Specific 50CpG Island Methylation Signatures of FHITand p16 Genes and Their Potential Diagnostic Relevance

in Indian Breast Cancer Patients

Raza Ali Naqvi,1,* Arif Hussain,1,* Mohmammad Raish,1 Afshan Noor,1 Mohammad Shahid,1 Ritu Sarin,2

Himani Kukreti,3 Nida Jameel Khan,1 Shandar Ahmad,4 Suryanarayan V.S. Deo,5

Syed Akhtar Husain,1 Syed Tazeen Pasha,3 Seemi Farhat Basir,1 and Nootan Kumar Shukla5

Even after tremendous molecular studies, early detection, more accurate and sensitive diagnosis, and prognosis ofbreast cancer appear to be a riddle so far. To stab the enigma, this study is designed to envisage DNA methylationsignatures as cancer-specific and stage-specific biomarkers in Indian patients. Rigorous review of scattered sci-entific reports on aberrant DNA methylation helped us to select and analyze a potential tumor suppressor genepair (FHIT and p16 genes) in breast cancer patients. Methylation signatures from 232 primary sporadic breastcancer patients were pinpointed by methylation-specific PCR (MSP). To increase the sensitivity, we combinedboth MSP and expression studies (RT-PCR and Northern blotting) in a reproducible manner. Statistical analysisillustrated that hypermethylation of FHIT gene ( p < 0.0001) and p16 gene ( p¼ 0.04) may be used as a potentialdiagnostic marker to diagnose the early and locally advanced stages of breast cancer. Additionally, the studyauthenticates the dependency of methylation and expressional loss of p16 gene on FHIT gene silencing. Thisobservation not only describes the severity of disease when both genes are silenced but also drives to speculate themolecular cross talk between two genes or genetic pathways dictated by them separately.

Introduction

Despite enormous progress that has been made tounravel the molecular etiology of breast cancer, our

understanding about this disease, like other cancers, is stillnot clear. Even though tremendous endeavors have beenmade by molecular oncologists to understand the etiology ofthis disease, clinical oncologists are still using conventionalmodes in its prognosis and diagnosis (Early Breast CancerTrialists’ Collaborative Group, 1998a, 1998b; Goldhirsch et al.,2001). Several groups report the recurrence of node negativebreast cancer and nonrecurrence of free lymph node positivecases (Hayes et al., 2001). Additionally, many factors (withlimited predictive value) have been investigated to predictthe disease outcome (Hayes et al., 2001).

Numerous reports attempted to validate that cytosine meth-ylation, a postreplicative epigenetic modification of DNA,plays a pivotal role in physiology and progression of carcino-genesis, and it has recently been shown to be linked with

specific alterations in chromatin structure (Baylin et al., 2000,2001; Braun et al., 2000; Foster et al., 2000; Fuks et al., 2000;Nguyen et al., 2001; Esteller, 2002; Esteller and Herman, 2002;Baylin, 2005), which culminates into closing down of DNA totranscription (Esteller, 2003; Laird, 2003; Patel et al., 2003).Therefore, genes that are aberrantly methylated in specific tu-mors may be treated as potential molecular signatures for tu-mor diagnosis and prognosis (Negrini et al., 1996; Cottrell andLaird, 2003; Laird, 2003; Arun et al., 2005; Guler et al., 2005).Various workers tried to show the specific DNA methylationsignatures associated with different cancers. Almost all tumor-suppressing genes are involved somehow at different stages ofall cancers (Baylin et al., 2000; Clark and Melki, 2002; Ehrlich,2002). Therefore, there is a need for sensitive stage-specific andcancer-specific evaluation.

Starting with the study of Kim et al. (2006), we tried tofurther analyze clinicopathological, prognostic, and diag-nostic potentials of 50CpG island methylation signatures of apotential tumor suppressor gene pair, fragile histidine triad

1Department of Biosciences, Jamia Millia Islamia, New Delhi, India.2Section of Digestive Diseases, Department of Internal Medicine, Yale University, New Haven, Connecticut.3Division of Biochemistry and Biotechnology, National Institute of Communicable Disease (NICD), Delhi, India.4National Institute of Biomedical Innovation, Osaka University, Osaka, Japan.5Institute of Rotary Cancer Hospital (IRCH), All India Institute of Medical Sciences (AIIMS), New Delhi, India.*Both authors contributed equally for this paper.

DNA AND CELL BIOLOGYVolume 27, Number 9, 2008ª Mary Ann Liebert, Inc.Pp. 517–525DOI: 10.1089=dna.2007.0660

517

(FHIT) (located at 3p14.2) and p16 (located at 9p21), in Indianfemale breast cancer patients.

A number of reports describe the stage-specific involve-ments of FHIT gene in various cancers, including breast can-cer (Negrini et al., 1996; Ohta et al., 1996; Virgilio et al., 1996;Greenspan et al., 1997; Sozzi et al., 1998; Hadaczek et al., 1999;Baffa et al., 2000; Ozaki et al., 2000; Yuan et al., 2000; Santoset al., 2004; Arun et al., 2005; Guler et al., 2005; Iliopoulos et al.,2005).

In the same way, scientific literature also portrays theinvolvement of p16 in various cancers, including breast can-cer (Cairns et al., 1995; Herman et al., 1995; Merlo et al.,1995; Belinsky et al., 1998; Liggett and Sidransky, 1998; Simonet al., 1998; Friedrich et al., 2001; Polsky et al., 2001; Lehmannet al., 2002; Hu et al., 2003; Huang et al., 2004; Krassenstein et al.,2004; Li et al., 2006, 2007; Bean et al., 2007; Jing et al., 2007).Importantly, Holst et al. (2003) suggest that p16 promoter–hypermethylated variant epithelial cells represent precursorsto breast cancer.

We therefore tried to authenticate the stage-specific diag-nostic potential of specific epigenetic signatures of the genepair (FHIT and p16) in Indian breast cancer patients, whichadditionally could provide some useful insights into the ini-tiation or progression of breast cancer in these patients.

Materials and Methods

Subjects

In this study, 232 paired primary breast cancer tissues andperipheral blood samples were collected from the Institute ofRotary Cancer Hospital (IRCH), All India Institute of MedicalSciences (AIIMS), New Delhi. All tumor samples were col-lected in RNA preservative reagent RNAlater (Ambion, Aus-tin, TX), and snap-frozen at�208C immediately after resectiontill further molecular analyses. Peripheral blood samples wereimmediately subjected to isolation of DNA and RNA.

