Switching Antibiotics Production On and Off in Actinomycetes by an IclR Family Transcriptional...

August 2014⎪Vol. 24⎪No. 8

J. Microbiol. Biotechnol. (2014), 24(8), 1065–1072http://dx.doi.org/10.4014/jmb.1403.03026 Research Article jmbReview

Switching Antibiotics Production On and Off in Actinomycetes by anIclR Family Transcriptional Regulator from Streptomyces peucetiusATCC 27952Amit Kumar Chaudhary1, Bijay Singh1, Sushila Maharjan1, Amit Kumar Jha1, Byung-Gee Kim2, and

Jae Kyung Sohng1*

1Institute of Biomolecule Reconstruction, Department of Pharmaceutical Engineering, Sun Moon University, Asan 336-708, Republic

of Korea2School of Chemical and Biological Engineering, Institute of Molecular Biology and Genetics, Seoul National University, Seoul 151-

744, Republic of Korea

Introduction

Actinomycetes are the major sources of numerous

biologically active compounds with potential medical and

industrial value [5]. The lifespan of Streptomyces, belonging

to the phylum Actinobacteria, has a complex life cycle [3, 4,

8]. The production of secondary metabolites is regulated by

pathway-specific regulators that are generally located

within the biosynthetic gene cluster in the genome [1, 10,

31]. The expression of these specific regulators linked to the

biosynthetic pathways is directly or indirectly controlled

by positive regulators, such as AfsS [13] and AtrA [34], and

by negative regulators, AbsA1 [19] and PhoP [28]. Most

often, the transcriptional regulators receive signals related

to variations in temperature, nutrients availability, cell

crowding, or toxic molecules, triggering the necessary

metabolic adjustments to adapt to the environmental

conditions [2, 12, 30].

Streptomyces coelicolor is used as the model strain to study

morphological and metabolic differentiation in relation to

Received: March 11, 2014

Revised: April 24, 2014

Accepted: April 24, 2014

First published online

April 30, 2014

*Corresponding author

Phone: +82-41-530-2246;

Fax: +82-41-544-2919;

E-mail: [email protected]

upplementary data for this

paper are available on-line only at

http://jmb.or.kr.

pISSN 1017-7825, eISSN 1738-8872

Copyright© 2014 by

The Korean Society for Microbiology

and Biotechnology

Doxorubicin, produced by Streptomyces peucetius ATCC 27952, is tightly regulated by dnrO,

dnrN, and dnrI regulators. Genome mining of S. peucetius revealed the presence of the IclR

(doxR) type family of transcription regulator mediating the signal-dependent expression of

operons at the nonribosomal peptide synthetase gene cluster. Overexpression of doxR in native

strain strongly repressed the drug production. Furthermore, it also had a negative effect on the

regulatory system of doxorubicin, wherein the transcript of dnrI was reduced to the maximum

level in comparision with the other two. Interestingly, the overexpression of the same gene

also had strong inhibitory effects on the production of actinorhodin (blue pigment) and

undecylprodigiosin (red pigment) in Streptomyces coelicolor M145, herboxidiene production in

Streptomyces chromofuscus ATCC 49982, and spinosyn production in Saccharopolyspora spinosa

NRRL 18395, respectively. Moreover, DoxR exhibited pleiotropic effects on the production of

blue and red pigments in S. coelicolor when grown in different agar media, wherein the

production of blue pigment was inhibited in R2YE medium and the red pigment was inhibited

in YEME medium. However, the production of both blue and red pigments from S. coelicolor

harboring doxR was halted in ISP2 medium, whereas S. coelicolor produced both pigmented

antibiotics in the same plate. These consequences demonstrate that the on and off production

of these antibiotics was not due to salt stress or media compositions, but was selectively

controlled in actinomycetes.

