Function of Corynebacterium glutamicum promoters in Escherichia coli, Streptomyces lividans, and...

Function of Corynebacterium glutamicum promoters inEscherichia coli, Streptomyces lividans, and Bacillus subtilis

Miroslav Patek a,*, Gunther Muth b, Wolfgang Wohlleben b

a Institute of Microbiology, Academy of Sciences of the Czech Republic, Vıdenska 1083, CZ-14220 Prague 4, Czech Republicb Microbiology/Biotechnology, Eberhard-Karls-University, Auf der Morgenstelle 28, D-72076 Tubingen, Germany

Received 19 November 2002; received in revised form 2 April 2003; accepted 7 April 2003

Abstract

The function of seven promoters from Corynebacterium glutamicum , P-hom , P-leuA , P-per , P-aes1, P-aes2, P-45,

and P-104, was analyzed in a heterologous background. DNA fragments carrying the promoters were cloned into

shuttle promoter-probe vectors replicating in Escherichia coli and C . glutamicum (pET2), Streptomyces lividans

(pGL7011) and Bacillus subtilis (pRB394). With the exception of P-hom , P-leuA and P-104 in B . subtilis , all promoters

were found to be active in all species. Non-radioactive methods of primer-extension analysis and of S1-nuclease

protection assay using automatic sequencer were developed to determine the respective transcriptional start points

(TSPs). All TSPs were determined by primer extension and in two promoters (P-45 and P-hom ) the main TSPs were

confirmed by S1-mapping. While the main TSPs were identical in all four species, utilization of multiple TSPs varied

among the species and additional TSPs were detected in S . lividans . Knowledge of the efficiency of promoters and of

exact respective TSPs may be of practical value for the construction of expression systems in a heterologous

background.

# 2003 Elsevier B.V. All rights reserved.

Keywords: Corynebacterium glutamicum ; Escherichia coli ; Streptomyces lividans ; Bacillus subtilis ; Promoters; Heterologous expression

1. Introduction

Introduction of heterologous genes into indus-

trial microorganisms, where they constitute new

metabolic pathways that may lead to the synthesis

of novel products or creation of new degradative

activities, belongs to the most popular strategies of

strain improvement (Bailey, 1991). Well-defined

regulated promoters coming from various bacteria

serve also as efficient tools in rational metabolic

engineering (Goldstein and Doi, 1995). The major

barriers preventing general heterologous expres-

sion of the genes in bacteria are the different

structure of promoters and different recognition

abilities of the respective RNA polymerases in

individual species. The variations in core promoter

sequence elements are connected especially with

* Corresponding author. Tel.: �/420-241062398; fax: �/420-

241722257.

E-mail address: [email protected] (M. Patek).

Journal of Biotechnology 104 (2003) 325�/334

www.elsevier.com/locate/jbiotec

0168-1656/03/$ - see front matter # 2003 Elsevier B.V. All rights reserved.

doi:10.1016/S0168-1656(03)00159-7

mailto:[email protected]

the existence of a number of various sigma factorsresponsible for driving transcription from promo-

ters of different classes of genes (Wosten, 1998).

However, there are also differences among pro-

moters recognized by major sigma factors respon-

sible for the transcription of the prevailing

category of genes, called house-keeping genes.

Accumulated evidence indicates that these differ-

ences are based particularly on the evolutionarydistance between the species (Hausner et al., 1991)

and generally on the different G�/C content in the

respective genomes (Morrison and Jaurin, 1990).

Gene expression in bacterial genera with high A�/

T content (Streptococcus , Lactococcus , Bacillus )

requires mostly high similarity of the core promo-

ter sequences (�/10 and �/35 regions) with the

consensus sequence. In contrast, promoters inbacteria with high G�/C content (Streptomyces ,

Mycobacterium ) tolerate a much higher variability

within the consensus sequence elements (Bourn

and Babb, 1995; Bashyam et al., 1996). In many

promoters of these bacteria, the less important

elements, the �/35 hexamers, conform so little with

the canonical sequence that they are beyond

recognition (less than 3/6 nt). It seems thatrecognition stringency of RNA polymerases of

these bacteria reflects the level of conservation of

the key promoter sequences. Cloning of DNA

fragments from A�/T rich bacteria faces a for-

midable problem of plasmid instability caused by

ubiquitous transcriptional initiation from inciden-

tal sequences mimicking especially the �/10 con-

sensus hexamer TATAAT. Conversely, promotersfrom G�/C-rich species are frequently not recog-

nized in A�/T-rich bacteria and in E . coli whose

genome displays a nearly even representation of

bases (Strohl, 1992).