The pathologic staging was done according to the 1997TNM system (Sobin and Fleming, 1997) and conventionalstaging system (Devita et al., 2005). According to Devita et al.,patients under stage I, stage IIA, and stage IIB were consid-ered as early breast cancer group, which comprised of 45.6%(106=232) of patients; subjects under stage IIIA, stage IIIB, andstage IIIC were considered as locally advanced breast cancergroup (52.5% [122=232]); and patients (4=232) under stage IVexhibited as metastatic category. No familial patient was in-cluded in this study.

The median age of the patients was 51 years. Fifty-twopercent (121=232) were in premenopausal state, and 37.9%(88=232) were in postmenopausal state. About 64.6% (150=232) cases were of estrogen receptor (ER) positive, while35.3% (82=232) were of ER-negative type. Seventy percent(163=232) of patients had progesterone receptor (PR) positive,and 34.0% (79=232) PR negative.

DNA extraction

Genomic DNA from the above-mentioned subjects wereisolated as per instructions of DNA extraction minikit (Qia-gen, Valencia, CA). All DNA samples extracted from varioustissues (tissues with breast cancer and also normal tissues ofbreast and other sites) and their corresponding blood sampleswere kept at �208C till further analyses.

Bisulfite modification and methylation-specific PCR

50CpG island methylation index of the promoter regions ofFHIT and p16 genes was determined by methylation-specificPCR (MSP), as described by Herman et al. (1996). First, thegenomic DNA (*1 mg) was denatured with NaOH (finalconcentration, 0.2 M) and 10 mM hydroquinone (Sigma Che-mical, St. Louis, MO), and 3 M sodium bisulfite (Sigma Che-mical) was added. The mixture was incubated at 508C for 16 h.Afterward, modified DNA was purified using Wizard DNApurification resin (Promega, Madison, WI), followed by eth-anol precipitation. Treatment of genomic DNA with sodiumbisulfite converts unmethylated, but not methylated cyto-sines, into uracil, which is then converted into thymidineduring the subsequent PCR step, producing sequence differ-ences between methylated and unmethylated DNA. Theprimers and annealing temperatures used for MSP have beendescribed previously by Zochbauer-Muller et al. (2001) andHerman et al. (1996) (Table 1). One pair of primers recognizeda sequence in which CpG sites are unmethylated (bisulfite-modified to UpG), and the other recognized a sequence inwhich CpG sites are methylated (unmodified by bisulfitetreatment). Negative control samples without DNA were in-cluded for each set of PCR. PCR products were analyzed on2% agarose gels containing ethidium bromide. To avoidbreast cancer biopsies containing the contamination of normalcells, the MSP reactions were repeated at least four times forfurther confirmation and to rule out the chances of contami-nation of normal cells with breast cancer tissues. Only sam-ples that reproduced the same results at least three times wereused in the analyses (data not shown).

The results obtained from the above-mentioned analyseswere divided into three groups: fully methylated group wasdesignated as MM, hemimethylated group as MU, and nomethylation as UU. Individuals were categorized under MMgroup if amplification was obtained with methylation-specificprimers; otherwise, they were categorized under MU group.The patients were categorized as UU when amplification wasobserved using primers specific for unmethylated DNA. Inaddition to breast cancer biopsies, the normal tissues of breastand other sites were used in the analyses.

RNA extraction and RT-PCR

Total RNA was isolated from primary breast cancer tissuesand their corresponding blood samples using the RNeasyMini Kit (Qiagen), and RT reaction was performed with 200 to300 ng of total RNA (both from breast cancer tissues andblood) in a 20 mL final volume containing 10� buffer (ABI,Foster City, CA), 2.5 mM MgCl2, 10 mM DTT (ABI), 200mM ofeach dNTPs (ABI), 28 pmol of reverse primer for cDNA ofFHIT gene and p16 gene separately (Table 2) (Asamoto et al.,1997; Zochbauer-Muller et al., 2001), 200 units of reversetranscriptase (ABI) at 428C for 45 min. The reaction was ter-minated at 998C for 5 min.

After RT reaction, PCR amplifications were carried out formRNA expression analyses of FHIT and p16 genes as de-scribed previously by Zochbauer-Muller et al. (2001) andAsamoto et al. (1997), respectively (Table 2). In addition toFHIT and p16 gene expression, the expression of b-actin geneat mRNA level was also analyzed using RT-PCR. After eachRT-PCR, the products were envisioned in ethidium bromide–stained 3% agarose gel under UV light. RT-PCRs were also

518 NAQVI ET AL.

performed with normal tissues (blood and tissues of breastorigin or other sites of individuals without cancer).

Northern blotting

Northern blotting was done after radiolabeling cDNA ofFHIT and p16 genes synthesized as above, using [a-32P] dCTPby random priming. Prehybridization and hybridization werecarried out in 50% formamide, 5� SSPE, 10�Denhardt’s so-lution, 2% SDS, and 0.1 mg=mL single-stranded DNA at 428C.Hybridized membranes were washed in 2� SSC, 0.1% SDS,and in decreasing concentrations of SSC for 20 min each at608C. After scanning, the membrane was rehybridized to checkthe expression of p16 gene and b-actin gene (as control).

Statistical analysis

Comparisons were made by various tests as required(Fisher’s two tailed), using www.faculty.vassar.edu=lowr.p< 0.05 was taken as significant. All p-values were of twosided.

Results

Stage-specific methylation fingerprint analysisin selected gene pair (FHIT and p16 genes)

For FHIT gene, the MM group was comprised of 15.0%(16=106) early, 60% (74=122) locally advanced, and 4 me-tastasis patients, respectively. Likewise, the MU group was

formed by 39.6% (42=106) early and 29.5% (36=122) locallyadvanced patients, respectively. The following cases com-prised the UU group: 45.28% (48=106) early and 9.8%(12=122) locally advanced patients. No patient in the pri-mary breast cancer under metastasis category showed theUU or MU categories of promoter methylation (Table 3, Fig.1A, B).

Methylation grouping for p16 was done as explained in theprevious section. About 50.9% (54=106) early and 57.3%(70=122) locally advanced cases constituted the MM category.About 41.5% (44=106) early and 22.9% (28=122) locally ad-vanced patients were in the UU category. About 7.5% (8=106)early and 19.6% (24=122) locally advanced breast cancer pa-tients were in the MU category (Table 3; Fig. 1C, D).