Keywords: Actinomycetes, doxR, iclR, negative regulator, pleiotropic, secondary metabolites

S

S

1066 Chaudhary et al.

J. Microbiol. Biotechnol.

antibiotic biosynthesis [4, 8]. S. coelicolor is usually known

to produce two major antibiotics, actinorhodin (blue

pigment) [18] and undecylprodigiosin (red pigment) [7],

generally controlled by the pathway-specific regulators

ActII-ORF4 [11] and RedD [31]. Moreover, RedD and ActII-

ORF4 are also homologous to DnrI, which activates all the

structural genes involved in doxorubicin biosynthesis in S.

peucetius. The biosynthesis of doxorubicin in S. peucetius is

tightly regulated by three transcriptional regulators, dnrO,

dnrN, and dnrI. The dnrO gene encodes a DNA binding

protein that binds specifically to the dnrN/dnrO promoter

region and activates dnrN [22]. DnrN protein binds

specifically to the DnrI promoter region [9] and activates

the transcription of the dnrI gene [21] and, in turn, DnrI

activates the transcription of the doxorubicin biosynthesis

genes. Study reveals that disruption of any of these

regulatory genes leads to complete blockade of doxorubicin

production in this strain [22].

Among the transcriptional regulators, the members of

isocitrate lyase regulator (IclR) family have been found to

play important roles in diverse biological processes in

streptomycetes. For example, AreB modulates leucine

biosynthesis, and cephamycin C and clavulanic acid

production in S. clavuligerus [25]; SsgR is developmentally

regulated in S. coelicolor and activated towards the onset of

sporulation [32]; NdgR plays pleiotropic roles in amino acid

metabolism, quorum sensing, morphological changes, and

antibiotic production in S. coelicolor [38]; and HpdR plays a

significant regulatory role in both tyrosine catabolism and

calcium-dependent antibiotic biosynthesis in S. coelicolor

[37]. In this study, we have identified doxR of the IclR type

family regulator at the nonribosomal peptide synthetase

(NRPS) gene cluster from the Streptomyces peucetius ATCC

27952 genome and described its role on antibiotics

productions in Streptomyces peucetius ATCC 27952, Streptomyces

coelicolor M145, Streptomyces chromofuscus ATCC 49982, and

Saccharopolyspora spinosa NRRL 18395.

Materials and Methods

Bacterial Strains, Plasmids, and Media

The bacterial strains and plasmids used in this study are listed

in Table 1. Streptomyces strains were cultivated in R2YE and ISP2

media [14, 15] at 28°C for plasmid or genome isolation, protoplast

preparation, transformation, and regeneration. To observe the

antibiotics production, R2YE, ISP2, or YEME medium was used

for S. peucetius and S. coelicolor, whereas production medium

(Glucose: 45% added after autoclave; yeast extract: 1.4%; soybean

meal: 0.25%; NaCl: 0.01%; and soybean oil: 0.5%) and medium

6A6 [14] were used for S. spinosa and S. chromofuscus, respectively.

E. coli XL1 Blue MRF (Stratagene) and E. coli ET 12567 [17] were

used for routine subcloning and demethylating host, respectively.

When necessary, ampicillin, chloramphenicol, and tetracycline

were used at a final concentration of 100, 100, and 25 µg/ml for

the selection of recombinants [25]. pGEM-T Easy vector (Promega)

and pIBR25 [29] were used as subcloning and multicopy expression

vectors, respectively.

Construction of Recombinant DNAs (rDNAs) and Strains

A pair of primers, listed in Table 2, was designed to amplify the

Table 1. List of plasmids, rDNAs, and strains used in this study.

Plasmid or Strain Description Source/Reference

Plasmids/rDNAs

pGEM-T Easy E. coli cloning vector, ampr Promega

pIBR25 E. coli-Streptomyces shuttle vector, ermE* promoter, ampr, tsrr [29]