Analyses of promoters from moderately G�/C-

rich Corynebacterium glutamicum (Patek et al.,

1996, 2003; Vasicova et al., 1999) revealed that the

level of conservation of characteristic promotersequences (�/35 and �/10 regions) in this organism

is much lower than that in A�/T-rich gram-

positive bacteria and comparable to that of G�/

C-rich Streptomyces . In the present study we

tested the activity of promoter-carrying fragments

from C . glutamicum in different bacteria. The

development of non-radioactive determination of

transcriptional start points (TSPs) using fluores-cently labeled primer extension, S1-mapping and

automated DNA sequencer has been an important

methodological point of this study.

2. Materials and methods

2.1. Bacterial strains, growth conditions, plasmids

and oligonucleotides

The strains C. glutamicum ATCC13032, S .

lividans TK64 (Hopwood et al., 1983), B. subtilis

1-E7 (Grohmann et al., 1997) and E. coli XL-1

BLUE (Stratagene) were used. C. glutamicum and

S . lividans were cultivated in 2�/YT medium at

30 8C, E. coli and B. subtilis in LB medium(Sambrook et al., 1989) at 37 8C. When appro-

priate, kanamycin (Km) was added (5�/30 mg

ml�1). Chloramphenicol (Cm) and gentamicin

(Gm) were used to detect the promoter activity.

Minimal inhibitory concentration of chloramphe-

nicol and gentamicin was determined according to

Ozaki et al. (1984) and Labes et al. (1997),

respectively. Shuttle promoter-probe vectors werepET2 (Vasicova et al., 1998), pGL7011 (Labes et

al., 1997) and pRB394 (Bruckner, 1992). Plasmids

used as templates for PCR amplification of

promoter-carrying fragments and the respective

oligonucleotide primers are listed in Table 1.

Primers PUBG1 CCAGATCTGCAGCCAAG-

CTTG and PLBG2 ACAGATCTGCTGCGTAA-

CATCGTTG were used for recloning all promo-ters from pGL11 to pET2 and pRB394. Primers

Cy5-AAC3 TAACGCGCTTGCTGCTTGG and

Cy5-AAC4 GTAACATCGTTGCTGCTCC la-

beled by fluorescent Cy5 dye were used for

sequencing, primer extension and PCR-amplifica-

tion of probes for S1-mapping.

2.2. DNA and RNA isolation and manipulations

Alkaline method with strain-specific modifica-

tions was used for plasmid DNA isolation from E.

coli (Sambrook et al., 1989), C. glutamicum (Patek

et al., 1996), S. lividans (Hopwood et al., 1985) and

B. subtilis (Voskuil and Chambliss, 1993). RNA

was isolated from C . glutamicum and E. coli as

M. Patek et al. / Journal of Biotechnology 104 (2003) 325�/334326

described by Eikmanns et al. (1994). RNA was

isolated from S . lividans and B. subtilis by the

same method with minor modifications. Standard

procedures were used for digestion of DNA by

restriction enzymes and ligation. E . coli was

transformed as described by Hanahan (1985), C .glutamicum by electroporation (Liebl et al., 1989),

S . lividans by using protoplasts (Hopwood et al.,

1985) and B . subtilis by the method of Chang and

Cohen (1979).

2.3. Primer-extension analysis, S1-nuclease

protection assay and sequencing

Primer extension was performed essentially asdescribed by Peters-Wendisch et al. (1998). 30 mg

RNA was hybridized with 5 pmol Cy5-labelled

primer (Cy5-AAC3 or Cy5-AAC4) complemen-

tary to the pGL7011 sequence. Precipitated RNA

with hybridized primer was dissolved in 20 ml of

the following reaction mixture: 4 ml AMV RT

buffer (Promega), 0.5 ml dNTP (20 mM), 1 ml

RNase inhibitor (20 U, Promega), 2 ml actinomy-cin D (1 mg, Serva) and 12.5 ml H2O. After addition

of 20 U avian myeloblastosis virus reverse tran-

scriptase (AMV RT, Promega) the reaction was

run at 42 8C for 2 h. It was stopped with 1 ml

EDTA (0.5 mM, pH 8.0) and RNA was removed

by RNase treatment. After precipitation, the

sample was dissolved in 7 ml TE buffer (10 mM

Tris, 1 mM EDTA, pH 8.0) and 5 ml stop buffer

from ALFexpress Thermo Sequenase Cy5 Dye

Kit, 6 ml sample was heat-denaturated, loaded

onto 6% polyacrylamide sequencing gel next to the

sequencing ladder and run in the ALFexpressapparatus. The results were evaluated using the

Fragment Manager program (Pharmacia Biotech,

Rosendaal, The Netherlands).