Fisher’s two-tailed tests were performed to find out theassociation between hypermethylation of FHIT and p16 geneswith clinical stages of primary breast cancer patients usingwww.faculty.vassar.edu=lowr. p-Value of the analysis sug-gests that FHIT and p16 genes show promoter methylation ina stage-specific manner ( p< 0.0001 for FHIT gene for locallyadvanced, and p¼ 0.04 for p16 gene for early Indian breastcancer cases) (Table 3).

In addition to this, methylation of FHIT and p16 genes inassociation with other clinicopathological features like age,menopausal status, ER status, and PR status was analyzed(Table 4). No significant association was found between ageand menopausal status of patients with either FHIT or p16gene methylation, as the p-values of the analysis were 0.782(age) and 0.324 (menopausal state) for FHIT gene, and 0.578(age) and 0.779 (menopausal state) for p16 gene, respectively.

Table 1. MSP Primers for FHIT and p16 Genes

Name of the gene and primer sequences Ref. Amplicon size (bp)

FHITMethylated Zochbauer-Muller et al. (2001)50TTGGGGCGCGGGTTTGGGTTTTTACGC30 (F) 7450 CGT AAA CGA CGC CGA CCC CAC TA 30(R)

Unmethylated50 TTG GGG TGT GGG TTT GGG TTT TTA TG 30 (F) 7450 CAT AAA CAA CAC CAA CCC CAC TA 30 (R)

p16Methylated Herman et al. (1996)50TTATTAGAGGGTGGGGCGGATCGC 30 (F) 15050GACCCCGAACCGCGACCGTAA 30 (R)

Unmethylated50 TTATTAGAGGGTGGGGTGGATTGT 30 (F) 15150 CAACCCCAAACCACAACCATAA 30 (R)

Table 2. RT-PCR Primers for FHIT and p16 Genes

Name of the gene Primer sequence Ref. Amplicon size (bp)

FHIT 50 CCT CCC TCT GCC TTT CAT TC 30 (F) Zochbauer-Muller et al. (2001) 75650 TTC AAA CTG GTT GGC AAT AGC 30 (R)

p16 50GGGGTTCGGGTAGAGGAGGTG30 (F) Asamoto et al. (1997) 36350CATGGTTACTGCCTCTGGTG30 (R)

SPECIFIC 50CpG ISLAND METHYLATION OF FHIT AND P16 GENES 519

However, an association was obtained between gene meth-ylation and ER and PR positivity. p-Values of analysis in caseof ER positivity for FHIT gene methylation and p16 genemethylation were 0.0191 and 0.018, respectively. p-values forPR positivity and methylation of FHIT and p16 genes were0.0005 and 0.000009, respectively (Table 4).

Effect of promoter methylation of FHIT and p16 geneson their expression: RT-PCR and Northern blotting

Expression of mRNA of FHIT gene in Indian breast cancercases was analyzed by RT-PCR (Fig. 2A) and northern blot-ting (Fig. 3A). Expression was analyzed separately in eachcategory of methylation (i.e., MM, MU, and UU) and its cor-responding clinicopathological stage (early or locally ad-vanced). In the MM category, 75% (12=16) early breast cancer

patients and 95.9% (71=74) locally advanced hypermethylatedpatients showed no expression. Interestingly, in MM group,25% (4=16) and 4% (3=74) of patients in early and locally ad-vanced stages, respectively, showed somewhat intense bandsin RT-PCR and northern blotting. Similarly, 10.4% (5=48) ofearly and 66.6% (8=12) of locally advanced breast cancer pa-tients under UU category showed no or very feeble expressionpattern for the FHIT gene. 89.5% (43=48) early and 33% (4=12)locally advanced stage patients of UU category showedstrong expression in either approach of expression analysis.In the hemimethylated category, 2.3% (1=42) early and 45%(18=40) locally advanced stage patients showed negative ex-pression, while 97.6% (41=42) early and 55.0% (22=40) locallyadvanced breast cancer patients showed insubstantial ex-pression of FHIT gene (Table 5).

Similarly, the expression pattern of p16 gene was analyzed(Figs. 2B and 3B). In the MM category, 75.9% (41=54) earlybreast cancer cases and 92.8% (65=70) locally advancedhypermethylated patients showed no expression. 24.07%(13=54) and 7.1% (5=70) of patients in early and locally ad-vanced stage, respectively, of MM group showed somewhatintense bands in RT-PCR and northern blotting. About 11.3%(5=44) early and 7.1% (2=28) locally advanced breast cancerpatients under UU category showed no or very feeble ex-pression of the p16 gene. 88.6% (39=44) early and 92.8%(26=28) locally advanced stage patients of UU categoryshowed strong expression. In the MU category, 87.5% (7=8)early and 12.5% (3=24) locally advanced stage patientsshowed negative expression, while 12.5% (1=8) early and87.5% (21=24) locally advanced breast cancer patients showedexpression of p16 gene (Table 6). The b-actin gene was acontrol for all expression studies.

After applying the Fisher’s (two sided) tests on methylationand expression data for both genes FHIT as well as p16, asignificant association was observed among various cate-gories of methylation and expression of FHIT and p16 genes.For FHIT gene, p-values of all three categories of 50CpG island

Table 3. Stage-Specific Methylation Patterns of FHIT

and p16 Genes in Breast Cancer Patients

Early LA

MethylationStage I, IIA,

and IIBStage IIIA, IIIB,

IIIC, and metastasis Total p-valuesa

FHIT geneM 16 78 94U 48 12 60 <0.0001MU 42 36 78Total 106 126 232

p16 geneM 54 74 128U 44 28 72 0.04MU 8 24 32Total 106 126 232

ap-values of Fisher’s two-tailed test.M, methylated; U, unmethylated; MU, hemimethylated primary

breast cancer cases; LA, locally advanced breast cancer patients.