pIR25 pIBR25 expression vector with the doxR gene This study

Strains

S. peucetius ATCC 27952 Doxorubicin producer ATCC

S. peucetius DM07 Doxorubicin non-producer [27]

S. coelicolor M145 Actinorhodin and undecylprodigiosin producer [15]

S. peucetius DR10 S. peucetius harboring pIR25 This study

S. peucetius DR11 S. peucetius DM07 harboring pIR25 This study

S. coelicolor DR12 S. coelicolor harboring pIR25 This study

S. chromofuscus 123 S. chromofuscus harboring pIR25 This study

S. spinosa 123 S. spinosa harboring pIR25 This study

E. coli XL1 Blue MRF Cloning strain Stratagene

E. coli ET 12567 DNA demethylating strain (dam- dcm- hsdS cmr) [17]

Switching Antibiotics Production On and Off in Actinomycetes 1067


doxR gene (GenBank: JQ814785) to express in streptomycete. The

PCR product was cloned into pGEM-T Easy vector prior to

sequencing. The correct clone of doxR was cloned into pIBR25

vector to generate rDNA pIR25. The pIR25 was transformed into

S. peucetius ATCC 27952, S. peucetius DM07, S. coelicolor M145,

S. chromofuscus ATCC 49982, and S. spinosa NRRL 18395 by the

protoplast method to generate S. peucetius DR10, S. peucetius

DR11, S. coelicolor DR12, S. chromofuscus 123, and S. spinosa 123,

respectively [15]. The vector pIBR25 was also transformed into

these streptomycetes to construct S. peucetius IBR, S. coelicolor IBR,

S. chromofuscus IBR, and S. spinosa IBR, respectively, for control

experiments.

Determination of Doxorubicin, Actinorhodin, Undecylprodigiosin,

Herboxidiene and Spinosyn Production

In order to evaluate doxorubicin production, S. peucetius, S.

peucetius DR10, S. peucetius DR11, and S. peucetius IBR were

cultured on R2YE agar and liquid medium at 28°C for 2-7 days.

The doxorubicin was extracted and analyzed as previously

described [27]. In the same way, S. coelicolor, S. coelicolor DR12 and

S. coelicolor IBR were cultured on R2YE, ISP2, or YEME agar and

liquid medium at 28°C for 2-7 days. The blue and red pigments

were extracted and analyzed as previously described [35].

Furthermore, to analyze the production of herboxidiene, the

fermentation product was isolated after 8 days of culture and

analyzed as previously described [14]. Similarly, to analyze the

production of spinosyn, 1 ml of culture supernatant was taken

from the production medium (Glucose: 45% added after

autoclave; yeast extract: 1.4%; soybean meal: 0.25%; NaCl: 0.01%;

and soybean oil: 0.5%) and mixed with double the volume of

acetonitrile after 7 days of culture, vortexed, and then centrifuged

to collect the supernatant. The resulting filtrate was analyzed on a

C18 reversed-phase HPLC column under isocratic condition at

245 nm using acetonitrile: methanol: 2% ammonium acetate buffer

(2:2:1 (v/v/v)) as the mobile phase.

Isolation of Total RNA and Reverse Transcription Polymerase

Chain Reaction (RT-PCR)

An Rneasy Mini kit (Qiagen, USA) was used for total RNA isolation

[6]. The program for reverse transcription was carried out at 50°C

for 30 min and followed by PCR using the gene-specific primer

pairs as listed in Table 2. Negative controls were carried out with

Taq DNA polymerase without reverse transcriptase to confirm

that the amplified products were derived from RNA rather than

DNA. The 16S rRNA gene was used as a positive control.

Results

Identification of IclR Family of Transcriptional Regulator,

doxR in Streptomyces peucetius ATCC 27952

S. peucetius ATCC 27952 is a producer of the antitumor

drugs daunorubicin and doxorubicin. Genome sequencing

of S. peucetius ATCC 27952 has been accomplished in our

lab (unpublished data), disclosing more than 20 secondary

metabolite gene clusters and a large numbers of regulatory

genes in its genome. Among them, the doxR gene belonging

to the IclR family of transcriptional regulator was located

within the NRPS gene cluster (Fig. 1). The characteristic

features of IclR-family members are the presence of an N-

terminal helix-turn-helix DNA binding domain and the

effector binding C-terminal domain [16, 39]. In general,

IclR protein binds specifically to DNA sequences of

promoters or operators [11, 20]. Usually, the gene for the

IclR-type regulator lies upstream of its target gene cluster

and is transcribed in the opposite direction [33]. However,

the direction of transcription of doxR is the same as of its

adjacent genes, as shown in Fig. 1. Furthermore, amino

acid sequence alignment revealed that DoxR has 55%

identity with AvmR (S. avermitilis MA 4680), 54% with

NdgR (S. coelicolor A3 (2)), and 55% with AreB (S. clavuligerus

ATCC 27064) as shown in Fig. 2.