The 5?-Cy5-labelled PCR fragment was used as

a probe for S1-mapping. First, DNA fragment

comprising the promoter region was amplified

using the Cy5-AAC4 primer and HOM1 or

P45U primers and the respective pET2-constructsas templates. The purified PCR product (1 mg) was

used as the template for single-strand PCR again

with the Cy5-AAC4 primer (100 pmol). 5 pmol of

the PCR-generated probe was mixed with 20 mg

RNA in the hybridization buffer (Peters-Wendisch

et al., 1998), incubated at 70 8C for 15 min and

then at 45 8C overnight. Single-stranded DNA was

digested by 100 U of S1 nuclease (Sigma) at 37 8Cfor 30 min. After precipitation by isopropanol, the

samples were dissolved in 7 ml TE buffer and 5 ml

stop buffer. The products (6 ml) were run on the gel

in the ALFexpress apparatus in the same way as

the primer extension products. Sequencing was

done using the Cy5-AutoRead Sequencing Kit and

ALFexpress electrophoretic apparatus.

Table 1

Plasmids used as templates and oligonucleotides for PCR amplification of promoter-carrying fragments

Promoter Plasmid template Oligonucleotide primers (5? �/3?) Citation or source

P-per pKG48 PER1 AAGGATCCAAAGAGGGGAAACCAGG Nesvera et al., 1997

PER2 TCGGAGGGATCCACCGCTGAT

P-aes 1, P-aes2 pKG48 AES1 TTGGATCCTCTAAGAGTTCTAGCC Venkova et al., 2001

AES2 AAGGATCCGGTATGCGTTAGGTATT

P-104 pEKplCmF104 P104U GCGGATCCGCCCCGGTATGC Patek et al., 1996

CM4 GAAAATCTCGTCGAAGCTCG

P-45 (P-out) pEKplCmF45 P45U GCGGATCCTCATTCGCCGTGGC Patek et al., 1996

CM4 GAAAATCTCGTCGAAGCTCG

P-leuA pKK7 LEUA1 CGGCCGGATCCAAAAGGTA Patek et al., 1994

LEUA2 GTGGATCCACGACCGGCA

P-hom pJC1-hom HOM1 GAGGATCCAAAATGTCCTCCCCG Reinscheid et al., 1991

HOM2 GCGGATCCTGAGGTCATGATTCT Mateos et al., 1994

M. Patek et al. / Journal of Biotechnology 104 (2003) 325�/334 327

3. Results and discussion

3.1. Cloning of the promoter-carrying DNA

fragment

Promoters from the C . glutamicum chromo-

some (P-45, P-hom and P-leuA ), from the C .

glutamicum plasmid pGA1 (P-per , P-aes1 and P-

aes2) and from the C . glutamicum phage fGA1

(P-104) were chosen to analyze the heterologousfunction of a wide spectrum of promoter types.

Among them, P-per and P-45 are strong promo-

ters from mobile genetic elements, P-hom is a

weaker promoter considered as C. glutamicum -

specific and P-leuA is a promoter of the gene

regulated probably by transcriptional attenuation

(Patek et al., 1994). The similarity of their

presumed �/10 and �/35 sequences to the statis-tical consensus sequence (Patek et al., 1996) ranges

widely. All of them are considered as promoters

recognized by RNA polymerase containing the

principal sigma factor. Promoter-carrying frag-

ments were amplified by PCR, digested by BamHI

and cloned into pGL7011. The resulting constructs

were used as templates for amplification of pro-

moter fragments using the primers PUBG1 andPLBG2 with the BglII sites attached. The frag-

ments digested by BglII were cloned in parallel

into the BamHI site of the other two promoter-

probe vectors, pET2 and pRB394. All fragments

contained the same sequences at 5? end (131 bp)

and at 3? end (43 bp) coming from the vector

pGL7011. In this way the promoters were encom-

passed by the same sequences in all three vectors.The constructs based on pET2, pGL7011 and

pRB394 were isolated from E . coli and transferred

by transformation into C . glutamicum , S . lividans

and B . subtilis , respectively. The transformants

were selected on kanamycin and tested for the

reporter resistance given by the particular vector

(pET2, CmR; pGL7011, GmR; pRB394, CmR). In

E . coli , C . glutamicum and S . lividans all con-structs conferred to the transformants the resis-

tances given by the reporter gene (Table 2). This

indicated that all fragments ensured the transcrip-

tional activity in these three hosts. B. subtilis with

pRB394 carrying the promoters P-hom , P-104 and

P-leuA did not grow on chloramphenicol whereas

P-per , P-45 and P-aes1�/aes2 provided CmR

phenotype to the host (Table 2).

