Selenium Supplementation Restores the Antioxidative Capacityand Prevents Cell Damage in Bone Marrow Stromal CellsIn Vitro

REGINA EBERT,a MATTHIAS ULMER,a SABINE ZECK,a JUTTA MEISSNER-WEIGL,a DORIS SCHNEIDER,a

HELGA STOPPER,b NICOLE SCHUPP,b MOUSTAPHA KASSEM,c FRANZ JAKOBa

aMusculoskeletal Research Center, Orthopaedic Department, University of Wurzburg, Wurzburg, Germany;bInstitute of Pharmacology and Toxicology, University of Wurzburg, Wurzburg, Germany; cDepartment of

Endocrinology, University Hospital of Odense, Odense, Denmark

Key Words. Bone marrow stromal cells • Reactive oxygen species • Micronuclei • Selenoproteins • Tissue engineering

ABSTRACT

Bone marrow stromal cells (BMSCs) and other cell popula-tions derived from mesenchymal precursors are developedfor cell-based therapeutic strategies and undergo cellularstress during ex vivo procedures. Reactive oxygen species(ROS) of cellular and environmental origin are involved inredox signaling, cumulative cell damage, senescence, andtumor development. Selenium-dependent (glutathione per-oxidases [GPxs] and thioredoxin reductases [TrxRs]) andselenium-independent (superoxide dismutases [SODs] andcatalase [CAT]) enzyme systems regulate cellular ROSsteady state levels. SODs process superoxide anion to hydro-gen peroxide, which is subsequently neutralized by GPx andCAT; TrxR neutralizes other ROS, such as peroxinitrite.Primary BMSCs and telomerase-immortalized human mes-enchymal stem cells (hMSC-TERT) express GPx1–3, TrxR1,TrxR2, SOD1, SOD2, and CAT. We show here that instandard cell cultures (5%–10% fetal calf serum, 5–10 nM

selenite), the activity of antioxidative selenoenzymes is im-paired in hMSC-TERT and BMSCs. Under these conditions,the superoxide anion processing enzyme SOD1 is not suffi-ciently stimulated by an ROS load. Resulting oxidative stressfavors generation of micronuclei in BMSCs. Supplementa-tion of selenite (100 nM) restores basal GPx and TrxRactivity, rescues basal and ROS-stimulated SOD1 mRNAexpression and activity, and reduces ROS accumulation inhMSC-TERT and micronuclei generation in BMSCs. Inconclusion, BMSCs in routine cell culture have low antioxi-dative capacity and are subjected to oxidative stress, asindicated by the generation of micronuclei. Selenite supple-mentation of BMSC cultures appears to be an importantcountermeasure to restore their antioxidative capacity andto reduce cell damage in the context of tissue engineeringand transplantation procedures. STEM CELLS 2006;24:1226–1235

INTRODUCTIONBone marrow stromal cells (BMSCs) can give rise to differen-tiation of terminally differentiated mesenchymal cells, such asosteoblasts, chondrocytes, myotubes, and adipocytes. Mesen-chymal stem cells (MSCs) can give rise to a transient amplifyingcell pool, which in the context of many reviews and experimentsis also termed MSCs, but probably should rather be calledmesenchymal precursors or a similar term. They can be readilyisolated from various sources and are developed for cell-basedregenerative therapies, such as tissue engineering of bone andcartilage [1–5]. Precursor cells of any kind are as well used astarget cells for gene therapy [6–8]. In vivo and especially exvivo procedures required for both tissue engineering and gene

therapy expose cells to considerable oxidative stress. Oxidativestress causes damage of the genome and proteome and promotessenescence, aging, and tumorigenesis [9–23]. The biologicalrelevance of oxidative stress for the survival and self-renewalcapacity of in this case hematopoetic stem cells has recentlybeen stressed by the fact that in stem cells defective in the cellcycle checkpoint activator ataxia telangiectasia mutated [24],the self renewal capacity can be enhanced by antioxidativesubstances such as N-acetyl-cysteine treatment but not by te-lomerase overproduction.

