [1, 2] (Figure 1). Liver fibrosis represents

the final pathological pathway irrespective of the etiology.

Figure 1. The illustration of pathogenesis of liver diseases, including the etiologies and the types of liver damage. The etiologies of liver diseases are unhealthy lifestyle, overconsumption of alcohol, and viral hepatitis. Created with www.biorender.com. The etiologies of liver diseases are non-alcoholic fatty liver disease (NAFLD, due to metabolic

disorders and unhealthy lifestyle), alcohol-associated liver disease (ALD, due to excessive

intake of alcohol), viral hepatitis (HBV/HCV, due to hepatitis B/C viral infections), drug-induced

liver injury (DILI, due to drug abuse), primary biliary cholangitis (PBC) or primary sclerosing

cholangitis (PSC) (due to auto-immune disorders) and hemochromatosis or Wilson’s disease

11

(due to genetic factors) etc [3-5]. Among other liver diseases, ALD and NAFLD are the most

common etiologies of chronic liver disease worldwide [6].

Over the past decades, hepatologists have made significant progress in disease understanding,

monitoring and disease management. However, two main challenges remain unresolved, i.e.,

(i) noninvasive, precise and early diagnosis (or disease staging), and (ii) effective treatment of

chronic liver diseases [7]. Currently, the only available treatment for the end-stage liver

diseases is liver transplantation; however, the feasibility of transplantation is limited due to a

lack of sufficient donor organs, and risks and complications associated with liver

transplantation, including transplant rejection, bleeding, infections and long-term use of

immunosuppressants [8]. Other treatments that mainly focus on removing the underlying

cause (e.g., a reduction of alcohol consumption in ALD or healthy diet, exercise and weight

loss in NAFLD that can slow the progression or even reverse early stage fibrosis [9]) are,

however, insufficient for chronic liver disease. Therefore, there is a need to develop effective

and safe therapies (preferably integrated with proper diagnosis, theranostics) for the

treatment of liver diseases.

Below we briefly elaborate on different (etiological) liver diseases:

Liver fibrosis

In chronic liver diseases, fibrosis is the result of an initial wound-healing response of the liver

to a repeated injury, which is associated with the secretion of inflammatory cytokines and

chemokines (produced by inflammatory immune cells, particularly macrophages), and an

excessive deposition of extracellular matrix (ECM) (produced by activated hepatic stellate

cells, HSCs or myofibroblasts). In the normal liver, ECM is a highly dynamic matrix with a

precisely regulated balance between synthesis and degradation. If the hepatic injury persists,

this regulation and ultimately liver regeneration fails and hepatocytes are substituted with

abundant ECM, including fibrillar collagen [10-12].

HSCs or myofibroblasts are the key source of excess ECM including collagen types I and III as

well as other proteins expressed in pathological fibrous tissues [11]. In particular, the

activation and transdifferentiation of quiescent HSCs into an activated myofibroblast-like

phenotype is the key pathogenic event in liver fibrosis characterized by an increased

expression of α-smooth muscle actin (α-SMA), a characteristic HSC activation marker, as well

12

as a large variety of proteins forming the connective tissue [13, 14]. The activation of HSCs is

mainly triggered by a multitude of profibrogenic and promitogenic mediators which are

released from injured liver cells (hepatocytes and sinusoidal endothelial cells) and from

(infiltrating) immune cells. Among these factors, transforming growth factor-β (TGF-β) and

platelet-derived growth factor (PDGF) are the key profibrogenic mediators [15]. Activation of

HSCs includes discrete phenotypic transformation characterized by the loss of retinoids,

increased proliferation, contractility and migration, and aberrant ECM secretion and

decreased matrix degradation, amongst other factors [14, 16].

Chronic liver diseases

Chronic liver disease (CLD) or end-stage liver disease, resulting from different etiologies as

mentioned above, is the leading cause of mortality worldwide [17]. CLD encompasses a large

number of conditions that have different etiologies and exist on a continuum between

hepatitis and cirrhosis [18, 19]. Liver cirrhosis is the result of a chronic inflammation and

fibrosis that can eventually lead to distortion of liver architecture, loss of liver function and,

as a result, end-stage liver failure [20-23]. The major complications associated with cirrhosis

includes ascites, spontaneous bacterial peritonitis, hepatic encephalopathy, portal

hypertension, variceal bleeding, and hepatorenal syndrome [24].

Non-alcoholic fatty liver disease (NAFLD)

As mentioned above, NAFLD represents one of the most common causes for chronic liver

disease worldwide and is one of the leading causes of liver-related mortality [25, 26]. NAFLD

is a disorder characterized by excessive accumulation of fat (in the form of triglycerides) in

hepatocytes (>5% fat content in the liver) [27, 28], and includes a spectrum of diseases ranging

from simple steatosis, steatohepatitis, to fibrosis and irreversible cirrhosis that may further

progress to HCC [29].

NAFLD is a continuously growing problem around the globe often accompanied with

increasing number of metabolic disorders including obesity, dyslipidemia, hypertension, and

type 2 diabetes mellitus (T2DM) [30-32]. Around 40-45 million adults in the United States are

diagnosed with NAFLD, which is directly associated with the high prevalence of obesity [26]

and steatosis present in 70% of T2DM patients [33]. In most NAFLD patients, the initial

symptoms start with lipid accumulation (steatosis), which is influenced by obesity and insulin

13

resistance (diabetes). Progression to steatohepatitis and fibrosis depends on other factors

such as free fatty acids (FFAs), inflammation, oxidative stress, and mitochondrial dysfunction

in a complex interplay with genetic predisposition [29, 34-36].

Non-alcoholic steatohepatitis (NASH) is considered to be the progressive/severe form of

NAFLD [27, 37] and is a leading cause of chronic liver disease worldwide [38, 39]. It is

associated with liver cancer even in the absence of overt liver cirrhosis. Studies suggest that

the incidence of NASH-associated HCC will increase over time and will become one of the

major etiology (together with alcoholic liver disease (ALD)) for HCC in the future [38, 40].

The pathogenesis of NASH and its progression to fibrosis is very complex and involves multiple

mechanisms (multiple hit hypothesis) [37, 41]. Excessive FFAs in the liver are the major driving

forces for steatosis. Steatosis is associated with oxidative stress and endoplasmic reticulum

stress that leads to hepatocyte injury and apoptosis. Prolonged and unrepaired cell injuries

promote inflammation involving Kupffer cells and infiltrating immune cells, and stimulate

fibrogenesis driven by HSCs [42-44].

Alcoholic liver disease (ALD)

As in NAFLD, ALD also varies from simple steatosis to alcohol-associated steatohepatitis (ASH)

that leads to fibrosis with or without cirrhosis and eventually HCC may develop [45, 46]. A

pivotal component in the progression of ALD is the direct toxicity of the first metabolite of

alcohol degradation i.e., acetaldehyde [47]. The universal therapy of ALD patients is prolonged

alcohol abstinence, regardless of the disease stage. However, most patients are diagnosed at

advanced stages of the disease, which leads to higher rates of complications and mortality

[48]. As the only established therapies include nutritional support and corticosteroids, it is

urgent to develop effective therapies based on the understanding of the pathophysiology of

ALD [49, 50].

1.2 Aim of the thesis

Hepatic macrophages and HSCs are main pathogenic drivers that are involved in the initiation

and development of liver inflammation, fibrosis, cirrhosis and hepatocarcinogenesis.

Consequently, hepatic macrophages and HSCs are the promising targets for therapeutics for

the treatment of liver diseases [51]. This thesis aims to identify novel approaches and potential

14

therapeutics to attenuate the inflammation and progression of liver fibrosis by

(mechanistic/molecular) targeting hepatic macrophages and HSCs.

1.3 Outline of the thesis

In this thesis, we developed different approaches to modulate macrophages and HSCs for the

treatment of liver diseases.

Macrophages are important cells of the innate immune system that have crucial roles in many

inflammatory diseases, either acute or chronic. Hepatic macrophages comprise of Kupffer cells

and infiltrating (bone marrow-derived) monocytes/macrophages [52]. During liver injury,

Kupffer cells rapidly respond to the injury by producing cytokines and chemokines, including

interleukin-1β (IL-1β), tumor necrosis factor α (TNF-α), C-C motif chemokine ligand 2 (CCL2),

and C-C motif chemokine ligand 5 (CCL5), resulting in the recruitment of other immune cells,

such as monocytes [53]. In response to exogenous or endogenous danger signals (e.g.

bacterial products or necrotic cell debris) through pattern recognition receptors (PRRs) in the

hepatic microenvironment, macrophages can be polarized into multiple phenotypes,

particularly M1 (classical) or M2 (alternative) activation states as known traditionally, for

simplistic presentation [54]. In general, M1 macrophages are considered as the primary

mediator of inflammation (pro-inflammatory) and M2 macrophages as the primary mediator

of wound healing during pathological fibrosis (anti-inflammatory) [55]. Macrophages

therefore exert a dual role i.e., causing liver inflammation and/or fibrosis resolution.

HSCs are multifunctional non-parenchymal cells located in the space of Disse between

sinusoidal endothelial cells and hepatocytes. In the normal/healthy liver, HSCs remain in a

non-proliferative and quiescent phenotype, and store vitamin A lipid droplets. As mentioned

above, upon liver injury, HSCs get activated and transdifferentiate into proliferative,

contractile, inflammatory, chemotactic, and ECM producing activated HSCs or myofibroblasts

[56, 57]. Activated HSCs produce tremendous amount of aberrant ECM that leads to the scar

tissue formation referred to as liver fibrosis that further progresses to CLD [58, 59].

As a first step in this thesis, to identify molecular targets in macrophages, we performed gene

profiler array in M0, M1- and M2-polarized mouse RAW264.7 macrophages. Two major kinase

families that are involved in the intracellular signaling pathways in innate cells are the Src-

15

family kinases and the SYK-ZAP70 kinases. We therefore assessed the implication of the SYK

and Src kinases in liver diseases.

SYK (spleen tyrosine kinase) is a cytoplasmic tyrosine kinase of 72 KDa that belongs to

ZAP70/SYK family of the non-receptor protein tyrosine kinases (PTKs). SYK was identified and

known to be expressed in hematopoietic cells, including macrophages, and has shown to be

involved in the downstream signaling events that drive inflammatory pathways of both the

innate and adaptive immune system. While most studies focused on hematopoietic cells, SYK

has also been shown to be expressed in non-hematopoietic cells including fibroblasts and

hepatocytes. In chapter 2, we present a review dealing with the SYK pathway in liver diseases.

This review summarizes the current understanding of SYK and its therapeutic implication in

liver diseases.

Understanding the role of SYK in liver and other diseases, we studied the implication of the

SYK pathway in NASH and investigated Poly (lactic-co-glycolic acid) (PLGA)-nanoparticles

based delivery of a SYK pathway inhibitor for the treatment of NASH. In chapter 3, we first

analyzed the SYK expression in livers of NASH and alcoholic hepatitis (AH) patients. We then

examined the expression and activation of the SYK signaling pathway in inflammatory

macrophages. We, thereafter, using the small-molecule SYK inhibitor R406, studied the

therapeutic implication of SYK inhibition in inflammatory macrophages. For the efficient

delivery of the SYK inhibitor R406 in vivo, we formulated R406 in PLGA nanoparticles and

investigated their therapeutic efficacy in vitro in M1-differentiated RAW macrophages and

murine bone marrow derived macrophages, and in vivo in the MCD diet-induced NASH mouse

model (Figure 2). With the promising results obtained during this study, we dwelled into the

other tyrosine kinases i.e., Src family of protein tyrosine kinases (SFKs), particularly Src being

the poorly investigated SFKs, that are the largest family of cytoplasmic tyrosine kinases

expressed in innate immune cells.

Src is a non-receptor tyrosine kinase that belongs to the Src family of protein tyrosine kinases

(SFKs) that includes nine members: Src, Yes, Fyn, Fgr, Lck, Hck, Blk, Lyn and Yrk. While Src, Fyn

and Yes are ubiquitously expressed, others (except Yrk, exclusively expressed in chickens) are

restricted to hematopoietic cells. SFKs regulate many fundamental cellular processes including

16

cell growth, differentiation, migration, survival, and are also identified as proto-oncogenes

involved in the cancer progression.

Figure 2. Graphical abstract depicting the hypothesized therapeutic role of R406-containing PLGA nanoparticles with improved pharmacokinetics of R406 in a NASH mouse model (Kurniawan et. al., Journal of Controlled Release 288 (2018) 227–238 [60]).

Moreover, SFKs play an essential role in the recruitment and activation of monocytes,

macrophages, neutrophils, and other immune cells. Considering the multicellular functions

and regulation of multiple signaling pathways by Src, we hypothesized Src may be a master

regulator involved in the pathophysiology of NAFLD and ALD (Figure 3). Therefore, in chapter

4, we investigated the role of Src kinase in NASH and ASH. We first assessed the expression

and activation of Src in human liver diseases from different etiologies i.e., NASH, alcoholic

hepatitis (AH), hepatitis C virus (HCV)-cirrhosis and biliary atresia (BA); and in respective

disease mouse models that mimic pathophysiological features of human NASH (methionine

choline deficient MCD-diet induced), ASH (chronic Lieber De Carli ethanol EtOH-diet induced

model), and carbon tetrachloride (CCl4)- and bile duct ligation (BDL)-induced liver fibrosis.

Thereafter, we assessed the functional role of Src kinase using a selective Src inhibitor KX2-

391. Functional inhibition of Src was studied in vitro in cell culture, precise-cut liver slices

(PCLS) and 3D human liver spheroids, and in vivo in MCD-diet-induced NASH and EtOH-diet-

17

induced ASH mouse models. We further examined mechanistic aspects involved in Src-

mediated effects.

Figure 3. Graphical abstract depicting the role of Src kinase in liver steatosis, inflammation, and fibrosis. The figure shows that Src kinase activates macrophages and HSCs via FAK/PI3K/AKT pathways, and is involved in fatty acid biosynthesis. KX2-391, a selective Src kinase inhibitor inhibited the key processes involved in alcoholic and non-alcoholic fatty liver diseases (Kurniawan et. al., Clinical and Translational Discovery, 2022 (in press)).

In the last chapter (chapter 5), we focused on targeting HSCs, key cell pathogenic cells involved

in fibrogenesis, with the aim to develop a theranostic approach with combined therapy and

diagnosis for personalized disease management. Fibroblast growth factors (FGFs) have been

shown to regulate HSCs differentiation and liver fibrosis. FGF-FGFR signaling pathways have

been shown to regulate liver homeostasis by regulating metabolism, promoting hepatocyte

proliferation and detoxification, and liver regeneration after partial hepatectomy. Specifically,

FGF2 has been shown to regulate HSCs function and has been investigated previously in liver

fibrosis. However, contradictory results have been reported. In this chapter, we investigated

the role of FGF2 and FGF2-SPIONs (FGF2 conjugated to the surface of superparamagnetic iron

oxide nanoparticles) as a theranostic approach with the aim to achieve an effective therapy

with simultaneous diagnosis of the stage of advanced fibrosis. To accomplish our aim, we first

analyzed the expression of FGFR in human liver cirrhosis and TGFβ-activated human HSCs (LX

18

cells) in vitro. We then investigated the effects of human recombinant FGF2 (low-molecular

weight) on TGFβ-activated human HSCs (LX2 cells) in vitro. In order to improve the stability

and systemic half-life of FGF2, we conjugated FGF2 to dextran- and PEG-coated SPIONs (Figure

4). Subsequently, we examined the therapeutic effects of FGF2-SPIONs versus free FGF2 on

TGFβ-activated human HSCs in vitro and in an acute CCl4 induced mouse model in vivo.

Figure 4. Schematic representation of FGF2 conjugation to SPIONs using carbodiimide chemistry (Kurniawan et. al., Journal of Controlled Release 328 (2020) 640–652 [61]).

Finally, in chapter 6, we summarize and discuss the findings presented in this thesis.

1.4 References

[1] A.L. Foundation, Progression of Liver Disease, American Liver Foundation Handout, 2016. [2] J. Das, Liver disease pathophysiology, Clinical Pharmacist, 3 (2011) 140-144. [3] J. Wiegand, T. Berg, The etiology, diagnosis and prevention of liver cirrhosis: part 1 of a

series on liver cirrhosis, Dtsch Arztebl Int, 110 (2013) 85-91. [4] W.M. Lee, Etiologies of acute liver failure, Semin Liver Dis, 28 (2008) 142-152. [5] J.C. Nault, Pathogenesis of hepatocellular carcinoma according to aetiology, Best Pract Res

Clin Gastroenterol, 28 (2014) 937-947. [6] N. Toshikuni, M. Tsutsumi, T. Arisawa, Clinical differences between alcoholic liver disease

and nonalcoholic fatty liver disease, World J Gastroenterol, 20 (2014) 8393-8406. [7] P. Uhl, G. Fricker, U. Haberkorn, W. Mier, Current status in the therapy of liver diseases,

Int J Mol Sci, 15 (2014) 7500-7512. [8] D.-B. Moon, S.-G. Lee, Liver transplantation, Gut and Liver, 3 (2009) 145-165. [9] N. Pydyn, K. Miekus, J. Jura, J. Kotlinowski, New therapeutic strategies in nonalcoholic fatty

liver disease: a focus on promising drugs for nonalcoholic steatohepatitis, Pharmacol Rep, 72 (2020) 1-12.

[10] R. Bataller, D.A. Brenner, Liver fibrosis, Journal of Clinical Investigation, 115 (2005) 209-218.

[11] K. Bottcher, M. Pinzani, Pathophysiology of liver fibrosis and the methodological barriers to the development of anti-fibrogenic agents, Adv Drug Deliv Rev, 121 (2017) 3-8.

[12] R. Xu, Z. Zhang, F.S. Wang, Liver fibrosis: mechanisms of immune-mediated liver injury, Cell Mol Immunol, 9 (2012) 296-301.

[13] R. Weiskirchen, F. Tacke, Liver fibrosis: which mechanisms matter, Clinical Liver Disease 8(2016) 94-99.

[14] T. Higashi, S.L. Friedman, Y. Hoshida, Hepatic stellate cells as key target in liver fibrosis, Adv Drug Deliv Rev, 121 (2017) 27-42.

19

[15] A.M. Gressner, R. Weiskirchen, Modern pathogenetic concepts of liver fibrosis suggest stellate cells and TGF-b as major players and therapeutic targets, Journal of Cellular and Molecular Medicine, 10 (2006) 76-99.

[16] J.T. Li, Z.X. Liao, J. Ping, D. Xu, H. Wang, Molecular mechanism of hepatic stellate cell activation and antifibrotic therapeutic strategies, J Gastroenterol, 43 (2008) 419-428.

[17] V.W. Setiawan, D.O. Stram, J. Porcel, S.C. Lu, L. Le Marchand, M. Noureddin, Prevalence of chronic liver disease and cirrhosis by underlying cause in understudied ethnic groups: The multiethnic cohort, Hepatology, 64 (2016) 1969-1977.

[18] T.R.R. III, A.M. Bhatti, Preventive strategies in chronic liver disease: Part II. cirrhosis, American Family Physician 64 (2001) 1735-1740.

[19] R.S. Rahimi, D.C. Rockey, Complications and outcomes in chronic liver disease, Curr Opin Gastroenterol, 27 (2011) 204-209.

[20] R.A. Mohammad, Complications of chronic liver disease, 2010, pp. 91-108. [21] A. Tayyeb, F. Azam, R. Nisar, R. Nawaz, U. Qaisar, G. Ali, Regenerative Medicine in Liver

Cirrhosis: Promises and Pitfalls, Liver Cirrhosis - Update and Current Challenges2017. [22] S.A. Almani, A.S. Memon, A.I. Memon, M. Iqbal Shah, M.Q. Rahpoto, R. Solangi, Cirrhosis

of liver: etiological factors, complications and prognosis, JLUMHS, (2008) 61-66. [23] X. Verhelst, A. Geerts, H.V. Vlierberghe, Cirrhosis: reviewing the literature and future

perspectives, European Medical Journal, (2016) 111-117. [24] J.J. Heidelbaugh, M. Sherbondy, Cirrhosis and chronic liver failure: part II. complications

and treatment, American Family Physician 74 (2006). [25] B. Li, C. Zhang, Y.T. Zhan, Nonalcoholic Fatty Liver Disease Cirrhosis: A Review of Its

Epidemiology, Risk Factors, Clinical Presentation, Diagnosis, Management, and Prognosis, Can J Gastroenterol Hepatol, 2018 (2018) 2784537.

[26] M. Lazo, R. Hernaez, M.S. Eberhardt, S. Bonekamp, I. Kamel, E. Guallar, A. Koteish, F.L. Brancati, J.M. Clark, Prevalence of nonalcoholic fatty liver disease in the United States: the Third National Health and Nutrition Examination Survey, 1988-1994, Am J Epidemiol, 178 (2013) 38-45.

[27] E.M. Brunt, V.W. Wong, V. Nobili, C.P. Day, S. Sookoian, J.J. Maher, E. Bugianesi, C.B. Sirlin, B.A. Neuschwander-Tetri, M.E. Rinella, Nonalcoholic fatty liver disease, Nat Rev Dis Primers, 1 (2015) 15080.

[28] N. Katsiki, D.P. Mikhailidis, C.S. Mantzoros, Non-alcoholic fatty liver disease and dyslipidemia: An update, Metabolism, 65 (2016) 1109-1123.

[29] J.K. Dowman, J.W. Tomlinson, P.N. Newsome, Pathogenesis of non-alcoholic fatty liver disease, QJM, 103 (2010) 71-83.

[30] M.E. Rinella, Nonalcoholic fatty liver disease: a systematic review, JAMA, 313 (2015) 2263-2273.

[31] Y. Fazel, A.B. Koenig, M. Sayiner, Z.D. Goodman, Z.M. Younossi, Epidemiology and natural history of non-alcoholic fatty liver disease, Metabolism, 65 (2016) 1017-1025.

[32] S.A. Polyzos, C.S. Mantzoros, Nonalcoholic fatty future disease, Metabolism, 65 (2016) 1007-1016.

[33] G. Targher, L. Bertolini, R. Padovani, S. Rodella, R. Tessari, L. Zenari, C. Day, G. Arcaro, Prevalence of nonalcoholic fatty liver disease and its association with cardiovascular disease among type 2 diabetic patients, Diabetes Care, 30 (2007) 1212-1218.

[34] Y.L. Fang, H. Chen, C.L. Wang, L. Liang, Pathogenesis of non-alcoholic fatty liver disease in children and adolescence: From "two hit theory" to "multiple hit model", World J Gastroenterol, 24 (2018) 2974-2983.

20

[35] J. Yu, S. Marsh, J. Hu, W. Feng, C. Wu, The Pathogenesis of Nonalcoholic Fatty Liver Disease: Interplay between Diet, Gut Microbiota, and Genetic Background, Gastroenterol Res Pract, 2016 (2016) 2862173.

[36] E. Buzzetti, M. Pinzani, E.A. Tsochatzis, The multiple-hit pathogenesis of non-alcoholic fatty liver disease (NAFLD), Metabolism, 65 (2016) 1038-1048.

[37] M.V. Machado, A.M. Diehl, Pathogenesis of Nonalcoholic Steatohepatitis, Gastroenterology, 150 (2016) 1769-1777.

[38] A. Canbay, J.P. Sowa, W.K. Syn, J. Treckmann, NASH Cirrhosis - the New Burden in Liver Transplantation: How Should It Be Managed?, Visc Med, 32 (2016) 234-238.

[39] Z.M. Younossi, The epidemiology of nonalcoholic steatohepatitis, Clinical Liver Disease, 11 (2018) 92-94.

[40] M. Arrese, A.E. Feldstein, Nash-Related Cirrhosis: An Occult Liver Disease Burden, Hepatol Commun, 1 (2017) 84-86.

[41] N. Magee, A. Zou, Y. Zhang, Pathogenesis of Nonalcoholic Steatohepatitis: Interactions between Liver Parenchymal and Nonparenchymal Cells, Biomed Res Int, 2016 (2016) 5170402.

[42] W. Liu, R.D. Baker, T. Bhatia, L. Zhu, S.S. Baker, Pathogenesis of nonalcoholic steatohepatitis, Cell Mol Life Sci, 73 (2016) 1969-1987.

[43] K.H. Kim, M.S. Lee, Pathogenesis of Nonalcoholic Steatohepatitis and Hormone-Based Therapeutic Approaches, Front Endocrinol (Lausanne), 9 (2018) 485.

[44] A. Caligiuri, A. Gentilini, F. Marra, Molecular Pathogenesis of NASH, Int J Mol Sci, 17 (2016).

[45] R.S. O'Shea, S. Dasarathy, A.J. McCullough, Alcoholic liver disease, Am J Gastroenterol, 105 (2010) 14-32; quiz 33.

[46] W. Dunn, V.H. Shah, Pathogenesis of Alcoholic Liver Disease, Clin Liver Dis, 20 (2016) 445-456.

[47] F. Stickel, C. Datz, J. Hampe, R. Bataller, Pathophysiology and Management of Alcoholic Liver Disease: Update 2016, Gut Liver, 11 (2017) 173-188.

[48] M.O. Farooq, R. Bataller, Pathogenesis and Management of Alcoholic Liver Disease, Dig Dis, 34 (2016) 347-355.

[49] B. Gao, R. Bataller, Alcoholic liver disease: pathogenesis and new therapeutic targets, Gastroenterology, 141 (2011) 1572-1585.

[50] L.Z. Kong, N. Chandimali, Y.H. Han, D.H. Lee, J.S. Kim, S.U. Kim, T.D. Kim, D.K. Jeong, H.N. Sun, D.S. Lee, T. Kwon, Pathogenesis, Early Diagnosis, and Therapeutic Management of Alcoholic Liver Disease, Int J Mol Sci, 20 (2019).

[51] F. Tacke, Targeting hepatic macrophages to treat liver diseases, J Hepatol, 66 (2017) 1300-1312.

[52] C. Ju, F. Tacke, Hepatic macrophages in homeostasis and liver diseases: from pathogenesis to novel therapeutic strategies, Cell Mol Immunol, 13 (2016) 316-327.

[53] Y.-y. Ma, M.-q. Yang, Z.-g. He, Q. Wei, J.-y. Li, The Biological Function of Kupffer Cells in Liver Disease, Biology of Myelomonocytic Cells2017.

[54] A. Sica, P. Invernizzi, A. Mantovani, Macrophage plasticity and polarization in liver homeostasis and pathology, Hepatology, 59 (2014) 2034-2042.

[55] P.J. Wermuth, S.A. Jimenez, The significance of macrophage polarization subtypes for animal models of tissue fibrosis and human fibrotic diseases, Clin Transl Med, 4 (2015) 2.

[56] C. Yin, K.J. Evason, K. Asahina, D.Y. Stainier, Hepatic stellate cells in liver development, regeneration, and cancer, J Clin Invest, 123 (2013) 1902-1910.

21

[57] T. Tsuchida, S.L. Friedman, Mechanisms of hepatic stellate cell activation, Nat Rev Gastroenterol Hepatol, 14 (2017) 397-411.

[58] R.K. Moreira, Hepatic stellate cells and liver fibrosis, Arch Pathol Lab Med, 131 (2007) 1728-1734.

[59] C. Hoffmann, N.E.H. Djerir, A. Danckaert, J. Fernandes, P. Roux, C. Charrueau, A.M. Lachages, F. Charlotte, I. Brocheriou, K. Clement, J. Aron-Wisnewsky, F. Foufelle, V. Ratziu, B. Hainque, D. Bonnefont-Rousselot, P. Bigey, V. Escriou, Hepatic stellate cell hypertrophy is associated with metabolic liver fibrosis, Sci Rep, 10 (2020) 3850.

[60] D.W. Kurniawan, A.K. Jajoriya, G. Dhawan, D. Mishra, J. Argemi, R. Bataller, G. Storm, D.P. Mishra, J. Prakash, R. Bansal, Therapeutic inhibition of spleen tyrosine kinase in inflammatory macrophages using PLGA nanoparticles for the treatment of non-alcoholic steatohepatitis, J Control Release, 288 (2018) 227-238.

[61] D.W. Kurniawan, R. Booijink, L. Pater, I. Wols, A. Vrynas, G. Storm, J. Prakash, R. Bansal, Fibroblast growth factor 2 conjugated superparamagnetic iron oxide nanoparticles (FGF2-SPIONs) ameliorate hepatic stellate cells activation in vitro and acute liver injury in vivo, J Control Release, 328 (2020) 640-652.

23

Chapter 2

Role of Spleen Tyrosine Kinase in Liver Diseases

Dhadhang Wahyu Kurniawan, Gert Storm, Jai Prakash, Ruchi Bansal

Published in: World J Gastroenterol. 2020 Mar 14;26(10):1005-1019. doi: 10.3748/wjg. v26.i10.1005.

24

Abstract

Spleen tyrosine kinase (SYK), a non-receptor tyrosine kinase, is expressed in most

hematopoietic cells and non-hematopoietic cells and play a crucial role in both immune and

non-immune biological responses. SYK mediate diverse cellular responses via an immune-

receptor tyrosine-based activation motifs (ITAMs)-dependent signalling pathways, ITAMs-

independent and ITAMs-semi-dependent signalling pathways. In liver, SYK expression has

been observed in parenchymal (hepatocytes) and non-parenchymal cells (hepatic stellate cells

and Kupffer cells) and found to be positively correlated with the disease severity. The

implication of SYK pathway has been reported in different liver diseases including liver fibrosis,

viral hepatitis, alcoholic liver disease, non-alcoholic steatohepatitis, and hepatocellular

carcinoma. Antagonism of SYK pathway using kinase inhibitors have shown to attenuate the

progression of liver diseases thereby suggesting SYK as a highly promising therapeutic target.

This review summarizes the current understanding of SYK and its therapeutic implication in

liver diseases.

25

2.1 Introduction

Spleen tyrosine kinase (SYK) is a cytoplasmic non-receptor protein tyrosine kinase (PTK) that

consists of two SYK homology 2 domains (SH2) and a C-terminal tyrosine kinase domain. These

domains are linked by two linker regions: interdomain A between the two SH2 domains and

interdomain B between the C-terminal SH2 domain and the kinase domain (Figure 1). SYK is a

member of the Zeta-chain-associated protein kinase 70/SYK family of the PTKs, with the

estimated molecular weight of 70 kDa [1, 2]. SYK is highly expressed in hematopoietic cells

including mast cells, neutrophils, macrophages, platelets, B cells and immature T cells, and is

important in signal transduction in these cells [2, 3]. In Immune cells, SYK mainly functions via

interaction of its tandem SH2 domains with immunoreceptor tyrosine-based activation motifs

(ITAMs). In mast cells, SYK mediates downstream signaling via high-affinity IgE receptors, FcεRI

and in neutrophils, macrophages, monocytes and platelets downstream signalling is mediated

via high affinity Igγ receptors, FcγR [4-6]. SYK plays a key role in signaling downstream of the

B and T cell receptors, hence also play a crucial role in early lymphocyte development [4, 7-

10]. Upon activation, SYK modulates downstream signaling events that drive inflammatory

pathways of both the innate and adaptive immune systems [11]. Besides ITAM-dependent

signalling pathway, SYK also mediates ITAM-independent signaling via integrins and C-type

lectins. For instance, SYK induces β2 integrin-mediated respiratory burst, spreading, and site-

directed migration of neutrophils towards inflammatory lesions [12].

Figure 1. Structure of spleen tyrosine kinase. Spleen tyrosine kinase contains tandem pair of spleen tyrosine kinase homology 2 which connected by interdomain A and separated by interdomain B from the catalytic (kinase) domain. SYK: Spleen tyrosine kinase; SH2: Spleen tyrosine kinase homology 2; ITAM: Immune-receptor tyrosine-based activation motifs.

The multifactorial role of SYK in the immune system has attracted attention in the past years.

SYK is recognized as a potential target for the treatment of inflammatory diseases such as

rheumatoid arthritis, asthma, allergic rhinitis, renal disorders, liver fibrosis and autoimmune

26

diseases [3, 7, 13-23]. In particular, the prevention of activation of cells via immune complexes

or antigen-triggered Fc receptor signaling and prevention of B cell receptor-mediated events

are believed to have increasing therapeutic potential of SYK [24, 25].

Besides hematopoietic cells, SYK has also been shown to be expressed in non-hematopoietic

cells including fibroblasts, epithelial cells, hepatocytes, neuronal cells, and vascular

endothelial cells [7, 26]. Here, SYK has shown to be involved in signalling steps leading to

mitogen activated protein (MAP) kinase activation by G-protein-coupled receptors in

hepatocytes [26, 27]. Besides being implicated in hepatocytes, SYK is also expressed in hepatic

macrophages, hepatic stellate cells (HSCs) and hepatic sinusoidal endothelial cells in liver [28].

However, studies investigating SYK signaling pathway in liver diseases are still limited, hence

this review highlights and discusses the opportunities and challenges of SYK as a potential

target for the treatment of liver diseases.

2.2 Spleen Tyrosine Kinase signaling mechanisms

Immunoreceptor signaling through SYK requires the SYK kinase activity as well as both SH2

domains [29]. The SYK kinase domain is inactive in the resting state of the protein but can be

activated by interaction of both SH2 domains to dual phosphorylated ITAMs [30].

Phosphorylation of tyrosine residues within the linker regions (interdomain A or B) also results

in kinase activation even in the absence of phosphorylated ITAM binding [29, 30]. Binding of

the SH2 domains of SYK to phosphorylated ITAMs is a critical step in SYK activation and

downstream signaling [31]. SYK itself can catalyze the autophosphorylation of its linker

tyrosine’s, leading to sustained SYK activation after a transient ITAM phosphorylation. In

addition, SYK itself can phosphorylate ITAMs, suggesting the existence of a positive-feedback

loop during initial ITAM-mediated SYK activation [32]. Tsang et al. [33] showed that SYK can

be fully triggered by phosphorylation or binding of its SH2 domains to the dual-

phosphorylated immune-receptor tyrosine based activity motif (ppITAM) (Figure 2) [33, 34].

Recently, Slomiany and Slomiany demonstrated LPS-induced SYK activation through protein

kinase Cδ (PKCδ)-mediates SYK phosphorylation on serine residues that is required for its

recruitment to the membrane-anchored TLR4, followed by SYK subsequent activation through

tyrosine phosphorylation. Hence, the intermediate phase of PKCδ-mediated SYK

phosphorylation on serine residues affects the inflammatory response [35]. The activated SYK

27

binds to a number of downstream signaling effectors and amplifies the inflammatory signal

propagation by affecting transcription factors activation and their assembly to transcriptional

complexes involved in expression of the proinflammatory genes [36].

Figure 2. Basis of spleen tyrosine kinase activation. In the resting state, spleen tyrosine kinase is auto-inhibited, because of the binding of interdomain A and interdomain B to the kinase domain. This auto-inhibited conformation can be activated by binding of the two spleen tyrosine kinase homology 2 domains to dually phosphorylated immune-receptor tyrosine-based activation motifs or by phosphorylation of linker tyrosine’s in interdomain A or B. SH2: Spleen tyrosine kinase homology 2; ITAM: Immune-receptor tyrosine-based activation motifs.

2.3 Spleen Tyrosine Kinase in liver fibrosis

Liver fibrosis, triggered by hepatitis B/C viral infection (viral hepatitis), alcohol abuse (alcoholic

liver disease) or non-alcoholic steatohepatitis (NASH) etc., is characterized by an excessive

deposition of extracellular matrix (ECM) proteins [37], leading to tissue scarring that further

progresses to end-stage liver cirrhosis and hepatocellular carcinoma [38].

Liver fibrosis poses a major health problem accounting for more than 1 million people deaths

every year worldwide [39]. Moreover, there is no therapeutic treatment available to date [40].

The central player that produces ECM resulting in liver fibrosis is HSCs [41]. HSCs are normally

localized in the peri-sinusoidal area, termed as space of Disse, as quiescent cells in healthy

liver and functions as retinoid storage cells [42]. Owing to hepatic injury, quiescent HSCs

28

phenotypically transdifferentiate into activated, contractile, highly proliferative, and ECM-

producing myofibroblasts [43].

SYK has been documented to play a critical role in the activation of HSCs and its upregulation

is evidenced in hepatic fibrosis/cirrhosis in hepatitis B and C patients, alcoholic hepatitis as

well as in NASH patients [28, 44]. Upregulated SYK further aggravate fibrosis by augmenting

trans-communication between hepatocytes and HSCs [28]. Blockage of SYK pathway using SYK

inhibitors abrogated HSCs activation, thereby ameliorated liver fibrosis and HCC development

in vivo in animal models [28]. SYK has also shown to mediate its function via expression of

transcription factors associated with HSCs activation (cAMP response element-binding

protein, CBP; myeloblastosis proto-oncogene, MYB and myelocytomatosis proto-oncogene,

MYC) and proliferation (MYC and cyclin D1, CCND1) [28]. Furthermore, two isoforms of SYK

i.e. the full-length SYK(L) and an alternatively spliced SYK(S) have been suggested whereby

SYK(L) but not SYK(S) found to play a major role in liver fibrosis while SYK(S) has been

associated with increased tumorigenicity, HCC invasiveness and metastases [28].

Interestingly, the crosstalk between SYK and Wnt (portamanteau of int and wg, wingless-

related integration site) signaling pathways also mediates activation of HSCs and accumulation

of immune cells at the site of fibrosis [28]. Wnt signaling has been shown to be upregulated in

activated HSCs and blockade of canonical Wnt pathway by adenoviral mediated transduction

of Wnt antagonist (Dickkopf-1) or via selective inhibitors reinstates quiescent phase of HSCs

in cultured cells [45, 46]. In-depth investigation at a genetic level revealed overexpression of

certain transcriptional factors (MYB, CBP and MYC) which plays a vital role in the activation of

HSCs [47, 48]. Notably, both the canonical Wnt pathway and SYK has shown to regulate the

expression of MYC and CBP [23, 49] highlighting SYK-Wnt crosstalk during liver fibrogenesis.

SYK has also shown to promote expression of several target genes including Wnt in activated

macrophages in a similar manner as in HSCs and this potential crosstalk between SYK and

other signaling pathways warrants further investigation. Dissection of the trans-

communication between signaling pathways is of great importance in order to highlight

prominent therapeutic targets to hinder inflammation and fibrogenesis. SYK is the major

signaling pathway and is also shown to be expressed in recruited macrophages, besides HSCs,

in the hepatic fibrosis [20, 28]. Selective blocking of SYK or its deletion in macrophages has

been correlated with the diminished activation of macrophages, which is indicated by a

29

reduction in the expression of Fc gamma receptors, monocyte chemoattractant protein 1

(MCP-1), tumor necrosis factor α (TNF-α) and interleukin 6 (IL-6) [5]. In summary, activation

of HSCs under the influence of SYK signaling leads to the secretion of soluble factors in the

form of cytokines and chemokines. These factors not only facilitate the recruitment of

macrophages (and other immune cells) but also arbitrates their activation to further worsen

the site of fibrosis.

2.4 Spleen Tyrosine Kinase in viral hepatitis

In the recent study, SYK expression was found to be highly induced in the liver tissues of HBV

and HCV infected patients. Furthermore, markedly increased expression of SYK was observed

in HCV-infected hepatocytes which in turn promoted reciprocal higher SYK expression in HSCs

thereby inducing HSCs activation and disease development [28, 50]. Furthermore, the

preliminary study analyzing gene expression profiles in Egyptian HCC patients associated with

HCV, showed that SYK is one of the most up-regulated genes out of 180 of genes were up

regulated [51].

HCV is also associated with B lymphocyte proliferative disorders, as evidenced by the binding

of HCV to B-cell surface receptor CD81 [52]. CD81 (cluster of differentiation 81, also known as

TAPA1), is identified as a target of an antibody that controlled B-cell proliferation. Engagement

of CD81 with HCV [53, 54], leads to ezrin and radixin phosphorylation through SYK activation

[55, 56]. Ezrin and radixin are members of the ERM (ezrin, radixin, moesin) family of actin-

binding proteins [56]. Hence, ezrin-moesin-radixin proteins and SYK are important therapeutic

host targets for the development HCV treatment [57].

SYK is also an important regulator and therapeutic target against HCV infection in hepatocytes

[55]. SYK expression has been observed near the plasma membrane of hepatocytes in HCV-

infected patients [57, 58]. HCV non-structural protein 5A (NS5A) has been shown to physically

and directly interact with SYK thereby promoting the malignant transformation of HCV-

infected hepatocytes [58]. These studies suggests that the strategies blocking SYK activation

before HCV-CD81 interaction, and/or modulating HCV post-entry and trafficking within target

cells involving SYK, F-actin, stable microtubules and EMR proteins provide novel opportunities

for the development of anti-HCV therapies [55].

30

2.5 Spleen Tyrosine Kinase in alcoholic liver disease (ALD)

The pathogenesis of ALD is multifactorial involving many complex processes including ethanol-

mediated liver injury, inflammation in response to the injury, and intestinal permeability and

microbiome changes [59-61] as shown in Figure 3. Alcohol and its metabolites generate

reactive oxygen species (ROS) and induce hepatocyte injury through mitochondrial damage

and endoplasmic reticulum (ER) stress [62-64]. Damaged hepatocytes release pro-

inflammatory cytokines and chemokines resulting in recruitment and activation of immune

cells. Central cell types involved in ALD progression are macrophages that have an important

role in inducing liver inflammation [65] by stimulating infiltration of immune cells (mainly

monocytes) and activation of Kupffer cells (KCs, resident macrophages) [59]. The early

communication of hepatocyte damage is mediated by KCs through damage-associated

molecular patterns (DAMPs) released by dying hepatocytes or pathogen-associated molecular

patterns (PAMPs) including lipopolysaccharides (LPS) via pattern recognition receptors (PRRs)

such as TLRs (Toll-like receptors), and NF-κB (nuclear factor kappa-light-chain-enhancer of

activated B cells) signaling and inflammasome activation etc. In ALD, resident and recruited

macrophages in the liver are activated by TLR4 (Toll-like receptor 4) signaling pathway

regulated by bacterial endotoxin (LPS) that is elevated in the portal and systemic circulation

owing to increased intestinal permeability after excessive alcohol intake [66, 67]. However,

there are also other mechanisms that regulate macrophage activation, such as hepatocyte

injury and lipid accumulation, histone acetylation in ethanol-exposed macrophages and

complement system [68]. SYK also plays an important role in TLR4 signaling, and SYK

phosphorylation in neutrophils and monocytes has been correlated with pro-inflammatory

cytokine secretion including TNF-α and MCP-1 [69]. Interestingly, SYK phosphorylation has

been shown to be regulated by LPS/TLR adaptor molecules MyD88/IRAKM (IL-1R-associated

kinase M)-mincle axis linking LPS-induced hepatocyte cell death with inflammation during ALD

disease pathogenesis. Zhou et al., has shown that damaged hepatocytes release endogenous

Mincle ligand spliceosome-associated protein 130 (SAP130) as a danger signal that

synergistically with LPS drives inflammation including inflammasome activation during ALD

[70].

Several studies have documented the increased SYK expression and phosphorylation in the

livers of alcoholic hepatitis (AH) patients [44]. Interestingly, increased SYK phosphorylation

31

was observed in ballooned hepatocytes with Mallory-Denk Bodies, co-localized with

ubiquitinated proteins in the cytoplasm suggesting the critical role of SYK in hepatocytes

during ER stress [71, 72]. SYK regulates hepatic cell death via TRAF family member-associated

NF-Ƙβ activator (TANK)-binding kinase 1/interferon (IFN) regulatory factor 3 (TBK1/IRF3)

signaling [20]. SYK has also been reported to play an important role in lipid accumulation, and

treatment with SYK inhibitor prevented progressive steatosis by suppressing lipid biogenesis

and increasing lipid metabolism in both in vitro cell culture and in vivo in ALD mouse models

exhibiting moderate ASH and chronic alcohol drinking [20]. SYKY525/526 phosphorylation

indicates SYK activation and is a prerequisite for its downstream modulatory function [73]. In

addition, total SYK and activated pSYKY525/526 expression was found to be significantly

increased in the circulating blood monocytes, and PBMCs in AH/cirrhosis patients [20]. Since

SYK is closely involved in the pathogenesis of ALD, SYK inhibition could prevent and/or

attenuate alcohol-induced liver inflammation, cell death, steatosis and subsequently fibrosis

in various phases of ALD [20, 73].

2.6 Spleen Tyrosine Kinase in Non-alcoholic Steatohepatitis (NASH)

NASH is characterized by increasing accumulation of so-called toxic lipids in hepatocytes, that

can develop into cirrhosis and primary liver cancer [74]. NASH is the more severe and clinically

significant form of NAFLD (non-alcoholic fatty liver disease) [75], characterized by hepatic cell

injury, steatosis together with inflammation, resulting into fibrosis signified by deposition of

extracellular matrix mainly composed of collagen/fibrin fibrils [76]. The progression of NASH

is associated with a progressive build-up of danger signals particularly PRRs including TLRs,

and nucleotide oligomerization domain (NOD)-like receptors (NLRs) [77] that engage multiple

receptors during immune response [78].

As also mentioned earlier, the interaction of LPS with TLR4 plays a major role in linking innate

immunity with inflammatory response and the activation of KCs [77, 79, 80]. Activated KCs

produce inflammatory cytokines and chemokines such as IL-1β, IL-6, iNOS, FcγR1, and CCL2

that contribute to the recruitment of circulating monocytes and macrophages into the

inflammed liver during NASH development mostly similar to ASH [81]. Activated KCs also

secrete TNF superfamily ligands such as TNF-α and TNF-related apoptosis-inducing ligand

32

(TRAIL), inducing apoptosis of adjacent hepatocytes and inflammation, and is crucial for

triggering NASH development [81-83] as depicted in Figure 3.