3.2. Determination of transcriptional start points

3.2.1. Promoter P-per

The 259-bp fragment carrying the promoter of

the per gene (Nesvera et al., 1997) from the

plasmid pGA1 conferred high-level expression ofthe reporter genes on all hosts. The signals given

by the primer extension product were very strong

and in the same position in all cases (Fig. 1A). It

seems that the P-per is a typical plasmid promoter,

which might be active in a wide range of species.

Its apparent �/10 hexamer TATAAT is identical

with the consensus sequence found in E . coli , B .

subtilis as well as in C . glutamicum (TAt/cAAT).Moreover, the G, as the second base upstream of

�/10, even extends this motif. The sequence in the

�/35 region (TAGAAT) is more similar to the �/

10 pattern than to the �/35 hexamer. However, in

combination with the completely consensual �/10

sequence, its similarity (3/6) to the E . coli /B .

subtilis consensus TTGACA is clearly sufficient

for high-level transcription. In S . lividans and E.

coli a weak signal was recognized in the spacer, at

C, 11 nt downstream of the TAGAAT hexamer in

�/35 position. The significance of this signal is not

clear. The strong promoter P-per seems suitable

for high gene expression in a wide range of

bacteria.

3.2.2. Promoter P-45

The fragment (185 bp) carrying the P-45 pro-moter (Patek et al., 1996) was also active in all four

species. The main TSP, 8 bp downstream of the

extended �/10 region (TGCTAAAGT), was iden-

tical in all cases (Fig. 1B). The �/35 hexamer

TTCCCG with the spacer of 17 nt showed

mediocre similarity (3/6) to E. coli consensus.

Another clear TSP within a spacer was detected

in S . lividans . In the appropriate distance up-stream, there is no apparent �/10 region similar to

E. coli consensus. It seems that this signal repre-

sents a Streptomyces-specific TSP, although in C.

glutamicum a faint signal was also visible. The

same conclusion resulted from S1-mapping with

the RNA from C . glutamicum and from S .


lividans (Fig. 2A). The promoter P-45 was identi-

fied as P-out within the ISCg2 element (Quast etal., 1999) in C . glutamicum . As part of a mobile

genetic element it might be adapted to the general

function in a wide spectrum of bacteria.

3.2.3. Promoter P-hom

The fragment (189 bp) with the P-hom (Mateos

et al., 1994) provided transcriptional activity in

three strains but not in B. subtilis . B. subtilis

harboring the vector pRB394-P-hom did not grow

on Cm and, in agreement with this result, no signalwas detected by primer extension analysis with

RNA isolated from this clone. The apparent �/10

element TATAGT (Fig. 1C) conforms well with

the B . subtilis consensus, but the hexamer AAG-

CAA in the regular distance of 17 bp bears poor

similarity (2/6) to the �/35 consensus. The main

TSP was identical in the three other species (Fig.

1C). Additional signals representing probablyextra TSPs were detected in S . lividans . A clear

signal found in S . lividans but not in other species

was observed at the C, 37 nt downstream of the

main TSP. This downstream TSP was localized 7

nt downstream of a putative �/10 motif

TAGGGT. The �/10 hexamer with an identical

sequence was previously found in at least four

Streptomyces promoters (Bourn and Babb, 1995).This G-rich hexamer fits to the Streptomyces �/10

consensus sequence TA(G/C)(G/C/A)(G/T)T de-

fined by Bourn and Babb (1995). Both TSPs were

identified at the same positions also by S1-map-

ping using the RNA from S . lividans (Fig. 2B).

However, minor signals between these two starts

determined by the two methods differed. Since the

background was generally higher in examinationsby S1-mapping, these minor peaks may represent

some unspecific signals.