Distribution of various categories of5'CpG island methyaltion of FHIT gene in

Indian breast cancer patients

80

Mc UHM16 HM101 HM211

M U MA C

B D

U Mc M

HM1 HM12 HM98U M U

151bp150bp

M U

74 bp

FHIT p16

M

60

No.

of b

reas

tca

ncer

pat

ient

s

40200

M U

Methylation Status

MU

8060

No.

of b

reas

tca

ncer

pat

ient

s

40200

M U

Methylation Status

MU

Distribution 5'CpG island methyaltionof p16 gene in Indian breast cancer

patients.

genegene

Early Locally Advanced breast cancer patientsEarly Locally Advanced

FIG. 1. Representative photographs of 50CpG island methylation of FHIT and p16 genes in Indian breast cancer patients.(A) MSP of FHIT gene: lane Mc, methylation control (sssI-treated DNA); lane U, unmethylated samples; lane M, methylatedsamples. (B) Distribution of different categories of FHIT methylation with early and locally advanced patients. (C) MSP of p16gene: lane Mc, methylation control (sssI-treated DNA); lane U, unmethylated samples; lane M, methylated samples.(D) Distribution of different categories of p16 methylation with early and locally advanced patients. HM16, HM101, HM211,HM1, HM12, and HM98 depicting various breast cancer patients.

520 NAQVI ET AL.

methylation, that is, MM, UU, and MU, are as follows:p¼ 0.015, p¼ 0.0001, and p¼< 0.00001, respectively (Table 5).Similarly, for p16 gene these values are p¼ 0.011, p¼ 0.86, andp¼ 0.0004, respectively, for MM, UU, and MU (Table 6).

Association between gene silencingof FHIT and p16 genes

Statistical analyses were also performed to find out therelationship between 50CpG island methylation of FHITand p16 genes in Indian female breast cancer patients,wherein p¼ 0.000877 showed a strong association betweenthese two epigenetic events. However, these occur at differ-

ent clinicopathological stages of Indian female breast cancerpatients (Table 7).

Discussion

Considerable variations in promoter methylation in indi-vidual genes existing in the profiles of different cancers couldbe molecular markers, which would be capable of distin-guishing among the various individual tumors and also theirnormal counterparts (Hayes et al., 2001; Esteller, 2002, 2003;Esteller and Herman, 2002; Cottrell and Laird, 2003; Laird,2003; Patel et al., 2003). DNA methylation markers have thepotential to provide a unique combination of specificity,sensitivity, and high information content and might be usedclinically in the diagnosis, prognosis, and recurrence evalua-tions of cancers (Tsou et al., 2002; Patel et al., 2003).

Our study shows bias of 50CpG island methylation of FHITgene toward locally advanced stages of breast cancer, therebysuggesting that FHIT gene silencing due to methylation isinvolved in the progression, rather than in the initiation, ofbreast tumorigenesis. Our results are found to be comparable

Table 4. Association of FHIT and p16 Methylation with Clinicopathological Markers

Total FHIT (þve) FHIT (�ve) p-valuesa p16 (þve) p16 (�ve) p-valuesa

Age (median, 51 years)50 years 80 36 44 0.782 39 41 0.578>50 years 150 71 79 66 84Unknown 2 NA NA

Menopausal statusPremenopausal 121 71 50 0.3242 63 58 0.779Postmenopausal 88 45 43 48 40Unknown 23 NA NA NA NA

ER statusPositive 150 89 61 0.0191 96 54 0.018Negative 82 35 47 39 43

PR statusPositive 163 101 62 0.0005 95 68 0.000009Negative 79 30 49 22 57

ap-values of Fisher’s two-tailed test.FHIT (þve), FHIT methylation positive (MM and MU); FHIT (�ve), FHIT methylation negative (UU); p16 (þve), p16 gene methylation

positive (MM and MU); p16 (�ve), p16 gene methylation negative (UU); ER status, estrogen status; PR status, progesterone status; NA, notaccepted in the analysis.

FIG. 2. (A) Representative photograph of RT-PCR of FHITgene in Indian female breast cancer patients. Lane 1: positivecontrol; lane 2: negative control; lanes 3, 5, 6, and 7: fullymethylated genotype of promoter region of FHIT gene; lane4: unmethylated promoter. (B) Representative photograph ofRT-PCR of p16 gene in Indian female breast cancer patients.Lane 1: positive control; lane 2: negative control; lane 3:unmethylated promoter; lanes 4 and 5: partial methylatedsamples; lanes 6 and 7: hypermethylated promoter. (C) Re-presentative photograph of RT-PCR of b-actin gene in Indianfemale breast cancer patients. Lane 1: positive control; lane 2:negative control; lanes 3–7 constituted expression of b-actingene in Indian female breast cancer patients.

FIG. 3. (A) Representative photograph of northern blottingof FHIT gene in Indian female breast cancer patients. Lane 1:positive control; lane 2: negative control; lanes 3 and 4: hy-permethylated promoter; lane 5: unmethylated promoter;lane 6: hemimethylated promoter. (B) Representative pho-tograph of northern blotting of p16 gene in Indian femalebreast cancer patients. Lane 1: positive control; lanes 2, 4, and6: hemimethylated promoter; lane 3: hypermethylated pro-moter; lane 5: unmethylated promoter.

SPECIFIC 50CpG ISLAND METHYLATION OF FHIT AND P16 GENES 521

with the findings of other workers (Campiglio et al., 2002;Zochbauer-Muller et al., 2001; Terry et al., 2007), but differentfrom those described by Kim et al. (2006).

Interestingly, cervical (Wu et al., 2006) and oesophageal cell(Kuroki et al., 2003) cancers have similar molecular signatures,suggesting similar molecular pathogenesis. On contrary, FHITmethylation was found to be significantly more pronounced instage IC of granulose cell tumor of ovarian origin (Dhillon etal., 2004), indicating a dissimilar etiology.

Likewise, 50CpG island methylation-mediated gene si-lencing of a classical tumor suppressor gene, p16=CDKN2A,suggested the predisposition of this event toward locally ad-vanced stages, but the p-value is not very significant. Ourresults with Indian breast cancer patients are consistent with

certain other studies reporting 50CpG island methylation ofthe p16 gene in breast cancer (Silva et al., 2003; Zemliakovaet al., 2003). Aberrant methylation signatures of both geneswere found to be independent with age and menopausal stateof patients but dependent on ER and PR status.

Our study also supports previous studies that suggest PRmight have a stronger prognostic role than ER in patients withbreast cancer and that PR-negative patients might have aworse outcome than patients with PR-positive disease (Costaet al., 2002; Arun et al., 2005). In this analysis, the p-value ofFHIT methylation versus PR status is more significant thanthe p-value of FHIT methylation versus ER status.