Overexpression of doxR Inhibits Doxorubicin Production

and Its Regulators in Streptomyces peucetius ATCC 27952

S. peucetius ATCC 27952 produces red color antibiotics on

ISP2 medium in 2 days. However, when doxR was

overexpressed, the red phenotype was lost (Figs. S1A and

S1B). Not only this, but the production of doxorubicin from

S. peucetius DR10 was not observed on ISP2 plate even when

incubated for 7 days. Consistently, the inhibitory effect of

doxR on doxorubicin production was not affected by

the change in media composition (Figs. S1C and S1D).

Moreover, HPLC analysis of the extracts from S. peucetius

Fig. 1. Transcription direction of iclR in comparision with its

adjacent genes in S. clavuligerus (areB), S. avermitilis (SAV2687),

S. coelicolor (SCO5552), and S. peucetius (doxR).

The acpC and acpD genes show transcription in the same orientation

to the doxR gene.



DR10 showed almost complete loss of doxorubicin and

daunorubicin production (Fig. 3). Furthermore, to prove

that the biosynthesis of doxorubicin is mainly inhibited by

the binding of DoxR to the dnrI promoter, doxR was

overexpressed in S. peucetius DM07, retaining its yellow

phenotype. Moreover, HPLC analysis of the extracts from

S. peucetius DM07 and S. peucetius DR11 showed no

significant differences in the chromatogram (Fig. 3).

The regulators DnrO and DnrN in combination with

master regulator DnrI regulate the production of doxorubicin

Fig. 2. Amino acid sequence alignment of S. peucetius DoxR, using CLUSTALW, with S. avermitilis AvmR (SAV2687), S. coelicolor

NdgR (SCO5552), and S. clavuligerus AreB.

The protein sequence of S. peucetius DoxR is different from its homologues. Black shadow is perfact match and gray shadow is similar sequence.

Fig. 3. HPLC profile of antibiotic production from S. peucetius

ATCC 27952 (A), std. doxorubicin (B), std. daunorubicin (C),

S. peucetius DR10 (D), S. peucetius DM07, and (E) S. peucetius

DR11.

Each of two arrows is doxorubicin and daunorubicin.

Fig. 4. RT-PCR analyses of genes related to production of

doxorubicin and actinorhodin.

(A) RT-PCR analysis of expression of genes related to doxorubicin

production. DoxR protein binds specifically to the dnrI promoter

region and reduces the transcription of the dnrI gene. (B) RT-PCR

analysis of expression of genes related to actinorhodin and red

pigment production in S. coelicolor DR12.



in S. peucetius. Therefore, the expressions of these regulatory

genes were analyzed by RT-PCR. The RT-PCR analysis

showed no significant changes in the expression of dnrO

and dnrN; however, the expression of dnrI was strongly

inhibited after the overexpression of doxR in S. peucetius,

suggesting doxR could bind to the promoter element of dnrI

for elimination of drug production from the mutant on

different agar and liquid media (Fig. 4A).

Overexpression of doxR Inhibits Blue and Red Pigment

Production in Streptomyces coelicolor M145

S. coelicolor M145 produces blue and red pigments on

R2YE in 3 days. In an attempt to observe the effect of doxR

in this strain on blue and red pigment production, doxR

was expressed in the similar manner as above. When

S. coelicolor DR12 was grown on R2YE agar, the production

of blue pigment was inhibited completely, even after the

strain was grown for 6 days, whereas S. coelicolor M145 and

S. coelicolor IBR produced both the pigments within 3 days

of culture (Fig. 5A). Moreover, when these strains were

cultured in ISP2 agar medium, S. coelicolor M145 and

S. coelicolor IBR produced both blue and red pigments, but

S. coelicolor DR12 did not produce any pigments in the

same plate (Fig. 5B). On the contrary, both blue and red

pigments were produced by S. coelicolor M145 and

S. coelicolor IBR in YEME agar (Fig. 5C), but S. coelicolor

DR12 did not produce red pigment when cultured in

YEME agar medium (Fig. 5D).

Discussion

The ease of genome sequencing revealed several putative

regulatory genes in S. peucetius ATCC 27952. One of them,

doxR, belonging to a member of IclR-type family regulators

showing closest homology to areB, SAV2687, and SCO5552

(associated with leucine biosynthesis), was located in the

NRPS gene cluster of S. peucetius genome. Generally, these

genes lie upstream of its target gene cluster and are

transcribed in the opposite direction [33]; however, doxR

was transcribed in the same direction as its adjacent genes.