3.2.4. Promoter P-104

The fragment (99 bp) accommodating the phage

promoter P-104 (Patek et al., 1996) has again

driven expression in all species except B . subtilis .

The main TSP identical in the three species is

located at the G, 10 nt downstream of the most

probable pertinent �/10 hexamer TAATGT (Fig.1D). According to the results of primer extension

analysis multiple nearby TSPs were detected in C.

glutamicum . This result was identical with the

conclusion from the analysis done previously by

the radioactive technique (Patek et al., 1996). Since

the alternative TSPs were localized upstream of

the main TSP, they cannot represent premature

stops of the reverse transcription but, moreprobably, actual starts. Overlapping putative �/

10 hexamers TGGGAT and GATAAT can be

recognized in a proper distance from these multi-

ple starts. The same or similar G-rich �/10

hexamers were found also in other C. glutamicum

promoters (TGGGAT in P-thrC ; TGGGGT in P-

34; taggtt in P-amt and GATGAT in P-brnF ,

reviewed by Patek et al., 2003). The heterogeneityof the TSPs might, therefore, be caused by these �/

10 regions. Surprisingly, a similar picture resulted

from the primer extension with E. coli RNA, albeit

with a lower peak resolution, while there were only

traces of signals in this region in S . lividans .

Instead, another TSP was detected in S . lividans

Table 2

Strength of the promoters in C. glutamicum , E. coli , S. lividans , and B. subtilis

Promoter C. glutamicum a S. lividans b E. coli a B. subtilis a

None 5 2 40 2

P-per 80 20 1000 40

P-45 70 10 600 30

P-hom 40 10 350 2

P-104 60 10 500 2

P-aes 1�/P-aes2 70 15 1200 30

P-leuA 60 10 750 5

a Minimal inhibitory concentration (mg ml�1) of chloramphenicol determined according to Ozaki et al. (1984).b Minimal inhibitory concentration (mg ml�1) of gentamicin determined according to Labes et al. (1997).


Fig. 1. Determination of TSPs by primer-extension analysis. Fluorograms generated by ALFexpress show the sequences produced with

the same Cy5-labelled primers as those used for primer extension. The fluorograms are reversed and labeled complementary (T, G, C,

A) to match the respective sequences of the coding strand shown at the bottom. The peaks below represent cDNA synthesized in

reverse transcription using RNA from the individual species: Cg, C . glutamicum , Sl, S . lividans , Ec, E . coli , Bs, B . subtilis . The

hooked arrows above the larger bold face letters indicate TSPs, presumed �/10 and �/35 hexamers are underlined. In 1D, alternative �/

10 hexamers are shown below the sequence. The minor TSPs are in parentheses. 1A, Promoter P-per ; 1B, P-45; 1C, P-hom ; 1D, P-104;

1E, P-aes1 and P-aes2, 1F, P-leuA .


as the G, 17 nt upstream of the main TSP. A veryfaint signal in this position was observed also for

E . coli . Since no clear consensus-like sequence is

located closely upstream, this start might again

represent a Streptomyces-specific transcriptional

signal. In spite of the probable �/35 region

(TTGACC) similar to the B. subtilis consensus

(5/6) occurring 17 nt upstream of the main �/10

hexamer TAATGT, no TSP was detected using theRNA isolated from this species. The reason for the

failing activity in B. subtilis might be the fact that

the whole core region of the promoter is unusually

G�/C-rich.

3.2.5. Promoters P-aes1 and P-aes2

Two separate promoters were previously identi-

fied upstream of the regulatory gene aes on the

plasmid pGA1 according to primer extension

analysis utilizing radioactively labeled primers

(Venkova et al., 2001). Identical TSPs were also

confirmed using constructs with promoters on

separate fragments. The fragment (274 bp) carry-

ing both promoters has driven transcription in all

four species. The main TSPs found by primer

extension were identical in all cases (Fig. 1E).

However, the utilization of the two promoters in

S . lividans seems to differ from that in other

bacteria. Both promoters were found to be weak in

B. subtilis . The core hexamers of the promoters

look very similar: TACGCT and TACTGT in �/

10 region and TTGCCT and TTGCCG in �/35

region, with 17-nt spacer in both cases. In both

promoters, TSPs were localized at a regular

distance, 7 nt downstream of the respective �/10

hexamers. A weak similarity of both these hexam-

ers to B. subtilis consensus (3/6) might be the

reason for the low activity of the promoters in this

species. Among 236 B. subtilis promoters none

contained such �/10 regions, the closest being

TACGAT and TACTCT (Helmann, 1995). In

Fig. 1. (Continued ).


addition to the main TSPs, minor signals can be

recognized upstream of both TSPs. The respective

�/10 motifs and the significance of these potential

TSPs are not obvious.