Using Fisher’s exact two-tailed test, an association betweenmethylation of FHIT and p16 genes in Indian female breast

Table 5. 50CpG Island Methylation and Expression of FHIT Gene

Hypermethylation

Variables of breast cancer Expression (�ve) Expression (þve) Total p-valuesa

Early (stage I, IIA, and IIB) 12 4 16 0.015LA (stage IIIA, IIIB, IIIC, and metastasis) 75 3 78Total 87 7 94

Unmethylated

Expression (�ve) Expression (þve)Early (stage I, IIA, and IIB) 5 43 48 0.0001LA (stage IIIA, IIIB, IIIC, and metastasis) 8 4 12Total 13 47 60

Hemimethylation

Expression (�ve) Expression (þve)Early (stage I, IIA, and IIB) 1 41 42 <0.00001LA (stage IIIA, IIIB, IIIC, and metastasis) 17 19 36Total 19 60 78

ap-values of Fisher’s two-tailed test.LA, locally advanced primary breast cancer cases.

Table 6. 50CpG Island Methylation and Expression of p16 Gene

Hypermethylation

Variables of breast cancer Expression (�ve) Expression (þve) Total p-valuesa

Early (stage I, IIA, and IIB) 41 13 54 0.011LA (stage IIIA, IIIB, IIIC, and metastasis) 69 5 74Total 110 18 128

Unmethylated

Expression (�ve) Expression (þve)Early (stage I, IIA, and IIB) 5 39 44 0.86LA (stage IIIA, IIIB, IIIC, and metastasis) 2 26 28Total 7 65 72

Hemimethylation

Expression (�ve) Expression (þve)Early (stage I, IIA, and IIB) 7 1 8 0.0004LA (stage IIIA, IIIB, IIIC, and metastasis) 3 21 24Total 10 22 32

ap-values of Fisher’s two-tailed test.LA, locally advanced primary breast cancer cases.

522 NAQVI ET AL.

cancer patients was detected, suggesting their cooperativeinvolvement in both initiation and progression of breast tu-morigenesis, similar to that of Kim et al. (2006). At present, weare unable to clearly state whether these two genes (FHIT andp16) are cooperating in tumorigenesis by participating in thesame or different biochemical pathways. Further work is stillrequired to understand the molecular cross talk between FHITand p16 genes for better comprehension of the etiology ofbreast cancer.

Expression studies of FHIT and p16 revealed an inversecorrelation between methylation status and expression ofgenes. We were unable to detect gene expression in all hy-permethylation cases of either of the genes, with few excep-tions. Our results on these genes were quite concordant withDUTT1 (ROBO1) at 3p12, RASSF1A at 3p21.3, BLU at 3p21.3,SEMA3B at 3p21.3, HYAL1 at 3p21.3, CACNA2D2 at 3p21.3,RARß2 at 3p24, and VHL at 3p25.3 (Dammann et al., 2000; Huiet al., 2000; Csoka et al., 2001; Dallol et al., 2002; Tse et al., 2002).In unmethylated samples, an intense signal of expression wasobtained in either of the expressional analyses method (seeMaterials and Methods section), but there were a few primarybreast cancer patients who showed no expression. This dis-crepancy in expression patterns in some cases of breast cancerpatients in this study with hypermethylation and unmethy-lation of either of genes could be due to the heterogeneouscells in the tumors, wherein one clonal line is methylationpositive for FHIT or p16 gene, while other is not. Therefore,our results also point out that both the methylation fingerprintof promoter and expression studies of that gene should besternly considered in the analyses about stage differentiation,diagnosis, or prognosis of breast cancer patients.

One could evaluate FHIT and p16 expression and methy-lation during serum DNA and nipple aspirate analysis(Krassenstein et al., 2004; Hu et al., 2006). However, moreprospective, randomized, controlled trials are still required toassess the true value of this gene pair (FHIT and p16) as astage-specific diagnostic tool.

This study also reveals one important link not discussedpreviously in breast tumorigenesis: even though p16 genemethylation is an early process of breast cancer, it can beinduced by FHIT gene methylation during progression ofbreast cancer.

Acknowledgments

The authors are thankful to Council of Scientific and In-dustrial Research, New Delhi (CSIR; Grant No. 9=466 [57]-

EMR-II), and University Grants Commission, New Delhi(UGC; Grant No. SR 3-94=2003), for financial assistance.

References

Arun, B., Kilic, G., Yen, C., Foster, B., Yardley, D.A., Gaynor, R.,and Ashfaq, R. (2005). Loss of FHIT expression in breast canceris correlated with poor prognostic markers. Cancer EpidemiolBiomarkers Prev 14, 1681–1685.

Asamoto, M., Iwahori, Y., Okamura, T., Shirai, T., and Tsuda, H.(1997). Decreased expression of the p16=MTS1 gene withoutmutation is frequent in human urinary bladder carcinomas.Jpn J Clin Oncol 27, 22–25.

Baffa, R., Gomella, L.G., Vecchione, A., Bassi, P., Mimori, K.,Sedor, J., Calviello, C.M., Gardiman, M., Minimo, C., Strup,S.E., Mccue, P.A., Kovatich, A.J., Pagano, F., Huebner, K., andCroce, C.M. (2000). Loss of FHIT expression in transitionalcell carcinoma of the urinary bladder. Am J Pathol 156, 419–424.

Baylin, S.B., Belinsky, S.A., and Herman, J.G. (2000). Aberrantmethylation of gene promoters in cancer—concepts, mis-concepts, and promise. J Natl Cancer Inst 92, 1460–1461.

Baylin, S.B., Esteller, M., Rountree, M.R., Bachman, K.E.,Schuebel, K., and Herman, J.G. (2001). Aberrant patterns ofDNA methylation, chromatin formation and gene expressionin cancer. Hum Mol Genet 10, 687–692.

Baylin, S.B. (2005). DNA methylation and gene silencing incancer. Nat Clin Pract Oncol 2, S4–S11.