Whereas DoxR homologs contain either 238 or 239 aa,

DoxR contains 253 aa residues. Not only is the size of DoxR

longer, but the contents of amino acid residues are also

different from its homologs. Furthermore, these genes are

also responsible for connecting the primary and secondary

metabolism in certain bacteria [25, 38].

When doxR was overexpressed in S. peucetius, the red

phenotype due to doxorubicin production was converted

into yellow phenotype, suggesting its effect on biosynthetic

genes of doxorubicin rather than others. Usually, the

production of antibiotics is controlled by the pathway-

Fig. 5. Production of pigmented antibiotics by S. coelicolor

strains in different media.

(A) R2YE, (B) ISP2, and (C, D) YEME media. W, S. coelicolor M145;

M1, M2, and M3 are three different colonies of S. coelicolor DR12. The

control strain is not shown in the plates.



specific regulatory genes [10, 31]. Therefore, it was

anticipated that the targets of DoxR would be regulatory

genes rather than genes coding for structural proteins for

doxorubicin biosynthesis. To observe this, doxR was

overexpressed in S. peucetius DM07 that contains dnrO and

dnrN but lacks dnrI. The yellow phenotype of S. peucetius

DM07 did not change, indicating that DoxR has no

significant effects on the other regulatory genes in the

genome. Since deletion of dnrI blocks the doxorubicin

production [22], it was confirmed that the binding of DoxR

inhibits the dnrI expression, leading to blockade of

doxorubicin production. Since the production of doxorubicin

is regulated by the networking of dnrO, dnrN, and dnrI, we

analyzed the expression levels of these genes in S. peucetius

DR10 by RT-PCR. Although the expression levels of dnrO

and dnrN were almost same, the transcription level of dnrI

was markedly diminished. It was now obvious that DoxR

suppressed the network of doxorubicin regulators, which

in turn suppressed the drug production.

Interestingly, the expression of doxR in S. coelicolor

inhibited the biosynthesis of blue and red pigments in a

media-dependent manner (Table 3). Similar results were

observed where the production of two pigmented

antibiotics is differentially affected in S. coelicolor at high

salt concentration, with blue pigment being inhibited and

red pigment activated [26]. In our case too, it seemed that

the on and off productions of the pigmented antibiotics

were simply due to the effect of salt concentrations. To

overcome this condition, we cultured both S. coelicolor and

S. coelicolor DR12 in the same agar plate. Whereas S. coelicolor

produced both antibiotics on the medium, S. coelicolor DR12

exhibited a different pattern of antibiotics production. In a

simple ISP2 agar medium containing yeast extract, malt

extract, and glucose, both blue and red pigments were

inhibited by DoxR in S. coelicolor DR12, whereas S. coelicolor

produced both pigment antibiotics in the same agar

medium. In a lesser complex YEME medium, DoxR showed

the inhibition of red pigment production in S. coelicolor

DR12.

Both regulators, redD and actII-ORF4, are located in the

biosynthetic gene cluster of the red and blue pigments,

respectively. The expressions of actII-ORF4 and redD are

differentially affected during the differential production of

the two antibiotics of S. coelicolor [26]. Therefore, we

performed RT-PCR to observe the expression level of these

Table 3. Antibiotics produced by Streptomyces coelicolor strains

in different media.

Strains Media Blue pigment Red pigment

S. coelicolor DR12 R2YE – +

S. coelicolor DR12 YEME + –

S. coelicolor DR12 ISP2 – –

S. coelicolor M145 R2YE + +

S. coelicolor M145 YEME + +

S. coelicolor M145 ISP2 + +

Production (+); No Production (–).

Table 2. List of primers used in this study.