3.2.6. Promoter P-leuA

The fragment with the P-leuA (179 bp) wasactive in C . glutamicum , E . coli and S . lividans .

The TSP was identical in all species (Fig. 1F).

Missing activity of P-leuA in B . subtilis can also be

explained by a low similarity (6/12) of the �/35 and

�/10 hexamers (CTACCC and TATGCT, respec-

tively) to the B . subtilis consensus.

3.3. Heterologous function of C. glutamicum

promoters

Emerging characteristics of C . glutamicum pro-

moters suggest that the organism is more tolerant

to deviations from the consensus sequence in �/10

and especially in �/35 regions. A similar feature

was observed in Micrococcus luteus (Nakayama et

al., 1989), in Streptomyces (Bourn and Babb,

1995) and in Mycobacterium promoters (Bashyam

et al., 1996). It seems that the recognition of the C .

glutamicum promoter by RNA polymerase is

based more on extended �/10 region than on

combination of �/10 and �/35 elements (Patek et

al., 2003). In contrast, an average E . coli promoter

matches in 7.9 nt from 12 consensus positions

(Lisser and Margalit, 1993) and B . subtilis even in

9.1 nt (Helmann, 1995). These differences are

probably reflected in heterologous function of

the promoters. In this study, activity of the C .

glutamicum promoters and exact determination of

TSPs showed that structural features of the

promoter region necessary for promoter function

are common in the analyzed bacteria. However,

probably due to the different levels of recognition

stringency based on the structure of primary sigma

Fig. 2. Determination of TSPs by S1-nuclease protection assay. Fluorograms generated by ALFexpress show the sequences produced

with the same Cy5-labelled primer as that used for amplification of single-strand PCR probe for the assay. The fluorograms are

reversed and labeled complementary (T, G, C, A) to match the respective sequences of the coding strand shown at the bottom. The

peaks below represent the products of digestion of the Cy5-labelled probe hybridized with RNA from C. glutamicum and S. lividans .

The hooked arrows above the larger bold face letters indicate TSPs, presumed �/10 and �/35 hexamers are underlined. The minor TSPs

are in parentheses. 1A, Promoter P-45; 1B, P-hom .


factors of the respective RNA polymerases, utili-zation of particular sequences in the promoter

regions varied among the species. All promoters

provided transcriptional activity and exhibit iden-

tical main TSPs in S . lividans and in E . coli . As

expected, in S . lividans some more G�/C-rich �/10

motifs were probably utilized for transcriptional

initiation. These Streptomyces -specific motifs

might be recognized by RNA polymerase withsome of the large number of alternative sigma

factors. However, since there is a high proportion

of G�/C-rich core motifs within promoters of

vegetative genes in Streptomyces , we infer that

the vegetative sigma factor is most probably

responsible for transcription starting at these

promoter motifs. On the other hand, promoters

differing too much from B . subtilis consensussequence were not recognized in this host.

Although a number of alternative sigma factors

are also present in B. subtilis , the promoters of C.

glutamicum with sequence structure differing con-

siderably from the consensus of B. subtilis pro-

moters of vegetative genes were not recognized.

Lack of the alternative sigma factors (mostly

stress-inducible or sporulation sigma factors) dur-ing the exponential growth or their markedly

different sequence requirements may be the reason

for this.

It is obvious that the promoter regions in

various bacteria share common sequence-depen-

dent structural features distinguishing them from

the rest of the genome sequence. Regardless of the

G�/C content in their genomes this might becharacteristics of DNA, such as helix stability,

helix flexibility and propensity to bending (Lisser

and Margalit, 1994). Within these wider promoter

regions, the particular �/10 regions, recognized by

RNA polymerases with different stringency re-

quirements in various species, may alternatively

determine initiation of transcription at different

TSPs with different efficiency. Knowledge of theactivity of promoters and of exact respective TSPs

may be of practical value for their use in a

heterologous background. Although homologous

transcriptional signals prove usually more reliable

in gene expression, strong or well-described regu-

lated promoters of heterologous origin may be

useful for construction of expression systems.

Acknowledgements

This work was supported by grant 525/01/0916

from the Grant Agency of the Czech Republic and

by Institutional Research Concept no.