Bean, G.R., Bryson, A.D., Pilie, P.G., Goldenberg, V., Baker, J.C.,Jr., Ibarra, C., Brander, D.M., Paisie, C., Case, N.R., Gauthier,M., Reynolds, P.A., Dietze, E., Ostrander, J., Scott, V., Wilke,L.G., Yee, L., Kimler, B.F., Fabian, C.J., Zalles, C.M., Broad-water, G., Tlsty, T.D., and Seewaldt, V.L. (2007). Morpholo-gically normal-appearing mammary epithelial cells obtainedfrom high-risk women exhibit methylation silencing of IN-K4a=ARF. Clin Cancer Res 13, 6834–6841.

Belinsky, S.A., Nikula, K.J., Palmisano, W.A., Michels, R., Sac-comanno, G., Gabrielson, E., Baylin, S.B., and Herman, J.G.(1998). Aberrant methylation of p16(INK4a) is an early eventin lung cancer and a potential biomarker for early diagnosis.Proc Natl Acad Sci USA 95, 11891–11896.

Braun, S., Pantel, K., Muller, P., Janni, W., Hepp, F., Kentenich,C.R., Gastroph, S., Wischnik, A., Dimpfl, T., Kindermann, G.,Riethmuller, G., and Schlimok, G. (2000). Cytokeratin-positivecells in the bone marrow and survival of patients with stage I,II, or III breast cancer. N Engl J Med 342, 525–533.

Cairns, P., Polascik, T.J., Eby, Y., Tokino, K., Califano, J., Merlo,A., Mao, L., Herath, J., Jenkins, R., Westra, W., Rutter, J.L.,Buckler, A., Gabrielson, E., Tockman, M., Cho, K.R., Hedrick,

Table 7. Correlation between FHIT and p16 Genes Methylation in Indian Breast Cancer Patients

FHIT gene methylation (MM & MU)

Molecular variables No Yes Total p-valuesa

60 172 232

p16 gene methylation (MM & MU)No 39 69 108 0.000877Yes 21 103 124Total 60 172 232

ap-values of Fisher’s two-tailed test.MM, methylated; MU, hemimethylated primary breast cancer cases.

SPECIFIC 50CpG ISLAND METHYLATION OF FHIT AND P16 GENES 523

L., Bova, G.S., Isaacs, W., Koch, W., Schwab, D., and Sidransk,D. (1995). Frequency of homozygous deletion at p16=CDKN2in primary human tumors. Nat Genet 11, 210–212.

Campiglio, M., Pekarsky, Y., Menard, S., Tagliabue, E., Pilotti, S.,and Croce, C.M. (2002). FHIT loss of function in human pri-mary breast cancer correlates with advanced stage of thedisease. Cancer Res 59, 3866–3869.

Clark, S.J., and Melki, J. (2002). DNA methylation and gene si-lencing in cancer: which is the guilty party? Oncogene 21,

5380–5387.Costa, S.-D., Lange, S., Klinga, K., Merkle, E., and Kaufmann, M.

(2002). Factors influencing the prognostic role of oestrogenand progesterone receptor levels in breast cancer-results of theanalysis of 670 patients with 11 years of follow-up. Eur JCancer 38, 1329–1334.

Cottrell, S.E., and Laird, P.W. (2003). Sensitive detection of DNAmethylation. Ann NY Acad Sci 983, 120–130.

Csoka, A.B., Frost, G.I., and Stern, R. (2001). The sixhyaluronidase-like genes in the human and mouse genomes.Matrix Biol 20, 499–508.

Dallol, A., Forgacs, E., Martinez, A., Sekido, Y., Walker, R.,Kishida, T., Rabbitts, P., Maher, E.R., Minna, J.D., and Latif, F.(2002). Tumor specific promoter region methylation of thehuman homologue of the Drosophila Roundabout gene DUTT1(ROBO1) in human cancers. Oncogene 21, 3020–3028.

Dammann, R., Li, C., Yoon, J.H., Chin, P.L., Bates, S., and Pfeifer,G.P. (2000). Epigenetic inactivation of a RAS association do-main family protein from the lung tumor suppressor locus3p21.3. Nat Genet 25, 315–319.

Devita, V.T., Jr., Hellman, S., and Rosenberg, S.A. (2005). Cancer:Principles and Practice of Oncology. Seventh edition (LippincottWilliams & Wilkins, Philadelphia, PA) pp. 1435.

Dhillon, V.S., Aslam, M., and Husain, S.A. (2004). The contri-bution of genetic and epigenetic changes in granulosa celltumors of ovarian origin. Clin Cancer Res 10, 5537–5545.

Early Breast Cancer Trialists’ Collaborative Group. (1998a).Polychemotherapy for early breast cancer: an overview of therandomized trials. Early Breast Cancer Trialists’ CollaborativeGroup. Lancet 352, 930–942.

Early Breast Cancer Trialists’ Collaborative Group. (1998b). Ta-moxifen for early breast cancer: an overview of the random-ized trials. Early Breast Cancer Trialists’ Collaborative Group.Lancet 351, 1451–1467.

Ehrlich, M. (2002). DNA methylation in cancer: too much, butalso too little. Oncogene 21, 5400–5413.

Esteller, M. (2002). CpG island hypermethylation and tumorsuppressor genes: a booming present, a brighter future. On-cogene 21, 5427–5440.

Esteller, M. (2003). Relevance of DNA methylation in the man-agement of cancer. Lancet Oncol. 4, 351–358.

Esteller, M., and Herman, J.G. (2002). Cancer as an epigeneticdisease: DNA methylation and chromatin alterations in hu-man tumors. J. Pathol. 196, 1–7.

Foster, C.S., Bostwick, D.G., Bonkhoff, H., Damber, J.E., van DerKwast, T., Montironi, R., and Sakr, W.A. (2000). Cellular andmolecular pathology of prostate cancer precursors. Scand JUrol Nephrol 205 Suppl, 19–43.

Friedrich, M.G., Blind, C., Milde-Langosch, K., Erbersdobler, A.,Conrad, S., Loning, T., Hammerer, P., and Huland, H. (2001).Frequent p16=MTS1 inactivation in early stages of urothelialcarcinoma of the bladder is not associated with tumor recur-rence. Eur Urol 40, 518–524.

Fuks, F., Burgers, W.A., Brehm, A., Hughes-Davis, L., andKoumanidis, T. (2000). DNA methyltransferase Dnmt1 as-

sociates with histone deacetylase activity. Nat Genet 24,

88–91.Goldhirsch, A., Glick, J.H., Gelber, R.D., Coates, A.S., and Senn,

H.J. (2001). Meeting highlights: International Consensus Panelon the Treatment of Primary Breast Cancer. Seventh Interna-tional Conference on Adjuvant Therapy of Primary BreastCancer. J Clin Oncol 19, 3817–3827.