Genes Primer sequence (5’-3’) Primer name

doxR GCCTCTAGAGCACTTCTATCTGATGG A (XbaI)

ATTAAGCTTCAAGCTGCCACCGCTGCC (HindIII)

NR-F:

NR-B:

doxR GAACATATGAACGCCGCCGCGCAG

ATTAAGCTTCGTTCCCGCAAAGCCGGC

doxR-RT-PCR-F:

doxR-RT-PCR-B:

16S rRNA CCTTCGGGTTGTAAACCTCTTTCAGCA

CAACACCTAGTTCCCAACGTTTACGGC

16S rRNA-RT-PCR-F:

16S rRNA-RT-PCR-R:

dnrO ATGACCGAGACGCCATCCCGC

TCACCCGGCTGCTGGCCC

dnrO-RT-PCR-F:

dnrO-RT-PCR-R:

dnrN ATGACCATCCGAGTCGTG

TCAGATCCAGCCGGACAT

dnrN-RT-PCR-F:

dnrN-RT-PCR-R:

dnrI ATGTTGGGCCCGCTCGTC

TCAGGCAAGCGCGACGGA

dnrI-RT-PCR-F:

dnrI-RT-PCR-R:

actII-orf4 ATGAGATTCAACTTATTG

CGGGCCTCGCCAGAGATC

RT-PCR-F:

RT-PCR-R:

redD GTGGAAATCAACATATTG

TGGGTACTGCGCCACCAG

RT-PCR-F:

RT-PCR-R:



regulators in S. coelicolor DR12 grown in R2YE and YEME

agar media. There was no expression of actII-ORF4 in R2YE

medium and lower expression of redD in YEME medium

due to doxR expression in S. coelicolor (Fig. 4B). It was quite

interesting that the inhibition of production of one

antibiotic of S. coelicolor by DoxR in one medium was

relieved when transferred to another medium. These

consequences suggested that the presence of an unknown

inducer molecule in the medium releases DoxR from the

target site of inhibition for the expression of the biosynthetic

genes to produce the target antibiotic. Binding of small

inducer molecules to the TetR regulator causes conformational

changes in the conserved DNA binding region that result

in release of the repressor from its target site and thus

allow transcription of the adjacent genes [23]. Since the

promoter elements of redD and actII-ORF4 are quite

different, it was obvious that the regulation of antibiotics

production by DoxR will be definitely different in two

different media. However, in the case of the dnrI promoter

sequence, where it shares a consensus with each of the

promoter elements from both redD and actII-ORF4 (Fig. S2),

the two different mechanisms of inhibition by doxR might

exist to reduce dnrI expression. That is the reason why the

production of doxorubicin was inhibited by doxR in

S. peucetius in all three media used. Furthermore, we also

checked the effect of doxR in herboxidiene and spinosyn

production by Streptomyces chromofuscus ATCC 49982 and

Saccharopolyspora spinosa NRRL 18395 [14, 36]. Like S. peucetius

and S. coelicolor, we found a decrement in herboxidiene and

spinosyn titers in doxR-overexpressed strains.

Acknowledgments

This work was supported by a grant from the Next-

Generation BioGreen 21 Program (SSAC, grant no. PJ0094832),

Rural Development Administration, and by the Intelligent

Synthetic Biology Center of Global Frontier Project funded

by the Ministry of Education, Science and Technology

(2011-0031960), Republic of Korea.

References

1. Aceti DJ, Champness WC. 1998. Transcriptional regulation

of Streptomyces coelicolor pathway-specific antibiotic regulators

by the absA and absB loci. J. Bacteriol. 180: 3100-3106.

2. Bibb MJ. 2005. Regulation of secondary metabolism in

streptomycetes. Curr. Opin. Microbiol. 8: 208-215.

3. Challis GL, Hopwood DA. 2003. Synergy and contingency

as driving forces for the evolution of multiple secondary

metabolite production by Streptomyces species. Proc. Natl.

Acad. Sci. USA 100: 14555-14561.

4. Chater KF. 1993. Genetics of differentiation in Streptomyces.

Annu. Rev. Microbiol. 47: 685-713.

5. Chaudhary AK, Dhakal D, Sohng JK. 2013. An insight into

the –omics based engineering of streptomycetes for secondary

metabolite overproduction. Biomed. Res. Int. 2013: 1-15.

6. Chaudhary AK, Park JW, Yoon YJ, Kim BG, Sohng JK. 2013.

Re-engineering of genetic circuit for 2-deoxystreptamine (2-

DOS) biosynthesis in Escherichia coli BL21 (DE3). Biotechnol.

Lett. 35: 285-293.

7. Feitelson JS, Malpartida F, Hopwood DA. 1985. Genetic and

biochemical characterization of the red gene cluster of

Streptomyces coelicolor A3 (2). J. Gen. Microbiol. 131: 2431-

2441.