AV0Z5020903. The stay of M. Patek at Eber-

hard-Karls-University in Tubingen was supported

by the Wilhelm-Schuler-Stiftung, III 1.2.-

0415.221.18-15/98. The authors thank M. Espino-sa (Madrid) for the help with B. subtilis RNA

manipulation, R. Bruckner (Tubingen) for the gift

of the plasmid pRB394, B. Eikmanns (Ulm) for

the plasmid pJC1-hom and J. Nesvera (Prague) for

critical reading of the manuscript.

References

Bailey, J.E., 1991. Toward a science of metabolic engineering.

Science 252, 1668�/1675.

Bashyam, M.D., Kaushal, D., Dasgupta, S.K., Tyagi, A.K.,

1996. A study of mycobacterial transcriptional apparatus:

identification of novel features in promoter elements. J.

Bacteriol. 178, 4847�/4853.

Bourn, W.R., Babb, B., 1995. Computer assisted identification

and classification of streptomycete promoters. Nucleic

Acids Res. 23, 3696�/3703.

Bruckner, R., 1992. A series of shuttle vectors for Bacillus

subtilis and Escherichia coli . Gene 122, 187�/192.

Chang, S., Cohen, S.N., 1979. High frequency transformation

of Bacillus subtilis protoplasts by plasmid DNA. Mol. Gen.

Genet. 168, 111�/115.

Eikmanns, B.J., Thum-Schmitz, N., Eggeling, L., Ludtke,

K.U., Sahm, H., 1994. Nucleotide sequence, expression

and transcriptional analysis of the Corynebacterium gluta-

micum gltA gene encoding citrate synthase. Microbiology

140, 1817�/1828.

Goldstein, M.A., Doi, R.H., 1995. Prokaryotic promoters in

biotechnology. Biotechnol. Annu. Rev. 1, 105�/128.

Grohmann, E., Zechner, E.L., Espinosa, M., 1997. Determina-

tion of specific DNA strand discontinuities with nucleotide

resolution in exponentially growing bacteria harboring

rolling circle-replicating plasmids. FEMS Microbiol. Lett.

152, 363�/369.

Hanahan, D., 1985. In: Glover, D.M. (Ed.), Techniques for

Transformation of E. coli , vol. 1. IRL Press, Oxford, pp.

109�/135.

Hausner, W., Frey, G., Thomm, M., 1991. Control regions of

an archaeal gene. A TATA box and an initiator element

promote cell-free transcription of the tRNA(Val) gene of

Methanococcus vannielii . J. Mol. Biol. 222, 495�/508.

Helmann, J.D., 1995. Compilation and analysis of Bacillus

subtilis sigma A-dependent promoter sequences: evidence


for extended contact between RNA polymerase and up-

stream promoter DNA. Nucleic Acids Res. 23, 2351�/2360.

Hopwood, D.A., Kieser, T., Wright, H.M., Bibb, M.J., 1983.

Plasmids, recombination and chromosome mapping in

Streptomyces lividans 66. J. Gen. Microbiol. 129, 2257�/

2269.

Hopwood, D.A., Bibb, M.J., Chater, K., Kieser, T., Kieser,

H.M., Bruton, C.J., Lydiate, D.J., Smith, C.P., Ward, J.M.,

Schrempf, H., 1985. Genetic Manipulation of Streptomyces :

A Laboratory Manual. John Innes Foundation, Norwich.

Labes, G., Bibb, M.J., Wohlleben, W., 1997. Isolation and

characterization of a strong promoter element from the

Streptomyces ghanaensis phage I19 using the gentamicin

resistance gene (aacC1 ) of Tn 1696 as reporter. Microbiol-

ogy 143, 1503�/1512.

Liebl, W., Bayerl, A., Schein, B., Stillner, U., Schleifer, K.H.,

1989. High efficiency electroporation of intact Corynebac-

terium glutamicum cells. FEMS Microbiol. Lett. 53, 299�/

303.

Lisser, S., Margalit, H., 1993. Compilation of E. coli mRNA

promoter sequences. Nucleic Acids Res. 21, 1507�/1516.

Lisser, S., Margalit, H., 1994. Determination of common

structural features in Escherichia coli promoters by compu-

ter analysis. Eur. J. Biochem. 223, 823�/830.

Mateos, L.M., Pisabarro, A., Patek, M., Malumbres, M.,

Guerrero, C., Eikmanns, B.J., Sahm, H., Martin, J.F.,

1994. Transcriptional analysis and regulatory signals of

the hom-thrB cluster of Brevibacterium lactofermentum . J.