Activated KCs instigates TLR4 and recruit an activated SYK, which is also expressed in HSCs,

hepatocytes, and cholangiocytes [77, 84-86]. SYK plays a role in IL1-induced chemokine

release via association with TRAF-6 (tumour necrosis factor (TNF) receptor activating factor

Figure 3. Role of spleen tyrosine kinase in alcoholic liver disease and non-alcoholic steatohepatitis pathogenesis. Excessive alcohol consumption and Increased fat accumulation due to an increased fat biogenesis and reduced metabolism, causes hepatocellular injury that generates reactive oxygen species, release of pro-inflammatory cytokines and chemokines leading to activation of resident macrophages (Kupffer cells), and recruitment of circulating immune cells including neutrophils and monocytes. Overconsumption of alcohol also trigger the production of lipopolysaccharides due to increased intestinal permeability. Increased levels of pathogen-associated molecular patterns (Lipopolysaccharides) and damage-associated molecular patterns (released from dying hepatocytes) that in turn interacts with toll-like receptors e.g. toll-like receptor 4 resulting in the activation of spleen tyrosine kinase signaling pathway, NF-κB signaling pathway, and inflammasome activation. These processes develop into liver inflammation and fibrosis via increased infiltration and activation of immune cells and hepatic stellate cells, respectively. SYK: Spleen tyrosine kinase; LPS: Lipopolysaccharides; PAMPs: Pathogen-associated molecular patterns; DAMPs: Damage-associated molecular patterns; TLRs: Toll-like receptors; HSCs: Hepatic stellate cells; ROS: Reactive oxygen species. Created with www.biorender.com.

33

6), which is a shared molecule in multiple signaling pathways and is recruited through

interactions of adaptor MyD88 and IRAK-1 (interleukin-1 (IL1) receptor-associated kinase 1)

with TLR4 [87-89]. Likewise, TLR4 transduces signals via the BCR (B-cell receptor) leading to

activation of SYK, which is important for B-cell survival, proliferation [90], and BCR-mediated

immune response [5]. Lipid peroxidation products, derived from phospholipid oxidation are

one of the sources of neo-antigens that are able to promote an adaptive immune response in

NASH [91]. The involvement of T and B cells in the progression of NASH automatically implicate

role of SYK in this process.

Recently, we have shown the positive correlation of SYK expression with the increasing NAS

score (NAFLD activity score) in livers from NASH patients as compared to normal livers [44].

As aforementioned, the role of SYK in NASH is not only via PRR pathways, but also through

NLR pathways. The role of several NLRs have been crucial in the formation of inflammasomes

and the nomenclature of inflammasomes is hence based on the NLR [92]. SYK is required for

NLRP3 (NLR protein 3) inflammasome activation [93], that forms an IL-1β-processing

inflammasome complex. Inflammasome activation has been shown to be associated with the

late stages of NASH, and not in early steatosis in mice [94]. Inflammasome activation can be

induced by free fatty acids (FFAs) and these FFAs can also induce apoptosis and the release of

danger signals in hepatocytes [94, 95]. Consequently, pharmacological inhibition of NLRP3

inflammasome in vivo has been demonstrated to reduce liver inflammation, hepatocyte

injury, and liver fibrosis in NASH [44, 96].

2.7 Spleen Tyrosine Kinase in Hepatocellular Carcinoma (HCC)

Hepatocyte apoptosis and compensatory proliferation are the key drivers for HCC

development, and SYK has been suggested to play a key role in HCC progression. in HCC,

intestinal microbiota and TLR4 link inflammation and carcinogenesis in the chronically injured

liver, and SYK regulate this link mediated via LPS-TLR4 interaction [97]. The intimate

correlation between SYK methylation and loss-of-expression, together with the role of SYK

methylation in gene silencing, indicates that epigenetic inactivation of SYK contributes to the

progression of HCC [98] signifying SYK methylation and loss of SYK expression as predictors of

poor overall survival in patients with HCC. Furthermore, methylation of SYK promoter was

found to be inversely regulated in HCC cells. Restoring SYK expression in SYK-silenced HCC cell

34

lines decreased hepatocellular growth, cell migration and invasion but increased cell adhesion

[99, 100].

On the other hand, checkpoint kinase 1 (CHK1) was found to be overexpressed and correlated

with poor survival of HCC patients. CHK1 phosphorylate tumor suppressor SYK isoform, SYK(L)

at Ser295 and inducing its proteasomal degradation. However, non-phosphorylated mutant

form of SYK(L) has been shown to suppress proliferation, colony formation, migration, and

tumor growth in HCC lines. Therefore, a strong inverse correlation between the expression

levels of CHK1 and SYK(L) was observed in patients with HCC [101]. Interestingly, Hong et al.

showed that another SYK isoform, SYK(S) promotes tumor growth, downregulate apoptosis,

enhances metastasis and counteract the opposing effects of SYK(L) [102]. These studies

suggest that SYK(L) downregulation or SYK(S) upregulation are the strong predictors of poor

clinical outcome in patients with HCC.

2.8 Small Molecules SYK inhibitors

Over the past decade, SYK signaling pathway has been recognized as a promising target for

the therapeutic intervention in different disease including autoimmune and inflammatory

disorders, fibrotic diseases and tumor. However, specificity and selectivity remain the major

concern for the development of drugs targeting ubiquitously expressed kinases. Hence,

debate about the specificity of SYK inhibitors has been a major point of discussion and has still

not reached an appropriate conclusion since the first SYK inhibitors entered into medicinal

chemistry optimization [25, 103, 104]. Over the past few years, several SYK inhibitors have

been designed while many are still in development, and the molecular structures of some of

these SYK inhibitors are depicted in Figure 4. Several SYK inhibitors are been evaluated in

preclinical and clinical studies in different diseases [103, 105], as highlighted in Table 1.

Table 1. Summary of pre-clinical and clinical studies using SYK inhibitors

Compound Medical Condition Description/Effect Ref. Fostamatinib (R788)

Ulcerative colitis Suppression of TNFα, T cells and neutrophils [106] Rheumatoid arthritis Reduced inflammation and tissue damage,

suppressed clinical arthritis, pannus formation and synovitis.

[107, 108]

Chronic lymphocytic leukemia and non-Hodgkin lymphoma

Disruption of BCR signaling inhibiting the proliferation and survival of malignant B cells.

[109], [110]

35

Ischemia-reperfusion induced intestinal and lung damage

Impaired release of pro-inflammatory and coagulation mediators, reduced neutrophils, macrophages and platelet accumulations

[111]

Glomerulonephritis Reduced proteinuria, glomerular macrophage and CD8 cells, MCP-1 and IL-1β, and renal injury

[112]

Entospletinib (GS-9973)

Chronic lymphocytic leukemia (CLL)

Decreased inflammation and disruption of chemokine/cytokine circuits (BCR signaling).

[113-115]

Diffuse large B-cell lymphoma (DLBCL)

Disruption of BCR signaling inhibiting the proliferation and survival of malignant B cells.

[116]

Cherubisme (craniofacial disorder)

Ameliorates inflammation and bone destruction in the mouse model of cherubism

[117]

Cerdulatinib (PRT062070)

Diffuse large B-cell lymphoma (DLBCL)

Disruption of BCR signalling inhibiting the proliferation and survival of malignant B cells

[118, 119]

TAK-659

Epstein-Barr virus-associated lymphoma

Inhibited tumour development and metastases [120]


Decreased tumour survival, myeloid cell proliferation and metastasis.

[121]

R406 (tamatinib)

Immunocomplexes mediated inflammation

Inhibits several critical modes of the inflammatory cascade

[122]

Human platelets Inhibition of activation of CLEC-2 (C-type lectin 2, platelet receptor), and platelet activation

[123]


Inhibition of constitutive and BCR-induced SYK activation, abrogation of CLL cell survival, migration, and paracrine signalling.

[124]

Leukemia Reduced tyrosine phosphorylation and c-Myc expression, blockade of tumorigenic cells proliferation transformed by oncogenes

[125]

Megakaryocytic leukemia

induced apoptosis, reduced cell proliferation and blockade of STAT5 signalling

[126]

Glomerulonephritis Downregulated MCP-1 production from mesangial cells and macrophages

[112]

Piceatannol

Oral squamous cell carcinoma (OSCC)

Inhibited tumour cell proliferation, induced of apoptosis, attenuated VEGF and MMP9 expression, and decreased metastases.

[127]

Some of the above mentioned SYK inhibitors have been explored in liver diseases and are

presented in Table 2. R406 has been shown to reduce SYK expression and phosphorylation in

macrophages, and other hepatic cells and has been shown to ameliorate non-alcoholic and

alcoholic steatohepatitis by inhibiting steatosis, inflammation and fibrosis suggesting multi-

faceted effects of this highly selective SYK inhibitor [20, 44]. GS-9973 is a new emerging,

selective and potent inhibitor of SYK that was evaluated in activated HSCs and showed anti-

fibrotic effects in rodent liver fibrosis models [28].

36

Very recently, two new inhibitors PRT062607 and Piceatannol have been investigated in

myeloid cells to reveal their protective effect against liver fibrosis and hepatocarcinogenesis

in vivo. Both inhibitors selectively blocked SYK phosphorylation, significantly reduced the

infiltration of inflammatory cells and HSCs trans-differentiation, and inhibited malignant

transformation in fibrotic livers [128].

Despite the encouraging results with SYK inhibitors, some issues remain unsolved (e.g. their

long-term safety has not yet been demonstrated). Moreover, due to the ubiquitous expression

of SYK in different cells, concerns have been raised about the possibility of side-effects owing

to the overall inhibition of the multiple cellular functions [2, 127]. A major challenge therefore

is how to inhibit pathological processes without disrupting physiological cell functions [129].

Nanotechnology is an interesting and promising alternative to improve the efficacy and

therapeutic effect of the SYK inhibitor e.g. using poly lactic-co-glycolic acid (PLGA)

nanoparticles, we have demonstrated improved therapeutic effectivity of R406 in MCD-diet

induced NASH [44]. In this study, we have shown that R406, encapsulated in PLGA

Fostamatinib (R788)

Cerdulatinib (PRT062070) TAK-659

Tamatinib (R406)

Entospletinib (GS-9973)

Piceatannol

Figure 4. Molecular structure of several SYK inhibitors. R406, GS-9973, PRT062070, and Piceatannol have been studied in liver diseases, while R788 and TAK-659 are being investigated in other diseases.

37

nanoparticles, reduced expression of SYK in macrophages in vitro, and attenuated steatosis,

inflammation, and fibrosis in vivo in NASH mouse model [44].

Table 2. SYK inhibitors implicated in liver diseases

2.9 Conclusion

In this review, we have highlighted the implication of SYK signaling pathways in different

diseases, more importantly in liver diseases. SYK plays a multifaceted role in liver diseases such

as liver fibrosis, alcoholic liver disease, non-alcoholic steatohepatitis, viral hepatitis, and

hepatocellular carcinoma. Furthermore, several SYK-related mechanisms have been

understood in the past decade which led to the development of numerous small-molecule

inhibitors that have been and are currently evaluated in vitro, in vivo in different animal

models and in clinical trials in patients for different indications. These inhibitors have shown

highly potent effects in the tested models and therefore is a promising therapeutic target that

should be explored further. To improve the therapeutic efficacy and clinical use of SYK

inhibitors with improved safety profile and reduce the side effects, nanotechnology

approaches, such as polymeric nanoparticles, liposomal-mediated delivery, or micelles, and

finally organ (tumor)-targeted drug delivery could be explored.

2.10 Acknowledgment

Inhibitor Mechanism of action Therapeutic effect Ref.

R406 Blocking of Fc receptor signalling pathway, NF-κB signalling pathway and inflammasome activation.

Reduced SYK expression and phosphorylation resulting in attenuated liver steatosis, inflammation and fibrosis in ASH and NASH murine models.

[20, 44]

GS-9973 Decreased expression of HSCs activation (CBP, MYB, MYC) and HSCs proliferation factors (MYC and CCND1).

Inhibition of HSCs proliferation and HSC activation resulting in amelioration of fibrosis and hepatocarcinogenesis.

[28]

PRT062607 and Piceatannol

Increased intra-tumoral p16, p53 and decreased expression of Bcl-xL and SMAD4. Decreased expression of genes regulating angiogenesis, apoptosis, cell cycle regulation and cellular senescence. Down-regulation of mTOR, IL-8 signalling and oxidative phosphorylation.

Reduced HSCs differentiation and infiltration of inflammatory cells including T cells, B cells and myeloid cells, reduced oncogenic progression. Marked attenuation of toxin-induced liver fibrosis, associated hepatocellular injury, intra-hepatic inflammation and hepatocarcinogenesis.

[128]

38

D.W.K has been supported by a PhD scholarship received from the Endowment Fund for the

Education Republic of Indonesia (Lembaga Pengelola Dana Pendidikan/LPDP, RI).

2.11 References

[1] C.A. Lowell, Src-family and Syk kinases in activating and inhibitory pathways in innate immune cells: signaling cross talk, Cold Spring Harb Perspect Biol, 3 (2011) 1-16.

[2] M. Riccaboni, I. Bianchi, P. Petrillo, Spleen tyrosine kinases: biology, therapeutic targets and drugs, Drug Discov Today, 15 (2010) 517-530.

[3] O.N. Pamuk, G.C. Tsokos, Spleen tyrosine kinase inhibition in the treatment of autoimmune, allergic, and autoinflammatory diseases, Arthritis Research & Therapy, 12 (2010) 1-11.

[4] A. Mocsai, J. Ruland, V.L. Tybulewicz, The SYK tyrosine kinase: a crucial player in diverse biological functions, Nat Rev Immunol, 10 (2010) 387-402.

[5] E. Schweighoffer, J. Nys, L. Vanes, N. Smithers, V.L.J. Tybulewicz, TLR4 signals in B lymphocytes are transduced via the B cell antigen receptor and SYK, J Exp Med, 214 (2017) 1269-1280.

[6] M. Turner, E. Schweighoffer, F. Colucci, J.P.D. Santo, V.L. Tybulewicz, Tyrosine kinase SYK: essential functions for immunoreceptor signalling, Immunologi Today, 21 (2000) 148-154.

[7] J.M. Bradshaw, The Src, Syk, and Tec family kinases: distinct types of molecular switches, Cell Signal, 22 (2010) 1175-1184.

[8] R.J. Cornall, A.M. Cheng, T. Pawson, C.C. Goodnow, Role of Syk in B-cell development and antigen-receptor signaling, PNAS, 97 (2000) 1713-1718.

[9] B. Keller, I. Stumpf, V. Strohmeier, S. Usadel, E. Verhoeyen, H. Eibel, K. Warnatz, High SYK Expression Drives Constitutive Activation of CD21(low) B Cells, J Immunol, 198 (2017) 4285-4292.

[10] A.R. Burton, L.J. Pallett, L.E. McCoy, K. Suveizdyte, O.E. Amin, L. Swadling, E. Alberts, B.R. Davidson, P.T. Kennedy, U.S. Gill, C. Mauri, P.A. Blair, N. Pelletier, M.K. Maini, Circulating and intrahepatic antiviral B cells are defective in hepatitis B, J Clin Invest, 128 (2018) 4588-4603.

[11] D. Frommhold, I. Mannigel, J. Schymeinsky, A. Mocsai, J. Poeschl, B. Walzog, M. Sperandio, Spleen tyrosine kinase Syk is critical for sustained leukocyte adhesion during inflammation in vivo, BMC Immunol, 8 (2007) 31.

[12] A. Mocsai, M. Zhou, F. Meng, V.L. Tybulewicz, C.A. Lowell, Syk is required for integrin signaling in neutrophils, Immunity, 16 (2002) 547-558.

[13] O.N. Pamuk, P.H. Lapchak, P. Rani, P. Pine, J.J. Dalle Lucca, G.C. Tsokos, Spleen tyrosine kinase inhibition prevents tissue damage after ischemia-reperfusion, Am J Physiol Gastrointest Liver Physiol, 299 (2010) G391-399.

[14] R.L. Geahlen, Getting Syk: spleen tyrosine kinase as a therapeutic target, Trends Pharmacol Sci, 35 (2014) 414-422.

[15] S.P. McAdoo, J. Reynolds, G. Bhangal, J. Smith, J.P. McDaid, A. Tanna, W.D. Jackson, E.S. Masuda, H.T. Cook, C.D. Pusey, F.W. Tam, Spleen tyrosine kinase inhibition attenuates autoantibody production and reverses experimental autoimmune GN, J Am Soc Nephrol, 25 (2014) 2291-2302.

[16] H. Patterson, R. Nibbs, I. McInnes, S. Siebert, Protein kinase inhibitors in the treatment of inflammatory and autoimmune diseases, Clin Exp Immunol, 176 (2014) 1-10.

39

[17] M. Kaur, M. Singh, O. Silakari, Inhibitors of switch kinase 'spleen tyrosine kinase' in inflammation and immune-mediated disorders: a review, Eur J Med Chem, 67 (2013) 434-446.

[18] T.K. Ma, S.P. McAdoo, F.W. Tam, Spleen Tyrosine Kinase: A Crucial Player and Potential Therapeutic Target in Renal Disease, Nephron, 133 (2016) 261-269.

[19] K.H. Chen, H.H. Hsu, H.Y. Yang, Y.C. Tian, Y.C. Ko, C.W. Yang, C.C. Hung, Inhibition of spleen tyrosine kinase (syk) suppresses renal fibrosis through anti-inflammatory effects and down regulation of the MAPK-p38 pathway, Int J Biochem Cell Biol, 74 (2016) 135-144.

[20] T.N. Bukong, A. Iracheta-Vellve, B. Saha, A. Ambade, A. Satishchandran, B. Gyongyosi, P. Lowe, D. Catalano, K. Kodys, G. Szabo, Inhibition of spleen tyrosine kinase activation ameliorates inflammation, cell death, and steatosis in alcoholic liver disease, Hepatology, 64 (2016) 1057-1071.

[21] S. McAdoo, F.W.K. Tam, Role of the Spleen Tyrosine Kinase Pathway in Driving Inflammation in IgA Nephropathy, Semin Nephrol, 38 (2018) 496-503.

[22] P.S. Michael, W.L. Christine, S. Andreas, C. Chung-Wai, Syk: A Novel Target for Treatment of Inflammation in Lung Disease, Inflammation & Allergy - Drug Targets (Discontinued), 8 (2009) 87-95.

[23] G. Coffey, F. DeGuzman, M. Inagaki, Y. Pak, S.M. Delaney, D. Ives, A. Betz, Z.J. Jia, A. Pandey, D. Baker, S.J. Hollenbach, D.R. Phillips, U. Sinha, Specific Inhibition of Spleen Tyrosine Kinase Suppresses Leukocyte Immune Function and Inflammation in Animal Models of Rheumatoid Arthritis, Journal of Pharmacology and Experimental Therapeutics, 340 (2012) 350-359.

[24] Y. Koyama, D.A. Brenner, Liver inflammation and fibrosis, The Journal of clinical investigation, 127 (2017) 55-64.

[25] R. Singh, E.S. Masuda, D.G. Payan, Discovery and development of spleen tyrosine kinase (SYK) inhibitors, J Med Chem, 55 (2012) 3614-3643.

[26] S. Yanagi, R. Inatome, T. Takano, H. Yamamura, Syk expression and novel function in a wide variety of tissues, Biochem Biophys Res Commun, 288 (2001) 495-498.

[27] S. Tsuchida, S. Yanagi, R. Inatome, J. Ding, P. Hermann, T. Tsujimura, N. Matsui, H. Yamamura, Purification of a 72-kDa protein-tyrosine kinase from rat liver and its identification as Syk: Involvement of Syk in signaling events of hepatocytes, J. Biochem, 127 (2000) 321-327.

[28] C. Qu, D. Zheng, S. Li, Y. Liu, A. Lidofsky, J.A. Holmes, J. Chen, L. He, L. Wei, Y. Liao, H. Yuan, Q. Jin, Z. Lin, Q. Hu, Y. Jiang, M. Tu, X. Chen, W. Li, W. Lin, B.C. Fuchs, R.T. Chung, J. Hong, Tyrosine kinase SYK is a potential therapeutic target for liver fibrosis, Hepatology, (2018).

[29] L.M. Keshvara, C. Isaacson, M.L. Harrison, R.L. Geahlen, Syk activation and dissociation from the B-cell antigen receptor is mediated by phosphorylation of tyrosine 130, The Journal of Biological Chemistry, 272 (1997) 10377-10381.

[30] Y. Zhang, H. Oh, R.A. Burton, J.W. Burgner, R.L. Geahlen, C.B. Post, Tyr130 phosphorylation triggers Syk release from antigen receptor by long-distance conformational uncoupling, PNAS 105 (2008) 11760-11765.

[31] R.A. Grucza, K. Fu¨tterer, A.C. Chan, G. Waksman, Thermodynamic study of the binding of the tandem-SH2 domain of the Syk kinase to a dually phosphorylated ITAM peptide: evidence for two conformers, Biochemistry, 38 (1999) 5024-5033.

[32] V.r. Rolli, M. Gallwitz, T. Wossning, Alexandra Flemming, W.W.A. Schamel, C.Z. rn, M. Reth, Amplification of B cell antigen receptor signaling by a Syk/ITAM positive feedback loop, Molecular Cell, 10 (2002) 1057-1069.

40

[33] Y. Kulathu, E. Hobeika, G. Turchinovich, M. Reth, The kinase Syk as an adaptor controlling sustained calcium signalling and B-cell development, EMBO J, 27 (2008) 1333-1344.

[34] E. Tsang, A.M. Giannetti, D. Shaw, M. Dinh, J.K. Tse, S. Gandhi, H. Ho, S. Wang, E. Papp, J.M. Bradshaw, Molecular mechanism of the Syk activation switch, J Biol Chem, 283 (2008) 32650-32659.

[35] B.L. Slomiany, A. Slomiany, Helicobacter pylori LPS-induced gastric mucosal spleen tyrosine kinase (Syk) recruitment to TLR4 and activation occurs with the involvement of protein kinase Cdelta, Inflammopharmacology, 26 (2018) 805-815.

[36] B.L. Slomiany, A. Slomiany, Syk: a new target for attenuation of Helicobacter pylori-induced gastric mucosal inflammatory responses, Inflammopharmacology, 27 (2019) 203-211.


[38] M. Parola, M. Pinzani, Liver fibrosis: Pathophysiology, pathogenetic targets and clinical issues, Mol Aspects Med, 65 (2019) 37-55.

[39] S.K. Asrani, H. Devarbhavi, J. Eaton, P.S. Kamath, Burden of liver diseases in the world, J Hepatol, 70 (2019) 151-171.

[40] D. Schuppan, M. Ashfaq-Khan, A.T. Yang, Y.O. Kim, Liver fibrosis: Direct antifibrotic agents and targeted therapies, Matrix Biol, 68-69 (2018) 435-451.

[41] R.L. Gieseck Iii, M.S. Wilson, T.A. Wynn, Type 2 immunity in tissue repair and fibrosis, Nature Reviews Immunology, 18 (2017) 62.

[42] T. Tsuchida, S.L. Friedman, Mechanisms of hepatic stellate cell activation, Nat Rev Gastroenterol Hepatol, 14 (2017) 397-411.

[43] K. Nishikawa, Y. Osawa, K. Kimura, Wnt/beta-Catenin Signaling as a Potential Target for the Treatment of Liver Cirrhosis Using Antifibrotic Drugs, Int J Mol Sci, 19 (2018).


[45] J.H. Cheng, H. She, Y.P. Han, J. Wang, S. Xiong, K. Asahina, H. Tsukamoto, Wnt antagonism inhibits hepatic stellate cell activation and liver fibrosis, Am J Physiol Gastrointest Liver Physiol, 294 (2008) G39-49.

[46] B.O. Akcora, G. Storm, R. Bansal, Inhibition of canonical WNT signaling pathway by beta-catenin/CBP inhibitor ICG-001 ameliorates liver fibrosis in vivo through suppression of stromal CXCL12, Biochim Biophys Acta Mol Basis Dis, 1864 (2018) 804-818.

[47] X. Wang, X. Tang, X. Gong, E. Albanis, S.L. Friedman, Z. Mao, Regulation of hepatic stellate cell activation and growth by transcription factor myocyte enhancer factor 2, Gastroenterology, 127 (2004) 1174-1188.

[48] J. Mann, D.A. Mann, Transcriptional regulation of hepatic stellate cells, Adv Drug Deliv Rev, 61 (2009) 497-512.

[49] Y. Tokunaga, Y. Osawa, T. Ohtsuki, Y. Hayashi, K. Yamaji, D. Yamane, M. Hara, K. Munekata, K. Tsukiyama-Kohara, T. Hishima, S. Kojima, K. Kimura, M. Kohara, Selective inhibitor of Wnt/beta-catenin/CBP signaling ameliorates hepatitis C virus-induced liver fibrosis in mouse model, Sci Rep, 7 (2017) 325.

[50] B. Aouar, D. Kovarova, S. Letard, A. Font-Haro, J. Florentin, J. Weber, D. Durantel, L. Chaperot, J. Plumas, K. Trejbalova, J. Hejnar, J.A. Nunes, D. Olive, P. Dubreuil, I. Hirsch, R.

41

Stranska, Dual Role of the Tyrosine Kinase Syk in Regulation of Toll-Like Receptor Signaling in Plasmacytoid Dendritic Cells, PLoS One, 11 (2016) e0156063.

[51] A.R. Zekri, M.M. Hafez, A.A. Bahnassy, Z.K. Hassan, T. Mansour, M.M. Kamal, H.M. Khaled, Genetic profile of Egyptian hepatocellular-carcinoma associated with hepatitis C virus Genotype 4 by 15 K cDNA microarray: preliminary study, BMC Res Notes, 1 (2008) 106.

[52] P. Pileri, Y. Uematsu, S. Campagnoli, G. Galli, F. Falugi, R. Petracca, A.J. Weiner, M. Houghton, D. Rosa, G. Grandi, S. Abrignani, Binding of hepatitis C virus to CD81, Science, 282 (1998) 938-941.

[53] M. Brazzoli, A. Bianchi, S. Filippini, A. Weiner, Q. Zhu, M. Pizza, S. Crotta, CD81 is a central regulator of cellular events required for hepatitis C virus infection of human hepatocytes, J Virol, 82 (2008) 8316-8329.

[54] J. Zhang, G. Randall, A. Higginbottom, P. Monk, C.M. Rice, J.A. McKeating, CD81 is required for hepatitis C virus glycoprotein-mediated viral infection, J Virol, 78 (2004) 1448-1455.

[55] T.N. Bukong, K. Kodys, G. Szabo, Human ezrin-moesin-radixin proteins modulate hepatitis C virus infection, Hepatology, 58 (2013) 1569-1579.

[56] G.P. Coffey, R. Rajapaksa, R. Liu, O. Sharpe, C.C. Kuo, S.W. Krauss, Y. Sagi, R.E. Davis, L.M. Staudt, J.P. Sharman, W.H. Robinson, S. Levy, Engagement of CD81 induces ezrin tyrosine phosphorylation and its cellular redistribution with filamentous actin, J Cell Sci, 122 (2009) 3137-3144.

[57] T.N. Bukong, K. Kodys, G. Szabo, A Novel Human Radixin Peptide Inhibits Hepatitis C Virus Infection at the Level of Cell Entry, Int J Pept Res Ther, 20 (2014) 269-276.

[58] S. Inubushi, M. Nagano-Fujii, K. Kitayama, M. Tanaka, C. An, H. Yokozaki, H. Yamamura, H. Nuriya, M. Kohara, K. Sada, H. Hotta, Hepatitis C virus NS5A protein interacts with and negatively regulates the non-receptor protein tyrosine kinase Syk, J Gen Virol, 89 (2008) 1231-1242.



[61] G. Szabo, P. Mandrekar, A recent perspective on alcohol, immunity, and host defense, Alcohol Clin Exp Res, 33 (2009) 220-232.

[62] F. Stickel, C. Datz, J. Hampe, R. Bataller, Pathophysiology and Management of Alcoholic Liver Disease: Update 2016, Gut Liver, 11 (2017) 173-188.

[63] J. Petrasek, A. Iracheta-Vellve, T. Csak, A. Satishchandran, K. Kodys, E.A. Kurt-Jones, K.A. Fitzgerald, G. Szabo, STING-IRF3 pathway links endoplasmic reticulum stress with hepatocyte apoptosis in early alcoholic liver disease, Proc Natl Acad Sci U S A, 110 (2013) 16544-16549.

[64] C.S. Lieber, Alcoholic fatty liver: its pathogenesis and mechanism of progression to inflammation and fibrosis, Alcohol, 34 (2004) 9-19.

[65] J. Guo, S.L. Friedman, Toll-like receptor 4 signaling in liver injury and hepatic fibrogenesis, Fibrogenesis & Tissue Repair, 3 (2010) 1-19.

[66] G. Szabo, Gut-liver axis in alcoholic liver disease, Gastroenterology, 148 (2015) 30-36. [67] Y.S. Roh, E. Seki, Toll-like receptors in alcoholic liver disease, non-alcoholic steatohepatitis

and carcinogenesis, J Gastroenterol Hepatol, 28 Suppl 1 (2013) 38-42. [68] J. Petrasek, P. Mandrekar, G. Szabo, Toll-like receptors in the pathogenesis of alcoholic

liver disease, Gastroenterol Res Pract, 2010 (2010).

42

[69] Y.I. Miller, S.H. Choi, P. Wiesner, Y.S. Bae, The SYK side of TLR4: signalling mechanisms in response to LPS and minimally oxidized LDL, Br J Pharmacol, 167 (2012) 990-999.

[70] H. Zhou, M. Yu, J. Zhao, B.N. Martin, S. Roychowdhury, M.R. McMullen, E. Wang, P.L. Fox, S. Yamasaki, L.E. Nagy, X. Li, IRAKM-Mincle axis links cell death to inflammation: Pathophysiological implications for chronic alcoholic liver disease, Hepatology, 64 (2016) 1978-1993.

[71] N. Afifiyan, B. Tillman, B.A. French, M. Masouminia, S. Samadzadeh, S.W. French, Over expression of proteins that alter the intracellular signaling pathways in the cytoplasm of the liver cells forming Mallory-Denk bodies, Exp Mol Pathol, 102 (2017) 106-114.

[72] N. Afifiyan, B. Tillman, B.A. French, O. Sweeny, M. Masouminia, S. Samadzadeh, S.W. French, The role of Tec kinase signaling pathways in the development of Mallory Denk Bodies in balloon cells in alcoholic hepatitis, Exp Mol Pathol, 103 (2017) 191-199.

[73] T.N. Bukong, A. Iracheta-Vellve, B. Gyongyosi, A. Ambade, D. Catalano, K. Kodys, G. Szabo, Therapeutic Benefits of Spleen Tyrosine Kinase Inhibitor Administration on Binge Drinking-Induced Alcoholic Liver Injury, Steatosis, and Inflammation in Mice, Alcoholism: Clinical and Experimental Research, 40 (2016) 1524-1530.

[74] M.V. Machado, A.M. Diehl, Pathogenesis of Nonalcoholic Steatohepatitis, Gastroenterology, 150 (2016) 1769-1777.

[75] J.K. Dowman, J.W. Tomlinson, P.N. Newsome, Pathogenesis of non-alcoholic fatty liver disease, QJM, 103 (2010) 71-83.

[76] Y.L. Fang, H. Chen, C.L. Wang, L. Liang, Pathogenesis of non-alcoholic fatty liver disease in children and adolescence: From "two hit theory" to "multiple hit model", World J Gastroenterol, 24 (2018) 2974-2983.

[77] V. Bieghs, C. Trautwein, Innate immune signaling and gut-liver interactions in non-alcoholic fatty liver disease, Hepatobiliary Surg Nutr, 3 (2014) 377-385.

[78] M. Ganz, T.N. Bukong, T. Csak, B. Saha, J.K. Park, A. Ambade, K. Kodys, G. Szabo, Progression of non-alcoholic steatosis to steatohepatitis and fibrosis parallels cumulative accumulation of danger signals that promote inflammation and liver tumors in a high fat-cholesterol-sugar diet model in mice, J Transl Med, 13 (2015) 193.

[79] S. Kiziltas, Toll-like receptors in pathophysiology of liver diseases, World J Hepatol, 8 (2016) 1354-1369.

[80] B. Nath, I. Levin, T. Csak, J. Petrasek, C. Mueller, K. Kodys, D. Catalano, P. Mandrekar, G. Szabo, Hepatocyte-specific hypoxia-inducible factor-1alpha is a determinant of lipid accumulation and liver injury in alcohol-induced steatosis in mice, Hepatology, 53 (2011) 1526-1537.

[81] A. Alisi, G. Carpino, F.L. Oliveira, N. Panera, V. Nobili, E. Gaudio, The Role of Tissue Macrophage-Mediated Inflammation on NAFLD Pathogenesis and Its Clinical Implications, Mediators Inflamm, 2017 (2017) 8162421.

[82] C.P. Day, From fat to inflammation, Gastroenterology, 130 (2006) 207-210. [83] G. Carpino, V. Nobili, A. Renzi, C. De Stefanis, L. Stronati, A. Franchitto, A. Alisi, P. Onori,

R. De Vito, G. Alpini, E. Gaudio, Macrophage Activation in Pediatric Nonalcoholic Fatty Liver Disease (NAFLD) Correlates with Hepatic Progenitor Cell Response via Wnt3a Pathway, PLoS One, 11 (2016) e0157246.

[84] A. Caligiuri, A. Gentilini, F. Marra, Molecular Pathogenesis of NASH, Int J Mol Sci, 17 (2016).

43

[85] J. Yu, S. Marsh, J. Hu, W. Feng, C. Wu, The Pathogenesis of Nonalcoholic Fatty Liver Disease: Interplay between Diet, Gut Microbiota, and Genetic Background, Gastroenterol Res Pract, 2016 (2016) 2862173.

[86] Y. Mao, F. Yu, J. Wang, C. Guo, X. Fan, Autophagy: a new target for nonalcoholic fatty liver disease therapy, Hepat Med, 8 (2016) 27-37.

[87] S. Chattopadhyay, G.C. Sen, Tyrosine phosphorylation in Toll-like receptor signaling, Cytokine Growth Factor Rev, 25 (2014) 533-541.

[88] E. Seki, D.A. Brenner, Toll-like receptors and adaptor molecules in liver disease: update, Hepatology, 48 (2008) 322-335.

[89] A. Chaudhary, T.M. Fresquez, M.J. Naranjo, Tyrosine kinase Syk associates with toll-like receptor 4 and regulates signaling in human monocytic cells, Immunol Cell Biol, 85 (2007) 249-256.

[90] R. Flynn, J.L. Allen, L. Luznik, K.P. MacDonald, K. Paz, K.A. Alexander, A. Vulic, J. Du, A. Panoskaltsis-Mortari, P.A. Taylor, J.C. Poe, J.S. Serody, W.J. Murphy, G.R. Hill, I. Maillard, J. Koreth, C.S. Cutler, R.J. Soiffer, J.H. Antin, J. Ritz, N.J. Chao, R.A. Clynes, S. Sarantopoulos, B.R. Blazar, Targeting Syk-activated B cells in murine and human chronic graft-versus-host disease, Blood, 125 (2015) 4085-4094.

[91] N. Magee, A. Zou, Y. Zhang, Pathogenesis of Nonalcoholic Steatohepatitis: Interactions between Liver Parenchymal and Nonparenchymal Cells, Biomed Res Int, 2016 (2016) 5170402.

[92] G. Szabo, T. Csak, Inflammasomes in liver diseases, J Hepatol, 57 (2012) 642-654. [93] A.F. Malik, R. Hoque, X. Ouyang, A. Ghani, E. Hong, K. Khan, L.B. Moore, G. Ng, F. Munro,

R.A. Flavell, Y. Shi, T.R. Kyriakides, W.Z. Mehal, Inflammasome components Asc and caspase-1 mediate biomaterial-induced inflammation and foreign body response, Proc Natl Acad Sci U S A, 108 (2011) 20095-20100.

[94] T. Csak, M. Ganz, J. Pespisa, K. Kodys, A. Dolganiuc, G. Szabo, Fatty acid and endotoxin activate inflammasomes in mouse hepatocytes that release danger signals to stimulate immune cells, Hepatology, 54 (2011) 133-144.

[95] W.Z. Mehal, The inflammasome in liver injury and non-alcoholic fatty liver disease, Dig Dis, 32 (2014) 507-515.

[96] A.R. Mridha, A. Wree, A.A.B. Robertson, M.M. Yeh, C.D. Johnson, D.M. Van Rooyen, F. Haczeyni, N.C. Teoh, C. Savard, G.N. Ioannou, S.L. Masters, K. Schroder, M.A. Cooper, A.E. Feldstein, G.C. Farrell, NLRP3 inflammasome blockade reduces liver inflammation and fibrosis in experimental NASH in mice, J Hepatol, 66 (2017) 1037-1046.

[97] I.J. Song, Y.M. Yang, S. Inokuchi-Shimizu, Y.S. Roh, L. Yang, E. Seki, The contribution of toll-like receptor signaling to the development of liver fibrosis and cancer in hepatocyte-specific TAK1-deleted mice, Int J Cancer, 142 (2018) 81-91.

[98] Y. Yuan, J. Wang, J. Li, L. Wang, M. Li, Z. Yang, C. Zhang, J.L. Dai, Frequent epigenetic inactivation of spleen tyrosine kinase gene in human hepatocellular carcinoma, Clin Cancer Res, 12 (2006) 6687-6695.

[99] S.H. Shin, K.H. Lee, B.H. Kim, S. Lee, H.S. Lee, J.J. Jang, G.H. Kang, Downregulation of spleen tyrosine kinase in hepatocellular carcinoma by promoter CpG island hypermethylation and its potential role in carcinogenesis, Lab Invest, 94 (2014) 1396-1405.

[100] C. Carone, A. Olivani, R. Dalla Valle, R. Manuguerra, E.M. Silini, T. Trenti, G. Missale, E. Cariani, Immune Gene Expression Profile in Hepatocellular Carcinoma and Surrounding Tissue Predicts Time to Tumor Recurrence, Liver Cancer, 7 (2018) 277-294.

44

[101] J. Hong, K. Hu, Y. Yuan, Y. Sang, Q. Bu, G. Chen, L. Yang, B. Li, P. Huang, D. Chen, Y. Liang, R. Zhang, J. Pan, Y.X. Zeng, T. Kang, CHK1 targets spleen tyrosine kinase (L) for proteolysis in hepatocellular carcinoma, J Clin Invest, 122 (2012) 2165-2175.

[102] J. Hong, Y. Yuan, J. Wang, Y. Liao, R. Zou, C. Zhu, B. Li, Y. Liang, P. Huang, Z. Wang, W. Lin, Y. Zeng, J.L. Dai, R.T. Chung, Expression of variant isoforms of the tyrosine kinase SYK determines the prognosis of hepatocellular carcinoma, Cancer Res, 74 (2014) 1845-1856.

[103] D. Liu, A. Mamorska-Dyga, Syk inhibitors in clinical development for hematological malignancies, J Hematol Oncol, 10 (2017) 145.

[104] G. Thoma, S. Veenstra, R. Strang, J. Blanz, E. Vangrevelinghe, J. Berghausen, C.C. Lee, H.G. Zerwes, Orally bioavailable Syk inhibitors with activity in a rat PK/PD model, Bioorg Med Chem Lett, 25 (2015) 4642-4647.

[105] M.C. Lucas, N. Bhagirath, E. Chiao, D.M. Goldstein, J.C. Hermann, P.Y. Hsu, S. Kirchner, J.J. Kennedy-Smith, A. Kuglstatter, C. Lukacs, J. Menke, L. Niu, F. Padilla, Y. Peng, L. Polonchuk, A. Railkar, M. Slade, M. Soth, D. Xu, P. Yadava, C. Yee, M. Zhou, C. Liao, Using ovality to predict nonmutagenic, orally efficacious pyridazine amides as cell specific spleen tyrosine kinase inhibitors, J Med Chem, 57 (2014) 2683-2691.

[106] G. Can, S. Ayvaz, H. Can, S. Demirtas, H. Aksit, B. Yilmaz, U. Korkmaz, M. Kurt, T. Karaca, The Syk Inhibitor Fostamatinib Decreases the Severity of Colonic Mucosal Damage in a Rodent Model of Colitis, J Crohns Colitis, 9 (2015) 907-917.

[107] M.E. Weinblatt, M.C. Genovese, M. Ho, S. Hollis, K. Rosiak-Jedrychowicz, A. Kavanaugh, D.S. Millson, G. Leon, M. Wang, D.v.d. Heijde, Effects of fostamatinib, an oral spleen tyrosine kinase inhibitor, in rheumatoid arthritis patients with an inadequate response to methotrexate, Arthritis & Rheumatology, 66 (2014) 3255-3264.

[108] J.A. Gomez-Puerta, A. Mocsai, Tyrosine kinase inhibitors for the treatment of rheumatoid arthritis, Current Topics in Medicinal Chemistry, 13 (2013) 760-773.

[109] M. Suljagic, P.G. Longo, S. Bennardo, E. Perlas, G. Leone, L. Laurenti, D.G. Efremov, The Syk inhibitor fostamatinib disodium (R788) inhibits tumor growth in the Emu- TCL1 transgenic mouse model of CLL by blocking antigen-dependent B-cell receptor signaling, Blood, 116 (2010) 4894-4905.

[110] J.W. Friedberg, J. Sharman, J. Sweetenham, P.B. Johnston, J.M. Vose, A. Lacasce, J. Schaefer-Cutillo, S. De Vos, R. Sinha, J.P. Leonard, L.D. Cripe, S.A. Gregory, M.P. Sterba, A.M. Lowe, R. Levy, M.A. Shipp, Inhibition of Syk with fostamatinib disodium has significant clinical activity in non-Hodgkin lymphoma and chronic lymphocytic leukemia, Blood, 115 (2010) 2578-2585.

[111] P.H. Lapchak, L. Kannan, P. Rani, O.N. Pamuk, A. Ioannou, J.J. Dalle Lucca, P. Pine, G.C. Tsokos, Inhibition of Syk activity by R788 in platelets prevents remote lung tissue damage after mesenteric ischemia-reperfusion injury, Am J Physiol Gastrointest Liver Physiol, 302 (2012) G1416-1422.

[112] J. Smith, J.P. McDaid, G. Bhangal, R. Chawanasuntorapoj, E.S. Masuda, H.T. Cook, C.D. Pusey, F.W. Tam, A spleen tyrosine kinase inhibitor reduces the severity of established glomerulonephritis, J Am Soc Nephrol, 21 (2010) 231-236.

[113] R.T. Burke, S. Meadows, M.M. Loriaux, K.S. Currie, S.A. Mitchell, P. Maciejewski, A.S. Clarke, J.A. Dipaolo, B.J. Druker, B.J. Lannutti, S.E. Spurgeon, A potential therapeutic strategy for chronic lymphocytic leukemia by combining idelalisib and GS-9973, a novel spleen tyrosine kinase (Syk) inhibitor, Oncotarget, 5 (2013) 908-915.

45

[114] J. Sharman, M. Hawkins, K. Kolibaba, M. Boxer, L. Klein, M. Wu, J. Hu, S. Abella, C. Yasenchak, An open-label phase 2 trial of entospletinib (GS-9973), a selective spleen tyrosine kinase inhibitor, in chronic lymphocytic leukemia, Blood, 125 (2015) 2336-2343.

[115] J. Sharman, J. Di Paolo, Targeting B-cell receptor signaling kinases in chronic lymphocytic leukemia: the promise of entospletinib, Ther Adv Hematol, 7 (2016) 157-170.

[116] J.M. Burke, A. Shustov, J. Essell, D. Patel-Donnelly, J. Yang, R. Chen, W. Ye, W. Shi, S. Assouline, J. Sharman, An Open-label, Phase II Trial of Entospletinib (GS-9973), a Selective Spleen Tyrosine Kinase Inhibitor, in Diffuse Large B-cell Lymphoma, Clin Lymphoma Myeloma Leuk, 18 (2018) e327-e331.

[117] T. Yoshimoto, T. Hayashi, T. Kondo, M. Kittaka, E.J. Reichenberger, Y. Ueki, Second-Generation SYK Inhibitor Entospletinib Ameliorates Fully Established Inflammation and Bone Destruction in the Cherubism Mouse Model, J Bone Miner Res, 33 (2018) 1513-1519.

[118] G. Coffey, A. Betz, F. DeGuzman, Y. Pak, M. Inagaki, D.C. Baker, S.J. Hollenbach, A. Pandey, U. Sinha, The novel kinase inhibitor PRT062070 (Cerdulatinib) demonstrates efficacy in models of autoimmunity and B-cell cancer, J Pharmacol Exp Ther, 351 (2014) 538-548.

[119] J. Ma, W. Xing, G. Coffey, K. Dresser, K. Lu, A. Guo, G. Raca, A. Pandey, P. Conley, H. Yu, Y.L. Wang, Cerdulatinib, a novel dual SYK-JAK kinase inhibitor, has broad anti-tumor activity in both ABC and GCB types of diffuse large B cell lymphoma, Oncotarget, 6 (2015) 43881-43896.

[120] O. Cen, K. Kannan, J. Huck Sappal, J. Yu, M. Zhang, M. Arikan, A. Ucur, D. Ustek, Y. Cen, L. Gordon, R. Longnecker, Spleen Tyrosine Kinase Inhibitor TAK-659 Prevents Splenomegaly and Tumor Development in a Murine Model of Epstein-Barr Virus-Associated Lymphoma, mSphere, 3 (2018).