Greenspan, D.L., Connolly, D.C., Wu, R., Lei, R.Y., Vogelstein,J.T., Kim, Y.T., Mok, J.E., Munoz, N., Bosch, F.X., Shah, K., andCho, K.R. (1997). Loss of FHIT expression in cervical carcinomacell lines and primary tumors. Cancer Res 37, 4692–4698.

Guler, G., Uner, A., Guler, N., Han, S.Y., Iliopoulos, D., Mccue,P., and Huebner, K. (2005). Concordant loss of fragile geneexpression early in breast cancer development. Pathol Int 55,

471–478.Hadaczek, P., Kovatich, A., Gronwald, J., Lubinski, J., Huebner,

K., and Mccue, P.A. (1999). Loss or reduction of FHIT ex-pression in renal neoplasias: correlation with histogenic class.Hum Pathol 11, 1276–1283.

Hayes, D.F., Isaacs, C., and Stearns, V. (2001). Prognostic factorsin breast cancer: current and new predictors of metastasis.J Mammary Gland Biol Neoplasia 6, 6375–6392.

Herman, J.G., Graff, J.R., Myohanen, S., Nelkin, B.D., and Baylin,S.B. (1996). Methylation-specific PCR: a novel PCR assay formethylation status of CpG islands. Proc Natl Acad Sci USA 93,

9821–9826.Herman, J.G., Merlo, A., Mao, L., Lapidus, R.G., Issa, J.P., Da-

vidson, N.E., Sidransky, D., and Baylin, S.B. (1995). Inactiva-tion of the CDKN2=p16=MTS1 gene is frequently associatedwith aberrant DNA methylation in all common human can-cers. Cancer Res 55, 4525–4530.

Holst, C.R., Nuovo, G.J., Esteller, M., Chew, K., Baylin, S.B., Her-man, J.G., and Tlsty, T.D. (2003). Methylation of p16(INK4a)promoters occurs in vivo in histologically normal human mam-mary epithelia. Cancer Res 63, 1596–1601.

Hu, S., Ewertz, M., Tufano, R.P., Brait, M., Carvalho, A.L., Liu,D., Tufaro, A.P., Basaria, S., Cooper, D.S., Sidransky, D., La-denson, P.W., and Xing, M. (2006). Detection of serum deoxy-ribonucleic acid methylation markers: a novel diagnostic toolfor thyroid cancer. J Clin Endocrinol Metab 91, 98–104.

Hu, X.C., Wong, I.H., and Chow, L.W. (2003). Tumor-derivedaberrant methylation in plasma of invasive ductal breastcancer patients: clinical implications. Oncol Rep 10, 1811–1815.

Huang, J., El-Gamil, M., Dudley, M.E., Li, Y.F., Rosenberg, S.A.,and Robbins, P.F. (2004). T cells associated with tumor re-gression recognize frameshifted products of the CDKN2Atumor suppressor gene locus and a mutated HLA class I geneproduct. J Immunol 172, 6057–6064.

Hui, R., Macmillan, R.D., Kenny, F.S., Musgrove, E.A., Blamey,R.W., Nicholson, R.I., Robertson, J.F.R., and Sutherland, R.L.(2000). INK4a gene expression and methylation in primarybreast cancer: over expression of p16INK4a messenger RNA is amarker of poor prognosis. Clin Cancer Res 6, 2777–2787.

Iliopoulos, A., Guler, G., Han, S.Y., Johnston, D., Druck, T.,Mccorkell, K.A., Palazzo, J., Mccue, P.A., Baffa, R., andHuebner, K. (2005). Fragile genes as biomarkers: epigeneticcontrol of WWOX and FHIT in lung, breast and bladder can-cer. Oncogene 24, 1625–1633.

Jing, F., Zhang, J., Tao, J., Zhou, Y., Jun, L., Tang, X., Wang, Y.,and Hai, H. (2007). Hypermethylation of tumor suppressorgenes BRCA1, p16 and 14–3-3 sigma in serum of sporadicbreast cancer patients. Onkologie 30, 14–19.

Kim, J.S., Kim, J.W., Han, J., Shim, Y.M., Park, J., and Kim, D.H.(2006). Cohypermethylation of p16 and FHIT promoters as a

524 NAQVI ET AL.

prognostic factor of recurrence in surgically resected stage Inon-small cell lung cancer. Cancer Res 15, 4049–4054.

Krassenstein, R., Sauter, E., Dulaimi, E., Battagli, C., Ehya, H.,Klein-Szanto, A., and Cairns, P. (2004). Detection of breastcancer in nipple aspirate fluid by CpG island hypermethyla-tion. Clin Cancer Res 10, 28–32.

Kuroki, T., Trapasso, F., Yendamuri, S., Matsuyama, A., Alder,H., Mori, M., and Croce, C.M. (2003). Allele loss and promoterhypermethylation of VHL, RAR-beta, RASSF1A, and FHIT tu-mor suppressor genes on chromosome 3p in esophagealsquamous cell carcinoma. Cancer Res 63, 3724–3728.

Laird, P.W. (2003). The power and the promise of DNA meth-ylation markers. Nat Rev Cancer 3, 253–266.

Lehmann, U., Langer, F., Feist, H., Glockner, S., Hasemeier, B.,and Kreipe, H. (2002). Quantitative assessment of promoterhypermethylation during breast cancer development. Am JPathol 160, 605–612.

Li, C., Rock, K.L., Woda, B.A., Jiang, Z., Fraire, A.E., and Dres-ser, K. (2007). IMP3 is a novel biomarker for adenocarcinomain situ of the uterine cervix: an immunohistochemical study incomparison with p16(INK4a) expression. Mod Pathol 2, 242–247. Epub.

Li, M., Cao, J., Wang, N.P., Li, L.Y., Li, L., Qiao, Y.L., and Pan, Q.J.(2006). The usefulness of p16INK4a in cytological screening ofcervical carcinoma. Zhonghua Zhong Liu Za Zhi 9, 674–677.

Liggett, W.H., Jr., and Sidransky, D. (1998). Role of the p16 tu-mor suppressor gene in cancer. J Clin Oncol 16, 1197–1206.