Bacteriol. 176, 7362�/7371.

Morrison, D.A., Jaurin, B., 1990. Streptococcus pneumoniae

possesses canonical Escherichia coli (sigma 70) promoters.

Mol. Microbiol. 4, 1143�/1152.

Nakayama, M., Fujita, N., Ohama, T., Osawa, S., Ishihama,

A., 1989. Micrococcus luteus , a bacterium with a high

genomic G�/C content, contains Escherichia coli -type

promoters. Mol. Gen. Genet. 218, 384�/389.

Nesvera, J., Patek, M., Hochmannova, J., Abrhamova, Z.,

Becvarova, V., Jelınkova, M., Vohradsky, J., 1997. Plasmid

pGA1 from Corynebacterium glutamicum codes for a gene

product that positively influences plasmid copy number. J.

Bacteriol. 179, 1525�/1532.

Ozaki, A., Katsumata, R., Oka, T., Furuya, A., 1984. Func-

tional expression of the genes of Escherichia coli in gram-

positive Corynebacterium glutamicum . Mol. Gen. Genet.

196, 175�/178.

Patek, M., Krumbach, K., Eggeling, L., Sahm, H., 1994.

Leucine synthesis in Corynebacterium glutamicum : enzyme

activities, structure of leuA , and effect of leuA inactivation

on lysine synthesis. Appl. Environ. Microbiol. 60, 133�/140.

Patek, M., Eikmanns, B.J., Patek, J., Sahm, H., 1996.

Promoters from Corynebacterium glutamicum : cloning,

molecular analysis and search for a consensus motif.

Microbiology 142, 1297�/1309.

Patek, M., Nesvera, J., Guyonvarch, A., Reyes, O., Leblon, G.,

2003. Promoters of Corynebacterium glutamicum . J. Bio-

technol. 104, 311�/323.

Peters-Wendisch, P.G., Kreutzer, C., Kalinowski, J., Patek, M.,

Sahm, H., Eikmanns, B.J., 1998. Pyruvate carboxylase from

Corynebacterium glutamicum : characterization, expression

and inactivation of the pyc gene. Microbiology 144, 915�/

927.

Quast, K., Bathe, B., Puhler, A., Kalinowski, J., 1999. The

Corynebacterium glutamicum insertion sequence ISCg2

prefers conserved target sequences located adjacent to genes

involved in aspartate and glutamate metabolism. Mol. Gen.

Genet. 262, 568�/578.

Reinscheid, D.J., Eikmanns, B.J., Sahm, H., 1991. Analysis of a

Corynebacterium glutamicum hom gene coding for a feed-

back-resistant homoserine dehydrogenase. J. Bacteriol. 173,

3228�/3230.

Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular

Cloning: A Laboratory Manual, second ed. Cold Spring

Harbor Laboratory Press, Cold Spring Harbor, New York.

Strohl, W.R., 1992. Compilation and analysis of DNA

sequences associated with apparent streptomycete promo-

ters. Nucleic Acids Res. 20, 961�/974.

Vasicova, P., Abrhamova, Z., Nesvera, J., Patek, M., Sahm, H.,

Eikmanns, B., 1998. Integrative and autonomously replicat-

ing vectors for analysis of promoters in Corynebacterium

glutamicum . Biotechnol. Techn. 12, 743�/746.

Vasicova, P., Patek, M., Nesvera, J., Sahm, H., Eikmanns, B.,

1999. Analysis of the Corynebacterium glutamicum dapA

promoter. J. Bacteriol. 181, 6188�/6191.

Venkova, T., Patek, M., Nesvera, J., 2001. Identification of a

novel gene involved in stable maintenance of plasmid pGA1

from Corynebacterium glutamicum . Plasmid 46, 153�/162.

Voskuil, M.I., Chambliss, G.H., 1993. Rapid isolation and

sequencing of purified plasmid DNA from Bacillus subtilis .

Appl. Environ. Microbiol. 59, 1138�/1142.

Wosten, M.M., 1998. Eubacterial sigma-factors. FEMS Micro-

biol. Rev. 22, 127�/150.


Function of Corynebacterium glutamicum promoters in Escherichia coli, Streptomyces lividans, and...

Documents

Transcript of Function of Corynebacterium glutamicum promoters in Escherichia coli, Streptomyces lividans, and...