[121] N. Purroy, J. Carabia, P. Abrisqueta, L. Egia, M. Aguilo, C. Carpio, C. Palacio, M. Crespo, F. Bosch, Inhibition of BCR signaling using the Syk inhibitor TAK-659 prevents stroma-mediated signaling in chronic lymphocytic leukemia cells, Oncotarget, 8 (2017) 742-756.

[122] S. Braselmann, V. Taylor, H. Zhao, S. Wang, C. Sylvain, M. Baluom, K. Qu, E. Herlaar, A. Lau, C. Young, B.R. Wong, S. Lovell, T. Sun, G. Park, A. Argade, S. Jurcevic, P. Pine, R. Singh, E.B. Grossbard, D.G. Payan, E.S. Masuda, R406, an orally available spleen tyrosine kinase inhibitor blocks fc receptor signaling and reduces immune complex-mediated inflammation, J Pharmacol Exp Ther, 319 (2006) 998-1008.

[123] J.C. Spalton, J. Mori, A.Y. Pollitt, C.E. Hughes, J.A. Eble, S.P. Watson, The novel Syk inhibitor R406 reveals mechanistic differences in the initiation of GPVI and CLEC-2 signaling in platelets, J Thromb Haemost, 7 (2009) 1192-1199.

[124] M.P. Quiroga, K. Balakrishnan, A.V. Kurtova, M. Sivina, M.J. Keating, W.G. Wierda, V. Gandhi, J.A. Burger, B-cell antigen receptor signaling enhances chronic lymphocytic leukemia cell migration and survival: specific targeting with a novel spleen tyrosine kinase inhibitor, R406, Blood, 114 (2009) 1029-1037.

[125] T. Wossning, S. Herzog, F. Kohler, S. Meixlsperger, Y. Kulathu, G. Mittler, A. Abe, U. Fuchs, A. Borkhardt, H. Jumaa, Deregulated Syk inhibits differentiation and induces growth factor-independent proliferation of pre-B cells, J Exp Med, 203 (2006) 2829-2840.

[126] C. Sprissler, D. Belenki, H. Maurer, K. Aumann, D. Pfeifer, C. Klein, T.A. Muller, S. Kissel, J. Hulsdunker, J. Alexandrovski, T. Brummer, H. Jumaa, J. Duyster, C. Dierks, Depletion of STAT5 blocks TEL-SYK-induced APMF-type leukemia with myelofibrosis and myelodysplasia in mice, Blood Cancer J, 4 (2014) e240.

46

[127] M. Baluom, E.B. Grossbard, T. Mant, D.T. Lau, Pharmacokinetics of fostamatinib, a spleen tyrosine kinase (SYK) inhibitor, in healthy human subjects following single and multiple oral dosing in three phase I studies, Br J Clin Pharmacol, 76 (2013) 78-88.

[128] A. Torres-Hernandez, W. Wang, Y. Nikiforov, K. Tejada, L. Torres, A. Kalabin, Y. Wu, M.I.U. Haq, M.Y. Khan, Z. Zhao, W. Su, J. Camargo, M. Hundeyin, B. Diskin, S. Adam, J.A.K. Rossi, E. Kurz, B. Aykut, S.A.A. Shadaloey, J. Leinwand, G. Miller, Targeting SYK signaling in myeloid cells protects against liver fibrosis and hepatocarcinogenesis, Oncogene, (2019).

[129] V.C. Kyttaris, G.C. Tsokos, Syk kinase as a treatment target for therapy in autoimmune diseases, Clin Immunol, 124 (2007) 235-237.

47

2.12 Supplementary Information

Figure S1. Crystal structure of spleen tyrosine kinase complexed with R406 (Protein Data Bank code 3FQS).

49

Chapter 3

Therapeutic Inhibition of Spleen Tyrosine Kinase in Inflammatory

Macrophages using PLGA Nanoparticles for the Treatment of Non-

alcoholic Steatohepatitis

Dhadhang Wahyu Kurniawan, Arun Kumar Jajoriya, Garima Dhawan, Divya Mishra, Josepmaria Argemi, Ramon Bataller, Gert Storm, Durga Prasad Mishra,

Jai Prakash, Ruchi Bansal

Published in: J Control Release. 2018 Oct 28; 288:227-238. doi: 10.1016/j.jconrel.2018.09.004.

50

Abstract

Non-alcoholic steatohepatitis (NASH) is the leading cause of cirrhosis worldwide and the most

rapidly growing indication for liver transplantation. Macrophages are the important cellular

component in the inflammatory milieu in NASH. Inflammatory and pro-fibrotic mediators

produced by macrophages causes significant tissue injury in many inflammatory diseases.

Therefore, inhibition of the inflammatory macrophages would be a promising approach to

attenuate NASH. In this study, we studied the implication of SYK pathway in NASH, and

investigated PLGA nanoparticles-based delivery of SYK pathway inhibitor as an effective and

promising therapeutic approach for the treatment of NASH. We found positive correlation

between SYK expression with the pathogenesis of NASH and alcoholic hepatitis in patients.

Importantly, SYK expression was significantly induced in M1-differentiated inflammatory

macrophages. To inhibit SYK pathway specifically, we used a small-molecule inhibitor R406

that blocks Fc-receptor signalling pathway and reduces immune complex-mediated

inflammation. R406 dose-dependently inhibited nitric-oxide release and M1-specific markers

in M1-differentiated macrophages. Thereafter, we synthesized PLGA nanoparticles to deliver

R406 to increase the drug pharmacokinetics for the efficient treatment of NASH. We

investigated the therapeutic efficacy of R406-PLGA in-vitro in differentiated macrophages, and

in-vivo in Methionine-Choline-deficient (MCD)-diet induced NASH mouse model. R406-PLGA

inhibited M1-specific differentiation markers in RAW and bone-marrow-derived

macrophages. In-vivo, R406 and more strongly R406-PLGA ameliorated fibrosis, inflammation

and steatosis in mice. R406 and more significantly R406-PLGA reduced ALT, AST and total

cholesterol serum levels. These results suggest that delivery of SYK inhibitor using PLGA

nanoparticles can be a potential therapeutic approach for the treatment of Non-alcoholic

steatohepatitis.

51

3.1 Introduction

Cirrhosis and hepatocellular carcinoma (HCC) are the most common liver-related causes of

morbidity associated with NASH (Non-alcoholic steatohepatitis) [1]. In the United States,

NASH has already become the second-leading etiology of liver disease requiring liver

transplantation in adults [2-4]. Advanced fibrosis or cirrhosis has been identified as the most

important histological feature associated with NASH [5]. Liver fibrosis is the condition

characterized by excessive accumulation of abnormal extracellular matrix (ECM) proteins,

which results from chronic non-resolving inflammation [6, 7]. The inflammation triggers the

tissue destruction which further leads to scar tissue formation. Cell death and inflammation

represent two characteristic but intricately linked features of the chronic liver disease that

promote the development of fibrosis [6, 7].

Hepatic injury initiates a cascade of a fibrogenic process initiated by inflammatory and

fibrogenic signals. The activation process is initiated by the release of growth factors,

profibrogenic cytokines and chemokines by the injured hepatocytes, and inflammatory cells

particularly macrophages and other non-parenchymal cells [6-8]. Hepatic macrophages arise

from circulating bone-marrow-derived monocytes, which are recruited to the injured liver or

from proliferating resident macrophages (Kupffer cells). Resident macrophages have shown

to play a significant role in initiaton of the inflammatory responses during tissue injury, while

infiltrating monocyte-derived macrophages leads to chronic liver inflammation and

fibrogenesis [7]. During enhanced recruitment owing to liver damage and environmental cues,

infiltrating monocytes undergo differentiation into two broad subsets of macrophages that

are categorized as classically-activated (M1) or alternatively-activated (M2). The initial

inflammatory response is predominantly mediated by classically-activated (M1-

differentiated) macrophages (activated by Th1 cytokines e.g. IFN-γ and LPS). In contrast, the

resolution phase of inflammation is driven by alternatively-activated (M2-differentiated)

macrophages, stimulated by Th2 cytokines (IL-4 or IL-13) [7].

We have earlier demonstrated crucial role of signaling pathways in liver fibrogenesis [9-11].

Another major signaling pathway involved in the pathogenesis of liver disease is Spleen

tyrosine kinase (SYK) signaling pathway [12-15]. SYK is a cytoplasmic tyrosine kinase of 72 KDa

that belongs to ZAP70/SYK family of the non-receptor protein tyrosine kinases (PTKs) [16]. SYK

52

was identified and known to be expressed in hematopoietic cells, including macrophages, and

has shown to be important in the downstream signalling events that drive inflammatory

pathways of both the innate and adaptive immune systems [16]. While most studies focused

on hematopoietic cells, SYK has also been shown to be expressed in non-hematopoietic cells

including fibroblasts and hepatocytes [15, 17]. A recent study has reported the up-regulation

of SYK in hepatocytes and activated HSCs during liver fibrosis that promotes HSCs activation

and proliferation via crosstalk between cytokines secreted by hepatocytes and HSCs [15].

Many studies have also demonstrated the role of SYK in various inflammatory and fibrotic

diseases, such as Rheumatoid Arthritis [18, 19], allergic asthma/rhinitis [20, 21], renal

interstitial fibrosis [22] and that SYK inhibition could be a therapeutic strategy for the

treatment of inflammation- and fibrosis-related diseases [15, 16, 18, 20, 22]. SYK functions via

an immuno-receptor tyrosine-based activation motif (ITAM) or Toll-like receptors (TLRs) which

are activated by pathogen-associated molecular patterns (PAMP) [16, 23]. Selective SYK

inhibition or deletion in macrophages has shown to reduce macrophage activation as shown

by reduced production of FcγR (Fc gamma receptor), CCL2 (or MCP1, macrophage chemotactic

protein 1), IL-6 and TNF-α (Tumor necrosis factor alpha) [16, 23]. Therapeutic inhibition of SYK

has shown to ameliorate inflammation and steatosis in Alcoholic liver diseases [12, 13], and

suppressed liver fibrosis via inhibition of HSC activation in animal models [15]. However,

implication and inhibition of SYK pathway in NASH and specifically in M1 inflammatory

macrophages has not been investigated yet.

Macrophages and especially the liver-resident Kupffer cells are in the focus of nanomedicine

due to their highly efficient and non-specific uptake of many nanomaterials as well as due to

their critical pathogenic functions during inflammation and fibrogenesis [24]. One of the

nanoparticles is Poly(lactic-co-glycolic acid) (PLGA)-based nanoparticles that are widely used

as drug delivery carriers in various biomedical applications such as vaccination, cancer,

inflammation, and other diseases [25, 26]. PLGA is a FDA-approved biodegradable polymer

with favorable mechanical properties, biodegradation kinetics, drug compatibility and

biocompatibility since PLGA is biologically hydrolyzed to metabolite monomers, lactic acid and

glycolic acid [25]. These two monomers are endogenously metabolized by the body via the

Krebs cycle therefore no systemic toxicity is associated with the utilization of PLGA for drug

53

delivery. PLGA-nanoparticles are internalized in cells partly through fluid-phase pinocytosis

and through Clathrin-mediated endocytosis [27].

In this study, we have analyzed the SYK expression in NASH and alcoholic hepatitis (AH)

patients. We have further examined the expression and activation of SYK signaling pathway in

inflammatory macrophages. We thereafter, using small-molecule SYK inhibitor R406, studied

the implication of therapeutic SYK inhibition in inflammatory macrophages. For the efficient

delivery of SYK inhibitor R406 in vivo, we synthesized R406-encapsulated PLGA nanoparticles

and investigated their therapeutic efficacy in vitro in M1-differentiated RAW macrophages

and murine bone marrow derived macrophages, and in vivo in MCD diet-induced NASH mouse

model.

3.2 Materials and methods

3.2.1 Cell lines

Murine RAW 264.7 macrophages were obtained from the American Type Culture Collection

(ATCC, Manassas, VA, USA). RAW macrophages were cultured in Roswell Park Memorial

Institute (RPMI) 1640 medium (Lonza, Verviers, Belgium) supplemented with 2 mM L-

glutamine (Sigma, St. Louis, MO), 10 % fetal bovine serum (FBS, Lonza) and antibiotics (50

U/mL Penicillin and 50 µg/mL streptomycin, Sigma).

3.2.2 Bone marrow derived macrophages

Bone marrow-derived macrophage (BMDM) cultures were freshly isolated from C57BL/6 mice

as described previously elsewhere [28]. Briefly, femurs and tibias were flushed with

Dulbecco's modified Eagle's medium (DMEM) (Life Technologies, Carlsbad, CA, USA) with 10

% FBS (Lonza) to collect bone marrow. Cells were then triturated 3-5 times through an 18-

gauge needle and centrifuged at 1200 rpm for 5 minutes. After removing supernatant, RBCs

were lysed with the lysis buffer and the remaining cells were washed in DMEM + 10 % FBS and

plated at 1 × 106 cells/ml in DMEM supplemented with 1% penicillin/streptomycin, 1 % HEPES,

0.001% β-mercaptoethanol, 10 % FBS, and 20 % supernatant from mouse 3T3 fibroblasts

(obtained from ATCC and cultured in cultured in (DMEM) medium supplemented with 2 mM

L-glutamine (Sigma), 10 % FBS (Lonza) and antibiotics (Sigma)). The fibroblasts conditioned

medium is required to promote differentiation of bone marrow cells into macrophages (7 –

54

10 days). Media was changed on days 2, 4, and 6 and cells were re-plated on day 7 for

performing experiments.

3.2.3 PLGA nanoparticles preparation

Poly (D,L-lactide-co-glycolide) (PLGA) nanoparticles were prepared by the emulsification

solvent evaporation method as described earlier [29]. Briefly, the internal phase containing

100 µL ethyl acetate containing 2.5 mg PLGA (Poly (D,L-lactide-co-glycolide, with a co-

monomer ratio of 50 : 50 (lactic/glycolic acid), Mw = 17,000, Corbion Purac, Gorinchem, The

Netherlands) and 40 μg R406 (Mw = 628.63, Selleckchem, Boston, NY) was emulsified into an

external aqueous phase of 100 µL of 2 % Poly (vinyl-alcohol) (PVA, Sigma) (w/v), drop by drop

under constant vortexing at maximum speed. The formed o/w microemulsion was

subsequently sonicated for 2 min at 5% power output. The emulsion was transferred into 40

mL of 0.3 % PVA (w/v) under magnetic stirring, and stirred overnight at room temperature to

evaporate organic solvent ethyl acetate and to solidify the emulsified nanodroplets. The

formed nanoparticles were isolated by centrifugation for 60 min at 16,000 rpm (rotor SS-34,

Sorvall RC-5C Plus, Kendro Lab, USA) and the supernatant was discarded. The resulting

nanoparticles were characterized for their average size and size distribution by dynamic light

scattering (DLS) and zeta potential measurements using a Nano ZS Zetasizer (Malvern

Instruments Ltd., Malvern, UK). R406-PLGA nanoparticles were characterized using Scanning

electron microscope (JEOL JSM-IT 100, Akishima, Japan) with a secondary electron detector

and an acceleration voltage of 3–5 kV. The nanoparticle dispersions were freeze-dried before-

hand and mounted on conductive carbon tape.

3.2.3.1 Determination of R406 encapsulation

R406 drug encapsulation (% DE) was done by developed HPLC method using UPLC

(Thermoscientific™ Dionex™ Ultimate™ 3000 system). Briefly, 50 µL samples R406-PLGA in

suspension were centrifuged using MicroCL 17 centrifuge (Thermoscientific) for 5 min at

13,300 rpm. Filtrates were discarded and the pellet was dissolved in DMSO and measured with

UPLC at λmax 261 nm (Figure S1A). Different drug concentrations were used, and measured

with UPLC and plotted as a standard curve (Figure S1B) for determination of drug

concentration.

55

3.2.3.2 In vitro drug release and uptake by RAW macrophage

To perform the drug release study of R406 and R406-PLGA, we plated the RAW cells (5 x 105

cells/well) in 12 well plates and cultured overnight. Then we added R406 and R406-PLGA in

the cells. Furthermore, 100 µL of samples were collected and replaced by an equal volume of

the medium at time intervals (0, 6, 12, 24, and 48 h). The amount of drug released into the

medium was calculated according to a standard curve of R406 which is measured with UPLC.

Each experiment was conducted as three independent experiment (n = 3). We also performed

the drug release study of R406 and R406-PLGA without RAW cells, i.e. in the complete medium

for RAW cells. The drug and the nanoparticles with the medium incubated in a shaking

incubator at 37°C. The rest of the procedure was same as drug release study with RAW cells.

The drug uptake was measured as % total drug (at different time points) - % total drug left in

the medium (at different time points). The graphs were ploted as % cumulative drug release

(to depict drug release) and % total drug uptake (to depict drug uptake by RAW macrophages).

3.2.4 In vitro efficacy studies in RAW cell macrophages

For differentiation of RAW macrophages, cells were plated (1 x 106 cells/well) in 12 well plates

and cultured overnight. The cells were then incubated with LPS (100 ng/mL, Sigma) and IFNγ

(10 ng/mL, Peprotech, Rocky Hill, NJ) for M1 differentiation, and IL-4 (10 ng/mL, Peprotech)

and IL-13 (10 ng/mL, Peprotech) for M2 differentiation for 24 h. To study the effect of SYK

inhibitor; RAW cells were incubated with medium alone, 0.5, 1.0 and 5.0 μM of SYK inhibitor

R406 (Selleckchem, Boston, NY) together with M1 differentiation stimulus for 24 h. For the

effect of SYK inhibitor R406 loaded nanoparticles (R406-PLGA), M1-differentiated

macrophages were incubated either with 5 μM R406, R406-PLGA (equivalent dose, 5 μM) or

PLGA (empty nanoparticles, equimolar concentration as R406-PLGA). Cells were then lysed

either with protein lysis buffer for western blot analysis or RNA lysis buffer for quantitative

real-time PCR analysis. All the efficacy studies were performed at least 3 times independently.

3.2.5 In vitro efficacy studies in freshly isolated murine bone marrow derived macrophages

Bone marrow derived macrophages were plated at a density of 1 × 106/mL and differentiated

into M1 macrophages using LPS (100 ng/mL, sigma) and IFNγ (10 ng/mL, Peprotech), or M2

macrophages using IL-4 (10 ng/mL, Peprotech) and IL-13 (10 ng/mL, Peprotech). For efficacy

studies, cells were incubated with medium alone, SYK-loaded nanoparticles (R406-PLGA),

56

empty nanoparticles (PLGA) and free drug (R406) together with M1 stimulus. After 24 h of

incubation, cells were lysed for RNA isolation and real-time PCR analysis. Three independent

experiments were performed.

3.2.6 Nitric oxide (NO) release bioassay

The effect of R406 on M1 macrophages was assessed by measuring the inhibition of nitric

oxide (NO) release as described earlier [30], a stable NO metabolite produced by M1

macrophages. RAW cells (2x105 cells/200 μL/well) were seeded in 96-well plates, were

cultured overnight and incubated with IFNγ (10 ng/mL, Peprotech) and LPS (100 ng/mL, Sigma)

together with different concentrations of SYK inhibitor R406 (0, 0.5, 1.0, and 5.0 μM). After 24

hrs, 100 μL culture supernatant was added to 100 μL of Griess reagent (1% sulfanilamide

(Sigma), 0.1% naphthyl ethylenediamine dihydrochloride (Sigma); 3% phosphoric acid (Sigma))

and the absorbance at 540 nm was measured with a microplate reader. NO release assays

were performed in triplicates in three independent experiments.

3.2.7 Cell viability assay

To assess the effects on cell viability, cells were plated in 96 well plates, cultured overnight

and incubated with different concentrations of R406 (0.1, 0.5, 1.0 and 5.0 uM) together with

M1 stimulus (100 ng/mL LPS and 10 ng/mL IFNγ) for 24 h. To study the effects of R406-PLGA

on cell viability, cells were incubated with R406-PLGA (equivalent dose, 5 μM), PLGA (empty

nanoparticles, equimolar concentration as R406-PLGA) or free drug R406 (5 μM) together with

M1 stimulus for 48 h. Cell viability assays were performed using Alamar Blue reagent

(Invitrogen, Carlsbad, CA, USA) as per manufacturer's instructions. The results are represented

as % cell viability normalized to untreated control cells (at 100%). All measurements were

performed in triplicates in three independent experiments.

3.2.8 Methionine and choline-deficient (MCD) diet model

Animal studies were conducted in strict accordance with the guidelines and ethical regulations

for the Care and Use of Laboratory Animals, CSIR-Central Drug Research Institute, India. The

protocols were approved by the Institutional Animal Ethics Committee at the CSIR-Central

Drug Research Institute, India. 8-week old male C57BL/6 mice (Jackson Laboratories, Bar

Harbor, USA) were fed on MCD diet (C1070, Altromin GmbH, Lage, Germany) for 4 weeks while

the controls received regular chow diet (n=4) for 4 weeks. In this study, we used male mice

57

since it has been shown that male mice develop more severe fatty liver disease as compared

to female mice. Furthermore, male mice were shown to be more vulnerable to hepatic lipid

accumulation while on MCD diet as compared to female mice. This study also suggested the

reduction of fatty liver disease development in female mice due to the sex hormones e.g.

estrogen [31]. MCD mice were treated for two weeks intravenously (three times per week)

with vehicle (PBS, n=5), R406 (10 mg/kg, n=5), R406-PLGA (equivalent dose of 10 mg/kg, n=5)

or PLGA (empty nanoparticles, equimolar concentrations as R406-PLGA, n=5) while continuing

MCD diet (Figure S2) At the end of the experiment, mice were euthanised and the liver tissues

and blood samples were collected for analysis. Alanine aminotransferase (ALT), aspartate

aminotransferase (AST), total plasma cholesterol levels, and plasma triglycerides levels were

measured by standard automated laboratory methods.

3.2.9 RNA extraction, reverse transcription, quantitative real-time PCR

Total RNA from cells and liver tissues was isolated using GenElute Total RNA Miniprep Kit

(Sigma) and SV total RNA isolation system (Promega Corporation, Madison, WI, USA),

respectively, according to manufacturer’s instructions. The RNA concentration was

quantitated by a UV spectrophotometer (NanoDrop Technologies, Wilmington, DE). Total RNA

(1 μg) was reverse-transcribed using iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA). All the

primers were purchased from Sigma-Genoysis (Haverhill, UK). Real-time PCR was performed

using 2x SensiMix SYBR and Fluorescein Kit (Bioline, QT615-05, Luckenwalde, Germany), 20 ng

cDNA and pre-tested gene-specific primer sets. The cycling conditions for the BioRad CFX384

Real-Time PCR detection system were 95°C for 10 min, 40 cycles of 95°C/15 sec, 72°C/15 sec,

and 58°C/15 sec. Finally, cycle threshold (Ct) values were normalized to reference gene GAPDH

and fold changes in expression were calculated using the 2-ΔΔCt method. All primers were

purchased from Sigma-Genosys (Haverhill, UK). The primer sequences are given in Table S1.

3.2.10 Western blot analysis

Cells were lysed using 1x Cell Lysis Buffer containing 1x DTT reducing agent (Cell Signaling

Technology, Leiden, the Netherlands) and homogenized using ultra-sonication on ice. The

samples were boiled and subjected to SDS-PAGE with 10% Tris-glycine gels (Life Technologies)

followed by protein transfer onto PVDF membrane. The membranes were developed

according to the standard protocols using primary and secondary antibodies (as mentioned in

58

Table S2). The bands were developed using ECL detection reagent (Perkin Elmer Inc., Walthan,

MA) and photographed using FluorChem M Imaging System (ProteinSimple, Alpha Innotech,

San Leandro CA). Intensity of individual bands were quantified using NIH ImageJ densitometry

software (NIH, Bethesda, MD), and expressed as % relative to β-actin or SYK.

3.2.11 Histological stainings

3.2.11.1 Immunostainings

Liver tissues were harvested and transferred to Tissue-Tek OCT embedding medium (Sakura

Finetek, Torrance, CA) and snap-frozen in 2-methyl butane chilled in a dry ice. Cryosections (6

µm) were cut using a Leica CM 3050 cryostat (Leica Microsystems, Nussloch, Germany). The

sections were air-dried and fixed with acetone for 20 min. Tissue sections were rehydrated

with PBS and incubated with the primary antibody for overnight at 4°C. Sections then were

incubated with horseradish peroxidase (HRP)-conjugated secondary antibody for 1 h at room

temperature. Then incubated with HRP-conjugated tertiary antibody for 1 h at room

temperature. Afterwards, peroxidase activity was developed using AEC (3-amino-9-ethyl

carbazole) substrate kit (Life Technologies, Carlsbad, CA) for 20 min and nuclei were

counterstained with hematoxylin (Fluka Chemie, Buchs, Switzerland). Endogenous peroxidase

activity was blocked by 3% H2O2 prepared in methanol. The sections were mounted with

Aquatex mounting medium (Merck, Darmstadt, Germany) and were scanned using

Hamamatsu NanoZoomer Digital slide scanner 2.0HT (Hamamatsu Photonics, Bridgewater,

NJ). The details about the antibodies used for immunostainings are provided in Table S2.

3.2.11.2 Oil-Red-O staining

Oil-Red-O stock solution was prepared by dissolving 0.3 g Oil-Red-O (Sigma) in 100 mL

isopropanol. Sections were fixed in 4% formalin for 20 min and were then stained in Oil-Red-

O solution as per manufacturer’s instructions. Briefly, formalin-fixed sections were rinsed with

60% isopropanol followed by staining with freshly prepared Oil Red O working solution for 15

min. Thereafter, sections were rinsed with 60% isopropanol and nuclei were counterstained

with hematoxylin (Fluka Chemie). Finally, sections were rinsed with tap water and were

mounted with aquatex mounting medium (Merck).

59

3.2.11.3 Hematoxylin and Eosin staining

Sections were fixed with 4% formalin for 20 min and then rinsed with distilled water. The

sections were incubated with hematoxylin for 15 min followed by washings with tap water.

Thereafter, sections were incubated with eosin solution for 1.5 min followed by wash in 96%

ethanol, dehydration with ethanol and were mounted with VectaMount mounting medium

(Vector Laboratories, Burlingame, CA).

3.2.11.4 Quantitative histological analyses

For quantitation, stained sections were scanned at high resolution using Hamamatsu

NanoZoomer Digital slide scanner 2.0HT (Hamamatsu Photonic). High resolution scans were

viewed using NanoZoomer Digital Pathology (NDP2.0) viewer software (Hamamatsu

Photonic). About 20 images (100 x) of each entire section (from NDP) were imported into

ImageJ software and were analyzed quantitatively at a fixed threshold.

3.2.12 SYK gene expression in the human liver tissues

SYK mRNA expression was assessed in the publicly available transcriptome datasets of liver

tissue from patients with NASH (GSE48452) [32] obtained from the National Center for

Biotechnology Information Gene Expression Omnibus database (GEO). Patients were

categorized into 4 groups as per biopsy-based pathological investigation: control group

(n=23); NAFLD activity score NAS 1-2 (n=13); NAS 3-4 (n=7) and NAS 5-6 (n=15).

High-throughput transcriptome profiling was performed using Illumina HiSeq2000 platform

(San Diego, CA) with liver samples provided by the InTeam Consortium (Human Biorepository

Core, University of Pittsburgh, PA) as described recently [18]. SYK mRNA expression was

evaluated in patients with different phenotypes: 11 patients with non-severe alcoholic

hepatitis (with Maddrey’s discriminant function, MDF ≤32); AH responders (with severe

alcoholic hepatitis (MDF>32) patients responsive to steroids, n=9) AH non-responders (AH

severe alcoholic hepatitis (MDF>32) patients non-responsive to steroids therapy, n=9) and 10

patients with explants who underwent early liver transplantation for severe alcoholic

hepatitis. Controls (n=10) were non-diseased livers obtained from biopsied single nodules,

whose histology was without significant alterations.

60

3.2.13 Statistical analyses

All the data are presented as a mean ± standard error of the mean (SEM). The graphs and

statistical analyses were performed using GraphPad Prism version 5.02 (GraphPad Prism

Software, Inc., La Jolla, CA). Comparison to control group were analyzed using unpaired

students’ t-test while multiple comparisons between different groups were performed by one-

way analysis of variance (ANOVA) with Bonferroni post-hoc test. The differences were

considered significant at p < 0.05.

3.3 Results and Discussion

3.3.1 Upregulation of SYK expression in NASH and AH patients, and inflammatory M1 macrophages

Previous studies have documented that the functional inhibition of SYK pathway attenuates

the severity of inflammatory diseases and fibrotic diseases [12, 13, 15, 16]. In this study, we

investigated the association of SYK expression with pathogenesis of NASH (non-alcoholic

steatohepatitis) and AH (Alcoholic hepatitis). Using transcriptome analysis, we found a highly

significant induction of SYK expression that correlated with the increasing NAS score (NAFLD

activity score) as compared to normal livers (GEO accession number: GSE48452) (Figure 1A).

In AH patients, we found a significant correlation between AH severity and SYK expression

(Figure 1B). Likewise, previous studies have shown correlation of SYK and SYK pathway

activation in liver fibrosis and alcoholic liver disease (ALD) patients as compared to healthy

controls [13, 15]. Since macrophages are the key pathogenic cells in NASH and inflammatory

liver diseases [33], we analyzed the SYK expression in differentiated murine RAW

macrophages i.e. LPS- and IFNγ-induced M1-differentiated inflammatory macrophages, and

IL-4- and IL-13-induced M2-differentiated restorative macrophages. We first confirmed the

differentiation of macrophages using M1 and M2-specific markers and found that M1-

differentiated macrophages significantly expressed M1 markers i.e. iNOS (inducible nitric

oxide synthase), IL-1β (Interleukin-1-beta), CCL2 (or MCP1, macrophage chemotactic protein-

1) and IL-6 (Interleukin-6) while M2-differentiated macrophages expressed M2 markers i.e.

MRC1 (mannose receptor complex 1) and ARG (Arginase I) (Figure 1C). We then analyzed SYK

expression in these differently differentiated macrophages. We observed significant

upregulation of SYK mRNA and protein expression in LPS- and IFNγ-differentiated M1

inflammatory macrophages as compared to undifferentiated macrophages, and IL-4 and IL-

61

13-mediated M2-differentiated restorative macrophages (Figure 1D,E). These results suggest

SYK as an appropriate molecular target in macrophages and inflammatory liver diseases

especially NASH.

Figure 1. Upregulation of SYK expression in NASH and AH patients, and differentiated macrophages. (A) Normalized SYK mRNA expression in the liver tissues from NASH patients: Control (n=23); NAFLD activity score (NAS) 1-2 (n=13); NAS 3-4 (n=7); NAS 5-6 (n=15). (B) Normalized SYK mRNA expression in the alcoholic hepatitis (AH) patients: controls (non-diseased livers, n=10); AH non-severe (n=11 patients); AH responders (AH patients responsive to steroids, n=9) AH non-responders (AH patients non-responsive to steroids therapy, n=9); AH explants (AH severe patients with early liver trannsplantation, n=11). (C) Gene expression of macrophage differentiation markers: iNOS, IL-1β, CCL2, IL-6 (M1 macrophages); MRC1 and ARG1 (M2 macrophages). (D) SYK gene expression in the undifferentiated macrophage (control), M1 and M2 macrophages. (E) SYK protein expression as compared to β-actin and the respective quantitative analysis. Data are presented as mean + SEM. *p<0.05, **p<0.01 and ***p<0.001 denotes significance.

62

3.3.2 SYK inhibitor R406 inhibited LPS- and IFNγ-induced activation of murine RAW macrophages

Since SYK expression was upregulated in M1-differentiated inflammatory macrophages, we

explored the activation of this receptor in macrophages. We used R406 which is a potent SYK

inhibitor (Figure 2A) to inhibit SYK signaling pathway, that has been used earlier [13]. We first

examined the phosphorylation of SYK and observed that increased SYK expression in M1

macrophages was accompanied with increased phosphorylation of SYK (Figure 2B,C). We then

tested the effect of SYK inhibitor, R406 on SYK phosphorylation and functional activation i.e.

nitric oxide (NO) release in M1-differentiated macrophages. We found that R406

concentration dependently reduced SYK phosphorylation i.e. SYK signalling pathway (Figure

2B,C) and LPS- and IFNγ-induced NO release (Figure 2D). In addition, we performed viability

studies and found no toxicity with R406 (Figure S3).

Figure 2. Inhibition of SYK phosphorylation and nitric oxide release by SYK inhibitor R406 in RAW macrophages. (A) Structure of R406, a SYK inhibitor. (B) Protein expression and (C) quantitative densitometry analysis of phosphorylated SYK (pSYK) as compared to SYK in RAW 264.7 macrophages after incubation with medium alone, M2 stimulus (10 ng/mL IL-4 and 10 ng/mL IL-13) and M1 stimulus (100 ng/mL LPS + 10 ng/mL IFNγ) without and with R406 (0, 0.5, 1, and 5 µM). (D) Nitric oxide (NO) release as measured in the culture supernatant of RAW 264.7 cells incubated with medium alone (M0 or control) or M1 stimulus (100 ng/mL LPS + 10 ng/mL IFNγ) with R406 (0, 0.5, 1, and 5 µM). ##p<0.01 denotes significance versus control M0 undifferentiated macrophages. *p < 0.05, **p < 0.01, and ***p < 0.001 denotes significance versus M1-differentiated macrophages.

63

3.3.3 SYK inhibitor R406 inhibited gene expression of inflammatory markers in mouse RAW macrophages

We further examined the efficacy of R406 on gene expression of inflammatory markers in M1-

differentiated macrophages. We observed that R406 dose-dependently inhibited LPS- and

IFNγ-induced gene expression of M1 markers i.e. IL1β, Fc gamma receptor 1 (FcγR1), iNOS,

CCL2 (or MCP1), IL-6 and CCR2 (C-C motif chemokine receptor 2) (Figure 3A-F). These results

are consistent with previous studies in experimental animal models [13, 34, 35]. Altogether,

these results suggest that SYK inhibitor R406 treatment can potentially inhibit inflammatory

macrophages and hence R406 has high potency for the treatment of inflammation-associated

diseases. Inflammation in the liver protects this organ from infection and injury, but excessive

inflammation may lead to extensive loss of hepatocytes, ischemia-reperfusion injury,

metabolic alterations, and eventually hepatic damage. Therefore, inhibition of inflammation

or inflammatory macrophages via SYK pathway inhibition might be promising approach for

the treatment of inflammatory liver diseases.

Figure 3. Inhibition of M1-specific differentiation and inflammatory markers by R406 in RAW macrophages. Gene expression of M1 markers IL-1β (A); FcγR1 (B); iNOS (C); CCL2 (D); IL-6 (E); and CCR2 (F) in RAW 264.7 cells after incubation with medium alone (M0) or M1 stimulus with R406 (0, 0.5, 1, and 5 µM). expression values for the respective genes in untreated M1 macrophages were set

64

at 1.0 to calculate the relative gene expression. Data are presented as mean + SEM. #p<0.05, ##p<0.01 denotes significance versus control M0 macrophages. *p<0.05, **p<0.01 and ***p<0.001 denotes significance versus M1-differentiated macrophages.

3.3.4 Preparation and characterization of R406-PLGA nanoparticles

Since small-molecule tyrosine kinase inhibitors have been shown to have poor

pharmacokinetics and bioavailability [36], we prepared R406-encapsulated PLGA

nanoparticles (R406-PLGA, Figure 4A) to improve the pharmacokinetics and thereof in vivo

therapeutic efficacy of R406. R406-PLGA nanoparticles (R406-PLGA) were analyzed for the

morphology, size and zeta potential (Figure 4B,C). R406-PLGA has Z-average 160 nm, with

almost comparable size to the control empty PLGA nanoparticles (PLGA) (Figure 4C). The zeta

potential was towards negative as shown in Figure 4C. We also measured the drug

encapsulation of R406 in the PLGA nanoparticles using HPLC (Figure S1A,B).

Figure 4. Characterization of R406-PLGA nanoparticles. (A) Representative image of R406-PLGA nanoparticles as characterized by scanning electron microscope (SEM); (B) Schematic presentation depicting the drug (R406) encapsulated in the PLGA nanoparticles; (C) The average particle size, polydispersity index (PDI), and zeta potential (ZP) of R406-PLGA NPs (or R406-PLGA) as compared to empty-NPs (PLGA) (n=3); (D) Physical stability (size stability) of R406-PLGA NPs for 46 days; (E) Protein expression and (F) quantitative densitometry analysis of pSYK compared to SYK on RAW 264.7 cells after incubation with medium alone (control), M2 stimulus (10 ng/mL IL-4 and 10 ng/mL IL-13), M1 stimulus (100 ng/mL LPS + 10 ng/mL IFNγ) with or without R406 (free drug), R406-PLGA or empty-NPs (PLGA). Data are presented as mean + SEM. *p < 0.05 and **p < 0.01 denotes significance.

The drug encapsulation of R406 in the PLGA nanoparticles was found to be 37,49%. We further

examined the physical stability of the R406-PLGA nanoparticles and observed that the particle

65

size remained relatively stable at around 160 nm size after 46 days. These results suggest the

successful synthesis of R406-PLGA nanoparticles with favorable particle size and stability for

appropriate delivery of SYK inhibitor.

3.3.5 R406-PLGA nanoparticles inhibited the SYK signalling pathway and gene expression of inflammatory markers in RAW macrophages

Following successful synthesis of R406-PLGA nanoparticles, we examined the R406 efficacy

after encapsulation in PLGA nanoparticles. We first tested R406-PLGA nanoparticles in RAW

macrophages for inhibition of SYK pathway and we found that both R406 and R406-PLGA

nanoparticles significantly inhibited the SYK signalling pathway (SYK phosphorylation) as

shown in Figure 4E,F. While empty PLGA nanoparticles alone didn’t show any effect in SYK

phosphorylation (Figure 4E,F). We further investigated the therapeutic effects of R406-PLGA

nanoparticles in M1-differentiated inflammatory macrophages. Interestingly, both R406 and

R406-PLGA nanoparticles significantly inhibited the gene expression of M1-specific markers

i.e. iNOS, FcγR1, IL-6, IL-1β, CCL2 (or MCP1) and IL-1α (Figure 5A-F).

However, we observed R406 was more effective than R406-PLGA nanoparticles which is

probably due to slow drug release kinetics of PLGA nanoparticles [25]. Generally, higher

content of polyglycolide leads to quicker rates of degradation with an exception of 50:50 ratio

of PLA/PGA which is used in this study exhibits the fastest degradation. As per modeling

studies, PLA/PGA 50:50 demonstrated release kinetics of about 2-3 weeks to achieve 100%

drug release [25]. Furthermore, studies have found, that the type of drug also plays a critical

role in determining the release kinetics [37]. We performed drug release studies using R406-

PLGA nanoparticles and found that % cumulative release of R406 from PLGA nanoparticles

increases gradually after incubation for 48 h as compared to the free drug (Figure S4A).

Furthermore, we performed drug uptake studies and observed that R406 (in free form) was

significantly taken up more in RAW macrophages (about 54% at 48 h) as compared to R406

(from PLGA nanoparticles) (about 45% at 48 h) as can be seen in Figure S4B. These data

supports the reduced in vitro therapeutic efficacy of R406-PLGA as compared to free R406,

however further suggest slow and gradual release of R406 which will be desired in vivo.

Essentially, these results suggest that R406 retained its therapeutic effects following

encapsulation in PLGA nanoparticles. We also performed the cell viability studies with R406-

PLGA nanoparticles and observed no effect on cell viability as shown in Figure S5.

66

3.3.6 R406-PLGA nanoparticles inhibited the SYK signalling pathway and gene expression of inflammatory markers in murine bone marrow derived macrophages

In general, immortalized cells are not considered normal as they divide indefinitely and

express unique gene patterns that are not found in cell type in vivo and hence they might not

have the relevant attributes of normal cells. Thus, it is important to validate the characteristics

and results on primary cells that have not been passaged many times. To mimic the in vivo

more closely, we performed studies on primary murine bone marrow derived macrophages

(BMDMs).

We first investigated the expression of SYK in BMDMs and observed significant upregulation

of SYK expression in M1-differentiated BMDMs as compared to undifferentiated and M2-

differentiated BMDMs (Figure 6A). Thereafter, we examined the effect of R406-PLGA

nanoparticles on the gene expression of inflammatory markers in M1-differentaited

inflammatory BMDMs. We found that both R406 and R406-PLGA nanoparticles induced highly

significant down-regulation in the expression levels of major inflammatory markers i.e. CCL2,

Figure 5. Inhibition of inflammatory markers or M1 differentiation markers by R406 and R406-PLGA in RAW macrophages. Gene expression of inflammatory or M1-differentiation macrophages markers in RAW 264.7 cells: (A) iNOS; (B) FcγR1; (C) IL-6; (D) IL-1β; (E) CCL2; (F) IL-1α after incubation with medium alone (M0 undifferentiated macrophages) or M1 stimulus (100 ng/mL LPS + 10 ng/mL IFNγ) with or without R406 (free drug), R406-PLGA or empty-NPs (PLGA). Data are presented as mean ± SEM. #p<0.05, ##p<0.01 denotes significance versus control M0 macrophages. Data are presented as mean + SEM. *p<0.05, **p<0.01, and ***p<0.001 denotes significance versus M1-differentiated macrophages.

67

IL-1α and IL-6 as shown in Figure 6B-D. These results further confirmed our previous results

in RAW macrophages and suggest that R406 retained its therapeutic efficacy after

encapsulation in PLGA nanoparticles. Notably, we did not observe any effects from empty

PLGA nanoparticles in RAW macrophages and in BMDMs (Figure 5A-F, 6B-D).

Figure 6. Inhibition of inflammatory markers or M1 differentiation markers by R406 and R406-PLGA in murine bone marrow derived macrophages. (A) Normalized SYK expression in undifferentiated M0, M1-differentiated and M2-differentiated macrophages. Gene expression of inflammatory markers: (B) CCL2; (C) IL-1α; and (D) IL-6 after incubation with medium alone (undifferentiated M0 macrophages) or M1 stimulus (100 ng/mL LPS + 10 ng/mL IFNγ) with or without R406 (free drug), R406-PLGA or empty-NPs (PLGA). Data are presented as mean + SEM. #p<0.05, ##p<0.01 denotes significance versus control M0 macrophages. *p<0.05, **p<0.01 and ***p<0.001 denotes significance versus M1-differentiated macrophages.

3.3.7 R406-PLGA nanoparticles ameliorated liver inflammation, fibrosis and steatosis in MCD diet induced NASH mouse model

Finally, we investigated the therapeutic efficacy of R406-PLGA nanoparticles in MCD-diet

induced NASH mouse model. We first examined the expression of SYK expression in mice with

MCD-diet induced NASH and found that SYK expression was highly significantly induced in

mice with NASH as compared to healthy controls (Figure 7B). With this observation, we

surmised that SYK play a major role in MCD-diet induced liver steatosis. We then examined

68

the therapeutic efficacy of R406 and R406-PLGA nanoparticles in MCD-diet induced NASH. We

followed the clinical treatment regimen, where we induced NASH for 4 weeks and treated

mice for last 2 weeks with in total 4 intravenous administrations while continuing with MCD

diet (Figure S2).

Figure 7. R406-PLGA ameliorates inflammation, steatosis, and fibrosis in methionine and choline-deficient (MCD) diet induced NASH mouse model. (A) Representative images of liver tissue from control group (chow-fed mice, n = 4), MCD group (MCD diet-fed mice, n = 5), MCD + R406 group (MCD diet-fed mice treated with free drug R406, n = 5), MCD + R406-PLGA group (MCD diet-fed mice treated

69

with R406-PLGA nanoparticles, n = 5), and MCD + PLGA group (MCD diet-fed mice treated with empty PLGA nanoparticles, n = 5). (B) Normalized SYK expression in liver tissue from MCD diet NASH mice (n = 5) compared to normal mice (n = 5). **p < 0.01 denotes significance. (C) Representative images of liver section stained with hematoxylin and eosin (H&E) staining, oil-red-O staining, and collagen I, F4/80 and MHC II as performed on healthy controls and MCD diet mice treated with respective treatments. (D) Quantitative image analysis of liver sections from healthy controls and MCD diet mice treated with respective treatments stained with oil-red-O, collagen I, F4/80 and MHC II. Data are presented as mean + SEM. #p < 0.05 denotes significance versus healthy controls; *p < 0.05, **p < 0.01, ***p < 0.001 denotes significance versus MCD diet mice.

Morphological examination of liver tissues at the end of the study showed the visible pale and

gross appearance suggesting the hepatocellular damage in MCD-diet induced NASH mice as

compared to normal healthy control group (Figure 7A). Treatment with R406 and R406-PLGA

showed considerably better appearance of livers in contrast to MCD-diet induced NASH livers

and PLGA-treated NASH livers (Figure 7A). Interestingly, we found that SYK inhibitor R406 and

more significantly R406-PLGA nanoparticles ameliorated (a) hepatic inflammation as

examined by H&E, F4/80 (macrophage marker) and MHC-II staining’s; (b) hepatic fibrosis as

confirmed by collagen I (major extracellular matrix protein) expression; and (c) steatosis as

examined using oil-red-o staining (Figure 7C,D).

We further examined plasma liver transaminases i.e. ALT and AST levels, and found that R406

and more efficiently R406-PLGA inhibited MCD-diet induced Ast and ALT levels (Figure 8A,B).