8. Flardh K, Buttner MJ. 2009. Streptomyces morphogenetics:

dissecting differentiation in a filamentous bacterium. Nat.

Rev. Microbiol. 7: 36-49.

9. Furuya K, Hutchinson CR. 1996. The DnrN protein of

Streptomyces peucetius, a pseudo-response regulator, is a

DNA-binding protein involved in the regulation of daunorubicin

biosynthesis. J. Bacteriol. 178: 6310-6318.

10. Gramajo HC, Takano E, Bibb MJ. 1993. Stationary-phase

production of the antibiotic actinorhodin in Streptomyces

coelicolor A3 (2) is transcriptionally regulated. Mol. Microbiol.

7: 837-845.

11. Gui L, Sunnarborg A, Pan B, LaPorte DC. 1996. Autoregulation

of iclR, the gene encoding the repressor of the glyoxylate

bypass operon. J. Bacteriol. 178: 321-324.

12. Hutchings MI, Hoskisson PA, Chandra G, Buttner MJ. 2004.

Sensing and responding to diverse extracellular signals?

Analysis of the sensor kinases and response regulators of

Streptomyces coelicolor A3 (2). Microbiology 150: 2795-2806.

13. Ishizuka H, Beppu T, Horinouchi S. 1995. Involvement of a

small ORF downstream of the afsR gene in the regulation of

secondary metabolism in Streptomyces coelicolor A3 (2).

Actinomycetologica 9: 37-43.

14. Jha AK, Lamichhane J, Sohng JK. 2014. Enhancement of

herboxidiene production in Streptomyces chromofuscus ATCC

49982. J. Microbial. Biotechnol. 24: 52-58.

15. Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA.

2000. Practical Streptomyces Genetics. John Innes Foundation,

Norwich, UK.

16. Lorca GL, Ezersky A, Lunin VV, Walker JR, Altamentova S,

Evdokimova E, et al. 2007. Glyoxylate and pyruvate are

antagonistic effectors of the Escherichia coli IclR transcriptional

regulator. J. Biol. Chem. 282: 16476-16491.

17. MacNeil DJ, Gewain KM, Ruby CL, Dezeny G, Gibbons PH,

MacNeil T. 1992. Analysis of Streptomyces avermitilis genes

required for avermectin biosynthesis utilizing a novel

integration vector. Gene 111: 61-68.

18. Malpartida F, Hopwood DA. 1986. Physical and genetic

characterisation of the gene cluster for the antibiotic



actinorhodin in Streptomyces coelicolor A3 (2). Mol. Gen.

Genet. 205: 66-73.

19. McKenzie NL, Nodwell JR. 2007. Phosphorylated AbsA2

negatively regulates antibiotic production in Streptomyces

coelicolor through interactions with pathway-specific regulatory

gene promoters. J. Bacteriol. 189: 5284-5292.

20. Negre D, Cortay JC, Old IG, Galinier A, Richaud C, Saint

Girons I, Cozzone AJ. 1991. Overproduction and characterization

of the iclR gene product of Escherichia coli K-12 and

comparison with that of Salmonella typhimurium LT2. Gene

97: 29-37.

21. Otten SL, Ferguson J, Hutchinson CR. 1995. Regulation of

daunorubicin production in Streptomyces peucetius by the

dnrR2 locus. J. Bacteriol. 177: 1216-1224.

22. Otten SL, Olano C, Hutchinson CR. 2000. The dnrO gene

encodes a DNA-binding protein that regulates daunorubicin

production in Streptomyces peucetius by controlling expression

of the dnrN pseudo response regulator gene. Microbiology

146: 1457-1468.

23. Ramos JL, Martínez-Bueno M, Molina-Henares AJ, Terán W,

Watanabe K, Zhang X, et al. 2005. The TetR family of

transcriptional repressors. Microbiol. Mol. Biol. Rev. 69: 326-

356.

24. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular Cloning:

A Laboratory Manual, 2nd Ed. Cold Spring Harbor Laboratory

Press, Cold Spring Harbor, New York.