Merlo, A., Herman, J.G., Mao, L., Lee, D.J., Gabrielson, E., Bur-ger, P.C., Baylin, S.B., and Sidransky, D. (1995). 5’ CpG islandmethylation is associated with transcriptional silencing of thetumor suppressor p16=CDKN2=MTS1 in human cancers. NatMed 1, 570–577.

Negrini, M., Monaco, C., Vorechovsky, I., Ohta, M., Druck, T.,Baffa, R., Huebner, K., and Croce, C.M. (1996). The FHIT gene at3p14.2 is abnormal in breast carcinomas. Cancer Res 56, 3173–3179.

Nguyen, T.C., Gonzales, F.A., and Jones, P.A. (2001). Alteredchromatin structure associated with methylation-inducedgene silencing in cancer cells: correlation of accessibility,methylation, MeCP2 binding and acetylation. Nucleic AcidsRes 29, 4598–4606.

Ohta, M., Inoue, H., Cotticelli, M.G., Kastury, K., Baffa, R., Pa-lazzo, J., Siprashvili, Z., Mori, M., Mccue, P., Druck, T., Croce,C.M., and Heubner, K. (1996). The human FHIT gene, span-ning the chromosome 3p14.2 fragile site and renal cell carci-noma associated translocation breakpoint, is abnormal indigestive tract cancers. Cell 84, 587–597.

Ozaki, K., Enomoto, T., Yoshino, K., Hongbo, S., Nakamura, T.,Fujita, M., Kuragaki, C., Sakata, M., Kurachi, H., and Murata,Y. (2000). FHIT alterations in endometrial carcinoma and hy-perplasia. Int J Cancer 85, 306–312.

Patel, A., Groopman, J.D., and Umar, A. (2003). DNA methyla-tion as a cancer-specific biomarker: from molecules to popu-lations. Ann NY Acad Sci 983, 286–297.

Polsky, D., Young, A.Z., Busam, K.J., and Alani, R.M. (2001). Thetranscriptional repressor of p16=Ink4a, Id1, is up-regulated inearly melanomas. Cancer Res 61, 6008–6011.

Santos, S.C., Cavalli, L.R., Cavalli, I.J., Lima, R.S., Haddad, B.R.,and Ribeiro, E.M. (2004). Loss of heterozygosity of the BRCA1and FHIT genes in patients with sporadic breast cancer fromSouthern Brazil. J Clin Pathol 57, 374–377.

Silva, J., Silva, J.M., Dominguez, G., Garcia, J.M., Cantos, B.,Rodriguez, R., Larrondo, F.J., Provencio, M., Espana, P., and

Bonilla, F. (2003). Concomitant expression of p16INK4a andp14ARF in primary breast cancer and analysis of inactivationmechanisms. J Pathol 199, 289–297.

Simon, A., Bartsch, D., and Barth, P. (1998). Frequent ab-normalities of the putative tumor suppressor gene FHIT at3p14.2 in pancreatic carcinoma cell lines. Cancer Res 58, 1583–1587.

Sobin, L.H., and Fleming, I.D. (1997). TNM classification ofmalignant tumors. Cancer 80, 1803–1804.

Sozzi, G., Pastorino, U., Moiraghi, L., Tagliabue, E., Pezzella, F.,Ghirelli, C., Tornielli, S., Sard, L., Huebner, K., Pierotti, M.A.,Croce, C.M., and Pilotti, S. (1998). Loss of FHIT function inlung cancer and preinvasive bronchial lesions. Cancer Res 58,

5032–5037.Terry, G., Ho, L., Londesborough, P., Duggan, C., Hanby, A.,

and Cuzick, J. (2007). The expression of FHIT, PCNA andEGFR in benign and malignant breast lesions. Br J Cancer 96,

110–117. Epub.Tse, A., Xiang, R.H., Bracht, T., and Naylor, S.L. (2002). Human

Semaphorin 3B (SEMA3B) located at chromosome 3p21.3suppresses tumor formation in an adenocarcinoma cell line.Cancer Res 62, 542–546.

Tsou, J.A., Hagen, J.A., Carpenter, C.L., and Laird-Offringa, I.A.(2002). DNA methylation analysis: a powerful new tool forlung cancer diagnosis. Oncogene 21, 5450–5461.

Virgilio, L., Shuster, M., Gollin, S.M., Veronese, M.L., Ohta, M.,Huebner, K., and Croce, C.M. (1996). FHIT gene alterations inhead and neck squamous cell carcinomas. Proc Natl Acad SciUSA 93, 9770–9775.

Wu, Y., Meng, L., Wang, H., Xu, Q., Wang, S., Wu, S., Xi, L.,Zhao, Y., Zhou, J., Xu, G., Lu, Y., and Ma, D. (2006). Regula-tion of DNA methylation on the expression of the FHIT genecontributes to cervical carcinoma cell tumorigenesis. OncolRep 16, 625–629.

Yuan, B.Z., Keck-Waggoner, C., Zimonjic, D.B., Thorgeirsson,S.S., and Popescu, N.C. (2000). Alteration of the FHIT genein human hepatocellular carcinoma. Cancer Res 60, 1049–1053.

Zemliakova, V.V., Zhevlova, A.I., Strel’nikov, V.V., Liubchenko,L.N., Vishnevskaia, I.V., Tret’iakova, V.A., Zaletaev, D.V., andNemtsova, M.V. (2003). Abnormal methylation of several tu-mor suppressor genes in sporadic breast cancer. Mol Biol 37,

696–703.Zochbauer-Muller, S., Fong, K.M., Maitra, A., Lam, S., Geradts,

J., Ashfaq, R., Virmani, A.K., Milchgrub, S., Gazdar, A.F., andMinna, J.D. (2001). 5’ CpG island methylation of the FHIT geneis correlated with loss of gene expression in lung and breastcancer. Cancer Res 61, 3581–3585.

Address reprint requests to:Nootan Kumar Shukla, M.B.B.S., M.S.

Department of Surgical OncologyDr. B.R. Ambedkar Institute Rotary Cancer Hospital

All India Institute of Medical Sciences (AIIMS)Ansari Nagar

New Delhi 110029India

E-mail: shuklank2@yahoo.com

Received for publication August 3, 2007; received in revisedform April 25, 2008; accepted April 25, 2008.

SPECIFIC 50CpG ISLAND METHYLATION OF FHIT AND P16 GENES 525