We also analyzed intrahepatic expression of SYK pathway downstream signaling molecule

CARD9 (caspase recruitment domain-containing protein 9) [38, 39] and found highly

significant inhibition of CARD9 by R406-PLGA nanoparticles as compared to R406 (Figure 8C).

In in vitro studies, we observed that both R406 and R406-PLGA nanoparticles decreased CCL2

(MCP1) expression in RAW macrophages and BMDMs, which was further implicated in the in

vivo studies. Reduced intrahepatic CCL2 expression by R406 and R406-PLGA nanoparticles

inhibits the macrophage chemotaxis/migration to liver therefore further inhibiting ongoing

liver inflammation (Figure 7C,D). Previous studies have demonstrated the crucial role of CCL2

in liver inflammation and shown that pharmacological inhibition of CCL2 ameliorated liver

inflammation by inhibition of macrophage infiltration [28]. We also analyzed gene expression

of F4/80 and crucial inflammatory markers i.e. CCL2, TNFα, iNOS, and intracellular cell

adhesion molecule 1 (ICAM1), and found that MCD-diet induced the macrophage influx (as

shown by F4/80 expression) and inflammatory markers which were inhibited by R406 and

70

more significantly by R406-PLGA nanoparticles suggesting highly beneficial and superior

effects of R406-PLGA nanoparticles as compared to R406 alone (Figure 8D-H).

Figure 8. Increased therapeutic efficacy of R406-PLGA nanoparticles in methionine and choline-deficient (MCD) diet induced NASH in mice. (A) Plasma Aspartate aminotransferase (AST) levels and (B) Plasma Alanine aminotransferase (ALT) levels. Intrahepatic gene expression of (C) CARD9 (caspase recruitment domain-containing 9); (D) macrophage marker F4/80; (E) monocyte chemoattractant protein 1 (MCP1) or chemokine (C-C motif) ligand 2 (CCL2); (F) Inflammatory cytokine, tumour necrosis factor alpha (TNFα); (G) inducible nitric oxide synthase (iNOS or NOS2) and (H) intracellular cell adhesion molecule 1 (ICAM-1). Data are presented as mean + SEM. *p<0.05, **p<0.01 denotes significance.

As previously demonstrated by us, there is a cross-talk between macrophages and hepatic

stellate cells (major fibrogenic cells in liver) [9, 10], therefore reduced inflammation resulted

in reduced liver fibrosis as confirmed by collagen I expression. R406 and more strongly, R406-

PLGA nanoparticles inhibited collagen I expression (Figure 7C,D). We further analyzed the

gene expression of HSCs specific markers i.e. desmin and alpha smooth muscle actin (α-SMA).

We observed that R406 and more potently R406-PLGA nanoparticles significantly inhibited

expression of MCD-diet induced HSCs activation while empty PLGA nanoparticles showed no

inhibitory effects (Figure 9A,B). These results collectively suggests that R406-PLGA

nanoparticles significantly inhibited fibrosis in MCD-diet induced NASH model.

71

Figure 9. Increased therapeutic efficacy of R406-PLGA nanoparticles in methionine and choline deficiency (MCD) diet induced NASH in mice. Intrahepatic gene expression of (A) Desmin and (B) α-SMA; (C) Total serum cholesterol levels expressed in mg/dL; (D) Total serum triglyceride levels in mg/dL; intrahepatic gene expression of (E) uncoupling protein 1 (UCP1); (F) PR domain containing 16 (PDRM16); (G) Peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC1α) and (H) c/EBPβ (CCAAT/enhancing binding protein β). Data are presented as mean + SEM. *p < 0.05, **p < 0.01 denotes significance.

Finally, we analyzed the effect of R406-PLGA on hepatic steatosis. Oil-red-o staining showed

significant induction in hepatic steatosis in MCD-induced NASH which was inhibited by R406

and more strongly by R406-PLGA nanoparticles (Figure 7C,D). We first examined total plasma

cholesterol and triglyceride levels, and found significant upregulation of these parameters in

NASH mice as compared to healthy controls. Interestingly, MCD-diet-induced cholesterol and

triglyceride levels were highly significantly inhibited by R406 and, more efficiently, by R406-

PLGA nanoparticles (Figure 9C,D). Furthermore, we analyzed expression of steatosis related

markers: UCP1 (uncoupling protein 1), PDRM16 (PR-domain containing 16), PGC1α

(Peroxisome proliferator-activator receptor gamma coactivator 1 alpha) and c/EBPβ

(CCAAT/enhancing binding protein β). UCP1, PDRM16 and PGC1α has been shown to induce

lipid oxidation and hence are involved in PGC1α/PDRM16/UCP1-mediated lipid energy

dissipation [39]. c/EBPβ (CCAAT/enhancing binding protein β), has shown to have a key role in

steatosis and the pathophysiology of MCD diet-mediated model of NASH through its effect on

72

lipid synthesis, inflammation, and ER stress [40]. We found that R406-PLGA nanoparticles

alone induced the expression of PGC1α, PDRM16, UCP1 and reduced MCD-diet induced

C/EBPβ expression suggesting increased lipid oxidation, reduced lipid synthesis and reduced

steatosis (Figure 9E-H). Altogether, these results suggest that R406 and more significantly

R406-PLGA nanoparticles significantly ameliorated fibrosis, inflammation, and steatosis in

NASH mouse model. Importantly, PLGA-mediated delivery significantly increased the in vivo

therapeutic efficacy of R406 and therefore potentially reduce the frequency of drug

administration.

3.4 Conclusion

In conclusion, we have demonstrated schematically a novel role of SYK signaling pathway in

modulating liver inflammation, fibrosis and steatosis attributed to non-alcoholic

steatohepatitis. We have also shown the role of SYK pathway in inflammatory M1

macrophages. Furthermore, this study highlights SYK inhibitor R406 as a potential therapeutic

for NASH. Using PLGA nanoparticles, we have demonstrated the efficient intrahepatic delivery

of SYK inhibitor for increased therapeutic efficacy as shown by decreased inflammation,

hepatic injury, fibrosis, and steatosis by suppressing SREBP1-mediated lipogenesis and

increased PGC1α/PDRM16/UCP1-mediated lipid energy dissipation. To our best knowledge,

this is the first study highlighting the increased therapeutic effects of SYK inhibitor using PLGA-

mediated delivery in NASH. This promising strategy can potentially be applicable for the

treatment of other inflammatory diseases and should be further explored for the systematic

evaluation for the clinical applications.

3.5 Acknowledgements

This study was funded by Endowment Fund for the Education Republic of Indonesia (Lembaga

Pengelola Dana Pendidikan/LPDP RI). This project was partially supported by the Netherlands

Organization for Health Research and Development (ZonMW, NWO)-funded VENI innovation

grant 916.151.94 (to R.B.). Authors thank Hetty ten Hoopen for her technical assistance.

3.6 References

[1] L. Pimpin, H. Cortez-Pinto, F. Negro, E. Corbould, J.V. Lazarus, L. Webber, N. Sheron, Burden of liver disease in Europe: epidemiology and analysis of risk factors to identify prevention policies, J Hepatol, (2018).

73

[2] S.M. Francque, D. van der Graaff, W.J. Kwanten, Non-alcoholic fatty liver disease and cardiovascular risk: Pathophysiological mechanisms and implications, J Hepatol, 65 (2016) 425-443.


[4] S.A. Polyzos, C.S. Mantzoros, Nonalcoholic fatty future disease, Metabolism, 65 (2016) 1007-1016.

[5] J. Wattacheril, D. Issa, A. Sanyal, Nonalcoholic Steatohepatitis (NASH) and Hepatic Fibrosis: Emerging Therapies, Annu Rev Pharmacol Toxicol, 58 (2018) 649-662.


[7] E. Seki, R.F. Schwabe, Hepatic inflammation and fibrosis: functional links and key pathways, Hepatology, 61 (2015) 1066-1079.

[8] R. Bansal, B. Nagorniewicz, J. Prakash, Clinical Advancements in the Targeted Therapies against Liver Fibrosis, Mediators Inflamm, 2016 (2016) 7629724.

[9] R. Bansal, J. van Baarlen, G. Storm, J. Prakash, The interplay of the Notch signaling in hepatic stellate cells and macrophages determines the fate of liver fibrogenesis, Sci Rep, 5 (2015) 18272.

[10] B. Ozturk Akcora, G. Storm, J. Prakash, R. Bansal, Tyrosine kinase inhibitor BIBF1120 ameliorates inflammation, angiogenesis and fibrosis in CCl4-induced liver fibrogenesis mouse model, Sci Rep, 7 (2017) 44545.

[11] B.O. Akcora, G. Storm, R. Bansal, Inhibition of canonical WNT signaling pathway by beta-catenin/CBP inhibitor ICG-001 ameliorates liver fibrosis in vivo through suppression of stromal CXCL12, Biochim Biophys Acta, 1864 (2018) 804-818.

[12] T.N. Bukong, A. Iracheta-Vellve, B. Gyongyosi, A. Ambade, D. Catalano, K. Kodys, G. Szabo, Therapeutic Benefits of Spleen Tyrosine Kinase Inhibitor Administration on Binge Drinking-Induced Alcoholic Liver Injury, Steatosis, and Inflammation in Mice, Alcohol Clin Exp Res, 40 (2016) 1524-1530.


[14] S.H. Shin, K.H. Lee, B.H. Kim, S. Lee, H.S. Lee, J.J. Jang, G.H. Kang, Downregulation of spleen tyrosine kinase in hepatocellular carcinoma by promoter CpG island hypermethylation and its potential role in carcinogenesis, Lab Invest, 94 (2014) 1396-1405.


[16] A. Mocsai, J. Ruland, V.L. Tybulewicz, The SYK tyrosine kinase: a crucial player in diverse biological functions, Nat Rev Immunol, 10 (2010) 387-402.

[17] T.N. Bukong, K. Kodys, G. Szabo, Human ezrin-moesin-radixin proteins modulate hepatitis C virus infection, Hepatology, 58 (2013) 1569-1579.

74

[18] T. Oton, L. Silva-Fernandez, J.L. Andreu, Spleen tyrosine kinase (Syk) inhibitor for rheumatoid arthritis, N Engl J Med, 364 (2011) 83; author reply 84.

[19] H. Okamoto, A. Kobayashi, Spleen tyrosine kinase (Syk) inhibitor for rheumatoid arthritis, N Engl J Med, 364 (2011) 83-84; author reply 84.

[20] E.S. Masuda, J. Schmitz, Syk inhibitors as treatment for allergic rhinitis, Pulm Pharmacol Ther, 21 (2008) 461-467.

[21] M. Ulanova, F. Duta, L. Puttagunta, A.D. Schreiber, A.D. Befus, Spleen tyrosine kinase (Syk) as a novel target for allergic asthma and rhinitis, Expert Opin Ther Targets, 9 (2005) 901-921.

[22] K.H. Chen, H.H. Hsu, H.Y. Yang, Y.C. Tian, Y.C. Ko, C.W. Yang, C.C. Hung, Inhibition of spleen tyrosine kinase (syk) suppresses renal fibrosis through anti-inflammatory effects and down regulation of the MAPK-p38 pathway, Int J Biochem Cell Biol, 74 (2016) 135-144.

[23] Y. Kulathu, G. Grothe, M. Reth, Autoinhibition and adapter function of Syk, Immunol Rev, 232 (2009) 286-299.

[24] M. Bartneck, K.T. Warzecha, F. Tacke, Therapeutic targeting of liver inflammation and fibrosis by nanomedicine, Hepatobiliary Surg Nutr, 3 (2014) 364-376.

[25] H.K. Makadia, S.J. Siegel, Poly Lactic-co-Glycolic Acid (PLGA) as Biodegradable Controlled Drug Delivery Carrier, Polymers (Basel), 3 (2011) 1377-1397.

[26] M. Mir, N. Ahmed, A.U. Rehman, Recent applications of PLGA based nanostructures in drug delivery, Colloids Surf B Biointerfaces, 159 (2017) 217-231.

[27] G. Sahay, D.Y. Alakhova, A.V. Kabanov, Endocytosis of nanomedicines, J Control Release, 145 (2010) 182-195.

[28] C. Baeck, X. Wei, M. Bartneck, V. Fech, F. Heymann, N. Gassler, K. Hittatiya, D. Eulberg, T. Luedde, C. Trautwein, F. Tacke, Pharmacological inhibition of the chemokine C-C motif chemokine ligand 2 (monocyte chemoattractant protein 1) accelerates liver fibrosis regression by suppressing Ly-6C(+) macrophage infiltration in mice, Hepatology, 59 (2014) 1060-1072.

[29] D.L. Priwitaningrum, J.G. Blonde, A. Sridhar, J. van Baarlen, W.E. Hennink, G. Storm, S. Le Gac, J. Prakash, Tumor stroma-containing 3D spheroid arrays: A tool to study nanoparticle penetration, J Control Release, 244 (2016) 257-268.

[30] R. Bansal, J. Prakash, E. Post, L. Beljaars, D. Schuppan, K. Poelstra, Novel engineered targeted interferon-gamma blocks hepatic fibrogenesis in mice, Hepatology, 54 (2011) 586-596.

[31] Y.H. Lee, S.H. Kim, S.N. Kim, H.J. Kwon, J.D. Kim, J.Y. Oh, Y.S. Jung, Sex-specific metabolic interactions between liver and adipose tissue in MCD diet-induced non-alcoholic fatty liver disease, Oncotarget 7 (2016) 46959-46971.

[32] M. Ahrens, O. Ammerpohl, W. von Schonfels, J. Kolarova, S. Bens, T. Itzel, A. Teufel, A. Herrmann, M. Brosch, H. Hinrichsen, W. Erhart, J. Egberts, B. Sipos, S. Schreiber, R. Hasler, F. Stickel, T. Becker, M. Krawczak, C. Rocken, R. Siebert, C. Schafmayer, J. Hampe, DNA methylation analysis in nonalcoholic fatty liver disease suggests distinct disease-specific and remodeling signatures after bariatric surgery, Cell Metab, 18 (2013) 296-302.


75

[34] Y.I. Miller, S.H. Choi, P. Wiesner, Y.S. Bae, The SYK side of TLR4: signalling mechanisms in response to LPS and minimally oxidized LDL, Br J Pharmacol, 167 (2012) 990-999.

[35] O. Gross, H. Poeck, M. Bscheider, C. Dostert, N. Hannesschlager, S. Endres, G. Hartmann, A. Tardivel, E. Schweighoffer, V. Tybulewicz, A. Mocsai, J. Tschopp, J. Ruland, Syk kinase signalling couples to the Nlrp3 inflammasome for anti-fungal host defence, Nature, 459 (2009) 433-436.

[36] M. Herbrink, B. Nuijen, J.H. Schellens, J.H. Beijnen, Variability in bioavailability of small molecular tyrosine kinase inhibitors, Cancer Treat Rev, 41 (2015) 412-422.

[37] S.J. Siegel, J.B. Kahn, K. Metzger, K.I. Winey, K. Werner, N. Dan, Effect of drug type on the degradation rate of PLGA matrices, Eur J Pharm Biopharm, 64 (2006) 287-293.

[38] R.A. Drummond, S. Saijo, Y. Iwakura, G.D. Brown, The role of Syk/CARD9 coupled C-type lectins in antifungal immunity, Eur J Immunol, 41 (2011) 276-281.

[39] Z. Zhang, L. He, S. Hu, Y. Wang, Q. Lai, P. Yang, Q. Yu, S. Zhang, F. Xiong, S. Simsekyilmaz, Q. Ning, J. Li, D. Zhang, H. Zhang, X. Xiang, Z. Zhou, H. Sun, C.Y. Wang, AAL exacerbates pro-inflammatory response in macrophages by regulating Mincle/Syk/Card9 signaling along with the Nlrp3 inflammasome assembly, Am J Transl Res, 7 (2015) 1812-1825.

[40] S.M. Rahman, J.M. Schroeder-Gloecker, R.C. Janssen, H. Jiang, I. Qadri, K.N. Maclean, J.E. Friedman, CCAAT/enhancing binding protein beta deletion in mice attenuate inflammation, endoplasmic reticulum stress, and lipid accumulation in diet-induced nonalcoholic steatohepatitis, Hepatology 45 (2007) 1108-1117.

76


Table S1. Sequence of the mouse primers used for quantitative real-time PCR

Table S2. Antibodies used for the immunohistochemistry and western blotting

Gene

Forward primer sequence (5’-3’) Reverse primer sequence (5’-3’) Accession no. iNOS GGTGAAGGGACTGAGCTGTT GCTACTCCGTGGAGTGAACAA NM_010927.4 IL-1β GCCAAGACAGGTCGCTCAGGG CCCCCACACGTTGACAGCTAGG NM_008361.3 CCL2 GTGCTGACCCCAAGAAGGAA GTGCTGAAGACCTTAGGGCA NM_011333.3 IL-6 TGATGCTGGTGACAACCACGGC TAAGCCTCCGACTTGTGAAGTGTA NM_031168.1 MRC1 TGGATGGATGGGAGCAAAGT GCTGCTGTTATGTCTCTGGC NM_008625.2 ARG1 GTGAAGAACCCACGGTCTGT CTGGTTGTCAGGGGAGTGTT NM_007482.3 GAPDH ACAGTCCATGCCATCACTGC GATCCACGACGGACACATTG NM_008084.2

SYK TCCATTGCAGCCATTCCCAT GTCCTGGAGTCACAGAAGGC NM_011518.2

FcγR1 GTGCTCTCATTGGGTGGTGA TGTAAGCCGTGCCTTCCAAT NM_010186.5

CCR2 AGGAGCCATACCTGTAAATGC TGTGGTGAATCCAATGCCCT NM_009915.2

IL-1α CGCTTGAGTCGGCAAAGAAA CTGATACTGTCACCCGGCTC NM_010554.4

CARD9 GGCTCTGAACAAGGAGCATCT TCCTGCGGTAGTTCTCGAAG NM_001037747.1

UCP1 GGATGGTGAACCCGACAACT GCTGAAACTCCGGCTGAGAA NM_009463.3

PDRM16 TGTGCGAAGGTGTCCAAACT TCTCTCCTCCTCCTTGAGCC NM_027504.3

PGC1α ACTCTCAGTAAGGGGCTGGTT GACGCCAGTCAAGCTTTTTCA NM_008904.2

SREBP1 CTGGTGAGTGGAGGGACCAT GACCGGTAGCGCTTCTCAAT NM_011480.4

Primary Antibody Source Immunostaining Western blotting

Polyclonal rabbit anti-SYK Cell Signalling 1:400

Monoclonal mouse anti-β-actin Sigma 1:5000

Polyclonal rabbit anti-pSYK Cell Signal Tech. 1:400

Polyclonal goat anti-collagen I Southern Biotech 1:100

Rat anti mouse F4/80 BioRad 1:100

Rat monoclonal MHC II Santa Cruz 1:100

Secondary Antibody Source

Polyclonal goat anti-rabbit IgG DAKO 1:100 1:1000

Polyclonal rabbit anti-mouse IgG DAKO 1:100 1:1000

Polyclonal goat anti-mouse IgG DAKO 1:100 1:1000

Polyclonal rabbit anti-goat IgG DAKO 1:100 1:1000

Polyclonal goat anti-rat IgG Southern Biotech 1:100 1:1000

77

Figure S1. Determination of % encapsulation of R406 in PLGA nanoparticles using HPLC. (A) Chromatogram of R406 in R406-PLGA nanoparticles. (B) Calibration curve for R406.

Figure S2. Schematic representation of the experimental design and treatment regimen in MCD-diet induced NASH mouse model.

78

Figure S3. Effect of R406 on RAW cell viability. Viability of RAW 264.7 macrophages after treatment with different concentrations of R406 in the presence of M1 stimulus (100 ng/mL LPS + 10 ng/mL IFNγ). Bars represent mean + SEM from n=3 independent experiments performed in triplicates.

Cell viability

M0 0 0.5 1 50

20

40

60

80

100M0M1

R406 (µM)

% ce

ll vi

abili

ty

79

Figure S4. In vitro drug release and uptake by RAW macrophages. (A) % cumulative release rate of R406 from R406-PLGA nanoparticles in medium (containing 10% FBS) as analyzed at different time intervals (0, 6, 12, 24, and 48 h). (B) % drug uptake by RAW macrophages as measured at different time intervals (0, 6, 12, 24, and 48 h).

80

Figure S5. Effect of R406-PLGA nanoparticles on the RAW cell viability. Viability of RAW 264.7 macrophages after treatment with R406, R406-PLGA nanoparticles and empty PLGA nanoparticles in the presence of M1 stimulus (100 ng/mL LPS + 10 ng/mL IFNγ). Bars represent mean + SEM from n=3 independent experiments performed in triplicates.

Control

MediumR406

R406-PLGA

PLGA

0

20

40

60

80

100M0M1

% C

ell v

iabi

lity

81

Chapter 4

Src Kinase as a Potential Therapeutic Target in Non-alcoholic and

Alcoholic Steatohepatitis

Dhadhang Wahyu Kurniawan, Richell Booijink, Arun Kumar Jajoriya, Garima Dhawan, Divya Mishra, Dorenda Oosterhuis, Josepmaria Argemi, Gert Storm, Peter Olinga, Ramon Bataller,

Sujit Komar Mohanty, Durga Prasad Mishra, Jai Prakash, Ruchi Bansal

Published in: Clinical and Translational Discovery vol. 2 issue 1 March 2022, DOI: 10.1002/ctd2.18

82

Abstract

Non-alcoholic steatohepatitis (NASH) and alcohol-associated steatohepatitis (ASH) are the

major cause of liver-related mortality with limited therapeutic options available. In this study,

we investigated the role of Src tyrosine kinase in the pathogenesis of (N)ASH. We examined

Src kinase expression in livers from patients with NASH, ASH, cirrhosis and biliary atresia, and

from preclinical mouse models: methionine choline deficient (MCD)-diet-induced NASH,

Lieber-DeCarli ethanol (EtOH)-diet-induced ASH, carbon tetrachloride (CCl4)- and bile duct

ligation (BDL)-induced liver fibrosis. Functional studies, using Src kinase inhibitor KX2-391,

were performed in NASH and ASH mouse models, and in relevant in vitro models.

Transcriptomic analysis revealed increased Src kinase expression in human and mouse

diseased livers that positively correlated with disease progression. Src kinase inhibition

ameliorated lipid biosynthesis (steatosis); monocytes/macrophages infiltration and

inflammatory cytokines expression (inflammation); and hepatic stellate cells (HSCs) activation

and collagen expression (fibrosis) in MCD-diet and EtOH-diet liver disease mouse models. In

vitro Src inhibition attenuated FFA-induced hepatocytic lipid accumulation; LPS/IFNγ-induced

nitric-oxide release, and expression of several inflammatory signatures in macrophages and

TGFβ-induced HSCs activation, contractility and collagen expression. Moreover, Src inhibition

diminished gene expression of inflammatory markers in LPS/IFNγ-stimulated BMDMs and LPS-

stimulated PCLS, and reduced FA accumulation, macrophage activation and collagen

deposition in 3D human liver spheroids. Mechanistic studies further revealed that Src kinase

mediated the effects through FAK/PI3K/AKT pathway. Our results demonstrate a multicellular

and functional role of Src kinase highlighting Src kinase as a promising therapeutic target in

(non)alcoholic steatohepatitis.

83

4.1 Introduction

Non-alcoholic steatohepatitis (NASH) and alcohol-associated steatohepatitis (ASH) are the

major cause of cirrhosis and hepatocellular carcinoma (HCC) associated morbidity and

mortality worldwide [1-3]. Currently, NASH and ASH are the common indication for liver

transplantation [4, 5]. Both non-alcoholic fatty liver diseases (NAFLD) and alcoholic liver

diseases (ALD) encompass a spectrum of pathologies ranging from simple steatosis to fibrosis,

cirrhosis and HCC [6, 7]. Although NASH and ASH share common pathogenesis and many

histopathological features, they differ in etiology. NASH is characterized by an excessive fat

accumulation in the liver while ASH is associated with high alcohol consumption (>20-30g/day)

[8]. Recent studies have deciphered the involvement of diverse signaling pathways that drive

the pathophysiology of NAFLD and ALD [9, 10]. Though significant progress has been made

towards (N)ASH disease understanding at the cellular and molecular level, currently there is

no clinically approved therapy available. Considering the alarming prevalence and global

burden, cutting-edge focused research is needed to discover novel therapeutic targets for the

development of effective treatment approaches.

When defining the pathogenic drivers of (N)ASH, it has been conceptualized that both

parenchymal cells (e.g. hepatocytes) and non-parenchymal cells (e.g. macrophages and

hepatic stellate cells, HSCs) are severely affected [6, 7]. Hepatocyte injury and steatosis are

triggered by toxic alcoholic metabolites during ALD, and fatty acid and cholesterol biosynthesis

with dysregulated lipid metabolism and transport during NAFLD. This hepatocyte injury is

accompanied by endoplasmic reticulum stress and initiates chronic inflammation through

reactive oxygen species and release of pro-inflammatory cytokines and chemokines [6, 7].

Furthermore, ASH and NASH are associated with altered intestinal permeability resulting in

increased intrahepatic levels of endotoxins further contributing to inflammation [11-13]. Due

to the ongoing inflammation, inflammatory mediators are released by the immune cells

mainly hepatic macrophages (resident Kupffer cells and infiltrating monocytes-derived

macrophages), leading to the trans-differentiation of quiescent HSCs into proliferative,

contractile and activated HSCs (myofibroblast phenotype) that contribute to fibrosis and

cirrhosis, and genomic instability predisposes to HCC [14].

84

Src is a non-receptor tyrosine kinase that belongs to the Src family of protein tyrosine kinases

(SFKs) that includes nine members: Src, Yes, Fyn, Fgr, Lck, Hck, Blk, Lyn and Yrk. While Src, Fyn

and Yes are ubiquitously expressed, others (except Yrk, exclusively expressed in chickens) are

restricted to hematopoietic cells [15, 16]. SFKs regulate many fundamental cellular processes

including cell growth, differentiation, migration, survival, and are also identified as proto-

oncogenes involved in the cancer progression [15, 16]. Moreover, SFKs play an essential role

in the recruitment and activation of monocytes, macrophages, neutrophils and other immune

cells [17]. Besides, Src and its family members have been implicated in several intracellular

signaling pathways in macrophages mediated by integrins and toll-like receptors [17, 18]. SFKs

play an important role in many pathologies including lung fibrosis, renal fibrosis, liver fibrosis

and systemic sclerosis [19-22]. These studies have reported TGFβ-induced activation of SFKs

mainly Src and Fyn, and the blockade of Src and Fyn is associated with reduced ECM

production and inhibited tissue fibrosis [20-22]. Particularly in context to liver fibrosis, Fyn

inhibitor saracatinib was shown to attenuate liver fibrosis via HSCs inhibition mediated via

focal adhesion kinase (FAK)/neural Wiskott-Aldrich syndrome protein (N-WASP) signaling [19].

Using the same inhibitor (saracatinib), Seo et al., recently demonstrated that Src inhibition

attenuated liver fibrosis, by preventing HSCs activation and suppressing hepatocytic

connective tissue growth factor (CTGF) expression, associated with SMAD3 downregulation

[23]. TGFβ1/Src axis is also involved in hepatocyte de-differentiation regulated by hepatocyte

nuclear factor 4 alpha (HNF4A) in alcoholic hepatitis [24]. SFKs interacts closely with Syk-ZAP70

family kinases with Src-family being ‘upstream’ hence regulating Syk-ZAP70 family, and the

FAK/proline-rich tyrosine kinase 2 (pyk2) involved in integrin signaling [25]. Several studies,

including ours, have reported the implication of Syk in liver diseases [26-28]. Considering the

multicellular functions and regulation of multiple signaling pathways by Src, we hypothesized

Src may be a master regulator involved in the pathophysiology of ALD and NAFLD.

In this study, we investigated the role of Src kinase in NASH and ASH. We first assessed the

expression and activation of Src in human liver diseases from different etiologies i.e. NASH,

alcoholic steatohepatitis (ASH), Hepatitis C virus (HCV)-cirrhosis and biliary atresia (BA); and

in respective disease mouse models that mimic pathophysiological features of human NASH

(methionine choline deficient MCD-diet induced [29]), ASH (chronic Lieber-DeCarli ethanol

EtOH-diet induced model [30]), and carbon tetrachloride (CCl4)- and bile duct ligation (BDL)-

85

induced liver fibrosis. Thereafter, we assessed the functional role of Src kinase using a

selective inhibitor KX2-391. Functional inhibition of Src kinase pathway was studied in vitro in

cell culture, PCLS and 3D human liver spheroids, and in vivo in MCD-diet-induced NASH and

EtOH-diet-induced ASH mouse models. We further examined the mechanisms involved in Src

kinase-mediated effects. To our best knowledge, this is the first study demonstrating the role

of Src kinase in (N)ASH.


4.2.1 Gene expression analysis of the human liver tissues

Src kinase mRNA expression was assessed using the publicly available transcriptome datasets

of liver tissues from patients with non-alcoholic steatohepatitis (GSE48452) [31], Hepatitis C

virus (HCV)-related cirrhosis (GSE6764) [32] and biliary atresia (GSE15235) [33] obtained from

the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus database

(GEO) and analyzed using GEO2R online database. NASH patients were categorized into 4

groups as per biopsy-based pathological investigation: control group (n=36); NAFLD activity

score (NAS) 1-2 (n=15); NAS 3-4 (n=7); and NAS 5-6 (n=15); HCV-cirrhosis patients were

categorized into 2 groups: control group (n=10) and cirrhosis group (n=9); biliary atresia

patients were divided into 3 groups: control group (n=4); biliary atresia with liver inflammation

(n=17) and biliary atresia with fibrosis (n=26).

High-throughput transcriptome profiling was performed using Illumina HiSeq2000 platform

(San Diego, CA) with liver samples provided by the InTeam Consortium (Human Biorepository

Core, University of Pittsburgh, PA) and deposited in the Database of Genotypes and

Phenotypes of the National Institutes of Health (dbGaP Study Accession: phs001807.v1.p1)

[24]. Src kinase mRNA expression was evaluated in patients with different phenotypes: 11

patients with non-severe alcoholic hepatitis (with Maddrey’s discriminant function, MDF ≤32);

ASH responders (with severe alcoholic steatohepatitis (MDF>32) patients responsive to

steroids, n=9) ASH non-responders (severe alcoholic steatohepatitis (MDF>32) patients non-

responsive to steroids therapy, n=9) and 10 patients with explants who underwent early liver

transplantation for severe alcoholic steatohepatitis. Controls (n=10) were non-diseased livers

obtained from biopsied single nodules, without significant alterations as per histopathological

analysis.

86

4.2.2 Human liver specimens

Human liver specimens were obtained from the autopsy of patients with NASH (n=5)

anonymously provided by the Laboratory Pathology Netherlands (LabPON). Normal liver

tissue (n=4) was collected from patients receiving hepatic resections for non-tumoral diseases,

including hepatic adenoma and focal nodular hyperplasia. Upon Institutional Review Board

approval and after written informed consent from patients, the tissue specimens were

collected. The use of human tissues was approved by the Local Medical Ethics Committee, and

the experimental protocols were performed in accordance with institutional guidelines and

regulations.

4.2.3 CCl4-induced chronic liver fibrosis mouse model

These animal experiments were performed in strict accordance with the guidelines and

regulations for the Care and Use of Laboratory Animals, Utrecht University, The Netherlands.

The protocols were approved by the Institutional Animal Ethics Committee of the University

of Twente, The Netherlands. All the animals received ad libitum normal chow diet and normal

water, and were housed with 12h-light/12h-dark cycle. 8-week old male C57BL/6 mice (Janvier

Labs, Le Genest, St. Isle, France) were treated with multiple intraperitoneal injections (twice

per week) of olive oil (Sigma, St. Louis, MO, USA) or CCl4 (Sigma, 1mL/kg, diluted in olive oil in

1 CCl4:5 olive oil) for 8 weeks (n=9 per group). At the end of the experiment, all mice were

sacrificed and livers were harvested for the subsequent analysis.

4.2.4 Bile-duct ligation mouse model




of Twente, The Netherlands. All the animals received ad libitum normal chow diet and normal

water, and were housed with 12h-light/12h-dark cycle. 8-week old male BALB/c mice (Janvier

Labs) were anesthetized with Isoflurane (2%). After midline laparotomy, the bile duct was

ligated with 6-0 silk suture. The abdomen was then washed with sterile saline and closed in

two layers with 4-0 vicryl suture. Mice were sacrificed after 48 h (n=3) and 28 days (n=3)

postoperatively and livers were harvested for the subsequent analysis. Control (sham-

operated) mice (n=6) were sacrificed and livers were harvested for the subsequent analysis.

87

4.2.5 Methionine and choline-deficient (MCD) diet model

These animal experiments were performed in strict accordance to the guidelines and ethical

regulations for the Care and Use of Laboratory Animals, CSIR-Central Drug Research Institute

(CDRI), India. The experimental procedures conducted in this study have been approved by

the Institutional Animal Ethics Committee at the CSIR-Central Drug Research Institute, India.

MCD model was performed as reported previously [27]. 8-week old male C57BL/6 mice

(Jackson Laboratories, Bar Harbor, USA) were fed a MCD diet (C1070, Altromin GmbH, Lage,

Germany) for 4 weeks while the controls received normal chow diet (n=8). MCD diet fed mice

were treated for two weeks intravenously (three times per week) with vehicle (PBS, phosphate

buffered saline, n=8) or KX2-391 (10 mg/kg, n=5) while continuing MCD diet feeding. At the

end of the experiment, mice were euthanized, the liver tissues and blood were collected for

the subsequent analysis [27]. Alanine aminotransferase (ALT), aspartate aminotransferase

(AST), total plasma cholesterol, and total plasma triglycerides were measured using standard

automated laboratory methods.

4.2.6 Lieber-DeCarli chronic ethanol feeding model




of Twente, The Netherlands. 10-12-week old female C57BL/6 mice were fed a Lieber-DeCarli

diet (F1258SP, Bio-Serv, Frenchtown, NJ, USA) with 3% ethanol (Thermo Fisher Scientific,

Rockford, IL, USA) for 8 weeks while control mice (n=5) were pair-fed with isocaloric control

liquid diet (F1259SP, Bio-Serv) [30]. 3% ethanol-containing Lieber-DeCarli diet fed mice (EtOH

mice) were treated for three weeks intravenously (twice per week) with vehicle (PBS, n=6) or

KX2-391 (10 mg/kg, n=5) whilst continuing alcoholic diet. Mice were euthanized, blood and

liver tissues were collected for analysis at the end of the experiment. Alanine

aminotransferase (ALT), aspartate aminotransferase (AST), total plasma cholesterol and total

plasma triglycerides were measured using standard automated laboratory methods.

4.2.7 Cell Lines

Human hepatic stellate cells (LX2 cells), provided by Prof. Scott Friedman (Mount Sinai

Hospital, New York, NY, USA), were cultured in DMEM-Glutamax medium (Invitrogen,

88

Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS, Lonza, Verviers, Belgium),

and antibiotics (50 U/mL Penicillin and 50µg/mL streptomycin, Sigma). Human hepatocytes

(HepG2) (ATCC, Manassas, VA, USA) and mouse NIH3T3 fibroblasts (ATCC) were cultured in

Dulbecco's modified Eagle's (DMEM) medium (Lonza) supplemented with 2 mM L-glutamine

(Sigma), 10% FBS (Lonza) and antibiotics [50U/mL Penicillin (Sigma) and 50 µg/mL

streptomycin (Sigma)]. Mouse RAW264.7 macrophages (ATCC) and human THP1 monocytes

(ATCC) were cultured in FBS, L-glutamine and antibiotics supplemented Roswell Park

Memorial Institute (RPMI) 1640 medium (Lonza). Human umbilical vein endothelial cells

(HUVECs) were purchased from Lonza and cultured in endothelial basal medium (EBM; Lonza)

supplemented with supplements (hydrocortisone, bovine brain extract, epidermal growth

factor, gentamycin sulphate, amphotericin-B) and 10% fetal bovine serum (FBS, Lonza).

4.2.8 Bone marrow derived macrophages

Bone marrow-derived macrophages (BMDMs) were freshly isolated from C57BL/6 mice as

described previously [27, 34]. Briefly, femurs and tibias were flushed with Dulbecco's modified

Eagle's medium (DMEM) (Life Technologies, Carlsbad, CA, USA) with 10% FBS (Lonza) to collect

bone marrow. Cells were then triturated 3–5 times through an 18-gauge needle and

centrifuged at 1200 rpm for 5 min. After removing supernatant, RBCs were lysed with the lysis

buffer and the remaining cells were washed in DMEM + 10% FBS and plated at 1×106 cells/mL

in DMEM supplemented with 1% penicillin/streptomycin, 1% HEPES, 0.001% β-

mercaptoethanol, 10% FBS, and 20% supernatant from mouse 3T3 fibroblasts [obtained from

ATCC and cultured in cultured in (DMEM) medium supplemented with 2 mM L-glutamine

(Sigma), 10% FBS (Lonza) and antibiotics (Sigma)]. The fibroblasts conditioned medium is

required to promote differentiation of bone marrow cells into macrophages (7–10 days).

Media was changed on days 2, 4 and 6, and cells were re-plated on day 7 for performing

experiments.

4.2.9 Effects of Src inhibitor KX2-391 on human LX2 cells

KX2-391, a highly selective and potent Src kinase inhibitor used in this study has been

purchased from Selleckchem (Houston, TX, USA). Cells were seeded in 24 well plates (5x104

cells/well) or 12 well plates (1x105 cells/well) and cultured overnight. To study the effects, cells

were starved overnight with serum-free medium and incubated with starvation medium

alone, 5 ng/mL of human recombinant TGFβ1 (Roche, Mannheim, Germany) with and without

89

50µM KX2-391 for 24h. Cells (24-well plates) were then fixed with chilled acetone : methanol

(1:1), dried and stained for different markers (collagen-I antibodies are summarized in

supplementary table 1). In addition, cells (12 well plates) were lysed with RNA lysis buffer to

perform quantitative real-time PCR analyses. Experiments were performed as three

independent experiments.

4.2.10 3D collagen-I gel contraction assay

3D collagen-I gel contraction assay has been performed as per standardized protocol. Briefly,

collagen suspension (5.0 mL) containing 3.0 mL Collagen G1 (5 mg/mL, Matrix biosciences,

Mörlenbach, Germany), 0.5 mL 10x M199 medium, 85µl 1N NaOH (Sigma) and sterile water

was prepared, and mixed with 1.0 mL (2×106) LX2 cells. Collagen gel-cells suspension (0.6

mL/well) was plated in a 24-well culture plates and allowed to polymerize for 1h at 37°C.

Polymerized gel was then incubated with 1 mL of serum-free medium with or without TGFβ

(5 ng/mL) together with 50µM KX2-391 followed by detachment of the gels from the culture

wells. Photographs were made with a digital camera at 24 h. The size of the gels was digitally

measured and normalized with their respective well size in each image. Gel contraction

experiments were performed in duplicates as three independent experiments.

4.2.11 Effects of Src inhibitor KX2-391 on Nitric Oxide (NO) release

The effect of KX2-391 on pro-inflammatory macrophages was assessed by measuring the

inhibition in nitrite (NO2) release. Nitrite was measured as a surrogate marker of NO

production. RAW264.7 cells (2 × 105 cells/200μl/well) were seeded in 96-well plates, cultured

with IFNγ (10 ng/mL) and LPS (100 ng/mL) together with different concentrations of Src

inhibitor KX2-391 (1, 5 and 50 μM). After 24 h, 100 μL culture supernatant was added to 100

μL of Griess reagent (1% sulfanilamide; 0.1% naphthylethylendiamine dihydrochloride; 3%

phosphoric acid) and absorbance at 540 nm was measured using microplate reader.

4.2.12 Effects of Src inhibitor KX2-391 on RAW264.7 and THP1 macrophages

Macrophages were plated in 12 well plates (1x105 cells/well) and cultured overnight [with 50

ng/mL phorbol-12-myristate-13-acetate (PMA) for THP1 macrophages for differentiation] at

37°C/5% CO2. To assess the effects, cells were incubated with medium alone, M2 stimulus (10

ng/mL IL-4 and IL-13) or M1 stimulus (10 ng/mL of IFNγ and 10 ng/mL LPS) with and/or without

KX2-391 (1, 5 and 50 μM) for 24h. Cells were lysed with RNA lysis buffer to perform

90

quantitative real-time PCR analyses or with protein lysis buffer for western blot analyses. All

the experiments were performed as three independent experiments.

4.2.13 In vitro efficacy studies of Src inhibitor KX2-391 in freshly isolated bone marrow derived macrophages

Bone marrow derived macrophages were plated at a density of 1 x 106 cells/mL and

differentiated into M1 macrophages using LPS (100 ng/mL, Sigma) and IFNγ (10 ng/mL,

Peprotech) or M2 macrophages using IL-4 (10 ng/mL, Peprotech) and IL-13 (10 ng/mL,

Peprotech). For efficacy studies, the cells were incubated with medium alone, 1, 10, and 50

µM of KX2-391 together with M1 stimulus. Incubated for 24 h, then cells were lysed for RNA

isolation and quantitative real-time PCR. At least 3 independent experiments were performed

for these efficacy studies.

4.2.14 Efficacy studies on murine precision-cut liver slices (PCLS)

Murine precision-cut liver slices (PCLS) were prepared as described previously [35]. We used

murine liver cores were obtained using a 5-mm biopsy-punch. Subsequently, the slices were

made using a Krumdieck tissue slicer (Alabama Research and Development, USA), was filled

with ice-cold Krebs-Henseleit buffer (KHB) supplemented with 25 mM D-glucose (Merck,

Darmstadt, Germany), 25 mM NaHCO3 (Merck), 10 mM HEPES (MP Biomedicals, Aurora, OH),

saturated with carbogen (95% O2/5% CO2) and adjusted to pH 7.4. A wet weight of PCLS

approximately 3 mg, have an estimated thickness of 300-400 µm. To avoid rapid loss of

viability after slicing, PCLS were directly transferred to ice-cold University of Wisconsin organ

preservation solution (UW-solution). After slicing, PCLS were cultured in 12-well plates in

William’s medium E + GlutaMAX (Gibco, New York, USA) supplemented with 14 mM Glucose

(Merck, Darmstadt, Germany) and 50 µg/mL gentamycin (Gibco). The slices were incubated

for 24 h at 37°C in an 80% O2/5% CO2 atmosphere. The culture plates were horizontally

shaken at 90 rpm (amplitude 2cm). For these experiments, PCLS were incubated with medium

alone, M1 stimulus (100 ng/mL LPS + 10 ng/mL IFNγ) with and without KX2-391 (25 µM). The

viability of the slices was assessed by measuring the adenosine triphosphate (ATP) content

using the ATP bioluminescence kit (Roche Diagnostics, Mannheim, Germany). Determined ATP

values (pmol) were normalized to the total amount of protein (µg) estimated by the Lowry

method (Bio-rad RC DC Protein Assay, Bio-Rad, Veenendaal, The Netherlands). Values

displayed are relative values compared to the related controls.

91

4.2.15 In vitro lipid biogenesis in human hepatocytes (HepG2 cells)

HepG2 cells were treated with palmitate (0.3 mM) in complete cell culture medium with or

without 50 μM KX2-391 for 48 h. At the end of the experiment, cells were washed twice with

PBS followed by fixation and staining using with oil-red-O staining kit (Sigma) as per

manufacturer’s instructions.

4.2.16 In vitro Human 3D spheroid NASH model

To prepare the human 3D spheroids, human hepatocytes HepG2 (80%), human monocytes

THP1 (10%), human hepatic stellate cells LX2 (5%) and human endothelial cells HUVECs (5%)

were mixed using complete medium containing 10% FBS as described elsewhere [36].

Spheroids containing 1,200 total cells were plated in ultra-low adhesion U bottomed plates

(ULA) (1,200 cells/100 μL) followed by addition of 100 μL of medium. After 7 days of culturing,

3D spheroids were incubated with 10 μg/mL LPS with and without KX2-391 (50 μM). After 7

days of culturing, images of the 3D spheroids were captured using light microscope and

spheroids were embedded in Tissue-Tek optimum-cutting temperature (O.C.T) embedding

medium (Thermo fisher Scientific), fixed and snap-frozen in 2-methyl butane (Sigma) chilled

on a dry ice. The spheroids were cryo-sectioned into 4 μm cryosections and stained as

described below.

4.2.17 RNA extraction, reverse transcription and quantitative real time PCR

Total RNA from cells and liver tissues was isolated using GenElute Total RNA Miniprep Kit

(Sigma) and SV total RNA isolation system (Promega Corporation, Fitchburg, WI, USA)

respectively according to manufacturer’s instructions. The RNA concentration was

quantitated by a UV spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA).

Total RNA (500 ng – 1 μg) was reverse-transcribed using iScript cDNA Synthesis Kit (Bio-Rad,

Hercules, CA, USA). All the primers were purchased from Sigma-Genosys (Haverhill, UK). Real-

time PCR was performed using 2x SensiMix SYBR and Fluorescein Kit (Bioline, QT615-05,

Luckenwalde, Germany), 20 ng cDNA and pre-tested gene-specific primer sets (listed in Table

S1 and S2). The cycling conditions for the BioRad CFX384 Real-Time PCR detection system

were 95°C for 10 min, 40 cycles of 95°C/15 sec, 58°C/15 sec and 72°C/15 sec. Finally, cycle

threshold (Ct) values were normalized to reference gene GAPDH and fold changes in

expression were calculated using the 2-ΔΔCt method.