25. Santamarta I, Lopez-Garcia MT, Perez-Redondo R, Koekman

B, Martin JF, Liras P. 2007. Connecting primary and

secondary metabolism: AreB, an IclR-like protein, binds the

AREccaR sequence of S. clavuligerus and modulates leucine

biosynthesis and cephamycin C and clavulanic acid production.

Mol. Microbiol. 66: 511-524.

26. Sevcikova B, Kormanec J. 2004. Differential production of

two antibiotics of Streptomyces coelicolor A3 (2), actinorhodin

and undecylprodigiosin, upon salt stress conditions. Arch.

Microbiol. 181: 384-389.

27. Singh B, Lee CB, Sohng JK. 2010. Precursor for biosynthesis

of sugar moiety of doxorubicin depends on rhamnose

biosynthetic pathway in Streptomyces peucetius ATCC 27952.

Appl. Microbiol. Biotechnol. 85: 1565-1574.

28. Sola-Landa A, Moura RS, Martin JF. 2003. The two-component

PhoR-PhoP system controls both primary metabolism and

secondary metabolite biosynthesis in Streptomyces lividans.

Proc. Nat. Acad. Sci. USA 100: 6133-6138.

29. Sthapit B, Oh TJ, Lamichhane R, Liou K, Lee HC, Kim CG,

Sohng JK. 2004. Neocarzinostatin naphthoate synthase: an

unique iterative type I PKS from neocarzinostatin producer

Streptomyces carzinostaticus. FEBS Lett. 566: 201-206.

30. Takano E. 2006. Gamma-butyrolactones: Streptomyces signaling

molecules regulating antibiotic production and differentiation.

Curr. Opin. Microbiol. 9: 287-294.

31. Takano E, Gramajo HC, Strauch E, Andres N, White J, Bibb

MJ. 1992. Transcriptional regulation of the redD transcriptional

activator gene accounts for growth-phase-dependent production

of the antibiotic undecylprodigiosin in Streptomyces coelicolor

A3 (2). Mol. Microbiol. 19: 2797-2804.

32. Traag BA, Kelemen GH, Van Wezel GP. 2004. Transcription

of the sporulation gene ssgA is activated by the IclR-type

regulator SsgR in a whi-independent manner in Streptomyces

coelicolor A3 (2). Mol. Microbiol. 53: 985-1000.

33. Tropel D, van der Meer JR. 2004. Bacterial transcriptional

regulators for degradation pathways of aromatic compounds.

Microbiol. Mol. Biol. Rev. 68: 474-500.

34. Uguru GC, Stephens KE, Stead JA, Towle JE, Baumberg S,

McDowall KJ. 2005. Transcriptional activation of the pathway-

specific regulator of the actinorhodin biosynthetic genes in

Streptomyces coelicolor. Mol. Microbiol. 58: 131-150.

35. Xu D, Seghezzi N, Esnault C, Virolle MJ. 2010. Repression

of antibiotic production and sporulation in Streptomyces

coelicolor by overexpression of a TetR family transcriptional

regulator. Appl. Environ. Microbiol. 76: 7741-7753.

36. Xue C, Duan Y, Zhao F, Lu W. 2013. Stepwise increase of

spinosad production in Saccharopolyspora spinosa by metabolic

engineering. Biochem. Eng. J. 72: 90-95.

37. Yang H, An Y, Wang L, Zhang S, Zhang Y, Tian Y, et al.

2010. Autoregulation of hpdR and its effect on CDA

biosynthesis in Streptomyces coelicolor. Microbiology 156: 2641-

2648.

38. Yang YH, Song E, Kim EJ, Lee K, Kim WS, Park SS, et al.

2009. NdgR, an IclR-like regulator involved in amino-acid-

dependent growth, quorum sensing, and antibiotic production

in Streptomyces coelicolor. Appl. Microbiol. Biotechnol. 82: 501-511.

39. Zhang RG, Kim Y, Skarina T, Beasley S, Laskowski R,

Arrowsmith C, et al. 2002. Crystal structure of Thermotoga

maritima 0065, a member of the IclR transcriptional factor

family. J. Biol. Chem. 277: 19183-19190.

Switching Antibiotics Production On and Off in Actinomycetes by an IclR Family Transcriptional...

Documents

Transcript of Switching Antibiotics Production On and Off in Actinomycetes by an IclR Family Transcriptional...