92

4.2.18 Immunohistochemistry

Liver tissues were harvested and transferred to Tissue-Tek optimum-cutting temperature

(O.C.T.) embedding medium (Sakura Finetek, Torrance, CA, USA), and snap-frozen in 2-methyl

butane chilled on a dry ice. Cryosections (4 μm) were cut using a Leica CM 3050 cryostat (Leica

Microsystems, Nussloch, Germany). The sections were air-dried and fixed with acetone for 10

min. Cells or tissue sections were rehydrated with PBS and incubated with the primary

antibody (refer to Table S3) for 1 h at room temperature. Cells or sections were then incubated

with horseradish peroxidase (HRP)-conjugated/fluorescent secondary antibody for 1 h at

room temperature. Then incubated with HRP-conjugated/fluorescent tertiary antibody for 1

h at room temperature. Thereafter, peroxidase activity (where HRP-conjugated antibodies

were used) was developed using AEC (3-amino-9-ethyl carbazole) substrate kit (Life

Technologies, Carlsbad, CA, USA) for 20 min and nuclei were counterstained with hematoxylin

(Sigma). In case of fluorescent stainings, nuclei were stained with DAPI (4ʹ,6-diamidino-2-

phenylindole). For liver sections, endogenous peroxidase activity was blocked by 3% H2O2

prepared in methanol. Cells or sections were mounted with Aquatex mounting medium

(Merck, Darmstadt, Germany) or anti-fade DAPI-containing mounting medium (Merck). The

staining was visualized and the images were captured using Nikon eclipse E600 microscope

(Nikon, Tokyo, Japan).

4.2.18.1 Oil-Red-O staining

Oil-Red-O stock solution was prepared by dissolving 0.3 g Oil-Red-O (Sigma) in 10 mL

isopropanol. The sections were fixed in 4% formalin for 20 min and were then stained in Oil-

Red-O solution as per manufacturer’s instructions. Briefly, formalin-fixed sections were rinsed

with 60% isopropanol followed by staining with freshly prepared Oil-Red-O working solution

for 15 min. Thereafter, the sections were rinsed with 60% isopropanol and nuclei were

counterstained with hematoxylin (Fluka Chemie). Eventually, the sections were rinsed with

tap water and were mounted with aquatex mounting medium (Merck).

4.2.18.2 Hematoxylin and Eosin staining

The sections were fixed with 4% formalin for 20 min and then rinsed with distilled water. The

sections were incubated with hematoxylin for 15 min followed by washing with tap water.

Thereafter, the sections were incubated with eosin solution for 1.5 min followed by wash in

93

96% ethanol, dehydration with ethanol and were mounted with VectaMount mounting

medium (Vector Laboratories, Burlingame, CA).

4.2.18.3 Quantitative histological analysis

For quantitation, sections were scanned using Hamamatsu NanoZoomer Digital slide scanner

2.0HT (Hamamatsu Photonics, Bridgewater, NJ, USA) for quantitative histological analysis.

High resolution scans were viewed using NanoZoomer Digital Pathology (NDP2.0) viewer

software (Hamamatsu Photonics). About 20 images (100x) of each entire section (from NDP)

were imported into ImageJ and were analyzed quantitatively at a fixed threshold. All the

primary antibodies used in this study have been pre-tested for specificity. The staining’s

performed in the study included the negative control (without primary antibody and isotype

control antibodies) to confirm the specificity of the staining and showed no non-specific

staining.


Cells were lysed using standard western blot lysis buffer (Life Technologies) and the prepared

cell lysates were stored at -80°C until use. The samples were boiled and subjected to SDS-

PAGE with 10% Tris-glycine gels (Life Technologies) followed by protein transfer onto PVDF

membrane. The membranes were developed according to the standard protocols using

primary and secondary antibodies as mentioned in Table S3. The bands were visualized using

ECL detection reagent (Perkin Elmer Inc., Waltham, MA) and photographed using FluorChem

M Imaging System (ProteinSimple, Alpha Innotech, San Leandro CA). Intensity of individual

bands was quantified using ImageJ densitometry software, and expressed in relative %.

4.2.20 Statistical analyses

All the graphs and heat maps were made using GraphPad Prism version 8.4.1 (GraphPad Prism,

La Jolla, CA, USA). All the results are expressed as the mean + standard error of the mean

(SEM). Statistical analyses were performed using GraphPad Prism version 9.1.2 (GraphPad

Prism, La Jolla, CA, USA). Multiple comparisons between different groups were calculated

using the one-way analysis of variance (ANOVA) with the Bonferroni post hoc test. Statistical

differences between two groups were calculated using a two-tailed unpaired t test.

Differences were considered significant when #p < 0.05, ##p < 0.01, ###p < 0.001 or *p < 0.05,

**p < 0.01, ***p < 0.001.

94

4.3 Results

4.3.1 Upregulation of Src expression is associated with liver disease severity

We first analyzed Src gene expression in different etiological liver diseases using the publicly

available database. In NASH patients, we found a highly significant induction of Src gene

expression that correlated with the increasing NAS (NAFLD activity score) compared to healthy

control livers (Figure 1A). Likewise in ASH patients, we found a significant correlation between

ASH severity with increasing Src gene expression from ASH non-severe, ASH responders

(responsive to steroids), ASH non-responders (non-responsive to steroids) and ASH explants

(with liver transplantation) (Figure 1A). Moreover, Src gene expression was upregulated in

liver tissues obtained from patients with other etiologies i.e. HCV-induced cirrhosis, and

infants with BA-induced liver inflammation and fibrosis (Figure 1A). Consistent with the

human data, Src gene expression was significantly increased in MCD diet-induced NASH,

Lieber-DeCarli EtOH diet-induced ASH, CCl4- and BDL-induced liver fibrosis mouse models

(Figure 1B).

We further examined the protein expression of Src in human and mouse livers by

immunostainings. We found that Src expression was increased in human NASH livers

compared to normal livers (Figure 1C). Furthermore, Src expression was higher in the livers

from MCD-induced NASH, Lieber-DeCarli EtOH-diet induced ASH and CCl4-induced fibrosis

mouse model compared to control livers (Figure 1D). Moreover, we observed an increased

nuclear localization of Src suggesting active Src kinase in the diseased livers as indicated by

arrows (Figure 1C-D). Histological analysis revealed significant liver damage in human NASH

liver tissues, and MCD-diet and EtOH-diet induced mouse models (hematoxylin and eosin;

H&E), while CCl4-induced liver fibrosis was confirmed using collagen I immunostainings when

compared to control livers (Figure 1C-D).

95

Figure 1. Upregulation of Src expression in human and mouse liver tissues. (A) Intrahepatic Src gene expression (from publicly available datasets) in NASH patients characterized by NAFLD activity score (NAS): NAS1-2 (n=15), NAS3-4 (n=7), NAS5-6 (n=15) compared to healthy controls (n=36); ASH patients with a spectrum of ALD: non-severe ASH (n=11), ASH responders (responsive to steroids, n=9), ASH non-responders (non-responsive to steroids, n=9) and ASH explants (with liver explants, n=10) compared to control livers (n=10); HCV-cirrhotic patients (n=9) compared to healthy controls (n=10); Biliary atresia (BA) patients with BA inflammation (n=17); BA fibrosis (n=26) compared to healthy controls (n=4). (B) Relative Src gene expression in the MCD-diet-fed (n=8) compared to control chow-diet fed mice (n=8); EtOH-diet-fed (n=11) compared to isocaloric liquid diet-fed mice (n=11); CCl4 (n=9) compared to control (olive oil) mice (n=9); and BDL 48hrs (n=3) and 28days (n=3) post-ligation compared to control (sham-operated) mice (n=6); (C) Representative images (scale=100μm) of Src-

96

and H&E-stained liver tissue sections from human NASH (n=5) compared to healthy controls (n=4). (D) Representative images (scale=100μm) of Src-, H&E- and collagen-I-stained liver sections from MCD-diet-fed NASH (n=8), EtOH-diet-fed ASH (n=8) and CCl4-induced liver fibrosis (n=8) mouse models compared to respective controls (n=8). Inserts are magnified images with arrows depicting Src nuclear staining. Mean + SEM, two-tailed Student’s t-test or one-way ANOVA with Bonferroni post-hoc test for comparisons between 2 or more than 2 groups respectively, *p<0.05, **p<0.01, ***p<0.001.

4.3.2 Src kinase inhibition ameliorated liver steatosis, inflammation and fibrosis in MCD-diet induced NASH mouse model

To understand the implication of Src kinase pathway in NASH, we tested the highly selective

and potent Src kinase inhibitor KX2-391 that binds specifically to the substrate binding site of

Src kinase. We investigated the therapeutic efficacy of KX2-391 in MCD-diet-induced NASH in

mice as per the regimen depicted in Figure 2A. Macroscopic visualization of liver tissues

demonstrated the visible pale and gross appearance of the liver suggesting the liver damage

in MCD-diet-fed NASH mice compared to control (chow-diet-fed) mice (Figure 2B). Treatment

with KX2-391 showed a noticeably improved appearance of livers compared to untreated

NASH livers (Figure 2B).

Steatosis, inflammation, and fibrosis are the hallmarks of NASH. We assessed the gene

expression of several NASH-related genes i.e. steatosis-related genes: lipogenesis-related

genes i.e. stearoyl CoA desaturase-1 (SCD1) that catalyzes the biosynthesis of

monounsaturated fatty acids [37], and diacylglycerol acyl transferase 2 (DGAT2) that catalyzes

the first step in triglyceride (TG) synthesis [38], endoplasmic reticulum (ER) stress and

unfolded protein response (ER/UPR) induced genes i.e. activating transcription factor 6 (ATF6)

and X-box-binding protein 1 (XBP1) [39], and fatty acid biosynthesis regulating protein i.e.

sterol regulatory element-binding protein 1c (SREBP1c) [40]; inflammation-related genes:

tumor necrosis factor alpha (TNFα), interleukin-1-beta (IL-1β), inducible nitric-oxide synthase

(iNOS), C-C motif chemokine ligand 2 (CCL2), interleukin-6 (IL-6); and fibrosis-related genes:

HSCs markers i.e. Desmin and alpha-smooth muscle actin (α-SMA). These genes were found

to be significantly upregulated in MCD-diet fed mice compared to controls, and were reduced

following treatment with KX2-391 (Figure 2C and Figure S1).

Intriguingly, KX2-391 significantly ameliorated liver damage as confirmed by H&E staining.

KX2-391 inhibited liver steatosis, inflammation, and fibrosis as assessed by Oil-red-O, F4/80,

and collagen-I (immuno)stainings respectively (Figure 2D-E).

98

Figure 2. Src inhibition ameliorated steatosis, inflammation and fibrosis in MCD-diet induced NASH in mice. (A) Schematic showing NASH induction and KX2-391 treatment regimen. (B) Representative macroscopic images of livers from control (chow) (n=8), MCD (n=8), and MCD+KX2-391 (n=5) group. (C) Heatmap showing relative intrahepatic gene expression (normalized with 18s rRNA) for steatosis (SCD1, DGAT2, XBP1, SREBP1 and ATF6); inflammation (TNFα, IL-1β, iNOS, CCL2 and IL-6) and fibrosis (Desmin and α-SMA) markers in different groups (Refer to Figure S1). *p<0.05, **p<0.01 denotes significance versus control group and #p<0.05, ##p<0.01 denotes significance versus MCD group. (D) Representative images (scale=100μm) and (E) quantitative analysis of liver sections stained with H&E, oil-red-O, F4/80 and collagen-I, and total liver collagen content (Hydroxyproline). (E) Plasma AST, ALT, triglycerides, and cholesterol levels. Mean + SEM, one-way ANOVA with Bonferroni post-hoc test, *p<0.05, **p<0.01, ***p<0.001.

Moreover, we found that KX2-391 significantly inhibited total collagen as assessed by

hydroxyproline assay, and AST, ALT, total triglycerides, and total cholesterol plasma levels

(Figure 2E-F). These results suggest Src kinase inhibition as a prospective approach to treat

NASH.

4.3.3 Src kinase inhibition attenuated liver steatosis, inflammation and fibrosis in EtOH-diet induced ASH mouse model

We further investigated the therapeutic efficacy of KX2-391 in chronic ethanol feeding in mice

as described elsewhere [30] and depicted in Figure 3A. Macroscopic visualization of liver

tissues at the end of the experiment morphologically showed mild pale appearance suggesting

the hepatocellular damage in EtOH-diet fed mice compared to isocaloric-diet fed control mice

(Figure 3B). Appearance of liver tissue after treatment with KX2-391 was improved when

compared to livers derived from EtOH-diet fed mice (Figure 3B).

We also assessed the gene expression of steatosis-related markers: SCD1, DGAT2, ATF6 and

XBP1; inflammation-related markers: IL-1β, iNOS, TNFα, Arg1, and IL-6; and fibrosis-related

markers: Collagen I, Desmin and α-SMA. KX2-391 reduced the EtOH-induced expression of

SCD1, DGAT2, ATF6 and XBP1 significantly (Figure 3C and Figure S2). Furthermore,

inflammation markers (IL-1β, iNOS, TNFα and IL-6) upregulated during EtOH-induced ASH

were inhibited by KX2-391 treatment (Figure 3C, Figure S2). Interestingly, KX2-391

upregulated the expression of Arginase-I (Arg1), as known as anti-inflammatory/restorative

macrophage marker (Figure 3C, Figure S2). We then analyzed the expression of fibrosis

markers in the liver tissues and observed that KX2-391 significantly reduced collagen I, desmin

and α-SMA expression as shown in Figure 3C and Figure S2.

100

Figure 3. Src inhibition attenuated steatosis, inflammation and fibrosis in EtOH-diet induced ASH in mice. (A) Schematic showing ASH induction and KX2-391 treatment regimen. (B) Representative macroscopic images of livers from control (n=6), EtOH (n=6), and EtOH+KX2-391 (n=6) group. (C) Heatmap showing relative intrahepatic gene expression (normalized with 18s rRNA) for steatosis (SCD1, DGAT2, ATF6 and XBP1); inflammatory (IL-1β, iNOS, TNFα, IL-6 and Arg1) and fibrosis (Collagen I, Desmin and α-SMA) markers in different groups (Refer to Figure S2). *p<0.05, **p<0.01 denotes significance versus control group and #p<0.05, ##p<0.01 denotes significance versus EtOH group. (D) Representative images (scale=100μm) and (E) quantitative analysis of liver sections stained with H&E, oil-red-O, F4/80 and collagen-I, and total liver collagen content (Hydroxyproline). (F) Plasma AST, ALT, triglycerides, and cholesterol levels. Mean + SEM, one-way ANOVA with Bonferroni post-hoc test, *p<0.05, **p<0.01, ***p<0.001.

We further observed increased liver damage as evidenced by H&E staining’s, steatosis (lipid

accumulation) as confirmed by Oil-Red-O staining’s, inflammation as assessed by F4/80

immuno-staining, and fibrosis as analyzed by collagen I immunostaining and total

hydroxyproline content in the EtOH-diet fed ASH mouse model (Figure 3D-E). KX2-391

treatment significantly inhibited liver steatosis, hepatic macrophage infiltration and

inflammation, and fibrogenesis (Figure 3D-E). We then analyzed plasma AST, ALT, triglycerides

and cholesterol levels and found that these parameters were upregulated in EtOH-fed mice

and strongly reduced following KX2-391 treatment (Figure 3F). These findings suggest that Src

inhibition ameliorates steatosis, inflammation and fibrosis associated with ASH.

4.3.4 Inhibition of Src diminished hepatocytic lipid accumulation and HSCs activation

To dissect the cellular effects of Src kinase activation in the liver during NASH and ALD, we

examined Src expression in different (non-activated) human cells i.e. THP1 (monocytes),

HUVECs (endothelial cells), HepG2 (hepatocytes) and LX2 cells (HSCs), and found increased Src

gene expression in hepatocytes and HSCs compared to THP1 and HUVECs (Figure 4A). To

confirm these in vitro results, we performed co-immunostainings of Src with hepatocyte

marker (EpCAM), macrophage marker (CD68) and fibrosis marker (Collagen I) in human NASH

livers. Indeed, we observed colocalization (indicated with arrows) of Src with these markers

further confirming the expression of Src in different liver cells (Figure S3). We then

investigated the implication of Src in hepatocytes and HSCs. We treated HepG2 cells with

palmitate (free fatty acid, FFA) to mimic lipid biogenesis and lipid storage. In accordance to

the in vivo data, Src inhibition in hepatocytes reduced hepatocytic lipid accumulation, as

assessed by oil-red-o staining, suggesting that Src activation directly regulates lipid

accumulation/metabolism in hepatocytes (Figure S4). In LX2 cells, we found that TGFβ-

101

induced collagen (gene and protein) expression and contractility was significantly attenuated

following treatment with KX2-391 (Figure 4B-E) corroborating with the anti-fibrotic effects of

KX2-391 observed in the mouse models.

Figure 4. Src inhibition decreased TGFβ-induced HSCs activation, contraction and collagen expression via FAK/PI3K/AKT pathway. (A) Relative Src gene expression (normalized with 18s rRNA) in THP1 monocytes, HUVECs, HepG2 and HSCs (n=3). (B) Collagen-I-stained control and TGFβ-activated LX2 cells ± 50μM KX2-391 (n=3) (C) Relative collagen-I and -III gene expression (normalized with 18s rRNA) in control and TGFβ-activated LX2 cells ± 50μM KX2-391 (n=3). (D) Quantitative analysis and (E) representative images showing contractility of control and TGFβ-activated LX2 cells ± 50μM KX2-391 (n=3). (F) Representative image showing western-blot analysis for phosphorylated Src, FAK, PI3K and AKT normalized with respective non-phosphorylated proteins in control and TGFβ-activated LX2 cells ± KX2-391 (n=3) (Refer to Figure S5). (G) % relative cell viability using Alamar blue assay on control and TGFβ-activated LX2 cells ± 50μM KX2-391 (n=3). Mean + SEM, one-way ANOVA with Bonferroni post-hoc test, *p<0.05, **p<0.01, ns=non-significant.

102

4.3.5 Src mediates HSCs activation via FAK/PI3K/AKT pathway

We performed western blot analysis to understand the underlying mechanism of anti-fibrotic

effects mediated by Src inhibitor in HSCs. We observed induction in the Src phosphorylation

upon TGFβ activation in HSCs which was inhibited by KX2-391 treatment (Figure 4F and Figure

S5). We further observed an increased phosphorylation of focal adhesion kinase (FAK),

phosphatidylinositol 3-kinase (PI3K) and serine/threonine kinase (AKT) after treatment with

TGFβ in HSCs. FAK/PI3K/AKT pathway plays an important role in the proliferation and

activation of HSCs, and fibrosis progression [41]. Furthermore, previously it has been

suggested that Src regulates FAK/PI3K/AKT pathway [42] as further confirmed in this study.

Here, we observed that Src inhibitor inhibited phosphorylation and hence activation of

FAK/PI3K/AKT (Figure 4F and Figure S5) suggesting Src-mediated regulation of FAK/PI3K/AKT

pathway in HSCs and liver fibrogenesis. Importantly, we observed about 15% inhibition in cell

viability reflected in the metabolic activity as assessed by Alamar blue assay (Figure 4G). The

inhibition in cell viability (or metabolic activity) might be attributed to inhibition of

FAK/PI3K/AKT pathway resulting in reduced HSCs proliferation and activation.

4.3.6 Src inhibition decreased expression of inflammatory markers in LPS- and IFNγ-stimulated pro-inflammatory macrophages and in precision-cut liver slices

Several studies have documented a significant increase in intrahepatic monocyte/macrophage

infiltration, phenotypic differentiation and activation in vitro, in vivo in experimental models,

and patients with (N)ASH [43]. To determine the implication of Src in macrophages, we first

assessed Src expression and Src pathway activation in non-activated, pro-inflammatory

(stimulated with LPS/IFNγ) and pro-resolving (stimulated with IL-4/IL-13) macrophages. In

RAW264.7 macrophages, we found significant induction of Src (gene and protein) expression

in LPS+IFNγ-stimulated pro-inflammatory macrophages compared to non-stimulated and

IL4+IL13-stimulated macrophages (Figure 5A-B). We also found an increased pSrc expression

in LPS+IFNγ-stimulated macrophages (Figure 5B). We found dose-dependent inhibition in cell

viability with 15% inhibition using highest concentration of KX2-391 (50µM) reflecting the

effect of KX2-391 on RAW264.7 macrophages metabolic activity following Src inhibition

(Figure 5C).

103

Figure 5. Src inhibition attenuated LPS and IFNγ-induced differentiation of RAW264.7 macrophages and BMDMs. (A) Src gene expression in RAW264.7 macrophages, n=3. (B) western-blot images and quantitative analysis showing pSrc protein expression (normalized with Src) in unstimulated (medium), LPS/IFNγ- and IL-4/IL-13-stimulated RAW264.7 macrophages, n=3. (C) Viability assay results in RAW macrophages as assessed using Alamar blue assay, n=3. (D) Nitric-oxide release in the culture supernatant; and relative iNOS, CCL2 and FcγR1 gene expression (normalized with 18s rRNA) in macrophages treated with medium, LPS/IFNγ with KX2-391 (0, 1, 10 and 50μM), n=3. (E) Gene expression of iNOS, CCL2 and FcγR1 (normalized with 18s rRNA) in BMDMs treated with medium, LPS/IFNγ ± 50μM KX2-391, n=3. Mean + SEM, one-way ANOVA with Bonferroni post-hoc test, *p<0.05, **p<0.01, and ***p<0.001.

We then evaluated the effect of Src inhibitor KX2-391 in RAW macrophages on nitric-oxide

(NO) release in LPS+IFNγ-differentiated macrophages. We observed that KX2-391

concentration-dependently reduced LPS+IFNγ-induced NO release (Figure 5D). We also found

that KX2-391 concentration-dependently inhibited LPS+IFNγ-induced inflammatory genes i.e.

iNOS, CCL2 and Fc gamma receptor 1 (FcγR1) (Figure 5D). We also tested the effect of KX2-

391 on LPS+IFNγ-differentiated BMDMs and observed that KX2-391 significantly down-

regulated the cell viability/metabolic activity as well as the expression of inflammatory genes

i.e. iNOS, CCL2, and FcγR1 (Figure 5E).

104

Finally, we analyzed the effect of KX2-391 in PCLS (prepared as shown schematically in Figure

6A and described elsewhere [35]) and human THP1 monocytes incubated with LPS+IFNγ.

Results revealed upregulation of Src expression in LPS+IFNγ-stimulated PCLS (as observed in

LPS+IFNγ treated BMDMs and THP1 macrophages) as compared to unstimulated and IL-4+IL-

13-stimulated PCLS (Figure S6 and Figure 6B). We treated PCLS with KX2-391 and examined

the effect of KX2-391 on PCLS viability (assessed using ATP assays, normalized with total

protein). In accordance with the in vitro results, we observed 15% inhibition (non-significant)

of cell viability/metabolic activity as compared to LPS+IFNγ PCLS (without KX-291), which

could be attributed to reduced cell proliferation and activation (Figure 6C).

Figure 6. KX2-391 inhibited LPS and IFNγ-induced inflammation in human THP1 macrophages, and precision-cut liver slices (PCLS). (A) Schematic showing PLCS preparation (refer to the methods section for details). (B) Src gene expression in PCLS, n=3. (C) Viability (ATP) assay normalized with total protein as assessed in PCLS, n=3 (3 liver slices per experiment). (D) Gene expression of iNOS and CCL2 (normalized with 18s rRNA) in PCLS treated with medium, LPS/IFNγ ± 25μM KX2-391, n=3 (3 liver slices per experiment). (E) Gene expression of iNOS, CCL2 and IL-6 (normalized with 18s rRNA) in PMA-

105

treated THP1 macrophages treated with medium alone, LPS/IFNγ ± 50μM KX2-391, n=3. Mean + SEM, one-way ANOVA with Bonferroni post-hoc test, *p<0.05, **p<0.01, and ***p<0.001.

Upon treatment with KX2-391, We further observed that KX2-391 significant inhibited

LPS+IFNγ-induced gene expression of inflammatory markers in PCLS (iNOS and CCL2) (Figure

6D) and THP1 macrophages (iNOS, CCL2 and IL-6) (Figure 6E). These results are consistent with

our findings in the mouse models.

4.3.7 Pharmacological Src inhibition attenuated pro-inflammatory macrophage activation via FAK/PI3K/AKT pathway

Finally, we performed western-blot analysis of unstimulated, LPS+IFNγ-stimulated, IL-4+IL-13-

stimulated, and LPS+IFNγ-stimulated and treated with KX2-391, to understand the underlying

mechanism of Src in macrophages. We observed stronger induction in Src protein expression

and phosphorylation upon LPS+IFNγ stimulation which was diminished by KX2-391 treatment

(Figure 7A and Figure S7). We further observed increased phosphorylation of FAK, PI3K and

AKT following LPS+IFNγ stimulation. Studies have reported the involvement of FAK/PI3K/AKT

pathway in the survival and activation of macrophages, and inflammatory responses [44].

Figure 7. Src inhibition attenuated LPS+IFNγ stimulated pro-inflammatory macrophages via FAK/PI3K/AKT pathway. (A) Representative image showing western-blot analysis for phosphorylated Src, FAK, PI3K and AKT normalized with respective non-phosphorylated proteins, in unstimulated, IL-4/IL-13- and LPS/IFNγ-stimulated ± KX2-391, n=3. Refer to Figure S7. (B) Schematic depicting the mechanism-of-action of Src-mediated effects.

106

In this study, we have observed that KX2-391 inhibited phosphorylation and activation of

FAK/PI3K/AKT in LPS+IFNγ-stimulated macrophages (Figure 7A and Figure S7) suggesting the

Src-mediated regulation of FAK/PI3K/AKT pathway in inflammatory macrophages. The

proposed mechanism of Src-mediated effects is schematically presented in Figure 7B.

Finally, we investigated the effect of KX2-391 in in vitro 3D-human spheroids model whereby

3D-spheroids were formed from human hepatocytes (HepG2), human hepatic stellate cells

(LX2 cells), human monocytes (THP1) and human endothelial cells (HUVEC) as schematically

presented in Figure S8A. These spheroids or liver microtissues display characteristic mild

steatohepatitis phenotype when incubated with LPS (endotoxin) as shown in Figure S8B. In

this study, we used LPS is a pleiotropic inflammatory stimulus as it is proposed to reach the

liver via hepatic portal vein after release from Gastrointestinal tract contributing to disease

progression. We treated 7-day spheroids with LPS, and incubated with KX2-391 for 7 days, and

found that treatment with LPS increased collagen-I expression and macrophage activation

marker, MHC-II (major histocompatibility complex class II) expression as well as steatosis

assessed by oil-red-o staining, and all these markers were reduced following Src inhibition

(Figure S8B). However, it is important to stress that LPS only induces pathways associated with

inflammatory signaling therefore NASH-relevant cues such as fructose, free fatty acids,

cholesterol and TGFβ in combination with LPS could be supplemented to model different

aspects of clinical NASH [45].

4.4 Discussion and conclusions

In this study, we report Src kinase as a promising therapeutic target in non-alcoholic and

alcoholic steatohepatitis. We demonstrated that Src was significantly expressed in NASH, ASH,

BA and HCV-cirrhotic patients suggesting that Src kinase is a common pathway involved in

liver pathophysiology irrespective of etiology. Furthermore, Src was upregulated in

hepatocytes, HSCs and inflammatory macrophages. Using a selective Src inhibitor KX2-391,

we have demonstrated amelioration of steatosis, inflammation and fibrogenesis in vitro and

in vivo in NASH and ASH mouse models. We further investigated the mechanism-of-action of

Src and found that Src regulates inflammation and fibrosis via a FAK/PI3K/AKT pathway.

Src family kinases (SFKs), comprising of nine members, have been earlier shown to be involved

in myofibroblasts activation in fibrotic diseases [19-22], and in macrophage activation in

107

inflammatory diseases [17, 18]. However, SFKs and especially Src kinase, one of the SFKs, has

not been explored yet in liver diseases especially in (N)ASH. We observed an increased Src

expression in different liver pathologies in patients and in mouse models. We also evaluated

Src inhibition by KX2-391 in vivo in NASH and ASH mouse models. MCD- and EtOH-diet induced

NASH and ASH respectively in mouse models and showed characteristic accumulation of fat

in hepatocytes (hepatic steatosis), intra-hepatic inflammation, and fibrosis as reported

previously [29, 30]. Triglycerides, FFAs and/or ketones have been hypothesized to be a key

initiating factor in NASH [46] and alcoholic fatty liver pathogenesis. Increased dietary FFA

intake and impaired FFA oxidation causes an increase in the flux of FFA within hepatocytes.

Once the threshold of lipid storage is exceeded, leads to production of toxic lipid metabolites.

The toxic lipid and alcoholic metabolites promote the overproduction of reactive oxygen

species (ROS), which cause liver damage [6, 7]. In this study, we have demonstrated in vitro

that KX2-391 rescued FFA accumulation in HepG2 cells when treated with palmitate. Likewise,

we showed in vivo that KX2-391 ameliorated steatosis in the liver induced by MCD and EtOH

diet.

We further found significant upregulation of SCD1, DGAT2, XBP1 and ATF6 gene expression in

liver tissues from NASH and ASH mouse models. SCD1 and XBP1 is required for de novo FA

synthesis in the liver [37, 47] and KX2-391 inhibited FA synthesis by reducing the SCD1 and

XBP1 expression significantly. Furthermore, de novo lipogenesis is enhanced by DGAT2 and

ATF6 overexpression [38, 48], based on our results, KX2-391 could prevent the overexpression

of DGAT2 and ATF6 and hence lipogenesis. SREBP1 is also shown to be upregulated which

plays a key role in hepatic transcriptional regulation of lipogenic enzymes [49] and

triglycerides in the liver [50]. In this study, we also observed significant downregulation in

SREBP1 expression after treatment with KX2-391.

Inflammation plays an important role in NASH and ASH pathogenesis [6, 7]. In this study, we

found that Src was highly upregulated in LPS/IFNγ-stimulated macrophages and Src inhibition

strongly inhibited LPS/IFNγ-induced NO release and inflammatory markers. Previous studies

demonstrated that pharmacological inhibition of CCL2 ameliorated liver inflammation by

inhibition of macrophage infiltration [34]. In this study, we showed that KX2-391 inhibited

CCL2 expression hence macrophage infiltration in vivo. Notably, we observed increased Src

kinase expression and phosphorylation in pro-inflammatory macrophages, a phenomenon

108

that is not specific to (N)ASH alone but also relevant for several inflammatory diseases

suggesting the implication of Src Kinase beyond (N)ASH.

Fibrosis is an end-stage disease in ASH and NASH patients, we therefore also analyzed the

expression of Src in HSCs and found increased expression of Src, which upon inhibition

attenuated TGFβ-induced collagen deposition and HSCs contractility. Consistent with in vitro

findings, KX2-391 inhibited fibrotic parameters in vivo in MCD- and EtOH-diet mouse models

and 3D human spheroids. Notably, KX2-391 was found to be non-toxic as assessed by the

viability studies in vitro and in PCLS, and in vivo as confirmed by the body weight of the animals

before and after treatment. Notably, Src modulates several signaling pathways, hence it is

possible that Src inhibitor treatment might lead to off-target effects and increasing risk for

infections due to immuno-suppression. Such potential adverse effects should be considered

during evaluation of Src inhibitors. Targeting approaches including organ-/cell-specific

delivery of potential Src inhibitors may be explored to improve the therapeutic efficacy while

reducing adverse effects.

Based on the results, we have clearly demonstrated a novel role of Src kinase in NASH and

ASH. We have also demonstrated the role of Src pathway in inflammatory macrophages, HSCs,

and hepatocytes, and further unraveled the mechanism-of-action of Src kinase. However

detailed mechanistic studies especially in in vivo disease models and human liver tissues are

required to validate our findings. To our best knowledge, this is the first comprehensive study

exploring the role of Src kinase and Src kinase inhibitor KX2-391 in NASH and ASH, and suggests

Src tyrosine Kinase as a potential therapeutic target in non-alcoholic and alcoholic

steatohepatitis. More studies using Src kinase inhibitor in other (N)ASH animal models, also

considering the lack of metabolic syndrome in MCD diet model, are warranted to validate

these findings. Since Src kinase is expressed on different cell types including hepatocytes,

inflammatory macrophages and HSCs, it is relevant that KX2-391 would be effective at

different stages of disease progression. Notwithstanding, given the ubiquitous expression of

Src kinase and as it regulates several signaling pathways, it is possible that (long-term) Src

treatment might potentially lead to adverse off-target effects including immunosuppression

with an increased risk for infections. Such potential adverse effects should be kept in mind

while investigating the therapeutic potential of Src inhibition in (N)ASH. To circumvent the

109

adverse effects, organ/cell-specific delivery of a Src inhibitor could be explored to improve the

short half-life and therapeutic efficacy.


Authors thank Busra Ozturk for the technical assistance during the animal experiments.

Authors also thank Ana Ortiz-Perez and Alexandros Vassilios Gabriel for their help in 3D human

spheroid study. This project was supported by the Indonesian Endowment Fund for Education

from the Republic of Indonesia (Lembaga Pengelola Dana Pendidikan/LPDP to DWK) and

Netherlands Organization for Health Research and Development, ZonMW, NWO, VENI

innovation grant 916.151.94 (to RB), and the University of Twente.

4.6 References

[1] L. Pimpin, H. Cortez-Pinto, F. Negro, E. Corbould, J.V. Lazarus, L. Webber, N. Sheron, E.H.S. Committee, Burden of liver disease in Europe: Epidemiology and analysis of risk factors to identify prevention policies, J Hepatol, (2018).

[2] M. Arrese, A.E. Feldstein, Nash-Related Cirrhosis: An Occult Liver Disease Burden, Hepatol Commun, 1 (2017) 84-86.

[3] S. Mitra, A. De, A. Chowdhury, Epidemiology of non-alcoholic and alcoholic fatty liver diseases, Transl Gastroenterol Hepatol, 5 (2020) 16.

[4] J.L. Mohler, E.S. Antonarakis, A.J. Armstrong, A.V. D'Amico, B.J. Davis, T. Dorff, J.A. Eastham, C.A. Enke, T.A. Farrington, C.S. Higano, E.M. Horwitz, M. Hurwitz, J.E. Ippolito, C.J. Kane, M.R. Kuettel, J.M. Lang, J. McKenney, G. Netto, D.F. Penson, E.R. Plimack, J.M. Pow-Sang, T.J. Pugh, S. Richey, M. Roach, S. Rosenfeld, E. Schaeffer, A. Shabsigh, E.J. Small, D.E. Spratt, S. Srinivas, J. Tward, D.A. Shead, D.A. Freedman-Cass, Prostate Cancer, Version 2.2019, NCCN Clinical Practice Guidelines in Oncology, J Natl Compr Canc Netw, 17 (2019) 479-505.

[5] D. Haldar, B. Kern, J. Hodson, M.J. Armstrong, R. Adam, G. Berlakovich, J. Fritz, B. Feurstein, W. Popp, V. Karam, P. Muiesan, J. O'Grady, N. Jamieson, S.J. Wigmore, J. Pirenne, S.A. Malek-Hosseini, E. Hidalgo, Y. Tokat, A. Paul, J. Pratschke, M. Bartels, P. Trunecka, U. Settmacher, M. Pinzani, C. Duvoux, P.N. Newsome, S. Schneeberger, L. European, A. Intestine Transplant, Outcomes of liver transplantation for non-alcoholic steatohepatitis: A European Liver Transplant Registry study, J Hepatol, 71 (2019) 313-322.


[7] S.M. Francque, D. van der Graaff, W.J. Kwanten, Non-alcoholic fatty liver disease and cardiovascular risk: Pathophysiological mechanisms and implications, J Hepatol, 65 (2016) 425-443.

[8] F. Scaglioni, S. Ciccia, M. Marino, G. Bedogni, S. Bellentani, ASH and NASH, Dig Dis, 29 (2011) 202-210.

[9] M.A. Konerman, J.C. Jones, S.A. Harrison, Pharmacotherapy for NASH: Current and emerging, J Hepatol, 68 (2018) 362-375.

110


[11] A.A. Kolodziejczyk, D. Zheng, O. Shibolet, E. Elinav, The role of the microbiome in NAFLD and NASH, EMBO Mol Med, 11 (2019).

[12] K. Ray, NAFLD. Leaky guts: intestinal permeability and NASH, Nat Rev Gastroenterol Hepatol, 12 (2015) 123.

[13] G. Szabo, Gut-liver axis in alcoholic liver disease, Gastroenterology, 148 (2015) 30-36. [14] N. Goossens, Y. Hoshida, Is Hepatocellular Cancer the Same Disease in Alcoholic and

Nonalcoholic Fatty Liver Diseases?, Gastroenterology, 150 (2016) 1710-1717. [15] R. Roskoski, Jr., Src protein-tyrosine kinase structure and regulation, Biochem Biophys Res

Commun, 324 (2004) 1155-1164. [16] S.J. Parsons, J.T. Parsons, Src family kinases, key regulators of signal transduction,

Oncogene, 23 (2004) 7906-7909. [17] C.A. Lowell, Src-family kinases: rheostats of immune cell signaling, Mol Immunol, 41

(2004) 631-643. [18] C.L. Abram, C.A. Lowell, The diverse functions of Src family kinases in macrophages, Front

Biosci, 13 (2008) 4426-4450. [19] G. Du, J. Wang, T. Zhang, Q. Ding, X. Jia, X. Zhao, J. Dong, X. Yang, S. Lu, C. Zhang, Z. Liu, Z.

Zeng, R. Safadi, R. Qi, X. Zhao, Z. Hong, Y. Lu, Targeting Src family kinase member Fyn by Saracatinib attenuated liver fibrosis in vitro and in vivo, Cell Death Dis, 11 (2020) 118.

[20] M. Hu, P. Che, X. Han, G.Q. Cai, G. Liu, V. Antony, T. Luckhardt, G.P. Siegal, Y. Zhou, R.M. Liu, L.P. Desai, P.J. O'Reilly, V.J. Thannickal, Q. Ding, Therapeutic targeting of SRC kinase in myofibroblast differentiation and pulmonary fibrosis, J Pharmacol Exp Ther, 351 (2014) 87-95.

[21] H.Y. Seo, J.H. Jeon, Y.A. Jung, G.S. Jung, E.J. Lee, Y.K. Choi, K.G. Park, M.S. Choe, B.K. Jang, M.K. Kim, I.K. Lee, Fyn deficiency attenuates renal fibrosis by inhibition of phospho-STAT3, Kidney Int, 90 (2016) 1285-1297.

[22] Y. Yan, L. Ma, X. Zhou, M. Ponnusamy, J. Tang, M.A. Zhuang, E. Tolbert, G. Bayliss, J. Bai, S. Zhuang, Src inhibition blocks renal interstitial fibroblast activation and ameliorates renal fibrosis, Kidney Int, 89 (2016) 68-81.

[23] H.Y. Seo, S.H. Lee, J.H. Lee, Y.N. Kang, J.S. Hwang, K.G. Park, M.K. Kim, B.K. Jang, Src Inhibition Attenuates Liver Fibrosis by Preventing Hepatic Stellate Cell Activation and Decreasing Connetive Tissue Growth Factor, Cells, 9 (2020).

[24] J. Argemi, M.U. Latasa, S.R. Atkinson, I.O. Blokhin, V. Massey, J.P. Gue, J. Cabezas, J.J. Lozano, D. Van Booven, A. Bell, S. Cao, L.A. Vernetti, J.P. Arab, M. Ventura-Cots, L.R. Edmunds, C. Fondevilla, P. Stärkel, L. Dubuquoy, A. Louvet, G. Odena, J.L. Gomez, T. Aragon, J. Altamirano, J. Caballeria, M.J. Jurczak, D.L. Taylor, C. Berasain, C. Wahlestedt, S.P. Monga, M.Y. Morgan, P. Sancho-Bru, P. Mathurin, S. Furuya, C. Lackner, I. Rusyn, V.H. Shah, M.R. Thursz, J. Mann, M.A. Avila, R. Bataller, Defective HNF4alpha-dependent gene expression as a driver of hepatocellular failure in alcoholic hepatitis, Nature Communications, 10 (2019) 3126.

[25] C.A. Lowell, Src-family and Syk kinases in activating and inhibitory pathways in innate immune cells: signaling cross talk, Cold Spring Harb Perspect Biol, 3 (2011).


111


[28] C. Qu, D. Zheng, S. Li, Y. Liu, A. Lidofsky, J.A. Holmes, J. Chen, L. He, L. Wei, Y. Liao, H. Yuan, Q. Jin, Z. Lin, Q. Hu, Y. Jiang, M. Tu, X. Chen, W. Li, W. Lin, B.C. Fuchs, R.T. Chung, J. Hong, Tyrosine kinase SYK is a potential therapeutic target for liver fibrosis, Hepatology, 68 (2018) 1125-1139.

[29] L. Hebbard, J. George, Animal models of nonalcoholic fatty liver disease, Nat Rev Gastroenterol Hepatol, 8 (2011) 35-44.

[30] A. Bertola, S. Mathews, S.H. Ki, H. Wang, B. Gao, Mouse model of chronic and binge ethanol feeding (the NIAAA model), Nat Protoc, 8 (2013) 627-637.

[31] M. Ahrens, O. Ammerpohl, W. von Schonfels, J. Kolarova, S. Bens, T. Itzel, A. Teufel, A. Herrmann, M. Brosch, H. Hinrichsen, W. Erhart, J. Egberts, B. Sipos, S. Schreiber, R. Hasler, F. Stickel, T. Becker, M. Krawczak, C. Rocken, R. Siebert, C. Schafmayer, J. Hampe, DNA methylation analysis in nonalcoholic fatty liver disease suggests distinct disease-specific and remodeling signatures after bariatric surgery, Cell Metab, 18 (2013) 296-302.

[32] E. Wurmbach, Y.B. Chen, G. Khitrov, W. Zhang, S. Roayaie, M. Schwartz, I. Fiel, S. Thung, V. Mazzaferro, J. Bruix, E. Bottinger, S. Friedman, S. Waxman, J.M. Llovet, Genome-wide molecular profiles of HCV-induced dysplasia and hepatocellular carcinoma, Hepatology, 45 (2007) 938-947.

[33] K. Moyer, V. Kaimal, C. Pacheco, R. Mourya, H. Xu, P. Shivakumar, R. Chakraborty, M. Rao, J.C. Magee, K. Bove, B.J. Aronow, A.G. Jegga, J.A. Bezerra, Staging of biliary atresia at diagnosis by molecular profiling of the liver, Genome Med, 2 (2010) 33.

[34] C. Baeck, X. Wei, M. Bartneck, V. Fech, F. Heymann, N. Gassler, K. Hittatiya, D. Eulberg, T. Luedde, C. Trautwein, F. Tacke, Pharmacological inhibition of the chemokine C-C motif chemokine ligand 2 (monocyte chemoattractant protein 1) accelerates liver fibrosis regression by suppressing Ly-6C(+) macrophage infiltration in mice, Hepatology, 59 (2014) 1060-1072.

[35] I.A. de Graaf, P. Olinga, M.H. de Jager, M.T. Merema, R. de Kanter, E.G. van de Kerkhof, G.M. Groothuis, Preparation and incubation of precision-cut liver and intestinal slices for application in drug metabolism and toxicity studies, Nat Protoc, 5 (2010) 1540-1551.

[36] M. Kozyra, I. Johansson, Å. Nordling, S. Ullah, V.M. Lauschke, M. Ingelman-Sundberg, Human hepatic 3D spheroids as a model for steatosis and insulin resistance, Scientific Reports, 8 (2018) 14297.

[37] D. Bhattacharya, B. Basta, J.M. Mato, A. Craig, D. Fernandez-Ramos, F. Lopitz-Otsoa, D. Tsvirkun, L. Hayardeny, V. Chandar, R.E. Schwartz, A. Villanueva, S.L. Friedman, Aramchol downregulates stearoyl CoA-desaturase 1 in hepatic stellate cells to attenuate cellular fibrogenesis, JHEP Rep, 3 (2021) 100237.

[38] D.G. McLaren, S. Han, B.A. Murphy, L. Wilsie, S.J. Stout, H. Zhou, T.P. Roddy, J.N. Gorski, D.E. Metzger, M.K. Shin, D.F. Reilly, H.H. Zhou, M. Tadin-Strapps, S.R. Bartz, A.M. Cumiskey, T.H. Graham, D.M. Shen, K.O. Akinsanya, S.F. Previs, J.E. Imbriglio, S. Pinto, DGAT2 Inhibition Alters Aspects of Triglyceride Metabolism in Rodents but Not in Non-human Primates, Cell Metab, 27 (2018) 1236-1248 e1236.

[39] S. Lee, S. Kim, S. Hwang, N.J. Cherrington, D.Y. Ryu, Dysregulated expression of proteins associated with ER stress, autophagy and apoptosis in tissues from nonalcoholic fatty liver disease, Oncotarget, 8 (2017) 63370-63381.

112

[40] T. Nagaya, N. Tanaka, T. Suzuki, K. Sano, A. Horiuchi, M. Komatsu, T. Nakajima, T. Nishizawa, S. Joshita, T. Umemura, T. Ichijo, A. Matsumoto, K. Yoshizawa, J. Nakayama, E. Tanaka, T. Aoyama, Down-regulation of SREBP-1c is associated with the development of burned-out NASH, J Hepatol, 53 (2010) 724-731.

[41] S. Reif, A. Lang, J.N. Lindquist, Y. Yata, E. Gabele, A. Scanga, D.A. Brenner, R.A. Rippe, The role of focal adhesion kinase-phosphatidylinositol 3-kinase-akt signaling in hepatic stellate cell proliferation and type I collagen expression, J Biol Chem, 278 (2003) 8083-8090.

[42] V. Thamilselvan, D.H. Craig, M.D. Basson, FAK association with multiple signal proteins mediates pressure-induced colon cancer cell adhesion via a Src-dependent PI3K/Akt pathway, FASEB J, 21 (2007) 1730-1741.


[44] X. Sun, X. Wang, T. Chen, T. Li, K. Cao, A. Lu, Y. Chen, D. Sun, J. Luo, J. Fan, W. Young, Y. Ren, Myelin activates FAK/Akt/NF-kappaB pathways and provokes CR3-dependent inflammatory response in murine system, PLoS One, 5 (2010) e9380.

[45] T. Kostrzewski, S. Snow, A.L. Battle, S. Peel, Z. Ahmad, J. Basak, M. Surakala, A. Bornot, J. Lindgren, M. Ryaboshapkina, M. Clausen, D. Linden, C. Maass, L.M. Young, A. Corrigan, L. Ewart, D. Hughes, Modelling human liver fibrosis in the context of non-alcoholic steatohepatitis using a microphysiological system, Commun Biol, 4 (2021) 1080.


[47] L.H. Glimcher, A.H. Lee, From sugar to fat: How the transcription factor XBP1 regulates hepatic lipogenesis, Ann N Y Acad Sci, 1173 Suppl 1 (2009) E2-9.

[48] D.L. Howarth, C. Lindtner, A.M. Vacaru, R. Sachidanandam, O. Tsedensodnom, T. Vasilkova, C. Buettner, K.C. Sadler, Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish, PLoS Genet, 10 (2014) e1004335.

[49] J.C. Chow, P.R. Ling, Z. Qu, L. Laviola, A. Ciccarone, B.R. Bistrian, R.J. Smith, Growth hormone stimulates tyrosine phosphorylation of JAK2 and STAT5, but not insulin receptor substrate-1 or SHC proteins in liver and skeletal muscle of normal rats in vivo, Endocrinology, 137 (1996) 2880-2886.

[50] N. Yahagi, H. Shimano, A.H. Hasty, T. Matsuzaka, T. Ide, T. Yoshikawa, M. Amemiya-Kudo, S. Tomita, H. Okazaki, Y. Tamura, Y. Iizuka, K. Ohashi, J. Osuga, K. Harada, T. Gotoda, R. Nagai, S. Ishibashi, N. Yamada, Absence of sterol regulatory element-binding protein-1 (SREBP-1) ameliorates fatty livers but not obesity or insulin resistance in Lep(ob)/Lep(ob) mice, J Biol Chem, 277 (2002) 19353-19357.

113


Table S1. Sequence of the mouse primers used for quantitative real-time PCR

Table S2. Sequence of the human primers used for quantitative real-time PCR

Table S3. Antibodies used for the immunohistochemistry and western blotting

Gene

Forward primer sequence (5’-3’) Reverse primer sequence (5’-3’) Accession no. 18s rRNA AACTTTCGATGGTAGTCGCCGT TCCTTGGATGTGGTAGCCGTTT 6YAN_2

ARG1 GTGAAGAACCCACGGTCTGT CTGGTTGTCAGGGGAGTGTT NM_007482.3

ATF6 TGGGAATGGAAGCCTAAAGAGG TGGGAGGACAGAGAAACAAGC NM_001081304.1 CCL2 GTGCTGACCCCAAGAAGGAA GTGCTGAAGACCTTAGGGCA NM_011333.3

Col1a1 TGACTGGAAGAGCGGAGAGT ATCCATCGGTCATGCTCTCT NM_007742.3

Desmin ATGCAGCCACTCTAGCTCGT CTCATACTGAGCCCGGATGT NM_010043.1

DGAT2 AGTTTCCTGGCATAAGGCCC ACATCAGGTACTCGCGAAGC NM_026384

F4/80 TGCATCTAGCAATGGACAGC GCCTTCTGGATCCATTTGAA NM_010130.4

FcγR1 GTGCTCTCATTGGGTGGTGA TGTAAGCCGTGCCTTCCAAT NM_010186.5 GAPDH ACAGTCCATGCCATCACTGC GATCCACGACGGACACATTG NM_008084.2 IL-1β GCCAAGACAGGTCGCTCAGGG CCCCCACACGTTGACAGCTAGG NM_008361.3 IL-6 TGATGCTGGTGACAACCACGGC TAAGCCTCCGACTTGTGAAGTGTA NM_031168.1

iNOS GGTGAAGGGACTGAGCTGTT GCTACTCCGTGGAGTGAACAA NM_010927.4 SCD1 GGAGACGGGAGTCACAAGAG TGCATCATTAACACCCCGAT NM_009127

Src GTGAGGTTCTGGACCAGGTG CTGGTACTGTGGCTCAGTGG NM_009271.3

SREBP1 CTGGTGAGTGGAGGGACCAT GACCGGTAGCGCTTCTCAAT NM_011480.4

TNF-α AGGCTGCCCCGACTACGTGC CAGCGCTGAGTTGGTCCCCC NM_013693.2

XBP1 AAGGGGAGTGGAGTAAGGCT TGCTGCAGAGGTGCACATAG NM_013842.3

α-SMA ACTACTGCCGAGCGTGAGAT CCAATGAAAGATGGCTGGAA NM_007392.2

Gene

Forward primer sequence (5’-3’) Reverse primer sequence (5’-3’) Accession no. Col1a1 GTACTGGATTGACCCCAACC CGCCATACTCGAACTGGAAT NM_000088.3 col3a1 AAGAAGGCCCTGAAGCTGAT GTGTTTCGTGCAACCATCCT NM_000090 Src CAACACAGAGGGAGACTGGT CACGTAGTTGCTGGGGATGT NM_198291.3 18s rRNA TGAGGTGGAACGTGTGATCA CCTCTATGGGCCCGAATCTT NM_022551.2

Primary Antibody Source Immunostaining Western blotting Polyclonal rabbit anti-Src Cell Signaling 1:100 1:500

Polyclonal rabbit anti-pSRC Cell Signaling 1:500

Polyclonal rabbit anti-pFAK (Tyr397) Cell Signaling 1:500

Polyclonal rabbit anti-FAK Cell Signaling 1:500

Polyclonal rabbit anti-pAKT (Ser473) Cell Signaling 1:500

Polyclonal rabbit anti-AKT Cell Signaling 1:500

114

Polyclonal rabbit pPI3K p85 (Tyr458)/p55 (Tyr199)

Cell Signaling 1:500

Polyclonal rabbit anti-PI3K P85 Cell Signaling 1:500

Polyclonal goat anti-collagen I Southern Biotech 1:100

Monoclonal rat anti-F4/80 BioRad 1:100


Monoclonal mouse anti-EpCAM HansaBiomed 1:100

Monoclonal mouse anti-CD68 eBioScience 1:100


Polyclonal goat anti-rabbit IgG DAKO 1:100 1:1000

Polyclonal rabbit anti-mouse IgG DAKO 1:100 1:1000

Polyclonal goat anti-mouse IgG DAKO 1:100 1:1000

Polyclonal rabbit anti-goat IgG DAKO 1:100 1:1000

Polyclonal goat anti-rat IgG Southern Biotech 1:100 1:1000

Donkey anti-goat Alexa 488 ThermoScientific 1:100

Donkey anti-rabbit Alexa 594 ThermoScientific 1:100

115

Figure S1. Src kinase inhibitor, KX2-391 inhibits the expression of steatosis, inflammation and fibrosis related genes in MCD diet-induced NASH in mice. Relative gene expression (normalized with 18s rRNA and relative to control mice) for (A) steatosis markers (SCD1, DGAT2, XBP1, SREBP1c and ATF6); (B) inflammation markers (TNFα, IL-1β, IL-6, iNOS and CCL2); and (C) fibrosis-HSCs markers (Desmin and α-SMA) as analyzed in the liver tissues from control chow-diet fed healthy mice (n = 8), MCD-diet fed mice (n = 8), MCD-diet fed mice treated with 10mg/kg KX2-391 (n = 5). Graphs represent mean + SEM, statistical differences were calculated using one-way ANOVA with the Bonferroni post hoc test. *p < 0.05, **p < 0.01 denotes significance.

116

Figure S2. Src kinase inhibitor, KX2-391 inhibits the expression of steatosis, inflammation and fibrosis and related genes in EtOH diet-induced ASH in mice. Relative gene expression (normalized with 18s rRNA and relative to control mice) for (A) steatosis markers (SCD1, DGAT2, XBP1 and ATF6); (B) inflammation markers (IL-1β, iNOS, TNFα, IL-6) (C) Arg1; and (D) fibrosis markers (Col1a1, Desmin and α-SMA) as analyzed in the liver tissues from isocaloric diet-fed healthy mice (n = 5), EtOH-diet fed mice (n = 6), EtOH-diet fed mice treated with 10mg/kg KX2-391 (n = 5). Graphs represent mean + SEM, statistical differences were calculated using one-way ANOVA with the Bonferroni post hoc test. *p < 0.05, **p < 0.01 denotes significance.

117

Figure S3. Colocalization of Src kinase with hepatocytes, macrophages and HSCs. Representative images (scale=100μm) of EpCAM (hepatocyte marker), CD68 (pan-macrophage marker) and collagen I (ECM, fibrosis-HSCs-related marker) (in green, first column) and Src (in red, second column) stained liver sections from human NASH livers. Blue staining (third column) indicates DAPI-nuclear staining. Arrows shown in merge images (fourth column) depict colocalization.

118

Figure S4. Inhibition of palmitate-induced lipid deposition in HepG2 cells. Oil-red-O staining and respective quantitative analysis showing inhibition of Palmitate-induced lipid deposition in HepG2 cells after 24h of treatment with 50µM KX2-391. Data presented as mean + SEM, statistical differences were calculated using two-tailed unpaired t test. **p < 0.01 denotes significance.

Palmitate Palmitate+KX2-391

Palmitate Palmitate+KX2-3910

20

40

60**

% o

il-re

d-O

stai

ning

(pos

itive

are

a pe

r fie

ld)

119

Figure S5. Src mediates HSCs activation via FAK/PI3K/AKT pathway. Quantitative western blot analysis (refer to Figure 4F) for phosphorylated Src, FAK, PI3K and AKT normalized with the respective non-phosphorylated Src, FAK, PI3K and AKT respectively as examined in control and TGFβ-activated HSCs (LX2 cells) with and without 24h of treatment with 50µM Src kinase inhibitor, KX2-391, n = 3. Graphs represent mean + SEM, statistical differences were calculated using one-way ANOVA with the Bonferroni post hoc test, *p < 0.05, **p < 0.01 denotes significance.

Control TGFb TGFb+KX2-3910.0

0.5

1.0

1.5

Rela

tive

pFAK

exp

ress

ion

(nor

mal

ized

with

FAK

)

✱ ✱


0.5

1.0

1.5

Rela

tive

pAkt

exp

ress

ion

(nor

mal

ized

with

Akt

)

✱ ✱✱


0.5

1.0

1.5

Rela

tive

pPI3

K ex

pres

sion

(nor

mal

ized

with

PI3

K)

✱ ✱


0.5

1.0

1.5Re

lativ

e pS

rc e

xpre

ssio

n(n

orm

alize

d w

ith S

rc)

✱ ✱

120

Figure S6. Src gene expression in LPS and IFNγ-stimulated BMDMs and human THP1 macrophages. Gene expression of Src (normalized with GAPDH) in unstimulated, LPS/IFNγ- and IL-4/IL-13-stimulated macrophages, n=3. Graphs represent mean + SEM, statistical differences were calculated using one-way ANOVA with Bonferroni post-hoc test, **p < 0.01 denotes significance.

Medium

LPS+

IFNg

IL-4+IL-

130

5

10

15 ✱✱ ✱✱Re

lativ

e Sr

c exp

ress

ion

(nor

mal

ized

with

GAP

DH)

BMDMs

Medium

LPS+

IFNg

IL-4+IL-

130.0

0.5

1.0

1.5

2.0

2.5✱✱ ✱✱

Rela

tive

Src e

xpre

ssio

n(n

orm

alize

d w

ith G

APDH

)

Human THP1

121

Figure S7. Pharmacological Src inhibition attenuated pro-inflammatory macrophage activation via FAK/PI3K/AKT pathway. Quantitative western blot analysis (refer to Figure 7A) for phosphorylated Src, FAK, PI3K and AKT normalized with the respective non-phosphorylated Src, FAK, PI3K and AKT respectively as examined in unstimulated (medium), LPS+IFNγ stimulated, IL-4+IL-13 stimulated and LPS+IFNγ stimulated treated with 50µM KX2-391 macrophages (refer to Figure 6A) and quantitatively analyzed as presented here, n = 3. Graphs represent mean + SEM, statistical differences were calculated using one-way ANOVA with the Bonferroni post hoc test, *p < 0.05, **p < 0.01 denotes significance.

122

Figure S8. Therapeutic efficacy of KX2-391 in 3D human spheroids model. (A) Spheroid assay schematic illustration: The cell-mixture containing HepG2, LX2, HUVECS and THP1 was plated in a 96-well ULA plates at 1,200 cells/well of density and grown for 7 days; At day 7, spheroids were treated with or without LPS and WP1066; After 7 days of treatment, the spheroids were retrieved, snap frozen and sectioned. The corresponding cryosections were used for immunostaining. (B) First panel of images depicts 3D spheroids stained with fibrosis marker, collagen I (in red); second panel depicts 3D spheroids stained with HSC activation marker, α-SMA (in green); third panel of images presents 3D spheroids stained with macrophage activation marker, MHC-II (in red); and fourth panel of images depicts 3D spheroids stained with M2 macrophage marker, mannose receptor (in green). Blue color shows DAPI nuclear staining.

A

B Control LPS + KX2-391 LPS

MH

CII

Colla

gen

I O

il-Re

d-O

123

Chapter 5

Fibroblast growth factor 2 (FGF2) conjugated superparamagnetic

iron oxide nanoparticles (SPIONs) ameliorate hepatic stellate cells

activation in vitro and acute liver injury in mice

Dhadhang Wahyu Kurniawan, Richell Booijink, Lena Pater, Irene Wols, Aggelos Vrynas, Gert Storm, Jai Prakash, Ruchi Bansal

Published in: J Control Release. 2020 Dec 10; 328:640-652. doi: 10.1016/j.jconrel.2020.09.041.

124

Abstract

Liver diseases are the growing health problem with no clinically approved therapy available.

Activated hepatic stellate cells (HSCs) are the key driver cells responsible for extracellular

matrix deposition, the hallmark of liver fibrosis. Fibroblast growth factor 2 (FGF2) has shown

to possess anti-fibrotic effects in fibrotic diseases including liver fibrosis, and promote tissue

regeneration. Among the fibroblast growth factor receptors (FGFRs), FGF2 interact primarily

with FGFR1, highly overexpressed on activated HSCs and inhibit HSCs activation. However,

FGF2 poses several limitations including short systemic half-life and stability owing to

enzymatic degradation. The aim of this study is to improve the stability and half-life of FGF2

thereby improving the therapeutic efficiency of FGF2 for the treatment of liver fibrosis. We

found that FGFR1-3 mRNA levels were overexpressed in cirrhotic human livers, while FGFR1c,

2c, 3c, 4 and FGF2 mRNA levels were overexpressed in TGFβ-activated HSCs (LX2 cells), and

FGFR1 protein expression were highly increased in TGFβ-activated HSCs. Treatment with FGF2

inhibited TGFβ-induced HSCs activation, migration, and contraction in vitro. FGF2 was

conjugated to superparamagnetic iron-oxide nanoparticles (SPIONs) using carbodiimide

chemistry, and the resulting FGF2-SPIONs was confirmed by dynamic light scattering (DLS),

zeta potential, dot-blot analysis, and Prussian Blue iron-staining. In vitro, treatment with

FGF2-SPIONs evidenced increased therapeutic effects (attenuated TGFβ-induced HSCs

activation, migration, and contraction) of FGF2 in TGFβ-activated HSCs and ameliorated early

liver fibrogenesis in vivo in acute carbon tetrachloride (CCl4)-induced liver injury mouse

model. In contrast, free FGF2 showed no significant effects in vivo. Altogether, this study

presents a promising therapeutic approach using FGF2-SPIONs for the treatment of liver

fibrosis.

125

5.1 Introduction

Liver diseases caused by viral infections (mainly hepatitis B and C viruses), metabolic

disorders, alcohol or drug abuse and autoimmune disorders affecting millions of people,

represents a major health problem with high morbidity and mortality [1]. Acute liver injury is

a transient, often reversible, wound healing response however persistent chronic injury to

the liver results in progressive accumulation of extracellular matrix (ECM) components

eventually resulting in liver cirrhosis, end-stage liver failure and hepatocellular carcinoma [2,

3]. Due to the lack of an effective therapy, liver diseases poses a major clinical impact with an

increasing number of patients requiring liver transplantation [1, 4, 5].

Hepatic stellate cells (HSCs) play a key role in the progression of liver fibrosis, regardless of an

underlying cause [3, 6, 7]. Upon injury, hepatocytes undergo apoptosis or necrosis and release

pro-inflammatory and pro-fibrogenic mediators that stimulates recruitment and activation of

inflammatory cells resulting in chronic liver inflammation. The resident and infiltrated

immune cells, in turn, secrete pro-inflammatory and pro-fibrogenic factors that activates

quiescent HSCs [2, 3]. Quiescent HSCs transdifferentiate into myofibroblast-like cells and

become highly proliferative, migratory, and contractile cells producing excessive amounts of

ECM components that accumulates in liver parenchyma, disrupts liver architecture and forms

the characteristic scar tissue [3, 6, 7].

Fibroblasts growth factors (FGFs) have been shown to regulate HSCs differentiation and liver

fibrosis. There are seven subfamilies of FGFs: FGF1 subfamily (FGF1, FGF2); FGF4 subfamily

(FGF4, FGF5, FGF6); FGF8 subfamily (FGF8, FGF17, FGF18); FGF9 subfamily (FGF9, FGF16,

FGF20); FGF10 subfamily (FGF3, FGF7, FGF10, FGF22); FGF11 subfamily (FGF11, FGF12, FGF13,

FGF14) and FGF19 subfamily (FGF15, FGF19, FGF21, FGF23) [8, 9]. These subfamilies of FGFs

are tissue specific and have different binding affinity with FGF receptors (FGFRs). There are

four isoforms of FGFRs: FGFR1, FGFR2, FGFR3, and FGFR4. FGFRs have different splice variants

and display tissue specific expression [8, 9]. FGF-FGFR signaling is critical in several

developmental processes including cellular proliferation, migration, differentiation,

morphogenesis and organogenesis [10]. Furthermore, FGF-FGFR signaling pathway regulate

liver homeostasis by regulating metabolism of lipids, cholesterol and bile acids, promotes

126

hepatocyte proliferation and detoxification, and facilitating liver regeneration after partial

hepatectomy [11].

Among other FGFs, FGF2 (also known as basic FGF) play a crucial role in numerous cellular

processes including organ development, wound healing and tissue regeneration [12]. FGF2

has been shown to regulate HSCs function and has been investigated extensively in liver

fibrosis however showed contradictory results [9, 13]. Some studies have demonstrated the

pro-fibrotic effects of FGF2, while numerous studies have demonstrated the anti-fibrotic

effects of FGF2 in vitro and in vivo in preclinical animal models [13]. Using FGF1-/-FGF2-/-

mouse models, Yu et al., demonstrated that acute carbon-tetrachloride (CCl4) administration

in FGF1-/-FGF2-/- mice resulted in elevated serum alanine aminotransferase (ALT) levels, HSCs

activation marked by increased intra-hepatic expression of alpha smooth muscle actin (α-

SMA) and desmin, accompanied with activation and migration of HSCs to the site-of-injury,

while chronic CCl4 administration led to decreased collagen expression and fibrosis [14]. Pan

et al., has demonstrated that 18 KDa low- (FGF2lmw) and 21 or 22 KDa high-molecular weight

(FGF2hmw) forms have distinct role in liver fibrogenesis, and that the exogenous FGF2lmw

treatment attenuated HSCs activation and fibrosis [15]. The presence of different FGF2

isoforms with distinct roles might explain the conflicting results reported on the effects of

FGF2. Besides hepatic fibrosis, FGF2 treatment has also shown to attenuate bleomycin-

induced pulmonary fibrosis [16] and ischemia reperfusion induced renal injury [17].

With respect to myofibroblast (activated HSCs in liver) activation and differentiation,

evidences have revealed that FGF2 promotes myofibroblast apoptosis in vivo, antagonizes

activation and transforming growth factor beta (TGFβ) signaling, antagonizes contractile

phenotypes and myofibroblast differentiation of non-fibroblasts progenitors, suppresses pro-

fibrogenic gene expression, and promotes regenerative healing [13]. Mapping studies and

crystal structures of FGF-FGFR complexes have revealed that FGF2 binds to different FGFR

splice variants with varying affinity [18-20]. In human liver myofibroblasts, FGF2 has been

shown to interact with FGFR1 which is highly overexpressed on myofibroblasts [21]. Although

the underlying mechanism through which FGF2 affects liver fibrosis is not entirely

understood, different FGF2-regulated signalling pathways have been proposed in several

diseases and cell types including Janus kinase (JAK), signal transducer and activator of

transcription (STAT), extracellular signal regulated kinase (ERK), mitogen-activated protein

127

kinase (MAPK), c-jun N-terminal kinase (JNK) and serine/threonine kinase AKT (also known as

protein kinase B, PKB) pathways [13]. Particularly, it has been demonstrated that selective

inhibitor of phosphatidylinositol 3-kinase (PI3K) and mitogen-activated protein kinase kinase

(MAPKK or MEK) abolished the protective effects of FGF2 suggesting involvement of PI3K/AKT

and MEK/ERK signaling pathways in FGF2-mediated effects [17].

While the attractiveness of using FGF2 as therapeutic is evident, there are several limitations

including a short systemic half-life after intravenous administration (due to small size) and

poor stability (owing to susceptibility to degradation by proteases) [22]. Conjugation of FGF2

to superparamagnetic iron-oxide nanoparticles (SPIONs) could be a promising alternative for

eliminating the drawbacks hampering future clinical application. SPIONs possess tailored

surface chemistry, low cytotoxicity and unique magnetic properties [23, 24]. Recent

developments of polymer (dextran/PEG)-coated SPIONs has shown tremendous

improvements in biocompatibility and blood circulation. We have previously demonstrated

an increased magnetic resonance imaging (MRI) contrast and therapeutic efficacy using

Relaxin-SPIONs in liver fibrosis [25].

In this study, we have first analyzed the expression of FGFR in human liver cirrhosis and TGFβ-

activated human HSCs (LX cells) in vitro. We then investigated the therapeutic effects of

human recombinant FGF2 (low-molecular weight) on TGFβ-activated human HSCs (LX cells)

in vitro. In order to improve the stability and systemic half-life of FGF2 thereby therapeutic

efficacy, we conjugated FGF2 to dextran- and PEG-coated SPIONs. Subsequently, we

examined the therapeutic effect of FGF2-SPIONs versus free FGF2 on TGFβ-activated human

HSCs in vitro and in an acute CCl4 induced mouse model in vivo.


5.2.1 FGFR gene expression analysis in the liver tissues from healthy and cirrhosis patients

Publicly available transcriptome datasets of liver tissues (GSE6764) from normal healthy

individuals (n=10) and cirrhotic patients (n=12) [26] were analysed using the Gene Expression

Omnibus (GEO) database of the National Centre for Biotechnology Information (NCBI) to

assess FGF receptor (FGFR) gene expression i.e. FGFR1, FGFR2, FGFR3 and FGFR4 in normal

and cirrhotic human livers.

128

5.2.2 Cell lines

Human hepatic stellate cells (LX2 cells), an immortalized human derived cell line, was

provided by Prof. Scott Friedman (Mount Sinai Hospital, New York, NY, USA). LX2 cells were

cultured in Dulbecco’s Modified Eagle’s Medium (DMEM)-Glutamax (Invitrogen, Carlsbad, CA,

USA) supplemented with 10% fetal bovine serum (FBS, Lonza, Verviers, Belgium), 50 U/mL

penicillin (Sigma, St. Louis, MO, USA) and 50 µg/mL streptomycin (Sigma).

5.2.3 Conjugation of FGF2 to SPIONs

Human FGF2 (Peprotech, Rocky Hill, NJ, USA) was conjugated to dextran-coated PEG-COOH

functionalized super-paramagnetic iron-oxide nanoparticles, SPIONs (micromod

Partikeltechnologie, GmbH, Rostock, Germany) using carbodiimide chemistry as described

previously [25, 27] and depicted in Figure 5A. Briefly, 100 µL of SPIONs (5 mg/mL) were

activated with 35 µmol NHS (N-hydroxysuccinimide, Sigma) and 10 µmol EDC (1-ethyl-3-(3-

dimethylaminopropyl)-carbodiimide HCl, Sigma) prepared in 125 µL of MES ([2(-N-

morpholino) ethanesulfonic acid, Sigma) buffer (pH 6.3). After 45 min of reaction at RT with

gentle shaking, SPIONs were washed thrice with PBS and purified using 30 kDa AmiconTM Ultra

Centrifugal Filters (Merck Millipore, Darmstadt, Germany) by centrifugation at 5000 rpm.

Afterwards, 15 µg of FGF2 (0.06 nmol in 15 µL) was added to the activated SPIONs and left to

react for overnight at 4°C with gentle shaking. Samples were then purified and unconjugated

COOH groups (on SPIONs) were reacted with 10 µg of glycine (Sigma) for 30 min at RT.

Eventually, FGF2-coated SPIONs (FGF2-SPIONs) were purified, resuspended in 100 µL PBS and

stored at 4°C.

5.2.4 Characterization of FGF2-SPIONs

5.2.4.1 Size and zeta potential measurements

The size of SPIONs and FGF2-SPIONs was measured using dynamic light scattering (DLS) with

Zetasizer Nano (Malvern Instruments, UK). Briefly, 5 µL of SPIONs or FGF2-SPIONs were

diluted in 1 mL PBS and measured in 1mL disposable polystyrene cuvettes. For zeta potential

measurements, 5 µL of SPIONs or FGF2-SPIONs were diluted in 1 mL KCl (10mM) and

measured in folded capillary cells DTS1060 (Malvern Instruments).

129

5.2.4.2 Dot blot analysis

Conjugation efficiency of FGF2 on SPIONs was determined by Dot blot analysis as reported

previously [25, 27]. Briefly, FGF2, SPIONs and FGF2-SPIONs were serially diluted in TBS buffer

(Thermo Scientific, Rockford, IL, USA). 2 µL of the samples were spotted on the nitrocellulose

membrane and allowed to dry for 10 min. The membrane was blocked for 1 h with 5%

blotting-grade blocker (BioRad, Hercules, CA, USA) prepared in TBS buffer Tween®-20 (TBST)

(Thermo Scientific). Afterwards, the membrane was incubated with rabbit anti-FGF2

monoclonal antibody (1:1000; Cell Signaling Technology, Massachusetts, MA, USA) for 1 h.

Membrane was washed three times in TBST and incubated for 1 h with secondary rabbit anti-

rat HRP-conjugated polyclonal antibody (1:1000, Dako, Glostrup, Denmark) followed by

tertiary goat-anti rabbit anti-rat HRP-conjugated polyclonal antibody (1:1000, Dako).

Afterwards, the blot was developed using PierceTM ECL Plus Western Blotting substrate

(Thermo Scientific) and was imaged using FluorChem Imaging System (ProteinSimple, Alpha

Innotech, San Leandro, CA, USA). The intensity of the dots were quantified using NIH ImageJ

software (NIH, Bethesda, MD) and the conjugation efficiency was calculated using the

standard curves prepared from known concentrations of FGF2 dots.

5.2.4.3 Prussian blue iron staining

To estimate the recovery of SPIONs during the conjugation process, Prussian Blue staining kit

(Sigma) was performed on the dot blots as per the manufacturer’s instructions and described

previously [25, 27]. Briefly, FGF2, SPIONs and FGF2-SPIONs were serially diluted in TBS buffer

(Thermo Scientific). 2 µL of the samples were spotted on the nitrocellulose membrane and

allowed to dry for 10 min. Iron was detected using Prussian Blue staining kit (Sigma)

containing potassium ferrocyanide and hydrochloric acid in 1:1 ratio. Images were captured

using a normal digital camera. The intensity of the dots were quantified using NIH ImageJ

software (NIH, Bethesda, MD) and the amount of iron staining (representative of SPIONs) was

calculated using the standard curves prepared from known amounts of SPIONs dots.

5.2.5 Cell binding and uptake experiments

Cell binding and uptake studies were performed as per the standardized protocols reported

previously [25]. Briefly, LX2 cells were seeded at 1 x 104 cells/well and cultured overnight.

Cells were then serum-starved for overnight and then incubated with 5 ng/mL TGFβ (Roche,

130

Mannheim, Germany) for 24 h. TGFβ-activated LX2 cells were then incubated with SPIONs or

FGF2-SPIONs at RT for 2 h (binding study) or at 37°C for 4 h (uptake study) in serum-free

medium supplemented with 0.5 % BSA (bovine serum albumin). After incubation, cells were

washed thrice with Dulbecco’s phosphate buffer saline (DPBS, Lonza) and were fixed with 4%

formalin and stained using Prussian Blue iron staining as per manufacturer’s instructions.

Images were captured using Nikon E400 microscope (Nikon, Tokyo, Japan), cellular uptake

was assessed by counting iron-positive cells/per field and has been depicted as % uptake.

5.2.6 Immunofluorescent staining

Cells were seeded in 24-well plates (3 x 104 cells/well) and cultured overnight. Cells were then

serum-starved for overnight and incubated with either starvation medium alone, different

concentrations of FGF2 (50 ng/mL, 100 ng/mL or 250 ng/mL) or 250 ng/mL FGF2, SPIONs, or

FGF2-SPIONs, and 5 ng/mL TGFβ for 24 h. Afterwards the cells were washed with 1x PBS, fixed

with ice-cold acetone and methanol (1:1 ratio) for 30 min at -20 °C followed by drying for 30

min at RT and rehydration with 1x PBS. The staining was performed using rabbit anti-FGFR1

(1:100) or goat anti-collagen I (1:100). Briefly, cells were incubated with the respective

primary antibodies (refer to Table S1) followed by incubation with Alexa 488-conjugated

secondary antibodies (Life Technologies, Gaithersburg, MD, USA). Cells were then mounted

with DAPI-containing mounting medium (Sigma). The staining was visualized, the images were

captured using fluorescent microscopy (Evos microscope, Tokyo, Japan), analysed using NIH

ImageJ software and presented as relative expression versus TGFβ-treated LX2 cells.

5.2.7 Cell viability studies

Cells were seeded in 96-well plates (5000 cells/well) and cultured overnight. Cells were

serum-starved for overnight and incubated with starvation medium alone, different


FGF2-SPIONs, and 5 ng/mL TGFβ for 24 h. Cells were then incubated with Alamar blue reagent

(Invitrogen), incubated for 4 h and fluorescent signal was measured using a VIKTORTM plate

reader (Perkin Elmer, Waltham, MA).


Cells were seeded in 12-well plates (8 x 104 cells/well) and cultured overnight. Cells were


131


FGF2-SPIONs, and 5 ng/mL TGFβ for 24 h. Cells were lysed using 1x lysis buffer prepared from

3x blue loading buffer and 30x reducing agent (1.25 M dithiothreitol, DTT) (Cell Signaling

Technology, Massachusetts, MA, USA) as per manufacturer’s instructions. The prepared

samples were loaded on 10 % Tris-glycine gels (Life Technologies) followed by transfer to the

PVDF membrane (Roche). The membranes were developed according to the standard

protocols using primary and secondary antibodies (refer to Table S1). The bands were

visualized using PierceTM ECL Plus Western Blotting substrate (Thermo Scientific) and

photographed using FluorChem Imaging System. Intensity of individual bands was quantified

using NIH ImageJ software, normalized with respective β-actin bands and presented as

relative expression versus TGFβ-treated LX2 cells.

5.2.9 Quantitative real time PCR

Cells were seeded in 12-well plates (8 x 104 cells/well) and cultured overnight. Cells were then



FGF2-SPIONs, and 5 ng/mL TGFβ for 24 h. Cells were then lysed using RNA lysis buffer. Total

RNA from cells was isolated using the GenElute Total RNA Miniprep Kit (Sigma) according to

the manufacturer’s instructions. The RNA concentration was quantified using NanoDrop® ND-

1000 Spectrophotometer (Thermo Scientific, Waltham, USA). Total RNA (1 µg) was reverse

transcribed using the iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA). Real-time PCR

was performed using 20 ng of cDNA, pre-tested gene-specific primer sets (listed in Tables S2)

and the 2x SensiMix SYBR and Fluorescein Kit (Bioline GmbH, QT615-05, Luckenwalde,

Germany) according to the manufacturer’s instructions. Finally, cycle threshold (Ct) values

were normalized to the reference gene 18s rRNA, and relative expression were calculated

using the 2-ΔΔCt method versus TGFβ-treated LX2 cells.

5.2.10 3D collagen gel cell contraction assay

A collagen suspension (5 mL) containing 3 mL of collagen G1 (5 mg/mL, Matrix biosciences,

Morlenbach, Germany), 0.5 mL of 10x M199 medium (Sigma), 85 µL of 1 N NaOH (Sigma) and

sterile water was mixed with 1 mL (2 x 106) of LX2 cells. The gel and cell suspension (0.6

mL/well) was plated in a 24-well culture plate and was allowed to polymerize. Polymerized

132

gels were incubated with 1 mL of serum-starved medium with or without human recombinant

TGFβ (5 ng/mL) together with different concentrations of FGF2 (50 ng/mL, 100 ng/mL or 250

ng/mL), or 250 ng/mL of FGF2, FGF2-SPIONs, and SPIONs (equimolar concentration), followed

by detachment of the gels. The size of the gels were digitally measured, normalized with their

respective well size in each image and presented as relative gel contraction versus TGFβ-

treated LX2 cells.

5.2.11 Cell migration assay

Cells were plated in 12-well culture plates (1 x 105 cells/well), cultured overnight and serum-

starved for 24 h. A standardized scratch was made using a 200 µL pipette tip fixed in a custom-

designed holder. Afterwards, cells were washed twice and incubated with starvation medium

(control), or with 5 ng/mL TGFβ prepared with or without different concentrations of FGF2

(50 ng/mL, 100 ng/mL or 250 ng/mL), or 250 ng/mL FGF2, SPIONs, or FGF2-SPIONs.

Microscopic images were taken at 0 and 24 h to measure the size of the scratch. Photographs

were analyzed using NIH ImageJ software, normalized with 0 h time point and presented as

relative wound healing versus TGFβ-treated LX2 cells.

5.2.12 CCl4-induced acute liver injury mouse model

All the animal experiments were carried out strictly according to the ethical guidelines for the

Care and Use of Laboratory Animals (Utrecht University, The Netherlands). Male Balb/c mice

(8-10 weeks old) were given single intraperitoneal injection of 1.0 mL/kg carbon tetrachloride

(CCl4, Sigma). CCl4-treated mice were treated with two intravenous administrations of PBS

(n=5), FGF2 (250 ng/dose, n=5) or FGF2-SPIONs (250 ng/dose, n=6) at day 3 and day 5. Healthy

controls (n=6) received olive oil alone. All the animals were euthanized at day 6. Liver tissues

and blood samples were retrieved for further analyses. All the animals were weighed before

sacrificing, and the respective organs were weighed directly after sacrificing. Alanine

aminotransferase (ALT) activity was determined in the plasma samples using a colorimetric

ALT activity assay kit (Sigma MAK052) according to the manufacturer’s instructions.

5.2.13 Histological immunostainings

Collected liver tissues were transferred to Tissue-Tek OCT embedding medium (Sakura

Finetek, Torrance, CA, USA) and snap-frozen in 2-methyl butane in a dry ice. Cryosections (5

µm) were cut using a Leica CM 3050 cryostat (Leica Microsystems, Nussloch, Germany). The

133

cryosections were air-dried and fixed with acetone for 20 minutes. Tissue sections were

rehydrated with PBS and incubated with the primary antibody (Collagen I or F4/80) overnight

at 4°C (refer to Table S1). This was followed by incubation with horseradish peroxidase (HRP)-

conjugated secondary antibody for 1 h at RT. Next, the samples were incubated with HRP-

conjugated tertiary antibody for 1 h at RT. Thereafter, peroxidase activity was developed

using the AEC (3-amino-9-ethyl carbazole) substrate kit (Life Technologies) for 20 minute and

nuclei were counterstained with hematoxylin (Fluka Chemie, Buchs, Switzerland).

Endogenous peroxidase activity was blocked by 3% H2O2 prepared in methanol. The sections

were mounted with Aquatex mounting medium (Merck) and were scanned using Hamamatsu

NanoZoomer Digital slide scanner 2.0HT (Hamamatsu Photonics). For quantitation, the high

resolution scans were viewed using NanoZoomer Digital Pathology (NDP2.0) viewer software

(Hamamatsu Photonics). About 20 images (100x) of each stained liver tissue section (from

NDP) were imported into ImageJ software and were analyzed quantitatively at a fixed

threshold.

5.2.13.1 Prussian blue staining combined with collagen I immunostaining

Cryosections were dried and fixed with 4% formaldehyde (Sigma) for 30 min. The sections

were washed thrice with 1x PBS and incubated with primary collagen I antibody for 1 h at RT,

followed by incubation with 0.3% hydrogen peroxide for 30 min. Next, the sections were

incubated with horseradish peroxidase (HRP)-conjugated secondary antibody for 1 h and

HRP-conjugated tertiary antibody for 1 h. Sections were then stained with AEC for 20 min as

per manufacturer’s instructions. Thereafter, the sections were washed with Milli Q water and

incubated with freshly prepared Prussian blue solution (Sigma). The sections were incubated

with Prussian blue mix solution for 30 min, washed in deionized water followed by mounting

with aquatex mounting medium, and imaged using NanoZoomer.

5.2.14 Graphs and statistical analyses

All graphs were made using GraphPad Prism version 8.4.1 (GraphPad Prism, La Jolla, CA, USA).

The results are expressed as the mean ± standard error of the mean (SEM). Statistical analyses

were performed using GraphPad Prism version 8.4.1 (GraphPad Prism, La Jolla, CA, USA).

Multiple comparisons between different groups were calculated using the one-way analysis

of variance (ANOVA) with the Bonferroni post hoc test. Statistical differences between two

134

groups were calculated using a two-tailed unpaired t test. Differences were considered

significant when #p < 0.05, ##p < 0.01, ###p < 0.001 or *p < 0.05, **p < 0.01, ***p < 0.001.

5.3 Results

5.3.1 Upregulation of FGF receptors (FGFRs) mRNA expression in cirrhosis patients

We first examined the mRNA expression levels of fibroblast growth factor receptors (FGFR)

and fibroblast growth factor 2 (FGF2) in human cirrhotic liver tissues using the publicly

available human microarray datasets GSE6764 from NCBI GEO database [26]. Patients were

categorized into two groups: normal and cirrhosis representing normal and cirrhotic livers

respectively. The available corresponding microarray datasets were analyzed using an online

database GEO2R. There are four known isoforms of FGFRs: FGFR1, FGFR2, FGFR3, FGFR4, and

all FGFRs are shown to be expressed in the liver [28]. Transcriptomic data analysis revealed a

significant increase in the mRNA expression levels of FGFR1 (p<0.05), FGFR2 (p<0.001) and

FGFR3 (p<0.05) in the cirrhotic livers compared to the normal livers (p<0.05) (Figure 1A).

However, no significant difference in FGFR4 mRNA expression (p=0.1037) was observed in

cirrhotic versus normal livers. Plasma levels of basic FGF (FGF2) were found to be significantly

elevated with the progression of liver disease (chronic hepatitis > liver cirrhosis >

hepatocellular carcinoma (HCC) [29]. However, no significant difference in FGF2 mRNA

expression, in the analyzed dataset GSE6764, was observed in the cirrhotic human livers as

compared to the normal healthy livers (Figure 1A).

5.3.2 Upregulation of FGFRs expression in vitro in human HSCs (LX2 cells)

FGF receptors have shown to be expressed by hepatocytes and HSCs, and are involved in

epithelium-mesenchymal paracrine signaling thereby regulating organogenesis [8]. During

liver injury, different FGFs produced by HSCs bind and activate the FGFRs on hepatocytes, and

hepatocyte-derived FGFs bind and activate FGFRs on HSCs thereby regulating hepatic

fibrogenesis [9]. Here, we have examined the expression levels of different FGF receptors and

FGF2 in control and human HSCs activated by TGFβ since TGFβ is the major fibrogenic cytokine

responsible for the activation and trans-differentiation of quiescent HSCs in the liver. We

activated LX2 cells (a human HSC cell line) with 5 ng/mL of recombinant human TGFβ for 24 h

and examined the mRNA expression levels of FGFRs and FGF2 in TGFβ-activated LX2 cells

versus control LX2 cells. We observed that mRNA expression of the FGFRs isoforms: FGFR1c

135

(p<0.05), FGFR2c (p<0.05), FGFR3c (p<0.05) and FGFR4 (p<0.05) was significantly upregulated

in TGFβ-activated LX2 cells compared to control cells as shown in Figure 1B. No significant

differences in the mRNA expression for FGFR1b, FGFR2b and FGFR3b was observed in

activated human HSCs [30]. Moreover, we found a significant increase in FGF2 mRNA levels

(Figure 1B), which is in accord with the recent study whereby induced FGF2 mRNA was

observed in activated humas HSCs [30]. Since FGF2 primarily interacts with FGFR1,

overexpressed by human myofibroblasts [21], we assessed the protein expression of FGFR1

using western blot analysis and immunofluorescence staining in TGFβ-activated HSCs versus

control cells. We found that FGFR1 was highly upregulated in the TGFβ-induced LX2 cells as

compared to control cells as shown in Figure 1C,D.

Figure 1. Expression of fibroblast growth factor receptors (FGFR) and FGF2 in human cirrhotic livers and TGFβ-activated human hepatic stellate cells (HSCs, LX2 cells). (A) Normalized FGFR1, FGFR2, FGFR3, FGFR4, and FGF2 mRNA expression levels from publicly available human microarray datasets (GSE6764). Normal livers (n = 10) and cirrhosis livers (n = 12). (B) Relative mRNA expression (normalized with 18 s rRNA) of FGFR1c, FGFR2c, FGFR3c, FGFR4, and FGF2 in control and TGFβ-activated LX2 cells, n = 6. (C) Representative image and quantitative analysis of western blot showing expression of FGFR1 and β-actin, performed on control and TGFβ-activated LX2 cells, n = 6. (D) Representative immunofluorescent images showing expression of FGFR1 (green) in control and TGFβ-activated HSCs (LX2 cells). Blue staining represents DAPI-nuclear staining, n = 3. Graphs represent

136

mean + SEM; statistical differences were calculated using two-tailed unpaired t-test, *P < 0.05, ***P < 0.001.

5.3.3 FGF2 inhibited collagen and α-SMA expression in TGFβ-activated human HSCs (LX2 cells) via pAKT signaling pathway

FGFs are categorized into seven subfamilies: FGF1, 4, 8, 9, 10, 11 and 19 as mentioned before

[8, 9]. Among other subfamilies, FGF1 subfamily, FGF1 and FGF2 have been investigated for

their effects on HSCs and liver fibrogenesis [9]. In particular, FGF2 has been shown to regulate

HSCs activation [9].

Figure 2. Effects of FGF2 on collagen I and α-SMA expression on TGFβ-activated LX2 cells. (A) Representative immunofluorescent images and (B) quantitative analysis of collagen I (green colour) stained control and TGFβ-activated LX2 cells treated with medium alone or FGF2 (50, 100 and 250 ng/mL), n=7. Blue staining represents DAPI-nuclear staining. (C) Relative gene expression analysis (normalized with 18 s rRNA) for α-SMA and collagen I as examined in control and TGFβ-activated LX2

137

cells treated with medium alone or FGF2 in different concentration (50, 100 and 250 ng/mL), n = 4. Graphs represent mean + SEM, statistical differences were calculated using one-way ANOVA with the Bonferroni post hoc test, ##P < 0.01, ###P < 0.001 represent significance versus control cells; *P < 0.05, **P < 0.01, ***P < 0.001 represent significance versus TGFβ-treated cells.

In this study, we investigated the effects of FGF2 on TGFβ-activated HSCs. Upon incubation

with TGFβ, we observed a significant upregulation of major extracellular matrix (ECM)

protein, collagen I and mRNA expression of major HSCs activation markers, alpha-smooth

muscle actin (α-SMA), collagen I and TGFβ, in TGFβ-activated LX2 compared to control LX2

cells. After treatment with increasing concentrations of FGF2, dose-dependent inhibition in

collagen I protein expression and mRNA expression of α-SMA, collagen I and TGFβ was found

(Figure 2A-C and Figure S1).

Moreover, FGF2-mediated dose-dependent inhibition of TGFβ-induced collagen I and α-SMA

protein expression which was confirmed by western blot analysis (Figure 3). We also

investigated the possible mechanism of action underlying FGF2-mediated inhibitory effects

on TGFβ-activated HSCs. Previously, it has been shown that FGF2 regulates proliferation,

migration, and invasion of cancer cells through phosphatidylinositol 3-kinase (PI3K)/AKT

signaling pathway [31]. In an ischemia-reperfusion induced renal injury model, it has been

demonstrated that selective inhibition of phosphatidylinositol 3-kinase (PI3K) [and mitogen-

activated protein kinase kinase (MAPKK or MEK)] abolished the protective effects of FGF2

confirming an involvement of PI3K/AKT (and MEK/ERK signaling pathways) in FGF2-mediated

effects [17]. Moreover, activation of PI3K/AKT signaling pathway, regulated by TGFβ, has been

shown to stimulate collagen synthesis by fibroblasts in different fibrotic diseases e.g. by HSCs

in hepatic fibrogenesis [32]. In this study, we examined the expression of p-AKT in control LX2

cells and TGFβ-activated LX2 cells treated without and with increasing concentrations of

FGF2. We observed that TGFβ led to an increased expression of pAKT in LX2 cells which was

dose-dependently inhibited with increasing concentrations of FGF2 (Figure 3).

138

Figure 3. FGF2 mediates the effects on TGFβ-activated LX2 cells via pAKT signaling pathway. Representative images and quantitative analysis of western blot depicting bands for collagen I, pAkt, Akt, α-SMA and β-actin, examined in control and TGFβ-activated LX2 cells treated with medium alone or increasing concentrations of FGF2 (50, 100 and 250 ng/mL), n = 3. Graphs represent mean + SEM, statistical differences were calculated using one-way ANOVA with the Bonferroni post hoc test, ##P < 0.01, ###P < 0.001 represent significance versus control cells; *P < 0.05, **P < 0.01, ***P < 0.001 represent significance versus TGFβ-treated cells.

5.3.4 FGF2 inhibited TGFβ-induced migration and collagen gel contractility of human HSCs (LX2 cells)

Upon TGFβ activation, HSCs become highly migratory and contractile cells that drives the

fibrotic alterations associated with chronic liver disease [3, 6]. Therefore, we also assessed

the effects of FGF2 on TGFβ-induced HSCs migration and contraction. We performed scratch

assay to assess HSCs migration and observed that TGFβ potentiated migration of HSCs which

was significantly and dose-dependently inhibited by an increasing concentrations of FGF2

(Figure 4A,C). We also examined the contraction using a 3D collagen gel contraction assay

and found that FGF2 dose-dependently decreased TGFβ-induced HSCs contraction (Figure

139

4B,D). Finally, we analysed the effect of FGF2 on cell viability and observed no significant

differences on cell viability with tested FGF2 concentrations (Figure 4E).

Figure 4. Efficacy of FGF2 on TGFβ-induced migration and contractility of TGFβ-activated LX2 cells. (A) Representative images (at 0 and 24 h) and (C) quantitative analysis (after 24 h) of migration by control and TGFβ-induced LX2 cells treated with medium alone or FGF2 (50, 100 and 250 ng/mL). (B) Representative images (after 72 h) and (D) quantitative analysis of 3D collagen gel contraction by control and TGFβ-activated LX2 cells treated with medium alone or FGF2 (50, 100 and 250 ng/mL). (E) % cell viability of control cells and TGFβ-activated LX2 cells treated with medium alone or FGF2 (50, 100 and 250 ng/mL). Graphs represent mean + SEM, statistical differences were calculated using one-way ANOVA with the Bonferroni post hoc test, ##P < 0.01, ###P < 0.001 represent significance versus control cells; **P < 0.01, ***P < 0.001 represent significance versus TGFβ-treated cells.

140

5.3.5 Characterization of FGF2-SPIONs

After confirming the pharmacological effects of FGF2 in vitro on TGFβ-activated HSCs, we

conjugated FGF2 protein to SPIONs. Biologics such as peptides and proteins have very short

half-life and are highly prone to enzymatic degradation and therefore are rapidly eliminated

from the body or degraded reducing their therapeutic efficacy [33]. Several strategies

including nanocarriers-mediated peptide/protein drugs delivery have been evolved over

years to protect them from degradation and to prolong their systemic half-life [34]. In this

study, we used SPIONs to improve the half-life of FGF2 and to target FGF2 to the livers. We

conjugated FGF2 to dextran-coated PEG-COOH functionalized SPIONs using carbodiimide

reaction chemistry as illustrated in a schematic picture in Figure 5A.

We conjugated the cysteine part of the FGF2 to the functionalized SPIONs and left the FGF2

receptor-binding domain abide to interact with FGFR1 on the HSCs surface. The conjugation

of FGF2 to SPIONs was confirmed by changes in size and zeta potential, and by dot-blot

analysis. Dynamic light scattering (DLS) measurements showed a slight increase in the mean

hydrodynamic size of SPIONs after conjugation with FGF2 (95 nm FGF2-SPIONs versus-80 nm

SPIONs) (Figure 5B). We also observed an increase in the negative surface charge (zeta

potential) of the particles after FGF2 conjugation (mean value of about -10 mV FGF2-SPIONs

versus -4 mV SPIONs) (Figure 5B). The successful conjugation of FGF2 to SPIONs was

confirmed by a dot blot analysis using anti-FGF2 antibody (Figure 5C). Based on the

quantitative analysis of FGF2 and FGF2-SPIONs, about 82% of FGF2 was estimated to be

conjugated to the SPIONs as derived from FGF2 standard curves presented in Figure S2.

Prussian blue iron-staining and the respective quantitative analysis confirmed that about 88%

SPIONs were recovered after conjugation due to the nanoparticle loss during the purification

steps as determined by SPIONs standard curves presented in Figure S2.

Quantitative analysis of dot blot FGF2 staining and iron staining (Figure S2) suggested 93%

conjugation of FGF2 to SPIONs indicating 4-5 FGF2 molecules per SPION. Finally, we

characterized the binding and uptake of FGF2-SPIONs in the TGFβ-activated LX2 cells. The

result demonstrated an increase in binding and uptake of FGF2-SPIONs as compared to the

unconjugated SPIONs (Figure 5D).

141

Subsequently, we analyzed the effect of FGF2-SPIONs and SPIONs on cell viability and

observed no significant differences on cell viability with tested concentrations (up to 250

ng/mL) (Figure 5E). FGF2-SPIONs were examined for long-term stability at 4°C using DLS

measurement (size) and dot blot (FGF2 conjugation/release) analysis. The results showed that

FGF2-SPIONs retained their size and FGF2 conjugation after 4 weeks of storage at 4°C.

Figure 5. Characterization and HSCs-specific binding/uptake of FGF2-SPIONs. (A) Schematic representation of FGF2 conjugation to SPION using carbodiimide chemistry. (B) Schematic of FGF2-SPIONs and table showing the hydrodynamic size, polydispersity index (PDI) and zeta potential of SPIONs and FGF2-SPIONs from n = 3 independent conjugations. (C) Dot blot image displaying FGF2 conjugation on SPIONs performed by FGF2 staining and SPIONs detection by Prussian Blue iron staining. FGF2-SPIONs, FGF2 and SPIONs were serially diluted and spotted on the membrane, thus the different dots in the figure represents the serial dilution of the respective samples. (D) Representative microscopic images and quantitative image analysis showing binding and uptake of FGF2-SPIONs versus SPIONs in TGFβ-activated LX2 cells, n = 8. (E) % cell viability of control LX2 cells and TGFβ-

142

activated LX2 cells with and without SPIONs, FGF2, FGF2-SPIONs treatment, n=8. Graphs represent mean + SEM; statistical differences were calculated using two-tailed unpaired t test, ***P < 0.001.

5.3.6 FGF2-SPIONs inhibited expression fibrosis markers, migration, and contractility of human HSCs (LX2) in vitro

Following FGF2 conjugation to SPIONs, we examined whether FGF2 retains its

pharmacological activity after chemical conjugation. To assess the effects of FGF2-SPIONs, we

used 250 ng/mL FGF2 based on our previous dose-dependent studies (Figure. 2,3,4). We

investigated the effects of FGF2-SPIONs on collagen I and α-SMA protein expression, and

collagen I, α-SMA and TGFβ1 mRNA expression on TGFβ-activated LX2 cells and found that

FGF2-SPIONs reduced both TGFβ-induced α-SMA and collagen I expression, and TGFβ1 mRNA

expression (Figure 6A-D and Figure S3).

Figure 6. Effects of FGF2-SPIONs on TGFβ-activated LX2 cells. (A) Representative immunofluorescent images (n = 4) and quantitative analysis of collagen I stained control and TGFβ-activated LX2 cells treated with medium alone, FGF2, FGF2-SPIONs or SPIONs. (B) Gene expression analysis for α-SMA and collagen I (normalized with 18 s rRNA) in control and TGFβ-activated LX2 cells treated with

143

medium alone, FGF2, FGF2-SPIONs or SPIONs, n = 6. (C) Representative images and (D) quantitative analysis of western blot depicting bands for collagen I, pAkt, Akt, α-SMA and β-actin, examined in control and TGFβ-activated LX2 cells treated with medium alone, FGF2, FGF2-SPIONs or SPIONs, n = 3. Graphs represent mean + SEM, statistical differences were calculated using one-way ANOVA with the Bonferroni post hoc test, #p<0.05, ##P < 0.01, ###P < 0.001 represent significance versus control cells; *P < 0.05, **P < 0.01, ***P < 0.001 represent significance versus TGFβ-treated cells.

Collaborating with our previous results, FGF2-SPIONs also inhibited the protein expression of

pAkt in TGFβ-activated LX2 cells (Figure 6C,D). We further examined the effect of FGF2-

SPIONs on TGFβ-induced HSCs migration and contraction and observed that FGF2-SPIONs

attenuated TGFβ-induced HSCs migration (Figure 7A) and contraction (Figure 7B). The results

clearly demonstrated that conjugation of FGF2 to SPIONs retained the pharmacological

effects of FGF2 and showed similar or slightly improved HSCs inhibitory effects as compared

to free unconjugated FGF2. Of note, SPIONs alone did not show significant inhibition of HSCs

as also reported previously [25].

Figure 7. Effects of FGF2-SPIONs on TGFβ-induced migration and contractility of human HSCs (LX2). (A) Representative images (at 0 and 24 h) and quantitative analysis (after 24 h) of migration by control and TGFβ-induced LX2 cells treated with medium alone, FGF2, FGF2-SPIONs or SPIONs. (B) Representative images (after 72 h) and quantitative analysis of 3D collagen gel contraction containing control and TGFβ-activated LX2 cells treated with medium alone, FGF2, FGF2-SPIONs or SPIONs, n = 6. Graphs represent mean + SEM, statistical differences were calculated using one-way ANOVA with the Bonferroni post hoc test. #P < 0.05, ##P < 0.05 versus control LX2 cells; *P < 0.05, **P < 0.01, ***P < 0.001 versus TGFβ-treated LX2 cells.

144

5.3.7 FGF2-SPIONs ameliorated fibrosis and inflammation in CCl4-induced acute liver injury mouse model

FGF2-SPIONs were subsequently evaluated for their therapeutic effects in the acute CCl4-

induced liver injury mouse model. Single CCl4 administration resulted in an increased intra-

hepatic collagen I (major ECM marker indicative of HSCs activation and ECM production, and

fibrogenesis) and increased F4/80 (macrophage marker indicative of macrophage-driven liver

inflammation) expression in CCl4-treated mice when compared with olive oil treated control

mice. FGF2-SPIONs (and not free FGF2) significantly attenuated collagen I and F4/80 protein

expression when compared with CCl4 mice or CCl4 mice treated with free FGF2 (P < 0.05) as

shown in Figure 8A,B.

Furthermore, % liver weight (normalized with respective body weight) was found to be

increased in CCl4 mice and CCl4 mice treated with free FGF2. Notably CCl4 mice treated with

FGF2-SPIONs showed significantly lowered % liver weights when compared with CCl4 mice (P

< 0.001), or CCl4 mice treated with free FGF2 (P < 0.01) (Figure 8C). We further examined the

localization of FGF2-SPIONs in the fibrotic livers. Following Prussian blue iron staining of

collagen-I stained liver sections, we observed localization of FGF2-SPIONs (stained with

Prussian blue) in the fibrotic regions stained with collagen-I secreted by activated HSCs

confirming HSCs-specific localization of FGF2-SPIONs in the fibrotic livers (Figure S4). This

observation aligns and supports our previous findings where we have shown an increased,

possibly HSCs-specific, uptake of RLX-SPIONs (relaxin-conjugated SPIONs) in the fibrotic livers

when compared to unconjugated SPIONs using MRI [25].

Finally, we examined plasma ALT levels and observed highly significant downregulation in ALT

levels following treatment with FGF2-SPIONs when compared with CCl4 mice (P < 0.001) or

CCl4 mice treated with free FGF2 (P < 0.05) (Figure 8D). Based on the previous in vitro results

and our previous studies [25, 27, 35] demonstrating that multiple administrations of SPIONs

didn’t show any beneficial therapeutic effects, SPIONs were not tested in vivo in the acute

CCl4-induced liver injury mouse model.

5.4 Discussion

In this study, we demonstrated the improved therapeutic efficacy of FGF2 after conjugation

with SPIONs, as a promising approach for the treatment of liver fibrosis. We confirmed an

145

upregulation of intrahepatic mRNA expression of FGFRs in cirrhotic patients and TGFβ-

activated HSCs. We further observed an increased protein expression of FGFR1, a major FGF2-

binding receptor in TGFβ-activated HSCs. Human recombinant FGF2 attenuated TGFβ-

induced HSCs activation, collagen I production, migration and contraction mediated via the

pAKT pathway. FGF2-conjugated SPIONs showed improved inhibition of TGFβ-activated HSCs

in vitro, and ameliorated inflammation and collagen I production in vitro in the acute CCl4-

induced liver injury mouse model.

Acute liver injury is a transient wound healing response characterized by liver inflammation

(increased infiltration and activation of macrophages) and fibrogenesis (enhanced activation

of quiescent HSCs). When the injury persists, liver undergous progressive scarring and

degeneration in a process known as fibrosis. HSCs are the main pathogenic cells responsible

for the production of abnormal fibrillar collagens in liver fibrosis. Therefore, substantial

efforts have been made to target HSCs for the treatment of liver fibrosis which showed

promising results [3-5, 7]. Upon hepatocellular injury, HSCs are activated in the presence of

growth factors, importantly TGFβ that results in activation, proliferation, migration,

contraction and collagen production by HSCs. Activation of HSCs are regulated by several

growth factors and signaling pathways [3, 4, 6]. Among others, FGFs have also been shown to

regulate HSCs [13], in particular FGF2 that has been shown to possess both pro- and anti-

fibrotic effects [9, 13]. In the present study, we found that exogenous low-molecular weight

FGF2 attenuated HSCs activation, migration, contraction and collagen expression. Our results

are in complete agreement with a study where high- and low-molecular weight FGF2 isoforms

were compared and demonstrated that low-molecular weight FGF2, as also used in this study,

potently ameliorated HSCs activation [15].

FGF2 can bind to different FGFR receptors with varying affinity, however it mainly interacts

with FGFR1 that has shown to be overexpressed on HSCs [21]. In this study, we also assessed

the expression levels of different types of FGFRs in human cirrhosis and in TGFβ-activated

human HSCs. Interestingly we found that almost all of the different FGFRs (except FGFR4)

were upregulated in human cirrhotic livers. FGFR1c, FGFR2c, FGFR3c and FGFR4 mRNA levels

were upregulated in TGFβ-activated human HSCs, and FGFR1 protein was highly expressed

on TGFβ-activated human HSCs.

146

Figure 8. Effects of FGF2-SPIONs in CCl4-induced acute liver injury mouse model. (A) Representative images and (B) quantitative analysis of collagen I (ECM marker) and F4/80 (macrophage marker) stained liver sections from control group (n = 6), CCl4 group (CCl4 mice treated with PBS, n = 5), CCl4 + FGF2 group (CCl4 mice treated with free FGF2, n = 5), and CCl4 + FGF2-SPIONs group (CCl4 mice treated with FGF2-SPIONs, n = 6). (C) % liver weights (normalized with respective body weights) from control group (n = 6), CCl4 group (CCl4 mice treated with PBS, n = 5), CCl4 + FGF2 group (CCl4 mice treated with free FGF2, n = 5), and CCl4 + FGF2-SPIONs group (CCl4 mice treated with FGF2-SPIONs, n = 6). (D) Alanine aminotransferase (ALT) levels (U/I) as analyzed in the plasma from different treatment groups. (B-D): Each symbol represents individual mice. Graphs represent mean + SEM, statistical differences were calculated using one-way ANOVA with the Bonferroni post hoc test. *P < 0.05, **P < 0.01, ***P < 0.001.

Although several mechanisms have been proposed with regard to FGF2-FGFR1 [13, 15, 36], in

this study we found an involvement of PI3K/AKT signaling pathway since pAKT expression was

significantly dose-dependently inhibited by an increasing concentrations of FGF2. These

results corroborates with the previous reports where selective inhibition of the PI3K/AKT

signaling pathway was shown to abrogate the protective functions of FGF2 [13, 17, 31, 32].

Our results confirmed the anti-fibrotic effects of FGF2. However, FGF2, like other biologics,

has several limitations such as short systemic half-life and susceptibility to enzymatic

degradation thereby reduced stability [22]. rFGF2 when administered with heparin showed

147

improved systemic circulation of FGF2 with slower clearance of heparin/rFGF-2 complexes

[22]. Nanotechnological advancements in the last decades have improved the

pharmacokinetics and targeted delivery of biologics e.g. using nanocarriers [33, 37]. SPIONs

provide several other advantages such as small size and dextran-PEG surface coating for

evading the mononuclear phagocytic system (MPS) and a large surface area allowing surface

conjugation and detection using MRI [23, 37, 38].

FGF2 has been shown to possess anti-fibrotic effects as also reported by others [13, 14, 15,

21, 36]. In this study, by coupling SPIONs to the SPIONs, we aimed to enhance the systemic

half-life and stability, and improve the targeting of FGF2 to the liver. Following successful

synthesis of FGF2-SPIONs, we confirmed the biological activity of FGF2, and found that FGF2-

SPIONs showed enhanced inhibition of HSCs activation, migration, contraction and collagen

production, most likely, due to the increased FGF2 stability. Subsequently, we investigated

the effects of FGF2 and FGF2-SPIONs in acute CCl4-induced liver injury mouse model. We

found that two doses of 250ng/dose/mouse FGF2-SPIONs attenuated fibrosis and

inflammation in early liver fibrogenesis model as confirmed by collagen I (ECM) expression

and F4/80 (macrophage) expression respectively. FGF2, in unconjugated free didn’t show the

significant inhibition in fibrogenesis in vivo at the tested doses. These results suggests that

SPIONs improved the half-life and possibly liver accumulation and HSCs-specific, and stability

of FGF2 resulting in improved biological efficacy of FGF2 in vivo. Since FGF2 is also known to

be involved in liver homeostasis, tissue repair and regeneration [11, 39, 40], it is also possible

that FGF2-SPIONs positively improve hepatocyte proliferation and hence promote liver

regeneration. To our best knowledge, this is the first study that explore the delivery of FGF2

to the diseased liver. However, this study has been performed in acute liver injury (earlier

liver fibrosis) model that does not correspond to the clinical situation. Patients normally

presents to the clinic when liver damage progresses to cirrhosis associated with liver

dysfunction. Nevertheless, this study provides the first proof-of-concept results highlighting

that FGF2-SPIONs can be a promising therapeutic approach, and therefore should to be

further explored in an advanced models of liver cirrhosis.

In conclusion, this study demonstrates that the SPIONs-mediated delivery of FGF2 potentiates

the therapeutic efficacy of FGF2 in vitro and in vivo thereby suggesting FGF2-SPIONs as a

potential therapeutic approach for the treatment of liver fibrosis. Moreover, SPIONs also

148

provides a possibility for MRI-based diagnosis therefore may also provide a personalized

theranostic approach with combined therapy and diagnosis for personalized disease

management. Altogether, this study presents a novel approach for the delivery of FGF2 as an

effective treatment of liver fibrosis.


This study was supported by the Indonesian Endowment Fund for Education from the

Republic of Indonesia (Lembaga Pengelola Dana Pendidikan/LPDP) and the University of

Twente.

5.6 References

[1] S.K. Asrani, H. Devarbhavi, J. Eaton, P.S. Kamath, Burden of liver diseases in the world, J Hepatol, 70 (2019) 151-171.


[3] S.L. Friedman, Mechanisms of hepatic fibrogenesis, Gastroenterology, 134 (2008) 1655-1669.

[4] R. Bansal, B. Nagorniewicz, J. Prakash, Clinical Advancements in the Targeted Therapies against Liver Fibrosis, Mediators Inflamm, 2016 (2016) 7629724.

[5] D. Schuppan, Y.O. Kim, Evolving therapies for liver fibrosis, J Clin Invest, 123 (2013) 1887-1901.

[6] S.L. Friedman, Hepatic stellate cells: protean, multifunctional, and enigmatic cells of the liver, Physiol Rev, 88 (2008) 125-172.

[7] S. Yazdani, R. Bansal, J. Prakash, Drug targeting to myofibroblasts: Implications for fibrosis and cancer, Adv Drug Deliv Rev, 121 (2017) 101-116.

[8] D.M. Ornitz, N. Itoh, The Fibroblast Growth Factor signaling pathway, Wiley Interdiscip Rev Dev Biol, 4 (2015) 215-266.

[9] J.D. Schumacher, G.L. Guo, Regulation of Hepatic Stellate Cells and Fibrogenesis by Fibroblast Growth Factors, Biomed Res Int, 2016 (2016) 8323747.

[10] C.M. Teven, E.M. Farina, J. Rivas, R.R. Reid, Fibroblast growth factor (FGF) signaling in development and skeletal diseases, Genes Dis, 1 (2014) 199-213.

[11] S.M. Tsai, D.W. Liu, W.P. Wang, Fibroblast growth factor (Fgf) signaling pathway regulates liver homeostasis in zebrafish, Transgenic Res, 22 (2013) 301-314.

[12] A. Bikfalvi, S. Klein, G. Pintucci, D.B. Rifkin, Biological roles of fibroblast growth factor-2, Endocr Rev, 18 (1997) 26-45.

[13] D.M. Dolivo, S.A. Larson, T. Dominko, Fibroblast Growth Factor 2 as an Antifibrotic: Antagonism of Myofibroblast Differentiation and Suppression of Pro-Fibrotic Gene Expression, Cytokine Growth Factor Rev, 38 (2017) 49-58.

[14] C. Yu, F. Wang, C. Jin, X. Huang, D.L. Miller, C. Basilico, W.L. McKeehan, Role of fibroblast growth factor type 1 and 2 in carbon tetrachloride-induced hepatic injury and fibrogenesis, Am J Pathol, 163 (2003) 1653-1662.

149

[15] R.L. Pan, L.X. Xiang, P. Wang, X.Y. Liu, L. Nie, W. Huang, J.Z. Shao, Low-molecular-weight fibroblast growth factor 2 attenuates hepatic fibrosis by epigenetic down-regulation of Delta-like1, Hepatology, 61 (2015) 1708-1720.

[16] H.Y. Koo, L.M. El-Baz, S. House, S.N. Cilvik, S.J. Dorry, N.M. Shoukry, M.L. Salem, H.S. Hafez, N.O. Dulin, D.M. Ornitz, R.D. Guzy, Fibroblast growth factor 2 decreases bleomycin-induced pulmonary fibrosis and inhibits fibroblast collagen production and myofibroblast differentiation, J Pathol, 246 (2018) 54-66.

[17] X. Tan, Q. Tao, G. Li, L. Xiang, X. Zheng, T. Zhang, C. Wu, D. Li, Fibroblast Growth Factor 2 Attenuates Renal Ischemia-Reperfusion Injury via Inhibition of Endoplasmic Reticulum Stress, Front Cell Dev Biol, 8 (2020) 147.

[18] A.N. Plotnikov, J. Schlessinger, S.R. Hubbard, M. Mohammadi, Structural basis for FGF receptor dimerization and activation, Cell, 98 (1999) 641-650.

[19] A. Chellaiah, W. Yuan, M. Chellaiah, D.M. Ornitz, Mapping ligand binding domains in chimeric fibroblast growth factor receptor molecules. Multiple regions determine ligand binding specificity, J Biol Chem, 274 (1999) 34785-34794.

[20] A.N. Plotnikov, S.R. Hubbard, J. Schlessinger, M. Mohammadi, Crystal structures of two FGF-FGFR complexes reveal the determinants of ligand-receptor specificity, Cell, 101 (2000) 413-424.

[21] J. Rosenbaum, S. Blazejewski, A.-M. Preaux, A. Mallat, D. Dhumeaux, P. Mavier, Fibroblast growth factor 2 and transforming growth factor b1 interactions in human liver myofibroblast, Gastroenterology 109 (1995) 1986-1996.

[22] M.A. Bush, E. Samara, M.J. Whitehouse, C. Yoshizawa, D.L. Novicki, M. Pike, R.J. Laham, M. Simons, N.A. Chronos, Pharmacokinetics and pharmacodynamics of recombinant FGF-2 in a phase I trial in coronary artery disease, J Clin Pharmacol, 41 (2001) 378-385.

[23] J.E. Rosen, L. Chan, D.B. Shieh, F.X. Gu, Iron oxide nanoparticles for targeted cancer imaging and diagnostics, Nanomedicine, 8 (2012) 275-290.

[24] C. Tassa, S.Y. Shaw, R. Weissleder, Dextran-coated iron oxide nanoparticles: a versatile platform for targeted molecular imaging, molecular diagnostics, and therapy, Acc Chem Res, 44 (2011) 842-852.

[25] B. Nagorniewicz, D.F. Mardhian, R. Booijink, G. Storm, J. Prakash, R. Bansal, Engineered Relaxin as theranostic nanomedicine to diagnose and ameliorate liver cirrhosis, Nanomedicine, 17 (2019) 106-118.

[26] E. Wurmbach, Y.B. Chen, G. Khitrov, W. Zhang, S. Roayaie, M. Schwartz, I. Fiel, S. Thung, V. Mazzaferro, J. Bruix, E. Bottinger, S. Friedman, S. Waxman, J.M. Llovet, Genome-wide molecular profiles of HCV-induced dysplasia and hepatocellular carcinoma, Hepatology, 45 (2007) 938-947.

[27] D.F. Mardhian, A. Vrynas, G. Storm, R. Bansal, J. Prakash, FGF2 engineered SPIONs attenuate tumor stroma and potentiate the effect of chemotherapy in 3D heterospheroidal model of pancreatic tumor, Nanotheranostics, 4 (2020) 26-39.

[28] S.E. Hughes, Differential expression of the fibroblast growth factor receptor (FGFR) multigene family in normal human adult tissues, J Histochem Cytochem, 45 (1997) 1005-1019.

[29] K. Jim-No, M. Tanimizu, I. Hyodo, F.Kurimoto, T. Yamashita, Plasma level of basic fibroblast growth factor increases with progression of chronic liver disease, J. Gastroenterol. 32 (1997)119-121.

150

[30] T. Seitz, K. Freese, P. Dietrich, W.E. Thasler, A. Bosserhoff, C. Hellerbrand, Fibroblast growth factor 9 is expressed by activated hepatic stellate cells and promotes progression of hepatocellular carcinoma, Sci. Rep. 10 (2020) 4546.

[31] H. Shi, J. Xu, R. Zhao, H. Wu, L. Gu, Y. Chen, FGF2 regulates proliferation, migration, and invasion of ECA109 cells through PI3K/Akt signalling pathway in vitro, Cell Biol Int, 40 (2016) 524-533.

[32] M.K. Son, Y.L. Ryu, K.H. Jung, H. Lee, H.S. Lee, H.H. Yan, H.J. Park, J.K. Ryu, J.K. Suh, S. Hong, S.S. Hong, HS-173, a novel PI3K inhibitor, attenuates the activation of hepatic stellate cells in liver fibrosis, Sci Rep, 3 (2013) 3470.

[33] B.J. Bruno, G.D. Miller, C.S. Lim, Basics and recent advances in peptide and protein drug delivery, Ther Deliv, 4 (2013) 1443-1467.

[34] D.S. Pisal, M.P. Kosloski, S.V. Balu-Iyer, Delivery of therapeutic proteins, J Pharm Sci, 99 (2010) 2557-2575.

[35] D.F. Mardhian, G. Storm, R. Bansal, J. Prakash, Nano-targeted relaxin impairs fibrosis and tumor growth in pancreatic cancer and improves the efficacy of gemcitabine in vivo, J Control Release, 290 (2018) 1-10.

[36] M. Sato-Matsubara, T. Matsubara, A. Daikoku, Y. Okina, L. Longato, K. Rombouts, L.T.T. Thuy, J. Adachi, T. Tomonaga, K. Ikeda, K. Yoshizato, M. Pinzani, N. Kawada, Fibroblast growth factor 2 (FGF2) regulates cytoglobin expression and activation of human hepatic stellate cells via JNK signaling, J Biol Chem, 292 (2017) 18961-18972.

[37] M. Arruebo, R. Fernández-Pacheco, M.R. Ibarra, J. Santamaría, Magnetic nanoparticles for drug delivery, Nano Today, 2 (2007) 22-32.

[38] R. Tietze, J. Zaloga, H. Unterweger, S. Lyer, R.P. Friedrich, C. Janko, M. Pottler, S. Durr, C. Alexiou, Magnetic nanoparticle-based drug delivery for cancer therapy, Biochem Biophys Res Commun, 468 (2015) 463-470.

[39] L. Maddaluno, C. Urwyler, S. Werner, Fibroblast growth factors: key players in regeneration and tissue repair, Development, 144 (2017) 4047-4060.

[40] Y.R. Yun, J.E. Won, E. Jeon, S. Lee, W. Kang, H. Jo, J.H. Jang, U.S. Shin, H.W. Kim, Fibroblast growth factors: biology, function, and application for tissue regeneration, J Tissue Eng, 2010 (2010) 218142.

151


Table S1. Antibodies used for the immunofluorescence staining and western blotting

Table S2: Sequence of the human primers used for quantitative real-time PCR

Primary Antibody Source Immunostaining Western blotting

Polyclonal rabbit anti-FGF2 Cell Signalling 1:1000


Polyclonal rabbit anti-α-SMA Sigma 1:500

Polyclonal goat anti-collagen I Southern Biotech 1:100 1:600

Rat anti-mouse F4/80 BioRad 1:100

Polyclonal rabbit anti-FGFR1 Cell Signaling 1:100 1:1000


HRP-conjugated goat anti-rabbit IgG DAKO 1:100 1:2000

HRP-conjugated rabbit anti-mouse IgG DAKO 1:100 1:2000

HRP-conjugated goat anti-mouse IgG DAKO 1:100 1:2000

HRP-conjugated rabbit anti-goat IgG DAKO 1:100 1:2000

Alexa 488 conjugated donkey anti-rabbit IgG Thermo Fisher Scientific 1:200

Alexa 488 conjugated donkey anti-goat IgG Thermo Fisher Scientific 1:200

Gene

Forward primer sequence (5’-3’) Reverse primer sequence (5’-3’) Accession no. FGFR1c GGACTCTCCCATCACTCTGCAT

GGCCCCTGTGCAATAGATGA

M34186.1 FGFR2c GCCAAGCCTGAGTCCTTTCT

ACGCAGAAGAGTGGTCCTTG

NM_001144919

FGFR3c GACGTACACGCTGGACGTGCTGGA

AGCACCACCAGCCACGCAGAGTGA

NM_000142 FGFR4 AGTTCTGCCTACAGGACACG ACAGGAGTCCCACCGTGTAT NG_012067.1

FGF2 GGCTTCTTCCTGCGCATCCA GCTCTTAGCAGACATTGGAAGA NM_002006 α-SMA CCCCATCTATGAGGGCTATG

CAGTGGCCATCTCATTTTCA

NM_001613.2 Col-1α1 GTACTGGATTGACCCCAACC CGCCATACTCGAACTGGAAT NM_000088.3

TGFβ1 GCGTGCTAATGGTGGAAACC GAGCAACACGGGTTCAGGTA NM_000660.4 18 s rRNA TGAGGTGGAACGTGTGATCA CCTCTATGGGCCCGAATCTT NM_022551.2

152

Figure S1. Effects of FGF2 on TGFβ mRNA expression in TGFβ-activated LX2 cells. Relative gene expression analysis (normalized with 18s rRNA) for TGFβ1 as examined in control and TGFβ-activated LX2 cells treated with medium alone or different concentrations of FGF2 (50, 100 and 250 ng/mL), n = 3. Graphs represent mean + SEM, statistical differences were calculated using two-tailed unpaired t test, ###P < 0.001 represent significance versus control cells; *P < 0.05 represent significance versus TGFβ-treated cells.

153

Figure S2. Quantitative analysis of FGF2 and SPIONs in FGF2-SPIONs conjugate. The dot blots were analyzed using ImageJ software. The obtained signal intensity were plotted at Y axis corresponding to known concentrations of FGF2 and SPIONs respectively at X axis. Using these standard curves, the unknown concentrations of FGF2 and SPIONs in FGF2-SPIONs after conjugation were derived to estimate % conjugation and % recovery.

0 20 40 60 80 1000

10000

20000

30000 FGF2 standard curve

Concentration (ng)

Sign

al in

tens

ity (a

.u.)

Y = 296,8X + 40,94R2 = 0,9763

154

Figure S3. Effects of FGF2 on TGFβ mRNA expression in TGFβ-activated LX2 cells. Relative gene expression analysis (normalized with 18s rRNA) for TGFβ1 as examined in control and TGFβ-activated LX2 cells treated with medium alone or different concentrations of FGF2 (50, 100 and 250 ng/mL), n = 3. Graphs represent mean + SEM, statistical differences were calculated using two-tailed unpaired t test, ###P < 0.001 represent significance versus control cells; *P < 0.05 represent significance versus TGFβ-treated cells.

155

Figure S4. HSCs-specific localization of FG2-SPIONs in liver in vivo. Representative microscopic image showing HSCs-specific localization of FGF2-SPIONs (in blue color, indicated by arrows) in the fibrotic regions stained with collagen I immunostaining (in red color). The collagen I immunostaining together with Prussian blue iron staining was performed on cryosections prepared from liver tissues obtained from fibrotic mice treated with FGF2-SPIONs.

157

Chapter 6

Summary

158

Summary

Liver fibrosis and its progression to liver cirrhosis and hepatocellular carcinoma (HCC) is a

growing health problem affecting millions of people worldwide. This growing global health

burden is attributed to hepatitis viral infections (viral hepatitis), metabolic disorders such as

obesity and diabetes (non-alcoholic fatty liver disease, NAFLD) and alcohol abuse (alcohol-

associated liver disease, ALD), among others [1]. Upon persistent liver injury, chronic

inflammation ensues that develops into fibrosis, that further develops into cirrhosis (end-

stage liver failure) and/or hepatocellular carcinoma (HCC).

Following hepatocellular damage, liver inflammation is triggered by the resident immune cells

followed by activation and infiltration of immune cells, mainly monocytes/macrophages, that

lead to chronic liver inflammation. Liver inflammation instigates proliferation, activation and

trans-differentiation of quiescent hepatic stellate cells (HSCs) to myofibroblasts that secretes

excessive amounts of extracellular matrix proteins, mainly collagen, resulting in tissue stiffness

and distortion of liver architecture referred to liver fibrosis that further develops into liver

cirrhosis (liver dysfunction) and cancer development [2, 3].

Despite the increasing prevalence of such liver diseases, unfortunately no clinically approved

drugs are available for their treatment. Removal of the underlying cause e.g. by alcohol

abstinence, lifestyle modifications i.e. healthy diet and exercise (weight loss), and regular

monitoring of liver function is recommended for patients with acute/early liver disease (liver

fibrosis). Liver transplantation is the only option available in case of end-stage liver failure

(liver cirrhosis). Due to the lack of sufficient liver donors, lifelong immunosuppressive drugs,

high costs and other associated problems, liver transplantation is used for only a minority of

patients. Therefore, there is an urgent need to develop a drug-based treatment for fatty liver

and fibrotic liver diseases.

Macrophages and hepatic stellate cells (HSCs) are known to play a crucial role in the

development of liver diseases, both during acute and chronic liver injury [4, 5]. Therefore, in

this thesis, we developed and investigated novel therapeutic approaches targeting

macrophages and HSCs. As summarized in chapter 1, we investigated the utility of novel

compounds and nanoparticle-based approaches to achieve this goal.

159

In an initial preliminary study, we used a profiler array tool, applied to murine RAW 264.7 cells.

Unstimulated M0 macrophages, lipopolysaccharide (LPS)/interferon gamma (IFNγ)-stimulated

pro-inflammatory M1 macrophages and interleukin (IL)-4/IL-13-stimulated pro-resolving M2

macrophages were analyzed for differential gene expression. In the profiler array, we found

that spleen tyrosine kinase (SYK) was highly upregulated in M1 macrophages, among other

genes that were upregulated in M1 macrophages (17 in total). This phenomenon is also

highlighted in our literature review (chapter 2), in which we describe and discuss the role of

the SYK signaling pathway in liver diseases [6]. This review points out that SYK is highly

expressed in liver diseases, and that SYK expression and activation of its signaling pathway

correlates with the disease severity in different etiological liver diseases including viral

hepatitis (B and C), NASH, ALD, liver cirrhosis and HCC [7-9] [10]. SYK is known to be widely

expressed in hepatocytes, hepatic macrophages and activated HSCs [11]. We further provide

an overview of different SYK inhibitors that have/can be explored for the treatment of liver

diseases. We have also highlighted the limitations of using SYK inhibitors e.g., poor

pharmacokinetics (small molecule inhibitors) and adverse effects due to involvement of SYK

in normal cellular functions, and future applications of targeting SYK inhibitors using

nanoparticles.

In chapter 3, motivated with the results obtained from the profiler array, we explored the

effects of a small molecule SYK inhibitor, R406 [12] (without and with nanoparticles) in vitro

and in vivo [8]. As shown previously by others [10, 11], we found a positive correlation of SYK

expression with the pathogenesis of NASH and alcoholic hepatitis in patients. But not shown

previously, we observed that SYK expression was particularly induced in M1-differentiated

pro-inflammatory macrophages. Following this observation, we assessed the implication of

the SYK pathway in macrophages and found that inhibition of the SYK pathway using R406

resulted in the inhibition of inflammation markers i.e., nitric oxide (NO) release, and enhanced

gene expression of IL-1β, FcγR1, iNOS, CCL2, IL-6, and CCR2, in a dose-dependent manner.

Based on the significant inhibition of the SYK pathway by R406 in M1 (pro-inflammatory)

macrophages and to overcome the limitations as mentioned above, we encapsulated this drug

into poly lactic-co-glycolic acid (PLGA) nanoparticles. PLGA was chosen considering its

biodegradability, biocompatibility as well as the fact that it is a FDA approved polymer [13].

After extensive characterization of the R406-PLGA nanoparticles, we examined the efficacy of

160

R406-PLGA nanoparticles in in vitro cultured RAW macrophages and BMDMs polarized

towards the M1 phenotype. We found that both R406-PLGA nanoparticles as well as R406

itself could significantly inhibit the gene expression of several inflammatory markers in vitro

[14]. In a subsequent in vivo study, using the MCD-diet NASH mouse model, we found that

R406-PLGA nanoparticles significantly ameliorated liver inflammation, fibrosis, and steatosis

as compared to free R406 [14]. We concluded that R406-PLGA nanoparticles could be a

promising approach for the treatment of NASH. However, further studies in mouse models i.e.

western diet models and/or the Stelic Animal Model (STAM) model, that more closely mimic

the clinical NASH situation, are needed.

Since SYK pathway is closely associated with SRC kinase pathway [15], we then explored the

involvement and role of SRC kinase pathway in liver diseases in chapter 4. We confirmed that

the Src gene was highly upregulated in human liver tissues obtained from patients with NASH,

alcoholic hepatitis, cirrhosis, and biliary atresia. We also observed that the Src gene was highly

upregulated in RAW 264.7 macrophages, murine BMDMs, and human MDMs (marrow-

derived macrophages), when polarized to their respective M1 phenotype. For a further

investigation of the role of the Src kinase pathway and potential therapeutic benefit of

inhibition of this pathway, we used the selective small molecule Src kinase inhibitor, KX2-391

[16].

KX2-391 inhibited the phosphorylation of Src, SYK and significantly reduced the NO release in

RAW macrophages. Moreover, gene expression analysis in RAW macrophages and BMDMs

evidenced that Src pathway inhibition mediated by KX2-391 attenuated the expression of

different inflammatory markers including iNOS, CCL2, and FcγR1. Additionally, in a precision-

cut liver slices (PCLS) model [17], KX2-391 decreased the gene expression of Src, iNOS and

CCL2 without affecting the cell/tissue viability. Moreover, KX2-391 attenuated hepatocytic

lipid accumulation; TGFβ-induced HSCs activation, contractility and collagen expression.

Next, we investigated the relevance of the Src pathway in NASH and ASH using a MCD-diet

NASH mouse model and a Lieber-De Carli ALD mouse model [18], respectively. The results

indicated that KX2-391 attenuated inflammation, fibrosis, and steatosis in both NASH and ASH

mouse models. Mechanistic studies further revealed that Src mediated the effects through

the FAK/PI3K/AKT pathway.

161

Accordingly, we proposed that inhibiting the Src kinase pathway using inhibitors such as KX2-

391 represents a potential treatment for liver diseases like NASH and ALD. The Src kinase

inhibitor KX2-391 is also very promising to be studied as a potential therapy for other chronic

diseases including cancer.

In chapter 5, we focused on targeting of HSCs to inhibit fibrosis. Since the fibroblast growth

factor receptor 1 (FGFR1) is highly overexpressed on activated HSCs, we decided to use basic

FGF (FGF2) to inhibit HSCs activation. We observed that FGF2 was able to inhibit TGFβ-induced

HSCs activation (confirmed by reduced collagen-I and α-SMA expression), migration of HSCs

(confirmed by wound healing assays) and contraction of HSCs (confirmed by 3D-gel

contraction assays). These results laid the foundation for our further studies in which we

conjugated FGF2 to superparamagnetic iron oxide nanoparticles (FGF2-SPIONs) to improve

the stability and half-life of FGF2 and thereby to improve the therapeutic efficacy of FGF2 for

the treatment of liver fibrosis. In addition to enhancing therapeutic efficacy, conjugation of

FGF2 with SPIONs is also expected to be applied for diagnostic-related purposes due to its

paramagnetic properties, providing theranostic potential [19]. After performing several in

vitro and in vivo experiments, the results revealed that the potency of FGF2-SPIONs conjugate

is significantly improved as compared to free FGF2. Besides improved therapeutic efficacy, we

also concluded that the conjugation of FGF2 with SPIONs may provide a personalized

theranostic approach with combined therapy and diagnosis for personalized disease

management. However, more studies are required to validate our findings and theranostic

potential of FGF2-SPIONs in more advanced and representative liver fibrosis animal models

[20].

In conclusion, the approaches described in this thesis are promising to be explored further for

the treatment of liver diseases like NASH or ALD-based liver fibrosis. With nanotechnological

approaches such as polymeric nanoparticles and SPIONs, the efficacy of active compounds

with poor pharmacokinetic profile can be significantly increased. In addition to increasing

efficacy, nanoparticulate delivery systems can also reduce the adverse effects of these active

compounds. Since the majority of administered nanoparticles will accumulate and be

sequestered in the liver after intravenous administration into the body, this thesis work

confirms our initial hypothesis that the design of nano-delivery systems can effectively

162

improve drug delivery to the liver and therefore have great potential to ameliorate the

therapy of liver diseases as presented in this thesis.

References

[1] M. Blachier, H. Leleu, M. Peck-Radosavljevic, D.-C. Valla, F. Roudot-Thoraval, The burden of liver disease in Europe: A review of available epidemiological data, in: E.A.f.T.S.o.T.L. (EASL) (Ed.), 2013.

[2] R.S. Rahimi, D.C. Rockey, Complications and outcomes in chronic liver disease, Curr Opin Gastroenterol, 27 (2011) 204-209.

[3] R.A. Mohammad, Complications of chronic liver disease, 2010, pp. 91-108. [4] C. Ju, F. Tacke, Hepatic macrophages in homeostasis and liver diseases: from pathogenesis

to novel therapeutic strategies, Cell Mol Immunol, 13 (2016) 316-327. [5] C. Yin, K.J. Evason, K. Asahina, D.Y. Stainier, Hepatic stellate cells in liver development,

regeneration, and cancer, J Clin Invest, 123 (2013) 1902-1910. [6] D.W. Kurniawan, G. Storm, J. Prakash, R. Bansal, Role of spleen tyrosine kinase in liver

diseases, World J Gastroenterol, 26 (2020) 1005-1019. [7] A.R. Zekri, M.M. Hafez, A.A. Bahnassy, Z.K. Hassan, T. Mansour, M.M. Kamal, H.M. Khaled,

Genetic profile of Egyptian hepatocellular-carcinoma associated with hepatitis C virus Genotype 4 by 15 K cDNA microarray: preliminary study, BMC Res Notes, 1 (2008) 106.


[9] I.J. Song, Y.M. Yang, S. Inokuchi-Shimizu, Y.S. Roh, L. Yang, E. Seki, The contribution of toll-like receptor signaling to the development of liver fibrosis and cancer in hepatocyte-specific TAK1-deleted mice, Int J Cancer, 142 (2018) 81-91.



[12] S. Braselmann, V. Taylor, H. Zhao, S. Wang, C. Sylvain, M. Baluom, K. Qu, E. Herlaar, A. Lau, C. Young, B.R. Wong, S. Lovell, T. Sun, G. Park, A. Argade, S. Jurcevic, P. Pine, R. Singh, E.B. Grossbard, D.G. Payan, E.S. Masuda, R406, an orally available spleen tyrosine kinase inhibitor blocks fc receptor signaling and reduces immune complex-mediated inflammation, J Pharmacol Exp Ther, 319 (2006) 998-1008.

[13] F. Danhier, E. Ansorena, J.M. Silva, R. Coco, A. Le Breton, V. Preat, PLGA-based nanoparticles: an overview of biomedical applications, J Control Release, 161 (2012) 505-522.

[14] H.H. Hansen, M. Feigh, S.S. Veidal, K.T. Rigbolt, N. Vrang, K. Fosgerau, Mouse models of nonalcoholic steatohepatitis in preclinical drug development, Drug Discov Today, 22 (2017) 1707-1718.

[15] C.A. Lowell, Src-family and Syk kinases in activating and inhibitory pathways in innate immune cells: signaling cross talk, Cold Spring Harb Perspect Biol, 3 (2011) 1-16.

163

[16] M. Anbalagan, L. Carrier, S. Glodowski, D. Hangauer, B. Shan, B.G. Rowan, KX-01, a novel Src kinase inhibitor directed toward the peptide substrate site, synergizes with tamoxifen in estrogen receptor alpha positive breast cancer, Breast Cancer Res Treat, 132 (2012) 391-409.

[17] P. Olinga, D. Schuppan, Precision-cut liver slices: a tool to model the liver ex vivo, J Hepatol, 58 (2013) 1252-1253.

[18] A. Bertola, S. Mathews, S.H. Ki, H. Wang, B. Gao, Mouse model of chronic and binge ethanol feeding (the NIAAA model), Nat Protoc, 8 (2013) 627-637.

[19] B. Nagorniewicz, D.F. Mardhian, R. Booijink, G. Storm, J. Prakash, R. Bansal, Engineered Relaxin as theranostic nanomedicine to diagnose and ameliorate liver cirrhosis, Nanomedicine, 17 (2019) 106-118.

[20] D.W. Kurniawan, R. Booijink, L. Pater, I. Wols, A. Vrynas, G. Storm, J. Prakash, R. Bansal, Fibroblast growth factor 2 conjugated superparamagnetic iron oxide nanoparticles (FGF2-SPIONs) ameliorate hepatic stellate cells activation in vitro and acute liver injury in vivo, J Control Release, 328 (2020) 640-652.

164

Appendix A – Nederlandse Samenvatting

Lever fibrose, en zijn gevorderde stadia lever cirrose en hepatocellulair carcinoom (HCC),

vormen een groeiend gezondheidsprobleem voor miljoenen mensen wereldwijd. Deze globaal

groeiende last op de gezondheidszorg is onder andere te wijten aan virale infecties van de

lever (virale hepatitis), metabolische stoornissen zoals obesitas en diabetes (niet-alcoholische

vette lever ziekte, NAFLD) en alcohol misbruik (alcoholische lever ziekte, ALD). Chronische

ontsteking in de lever, dat resulteert in fibrose, ontstaat als gevolg van aanhoudende lever

beschadiging, wat vervolgens verder kan ontwikkelen in lever cirrose (eind stadium lever

falen) en/of hepatocellulair carcinoom (HCC).

Als gevolg van hepatocellulaire schade worden lever eigen immuun cellen geactiveerd,

gevolgd door de activatie en infiltratie van circulerende immuun cellen, voornamelijk

monocyten en macrofagen, wat leidt tot chronische leverontsteking. Leverontsteking zet

daarna aan tot de proliferatie, activatie en trans-differentiatie van rustende hepatische

stellaat cellen (HSCs) naar myofibroblasten, die overmatige hoeveelheden extracellulaire

matrix eiwitten uitscheiden, voornamelijk collageen. Dit resulteert in stijfheid en vervorming

van de lever, gekarakteriseerd als lever fibrose, wat zich verder ontwikkelt in lever cirrose

(lever falen) en kanker.

Helaas zijn er, ondanks de toenemende prevalentie van deze lever ziektes, geen klinisch

goedgekeurde medicijnen beschikbaar voor de behandeling. Voor patiënten met acute lever

ziekte of lever ziekte in een vroeg stadium (lever fibrose), wordt aangeraden de onderliggende

oorzaak van de ziekte aan te pakken, bijvoorbeeld door onthouding van alcohol, of door

veranderingen aan te brengen in levensstijl met een gezond dieet en voldoende beweging, en

door de lever functie te monitoren. Voor patiënten in een laat stadium lever falen (lever

cirrose), is lever transplantatie de enige optie. Echter, lever transplantatie is alleen

beschikbaar voor een minderheid van de patiënten door een gebrek aan voldoende donoren,

levenslange afweeronderdrukkende medicatie, hoge kosten en andere aangesloten

problemen. Daarom is de ontwikkeling van medicijn-gerichte behandeling van vette lever en

fibrotische lever ziektes noodzakelijk.

Macrofagen en hepatische stellaat cellen (HSCs) spelen een cruciale rol in de ontwikkeling van

lever ziektes, zowel bij acute als chronische lever schade. Daarom ontwikkelden en

165

onderzochten we in deze theses nieuwe therapeutische benaderingen gericht op macrofagen

en HSCs. Om dit te bereiken onderzochten we de bruikbaarheid van nieuwe middelen en

technieken gebaseerd op nano-deeltjes, samengevat in hoofdstuk 1.

In een aanvankelijk inleidend onderzoek gebruikten we een profiel array, toegepast op muis

RAW 264.7 cellen. Niet-gestimuleerde M0 macrofagen, lipopolysaccharide (LPS)/interferon

gamma (IFNγ)-gestimuleerde pro-inflammatoire M1 macrofagen en interleukine (IL)-4/IL-13-

gestimuleerde wondgenezing bevorderende M2 macrofagen werden geanalyseerd voor

differentiële gen expressie. In de profiel array vonden we in totaal 17 genen die opgereguleerd

waren in M1 macrofagen, waaronder spleen tyrosine kinase (SYK). Dit wordt ook benadrukt

in onze literatuur recensie (hoofdstuk 2), waarin we de rol van het SYK signaaltransductiepad

in lever ziektes beschrijven en bespreken. Deze literatuurrecensie duidt aan dat SYK een hoge

expressie heeft in lever ziektes, en dat SYK expressie en activatie van zijn

signaaltransductiepad correleert aan de hevigheid van de ziekte in verscheidene etiologische

lever ziektes, waaronder virale hepatitis (B en C), NASH, ALD, lever cirrose en HCC. Het is

bekend dat SYK op grote schaal tot expressie komt in hepatocyten, lever macrofagen en

geactiveerde HSCs. Verder geven we een overzicht van de verschillende SYK inhibitoren die

zijn/kunnen worden onderzocht voor de behandeling van lever ziektes. Ook hebben we de

beperkingen van het gebruik van SYK inhibitoren onderschreven, bijvoorbeeld slechte

farmacokinetiek (kleine molecuul inhibitoren) en negatieve bijwerkingen door betrokkenheid

van SYK in normale cel functies, en verdere applicaties gericht op de combinatie van SYK

inhibitors met nano-deeltjes.

In hoofdstuk 3, gemotiveerd door de resultaten van de profiel array, onderzochten we het

effect van een klein molecuul SYK inhibitor, R406 (met en zonder nano-deeltjes), in vitro en in

vivo. Vergelijkbaar met wat anderen voor ons hebben onderzocht, vonden we een positieve

correlatie tussen SYK expressie en de pathogenese in patiënten met NASH of alcoholische

hepatitis. Echter, wij stelden vast dat SYK expressie voornamelijk opgewekt was in M1-

gedifferentieerde macrofagen, een observatie nog niet eerder beschreven. Na deze

observatie analyseerden we de implicatie van het SYK signaaltransductiepad in macrofagen,

en zagen dat SYK inhibitie met R406 leidde tot een inhibitie van ontstekingsmarkers zoals

stikstofoxide (NO) afgifte, en verhoogde gen expressie van IL-1β, FcγR1, iNOS, CCL2, IL-6 en

CCR2 op een dosisafhankelijke manier.

166

Naar aanleiding van de significante inhibitie van het SYK signaaltransductiepad door R406 in

M1 (pro-inflammatoire) macrofagen, en om voorgenoemde beperkingen te voorkomen,

hebben we dit medicijn ingekapseld in poly lactic-co-glycolic acid (PLGA) nano-deeltjes. PLGA

is gekozen omdat het zowel biodegradeerbaar als biocompatibel is, in combinatie met het feit

dat PLGA een FDA goedgekeurd polymeer is. Na uitgebreide karakterisering van de R406-

PLGA nano-deeltjes, onderzochten we de effectiviteit van de R406-PLGA nano-deeltjes in vitro

in gekweekte RAW macrofagen en BMDMs gepolariseerd richting een M1 fenotype. Hierbij

zagen we dat zowel R406-PLGA nano-deeltjes als R406 zelf de genexpressie van verschillende

ontstekingsmarkers significant kunnen reduceren. In een aaneensluitende in vivo studie,

waarbij we gebruik maakten van het MCD-dieet NASH muis model, vonden we dat R406-PLGA

nano-deeltjes lever ontsteking, fibrose en steatose significant reduceerden, in vergelijking met

vrije R406. We concludeerden dat R406-PLGA nano-deeltjes een veelbelovende strategie

kunnen zijn voor de behandeling van NASH. Echter, additionele studies in muis modellen, die

een betere representatie zijn van klinische NASH ontwikkeling, zoals Westers Dieet modellen

en/of het Stelic Animal Model (STAM model), zijn nodig.

Gezien het SYK signaaltransductiepad en het SRC kinase signaaltransductiepad nauw

verbonden zijn, onderzochten we de betrokkenheid en rol van het SRC kinase

signaaltransductiepad in lever ziektes in hoofdstuk 4. We bevestigden dat het SRC gen een

hoge expressie heeft in menselijk lever weefsel van patiënten met NASH, alcoholische

hepatitis, cirrose en biliaire atresie. We observeerden ook dat het Src gen een hoge expressie

heeft in RAW 264.7 macrofagen, muis BMDMs en menselijke MDMs (macrofagen uit het

beenmerg), wanneer deze gepolariseerd zijn naar hun M1 fenotype. Om de rol en eventuele

therapeutische voordelen van inhibitie van dit SRC kinase signaaltransductiepad verder te

onderzoeken, gebruikten we de selectieve klein molecuul SRC kinase inhibitor KX2-391.

KX2-391 zorgde voor inhibitie van de fosforylering van SRC, SYK en verminderde de NO afgifte

significant in RAW macrofagen. Bovendien, gen expressie analyse in RAW macrofagen en

BMDMs toonde aan dat inhibitie van SRC signaaltransductiepad door KX2-391 de expressie

van ontstekingsmarkers zoals iNOS, CCL2, en FcγR1 verminderde. Ook verminderde KX2-391

lipide accumulatie in hepatocyten; TGFβ-geïnduceerde HSCs activatie, contractiliteit en

collageen expressie.

167

Hierna onderzochten we de relevantie van het SRC signaaltransductiepad in NASH en ASH

door middel van een MCD-dieet NASH muis model, en een Lieber-De Carli ALD muis model,

respectievelijk. De resultaten lieten zien dat KX2-391 zorgde voor een vermindering van

ontsteking, fibrose en steatose in zowel het NASH als het ASH muis model. Verder toonden

mechanistische studies aan dat SRC deze effecten veroorzaakt via het FAK/PI3K/AKT

signaaltransductiepad.

We suggereren dat inhibitie van het SRC kinase signaaltransductiepad met inhibitoren zoals

KX2-391 kan dienen als een potentiële behandeling voor lever ziektes als NASH en ALD. De

SRC kinase inhibitor KX2-391 is ook veelbelovend als potentiële therapie voor andere

chronische ziektes, waaronder kanker.

In hoofdstuk 5 concentreerden we ons op het inhiberen van fibrose, door middel van gerichte

medicatie tegen HSCs. Gezien de hoge expressie van fibroblast growth factor receptor 1

(FGFR1) in actieve HSCs, besloten we basaal FGF (FGF2) te gebruiken voor het remmen van

HSCs activatie. Hierbij zagen we dat FGF2 zorgde voor een remming van TGFβ-geïnduceerde

HSCs activatie (bevestigd door een afname van collageen-1 en α-SMA expressie), migratie van

HSCs (bevestigd door wond heling-assays) en contractie van HSCs (bevestigd door 3D-gel

contractie-assays). Deze resultaten legden de fundering voor onze vervolgonderzoeken,

waarin we de stabiliteit en halveringstijd van FGF2 verbeteren door FGF2 te conjugeren aan

super paramagnetische ijzer oxide nano-deeltjes (FGF2-SPIONs). Hierdoor verbeteren we de

therapeutische efficiëntie van FGF2 voor de behandeling van lever fibrose. Tevens kan de

conjugatie van FGF2 met SPIONs worden gebruikt voor diagnostiek-gerelateerde doeleinden

gezien zijn paramagnetische eigenschappen, potentieel theranostische toepassingen. De

resultaten van verscheidene in vitro en in vivo experimenten toonden aan dat potentie van

het geconjugeerde FGF2-SPION hoger is dan vrije FGF2.

Afgezien van verhoogde therapeutische efficiëntie, concludeerden we dat conjugatie van

FGF2 met SPIONs de potentie heeft voor gepersonaliseerd theranostisch onderzoek, waarbij

therapie en diagnostiek gecombineerd kan worden voor gepersonaliseerd ziektebeheer.

Echter, aanvullend onderzoek is nodig om onze bevindingen te valideren en de theranostische

mogelijkheden van FGF2-SPIONs te analyseren in geavanceerde en representatieve lever

fibrose modellen.

168

In conclusie, deze thesis beschrijft veelbelovende methodes voor de behandeling van lever

ziektes zoals NASH of ALD-gebaseerde lever fibrose. Met behulp van nanotechnologie,

waaronder polymeer nano-deeltjes en SPIONs, wordt de efficiëntie van actieve middelen met

slechte farmacokinetiek significant verbeterd. Naast een toename in efficiëntie, kan een

bezorgsysteem gebaseerd op nano-deeltjes de negatieve bijwerkingen van de actieve

middelen reduceren.

Deze theses bevestigt onze initiële hypothese dat het ontwerpen van bezorgsystemen op

nano-schaal zorgt voor een effectieve verbetering van de medicijn afgifte naar de lever,

aangezien de meerderheid van de nano-deeltjes, na een intraveneuze injectie, accumuleert in

de lever. Daarom, zoals gepresenteerd in deze theses, hebben deze nano-deeltjes veel

potentie als therapeutische behandelingen voor lever ziektes.

169

Appendix B – Ringkasan Bahasa Indonesia

Liver fibrosis yang dapat memburuk menjadi liver sirosis dan hepatocellular carcinoma (HCC)

merupakan salah satu masalah kesehatan utama yang berkembang saat ini yang

mempengaruhi jutaan orang di seluruh dunia. Masalah kesehatan global yang meningkat ini

berhubungan antara lain dengan infeksi virus hepatitis, gangguan metabolisme seperti

obesitas dan diabetes (non-alcoholic fatty liver disease, NAFLD) dan penyalahgunaan alkohol

(alcoholic liver disease, ALD). Pada liver yang luka secara persisten, terjadi inflamasi kronis

yang kemudian dapat berkembang menjadi fibrosis, yang selanjutnya berkembang menjadi

sirosis (gagal liver stadium akhir) dan/atau hepatocellular carcinoma (HCC).

Setelah terjaid kerusakan liver secara seluler, inflamasi liver dipicu oleh sel imun bawaan yang

diikuti oleh aktivasi dan infiltrasi sel imun, terutama monosit/makrofag, yang menyebabkan

inflamasi liver secara kronis. Inflamasi hati memicu terjadinya proliferasi, aktivasi, dan trans-

diferensiasi hepatik stellate cells (HSCs) menjadi miofibroblas yang mensekresi protein matriks

ekstraseluler dalam jumlah berlebihan, terutama kolagen, yang mengakibatkan kekakuan

jaringan dan distorsi arsitektur liver yang disebut liver fibrosis yang selanjutnya berkembang

menjadi liver sirosis (disfungsi liver) dan berkembang memicu terjadinya kanker.

Meskipun prevalensi penyakit liver meningkat sangat tajam, sayangnya belum ada obat yang

telah disetujui secara klinis tersedia untuk pengobatan penyakit-penyakit liver tersebut.

Penghentian penyebab yang memicu terjadinya penyakit liver misalnya dengan berhenti

minum alkohol, modifikasi gaya hidup seperti diet sehat dan olahraga (penurunan berat

badan), dan pemantauan rutin fungsi liver dianjurkan untuk pasien dengan penyakit liver

akut/awal (liver fibrosis). Transplantasi liver adalah satu-satunya pilihan yang tersedia saat ini

dalam kasus gagal liver stadium akhir (liver sirosis). Karena kurangnya donor hati yang cukup,

obat imunosupresif seumur hidup, biaya yang tinggi dan masalah terkait lainnya, transplantasi

liver digunakan hanya untuk sebagian kecil pasien. Oleh karena itu, ada kebutuhan mendesak

untuk mengembangkan pengobatan untuk penyakit liver akibat penumpukan lemak dan

penyakit liver fibrotik.

Makrofag dan hepatic stellate cells (HSCs) diketahui memainkan peranan penting dalam

perkembangan penyakit liver, baik selama cedera liver akut maupun kronis. Oleh karena itu,

di dalam tesis ini, kami mengembangkan dan menginvestigasi pendekatan terapeutik baru

170

yang menargetkan makrofag dan HSCs. Seperti yang dirangkum dalam bab 1 , kami meneliti

kegunaan senyawa baru dan pendekatan terapi berbasis nanopartikel untuk mencapai tujuan

ini.

Pada studi pendahuluan, kami menggunakan profiler-array, yang diaplikasikan pada sel RAW

264,7 murine. Selanjutnya dilakukan analisis ekspresi gen diferensial untuk makrofag M0 yang

tidak distimulasi, makrofag M1 pro-inflamasi yang distimulasi menggunakan lipopolisakarida

(LPS)/interferon gamma (IFNg) dan makrofag M2 anti-inflamasi yang distimulasi dengan

interleukin (IL)-4/IL-13. Hasil profiler-array tersebut, kami menemukan bahwa spleen tyrosine

kinase (SYK) diregulasi sangat tinggi di dalam makrofag M1, terdapat 17 gen yang diregulasi

dalam makrofag M1. Fenomena ini juga dibahas dalam tinjauan literatur kami (bab 2), di mana

kami menggambarkan dan mendiskusikan peran jalur pensinyalan SYK pada penyakit liver.

Review ini menunjukkan bahwa SYK sangat diekspresikan pada penyakit liver, dan bahwa

ekspresi SYK dan aktivasi jalur pensinyalannya berkorelasi dengan tingkat keparahan penyakit

pada berbagai etiologis penyakit liver termasuk hepatitis virus (B dan C), non-alcoholic

steatohepatitis (NASH), ALD, sirosis hati, dan HCC. SYK diketahui diekspresikan secara luas

dalam hepatosit, makrofag hati, dan HSC yang teraktivasi. Kami selanjutnya memberikan

gambaran tentang berbagai inhibitor SYK yang telah/dapat dieksplorasi untuk pengobatan

penyakit liver. Kami juga telah mengkaji keterbatasan penggunaan inhibitor SYK misalnya,

farmakokinetik yang buruk (inhibitor bermolekul kecil) dan efek samping akibat keterlibatan

SYK dalam fungsi seluler normal, dan aplikasi penargetan inhibitor SYK menggunakan

nanopartikel pada masa yang akan datang.

Pada bab 3, merujuk pada hasil yang diperoleh dari profiler-array, kami mengeksplorasi efek

inhibitor SYK bermolekul kecil, R406 (tanpa dan dengan nanopartikel) secara in vitro dan in

vivo. Seperti yang sudah ditunjukkan sebelumnya oleh peneliti lain, kami menemukan korelasi

positif antara ekspresi SYK dengan patogenesis NASH dan hepatitis alkoholik pada pasien.

Tetapi tidak diperlihatkan seperti sebelumnya, kami mengamati bahwa ekspresi SYK secara

khusus diinduksi dalam makrofag pro-inflamasi yang berdiferensiasi M1. Setelah pengamatan

ini, kami meneliti implikasi jalur SYK dalam makrofag dan menemukan bahwa penghambatan

jalur SYK menggunakan R406 mengakibatkan penghambatan marker inflamasi yaitu

pelepasan nitrit oksida (NO), dan peningkatan ekspresi gen IL- 1 , FcgR1, iNOS , CCL2 , IL-6, dan

CCR2, pada dosis yang berkaitan.

171

Berdasarkan penghambatan signifikan jalur SYK oleh R406 dalam makrofag M1 (pro-inflamasi)

dan untuk mengatasi keterbatasan senyawa R406 seperti yang disebutkan di atas, kami

mengenkapsulasi obat ini ke dalam nanopartikel poly lactic-co-glycolic acid (PLGA). PLGA

dipilih karena mempertimbangkan factor biodegradabilitas, biokompatibilitas, dan fakta

bahwa PLGA merupakan polimer yang telah disetujui oleh food and drug administration (FDA).

Setelah melakukan karakterisasi ekstensif terhadap nanopartikel R406-PLGA, kami

mengevaluasi efektivitas nanopartikel R406-PLGA dalam makrofag sel RAW yang dikultur dan

bone marrow derived macrophage (BMDM) secara in vitro yang terpolarisasi menuju fenotipe

M1. Kami menemukan bahwa baik nanopartikel R406-PLGA maupun R406 itu sendiri dapat

secara signifikan menghambat ekspresi beberapa gen penanda inflamasi secara in vitro. Dalam

penelitian in vivo berikutnya, menggunakan model tikus NASH diet methylene-coline

deficiency (MCD), kami mendapati bahwa nanopartikel R406-PLGA secara signifikan

memperbaiki inflamasi hati, fibrosis, dan steatosis jika dibandingkan dengan R406 bebas. Kami

menyimpulkan bahwa nanopartikel R406-PLGA dapat menjadi salah satu pendekatan yang

menjanjikan untuk pengobatan NASH. Namun demikian, penelitian lebih lanjut pada model

tikus yaitu model diet barat dan/atau model Stelic Animal Model (STAM), yang lebih mirip

dengan situasi klinis NASH, diperlukan.

Berkaitan kedekatan jalur SYK dengan jalur SRC kinase, kami kemudian mengeksplorasi

keterlibatan dan peran jalur SRC kinase pada penyakit liver pada bab 4. Kami mengkonfirmasi

bahwa gen Src diregulasi sangat tinggi dalam jaringan hati manusia yang diperoleh dari pasien

dengan kondisi NASH, hepatitis alkoholik, sirosis, dan biliary atresia. Kami juga mengamati

bahwa gen Src diregulasi sangat tinggi dalam sel makrofag RAW 264,7, murine BMDM, dan

marrow-derived macrophage (MDM) manusia, ketika dipolarisasi ke fenotipe M1 masing-

masing. Untuk penelitian lebih lanjut tentang peran jalur SRC kinase dan manfaat potensial

terapeutik dari penghambatan jalur ini, kami menggunakan inhibitor SRC kinase bermolekul

kecil selektif, KX2-391.

KX2-391 menghambat fosforilasi SRC, SYK dan secara signifikan mengurangi pelepasan NO

dalam sel makrofag RAW. Selain itu, analisis ekspresi gen dalam sel makrofag RAW dan BMDM

membuktikan bahwa penghambatan jalur SRC yang dimediasi oleh KX2-391 melemahkan

ekspresi gen penanda inflamasi yang berbeda termasuk iNOS, CCL2, dan FcgR1. Selain itu,

dalam model precise-cut liver slices (PCLS), KX2-391 menurunkan ekspresi gen SRC, iNOS, dan

172

CCL2 tanpa mempengaruhi viabilitas sel/jaringan. Selain itu, KX2-391 melemahkan akumulasi

lipid hepatositik; aktivasi, kontraktilitas, dan ekspresi kolagen yang diinduksi TGFβ pada HSCs.

Selanjutnya, kami menginvestigasi relevansi jalur SRC di dalam NASH dan alcoholic

steatohepatitis (ASH) menggunakan model tikus NASH diet MCD dan model tikus Lieber-De

Carli ALD. Hasilnya menunjukkan bahwa KX2-391 melemahkan inflamasi, fibrosis, dan

steatosis pada model tikus NASH dan ASH. Studi mekanistik lebih lanjut mengungkapkan

bahwa SRC memediasi efek melalui jalur FAK/PI3K/AKT.

Oleh karena itu, kami mengusulkan bahwa menghambat jalur SRC kinase menggunakan

inhibitor seperti KX2-391 memiliki potensi tinggu untuk pengobatan penyakit hati seperti

NASH dan ALD. Inhibitor SRC kinase KX2-391 juga sangat menjanjikan untuk diteliti sebagai

potensial terapi untuk penyakit kronis lainnya termasuk kanker.

Pada bab 5, kami berfokus pada pentargetan HSCs untuk menghambat fibrosis. Terkait

tingginya ekspresi reseptor fibroblast growth factor 1 (FGFR1) pada HSCs yang diaktifkan, kami

memutuskan untuk menggunakan FGF basic (FGF2) untuk menghambat aktivasi HSCs. Kami

mengamati bahwa FGF2 mampu menghambat aktivasi HSCs yang diinduksi TGFβ (dikonfirmasi

dengan pengurangan ekspresi kolagen-I dan α-SMA), migrasi HSCs (dikonfirmasi oleh uji

penyembuhan luka) dan kontraksi HSCs (dikonfirmasi oleh uji kontraksi gel 3D). Hasil ini

menjadi dasar untuk penelitian lanjut kami, di mana kami mengkonjugasikan FGF2 ke

superparamagnetic iron oxide nanoparticles (FGF2-SPIONs) untuk meningkatkan stabilitas dan

waktu paruh FGF2 sehingga meningkatkan kemanjuran terapi FGF2 untuk pengobatan fibrosis

hati. Selain meningkatkan kemanjuran terapeutik, konjugasi FGF2 dengan SPIONs juga

diharapkan diterapkan untuk tujuan terkait diagnostik karena sifat paramagnetiknya yang

dapat memberikan potensi theranostik. Setelah melakukan beberapa percobaan in vitro dan

in vivo, hasilnya menunjukkan bahwa potensi konjugat FGF2-SPIONs meningkat secara

signifikan dibandingkan dengan FGF2 bebas. Selain peningkatan kemanjuran terapi, kami juga

menyimpulkan bahwa konjugasi FGF2 dengan SPIONs dapat memberikan pendekatan

theranostik yang dipersonalisasi dengan gabungan terapi dan diagnosis untuk manajemen

penyakit yang dipersonalisasi. Namun, diperlukan lebih banyak penelitian untuk memvalidasi

temuan kami dan potensi teranostik FGF2-SPIONs pada model hewan fibrosis hati yang lebih

maju dan representatif.

173

Sebagai kesimpulan, pendekatan yang dijelaskan dalam tesis ini menjanjikan untuk

dieksplorasi lebih lanjut untuk pengobatan penyakit hati seperti fibrosis hati berbasis NASH

atau ALD. Dengan pendekatan nanoteknologi seperti nanopartikel polimer dan SPIONs,

kemanjuran senyawa aktif dengan profil farmakokinetik yang buruk dapat ditingkatkan secara

signifikan. Selain meningkatkan efikasi, sistem penghantaran nanopartikel juga dapat

mengurangi efek merugikan dari senyawa aktif tersebut. Karena, sebagian besar nanopartikel

yang diberikan akan terakumulasi dan dilokalisasi di hati setelah pemberian intravena ke

dalam tubuh, karya tesis ini menegaskan hipotesis awal kami bahwa desain sistem

penghantara nano dapat secara efektif meningkatkan penghantaran obat ke hati dan oleh

karena itu memiliki potensi besar untuk memperbaiki terapi penyakit hati seperti yang

disajikan dalam tesis ini.

174

Appendix C

List of Publications (from this thesis)

1. Dhadhang Wahyu Kurniawan, Gert Storm, Jai Prakash, Ruchi Bansal, “Role of spleen tyrosine kinase in liver diseases”, World Journal of Gastroenterology (2020); 26(10): 1005–1019. doi: 10.3748/wjg.v26.i10.1005. (Chapter 2)

2. Dhadhang Wahyu Kurniawan, Arun Kumar Jajoriya, Garima Dhawan, Divya Mishra, Josepmaria Argemi, Ramon Bataller, Gert Storm, Durga Prasad Mishra, Jai Prakash, Ruchi Bansal, “Therapeutic inhibition of spleen tyrosine kinase in inflammatory macrophages using PLGA nanoparticles for the treatment of non-alcoholic steatohepatitis”, Journal of Controlled Release (2018); 288: 227-238. https://doi.org/10.1016/j.jconrel.2018.09.004. (Chapter 3)

3. Dhadhang Wahyu Kurniawan, Richell Booijink, Arun Kumar Jajoriya, Garima Dhawan, Divya Mishra, Dorenda Oosterhuis, Josepmaria Argemi, Gert Storm, Peter Olinga, Ramon Bataller, Sujit Kumar Mohanty, Durga Prasad Mishra, Jai Prakash, Ruchi Bansal, “Src kinase as a potential therapeutic target in non-alcoholic and alcoholic steatohepatitis”, Clinical and Translational Discovery (2022); 2(1): e18. https://doi.org/10.1002/ctd2.18. (Chapter 4)

4. Dhadhang Wahyu Kurniawan, Richell Booijink, Lena Pater, Irene Wols, Aggelos Vrynas, Gert Storm, Jai Prakash, Ruchi Bansal, “Fibroblast growth factor 2 conjugated superparamagnetic iron oxide nanoparticles (FGF2-SPIONs) ameliorate hepatic stellate cells activation in vitro and acute liver injury in vivo”, Journal of Controlled Release (2020); 328: 640-652. https://doi.org/10.1016/j.jconrel.2020.09.041. (Chapter 5)

175

Appendix D – Acknowledgements

Alhamdulillahirobbil'alamin, verily, all praise to Allah Subhanahu wa ta'ala for all the

abundance of His blessings, mercy, grace, and guidance that I accomplished my PhD work at

the University of Twente. Only because of His help I could reach the finish line of my PhD, after

a long and tiring journey as people say about the PhD journey. Now I have to write this section,

one of the simplest parts but not really easy as I should remember pieces of memories that

no one missed being acknowledged.

First of all, I would like to express my big gratitude to Dr. Ruchi Bansal, the person who has

been the most meritorious to my PhD journey. Without you, probably I went back to Indonesia

after doing the qualifier exam, in the failed condition. You are like a fairy godmother to me,

during my PhD work. While I was still in Indonesia and interviewed via skype by you, to be

honest, I had not understood yet what is liver fibrosis, the theme that you proposed to me.

You guided me in the laboratory directly, trained me in skills on how to handle the cell lines,

and how to do research with them, something that I had not been done in Indonesia at all.

You coached me until I was capable to do experiments in molecular biochemistry, molecular

pharmacology, and molecular immunology, independently. After having the results of the

experiments, you taught me how to process and analyze the data to be meaningful numbers

and graphics, good to see, and easy to read. You led me to write 4 manuscripts which were

successfully published in prominent peer-review scientific journals, something that I did not

imagine before I arrived in the Netherland 6 years ago. Your time to supervise me is more than

24 hours per day even on the weekend, you were always available to answer my questions

and received my reports. You educated me about perfection achievement, great scientific

work, wonderful performance, and speed as well as accuracy in taking a decision. Really, what

I achieved at this moment is truly beyond my expectations, I will never forget your direction,

your spirit, and your challenges.

Meeting with Prof. Dr. Gert Storm in Jakarta on 6th of June 2015 changed my life. Although

you did not read my proposal and my CV completely, it doesn’t matter, the most important

you gave me the opportunity to continue to study in the Netherlands. Thank you, Prof, your

generosity brought me to the University of Twente. I always enjoyed our discussions and

talking with you from the first time we met until now. Your style really makes an impression

176

on me and greatly affects my style when interacting with my students. You are truly a great

professor with excellent expertise in academics and a cool communicator. Your reputation is

my inspiration.

Thanks to Prof. Dr. Jai Prakash, as one of my promotors, you always motivate and advised me

to finish my PhD work remarkably. I never forget your statement about writing a paper as well

as I can and publishing it in a highly reputable scientific journal. I have acquired a lot of

scientific mentoring from you.

My gratitude also goes to the members of my graduation committee Prof. Dr. H.B.J.

Karperien, Prof. Dr. A. Kocer, Prof. Dr. K. Poelstra, Prof. Dr. P. Olinga, and Prof. Dr. R.

Weiskirchen for your time, for evaluating my PhD thesis, and taking part in my PhD defense

ceremony.

After being confirmed I was accepted as a PhD student at the University of Twente, the first

Indonesian I contacted was Dwi Lestari. She is my senior in the School of Pharmacy ITB

Bandung. From her, I obtained a lot of information about Enschede. Thank you Mbak Dwi for

your services and your help. You always answered my questions and my requests patiently.

You and your family always gave a warm welcome when I and my family visited your house on

Haaksbergerstraat 234. We miss the nice memories between our families.

Many thanks to Jonas Schnittert, my long-time office mate in ZH253, for the talks, discussions,

and every day jokes. I really remember our early interactions when you were grumpy because

of my mistakes in doing the lab duties. After that, gradually we had good teamwork and we

were more closer to each other, even now though we can’t meet every day physically we keep

in contact via WhatsApp. Thanks for the lesson about the very professional life. Our

relationship for about 2.5 years become an inspirational story to my students and colleagues

in Indonesia.

Another colleague who was in the same office for a long-time period was Marcel Alexander

Heinrich. I often call him "Prof" because of his super talent and ability. As far as I can

remember, during my stay in the BST Department, you were the only master student who has

got 10 for the master's thesis. Your ability to research, excellence in art and creativity make

you a very complete academic figure. I always remember your style after doing something

great. As I predicted, you got cum laude for your PhD work and you truly deserve it. Thanks

177

Marcel, I wish that your style of doing research, data processing, and writing manuscripts can

be transferred to me. Having a comrade like you is my another my wish, I still have another

prediction for you and can’t wait to see that you will receive a Nobel prize in the future.

Another senior figure in the targeted therapeutics group is Praneeth Reddy Kuninty. When

we have a discussion, you always tried to give a solution to the results of my experiments.

Thank Praneeth, discussion with you really enlightened me, your solutions were practical and

applicable. We did not only discuss in the room, but anywhere and anytime, even one very

cool memory with you is a discussion while pedaling a bicycle. I don’t know when we will have

a discussion again while riding a bicycle.

After Jonas graduated, Ahmed Mostafa came as a new PhD student and was sitting at the

desk next to me. Thank you for all the talks and chats about the PhD research as well as the

pharmaceutical worldwide topic. Thanks for your willingness to be my paranymph for my PhD

defense.

I am immeasurably grateful for the support system of the Artificial Organ and Bioengineering

Therapeutics/AOT Department (formerly BST Department). Thank you so much Karin

Hendriks, your service and dedication will not be repaid by me. From Indonesia to Netherlands

and from Netherlands to Indonesia, you have always supported me and was always responsive

to my questions and my requests. Hopefully, God rewards your kindness with multiplied

goodness. Thanks to Hetty ten Hoopen who very patiently and painstakingly supported the

continuity of my research, helped me with the UHPLC analysis, and for all the help during my

PhD project. If you want to visit your uncle’s grave in Indonesia just contact me. Thanks to

Marc Ankone for the very valuable discussion and information regarding our research in the

laboratory, and also for the full of insightful talks. Thank Lydia Bolhuis for organizing, and

distributing lab work very well.

The early weeks of my PhD days were almost always accompanied by Deby and Büsra Ozturk

in the laboratory. Thanks for the accompanying me and supporting me while preforming basic

molecular experiments in the lab.

After you (Büsra) finished your internship, you joined as a research assistant with Ruchi in

2018-2019 period. During this period, we were working together doing in vitro and in vivo

178

experiments. Thank Büsra for the discussion and cooperation, good luck with your life and

your future career.

Thanks to Richell Booijink, the longest partner in the group of liver research supervised by

Ruchi. It’s very pleasing to have a partner like you and work together with you since you were

a Master student. Also big thanks for your help in translating summary of my PhD thesis into

Nederlandse samenvatting. I wish you lots of success with your PhD work!

Thanks to Lena Heinrich (Pater) for the teamwork in the laboratory and for the very helpful,

friendly, and warm attitude. Your picture with Marcel when visiting my baby at my home is

stored neatly in our album.

For my Dutch friend in the department, Thijs Pasman, thank you for the unofficial course

about the Netherlands’ life and culture. Your warmness and jokes will always stay in my deep

memory.

Thanks to Tushar Satav and Tao Lu, two Post-Doctoral colleagues in the targeted therapeutics

research group. Discussion with both of you about working, research, and laboratory is almost

never-ending.

For fellow Dutch colleagues, Albert Jan, a football lover, thank you for the football coaching.

Also for your devour when eating the Indonesian foods. Good luck with your career and your

life!

To Franck Assayag, thank you for offering your apartment in Paris. Staying in your apartment

during the holiday together with my family was very helpful, imagine how many euros I would

have spent if we rented an apartment ourselves.

Thanks to Aysun, Denys, Natalia, Ilaria, Odyl, Iris, Karin Postma, Kasia, Chao, Pia, Aga, Bas,

Duco, Jia Liang, Kim, and Mike for togetherness in the BST Department. Also thanks to Eline,

Eshwari, Alex, Ana, Andreas, and Hilde for togetherness in the liver research group supervised

by Ruchi.

Hero Marhaento and his wife Astuti, our closest neighbor in the Pathmos area, thank you for

warmth, intimacy, kinship, and everything that makes us is like living in Yogyakarta. You also

often to be a lunch partner on the red sofa in the Zuidhorst Building and pray together around

campus. Discussion with you about PhD was always a pleasure even until we’re back in

179

Indonesia still continued. Thank you and an apology to you, if I was often troublesome to you

and your family.

Big thanks to Aulia Akbar for your assistance to drop and pick-up Ghazy goes to school when

I went to Indonesia in November 2017. Our talks on the train provided me with more insights

into life. Good luck with your career after your PhD!

Thanks to Taufiq Arifin, Sunu Widianto, and Ridwan Saptoto for the place of sholat. Instead

of going to Vriehof quite far, sholat in Mushola Taufiq then changed to Musholla Ridwan to be

a good option.

For Kunaifi, Pesi, Nova, Aji, Diah, Khafidz, Habib, Dwi Mandaris, Nico, Jarot, Krishna Aryanto,

Andri, Rizal, Irena, Heksi, Nissa, Abdul Rahman, Wibi, Imam, Yan, Muthia, Rindia, Andani,

Nisa, Yasmin, and all of PhD students from Indonesia who works at the University of Twente,

thank you for everything. Discussions, jokes, and kinship all of you will always chill and I hope

will be a spirit of collaboration to contribute to our beloved homeland, Indonesia Raya.

For the group of the February 2016 intake, including Akbar Aryanto, Aditya Fernando, Rheza,

Bima, Yasir, Aden, Hana, Ratri, Kania, Siti, etc thank you for the teamwork and your warmth.

Still remember at the beginning of our arrival at Enschede we eat together with all of you,

frequently. Especially Mas Akbar, thank you for already willing to accommodate me for a week

before I moved to the new rent house.

Deden Noor Rahman as chief of LPDP UT awardee when my first-time arrival at Enschede,

thank you for subletting your room for a week, while I occupy the housing facilitated by the

University of Twente. Thanks to all of LPDP Enschede awardees for all of your kinship.

To Iqbal Yulizar Mukti, a chief of LPDP UT awardee recently, thanks a lot for your willingness

to be one of my paranymphs in my PhD public defense.

Thanks to Yosia, Adi, Arif, Laksamana, Giri, Wildan, Ega, Ilus, Niswa, Dzulqornaen, Fauzan,

Fajar Eko, and all of PPI Enschede's volunteers who have always been compact and passionate

about guard kinship and the Indonesian atmosphere in Enschede.

Edi Trihartono and Kamia Handayani, a couple of husband and wife along with his family,

became the first Indonesian neighbors for our stay at Oosveenweg 86. Thank a lot for

everything, hopefully, sometime we will meet again warmly in Indonesia.

180

For Kartika Ratna Pratiwi, Erlis Saputra, Agung Budiono (deceased), Hakim, Afif, Didik

Setiawan, Mas Azis, Mbak Ary, Iwan Suharyanto, Karim, Pugo, Adityo, and all members of

Kagama NL, thank you for the kinship. Memories of KMF (kumpul-kumpul, makan-makan,

foto-foto) become sweet memoriest to be always remembered. With Kagama NL members

we are truly feel friendly atmosphere, guyup, rukun, and migunani.

For Amalia Muhaimin and Zulfan Zazuli, thank you for coming to Enschede and helping

prepare menus, food, drink, and everything to celebrate aqiqah of our baby. For Amalia and

Joko Mulyanto, I hope we keep going collaborating to make Unsoed much better.

Meeting with Adhyatmika and Ivan Surya Pradipta for the first time physically in the

Netherlands, I have a familiar feeling directly to both of you. This happens probably because

we have the same background in the pharmacy field. Thank you for your hospitality while I do

research experiments at the University of Groningen.

Dear Muslim colleagues affiliated with IMEA, thanks for the friendship for about 4 years at

Enschede. With IMEA, we still have an atmosphere of Ramadhan, Eid Fitri, and Eid Adha like

in Indonesia, even though we are living in the Netherland. The technical help and spirits of Bu

Sophie, Mbak Enung, Mbak Ely, Mbak Sifa, Mbak Ranny, Mbak Pipit, Mbak Wenny, and other

ladies to my family really make us touched and happy, even until approaching our return to

Indonesia. Big thanks IMEA- ers.

Thanks to Raymon, Ambar, Bu Ria, Pak Bambang, Fajar Sidiq, Monika, Fiki, Charles, Dewi,

and all members of Paguyuban IA ITB the Netherlands. Our togetherness and kinship are very

memorable, although only a few years.

Another community and place in the Netherlands that we will always remember, namely SGB

Utrecht. There we met noble-hearted people, thanks to Pak Gustiandi, Pak Supardi, and Pak

Dian, the trio who is well known as the sovereign of SGB Utrecht. Thank Pak Deden, because

of your network me and family can go for a walk around Europe and meet very kind-hearted

people. Thank Pak Makky for your reception during Fatih doing of UN in Den Haag. Thank Pak

Didin, the owner of Toko Nusantara, go to Den Haag is not complete before enjoying your

meal and drink, of course with the discount. Thank Pak Gunaryadi for your help during my

sons join in the SIDH Den Haag. To my very good senior at ITB, Pak Eko Hardjanto, thank you

very much for your goodness. Even until I’m back already in Indonesia I still bother you often.

181

Regardless, the struggling story in my PhD works at the University of Twente resulted from

the prayers of my mother Ibu Windrati and my mother-in-law Ibu Titiek Ekowati. Your prayers

every time is accepted and ijabah by Allah SWT. Thanks Moms, really, I cannot repay prayers

from you, may Allah reward your prayers with a lot of goodness in the world and the hereafter.

My thanks to my sons Fatih, Ghazy, and Rafid, who became my spirit, inspiration, and soul.

To Fatih, I'm sorry to have made your school move around, hopefully, the story of your

changing school would have added experience and enhanced your fight to reach your goal. To

Ghazy, though your first formal school in the Netherlands, always keep your spirit for go on

and on spirit go to school realize your dreams. To my little one who was born in Enschede, I

hope your childhood memories could motivate you and deliver you reach anything you want.

The last and the ultimate of everything, especially half of my soul dear beloved wife

Yudyawati, thank you have together me in all conditions, joy and sorrow. Besides moan sigh

to Allah SWT, to you my wife I tell all my feelings. Sorry if almost every day I outpour my heart

to you. Without you, maybe I am not able to complete this PhD journey. Your patience, your

attention, your love, and your maturity become my spirit for always being optimistic and

enthusiastic to finish the PhD story. May Allah continue together us and always present

happiness in our family.

182

Appendix E – About the Author

Dhadhang Wahyu Kurniawan was born on March 21st, 1979, in

Lamongan, East Java, Indonesia. He graduated bachelor and

pharmacist (Apotheker) from the School of Pharmacy Institut

Teknologi Bandung (ITB), Indonesia. He got married to his

lovely wife, Yudyawati (Iyut), and has three sons, Fatih, Ghazy,

and Rafid.

From May 2003 until March 2005, he worked as a Production

Supervisor at PT Hexpharm Jaya Laboratories (Kalbe Farma

holding company). In April 2005, he worked as a Formulation (Research and Development)

Senior Supervisor at PT Guardian Pharmatama. Then, from September 2005 until April 2006,

he worked as a lecturer at the Faculty of Pharmacy Universitas Pancasila (UP), Jakarta,

Indonesia. Since April 2006, he is a lecturer and researcher at the Department of Pharmacy

Universitas Jenderal Soedirman (Unsoed) Purwokerto, Indonesia. He became a student affairs

secretary at the Department of Pharmacy Unsoed from 2007 until 2009. In September 2011,

he graduated Master of Pharmacy from the Faculty of Pharmacy Universitas Gadjah Mada

(UGM) Yogyakarta, Indonesia. One year later, he became a general secretary at the

Department of Pharmacy Unsoed from 2012 until 2013. Then, he became the head of the

Department of Pharmacy, Faculty of Health Sciences Unsoed from 2013 until 2015.

At the end of 2015, he decided to resign as the head of the department to continue his study

at the University of Twente, the Netherlands. His PhD study was funded by the Indonesia

Endowment Fund for Education (Lembaga Pengelola Dana Pendidikan/LPDP), Ministry of

Finance Indonesia.

After finishing his PhD, he returned to Unsoed to continue his career in academia.

targeting of macrophages and hepatic stellate cells for the ...

Documents

Transcript of targeting of macrophages and hepatic stellate cells for the ...