Reactive oxygen species are produced within a cell by severalenzyme systems involved in respiratory burst reactions (e.g.,NADPH oxidases), by NO synthesis, and by several signaling

Correspondence: Franz Jakob, M.D., Musculosceletal Research Center, Orthopaedic Department, University of Wurzburg, Bret-treichstrasse 11, D-97074 Wurzburg, Germany. Telephone: 0049-931-8031500; Fax: 0049-931-8031599; e-mail: f-jakob.klh@mail.uni-wuerzburg.de Received March 16, 2005; accepted for publication January 7, 2006; first published online in STEMCELLS EXPRESS January 19, 2006. ©AlphaMed Press 1066-5099/2006/$20.00/0 doi: 10.1634/stemcells.2005-0117

TISSUE-SPECIFIC STEM CELLS

STEM CELLS 2006;24:1226–1235 www.StemCells.com

cascades. The products generated are involved in procedures ofhormone synthesis (e.g., thyroid hormones and steroid hor-mones [9]), vessel relaxation, redox regulation of multiple pro-moters and—if not sufficiently compartmentalized or in case ofspillover—in damage of the genome and proteome of cells[10–11]. SOD synthesizes hydrogen peroxide from superoxideradicals. Isoenzymes contain copper, zinc (SOD1 and the extra-cellular isoenzyme SOD3), iron, manganese (SOD2), and nickel(bacteria) in their active centers [25]. Deficiency, as well asoverproduction, of SOD1 is associated with diseases such asanemia, cystic fibrosis, and amyotrophic lateral sclerosis [26];SOD2 knockout in Drosophila is lethal early after hatching orcauses early adult onset mortality due to enhanced sensitivityagainst various stress mediators, oxygen, and toxins [27–32].SOD1 and SOD2 cannot substitute for each other [33]. SOD1mRNA is constitutively expressed and regulated by hydrogenperoxide and other substances. Identified promoter responseelements comprise sites for Sp-1, C/EBP, Egr-1, WT-1, AP2, axenobiotic response element, and an antioxidant response ele-ment [25, 34–40].

Hydrogen peroxide produced by SOD enzymes from super-oxide anion and water is neutralized to H2O by glutathioneperoxidases (GPxs), thioredoxin reductases (TrxRs), and cata-lase. Four GPx enzymes and three TrxR enzymes are selenium-dependent, carrying selenocysteine in their active centers. Sel-enocysteine, the 21st amino acid, is encoded by the opal stopcodon UGA, which in the presence of a 3� hairpin loop structureis translated as selenocysteine and incorporated into proteins [9].Selenium deficiency leads to translation of truncated proteins.There is a well-characterized protein- and organ-related hierar-chy in selenium incorporation and retention; for example, TrxRranks high compared with cellular GPx (cGPx; GPx1) andplasma GPx (pGPx; GPx3) at the protein level (due to theaffinity of selenocysteine insertion sequence [SECIS] bindingproteins to the individual SECIS element of a selenoprotein),and brain and testis rank high compared with other organs [9].The expression of various selenoproteins is modulated by se-lenite both at the transcription and the translation level [41–44].Recently, the human selenoprotein genome has been describedto comprise 25 human selenoproteins as indicated by a wholegenome screen searching for SECIS elements within the 3�-untranslated regions of open reading frames [42].

Formation of micronuclei is a biomarker of DNA damage.The micronucleus assay has emerged as one of the preferredmethods to assess chromosome damage, and the method is nowwidely applied for population monitoring of genetic damage(e.g., for studying nutrigenomics and chromosomal instability,to assess the individual oxidative burden in kidney insufficiencyand long-term hemodialysis, for screening of chemicals forgenotoxic potential, and for the prediction of interindividualvariations in radiosensitivity [12–16]). The connection betweenoxidative load and the formation of micronulei is being fosteredby a recent report in which overexpression of the antioxidantthioredoxin (the main substrate of TrxR) in fibroblasts of pa-tients suffering from Fanconi anemia (a disorder in which highconcentrations of superoxides are responsible for DNA damage)protects cells from mitomycin C-induced micronuclei formation[17, 18]. Cumulative damage contributes to aging processes ofthe organism and to cellular fail-safe programs such as cellularsenescence, as has been indirectly shown in transgenic animals,

in which overexpression of single and combined components ofantioxidative systems influenced longevity [19–23].

We have previously reported on the expression of variousselenoproteins in bone cells and cells of the myelomonocyticpathway of differentiation [45–47], but little is known about theexpression and role of antioxidant systems in stem cells or incells of the transient proliferating pool derived from them, or oftheir effectivity to scavenge the genome and proteome of thesecells during ex vivo procedures. We now used BMSC culturesand the recently established telomerase-immortalized humanmesenchymal stem cell line (hMSC-TERT) [48] to demonstratethat their antioxidative capacity under standard (selenium-defi-cient) cell culture conditions is impaired and to show biologicalconsequences in terms of intracellular production of reactiveoxygen species and formation of micronuclei. Selenite supple-mentation of culture media was capable of restoring the anti-oxidative capacity of BMSCs and of reducing intracellular ROSproduction and stress-related generation of micronuclei.

MATERIALS AND METHODS

Cell CultureMedia for cell culture and fetal calf serum (FCS) were obtainedfrom PAA Laboratories (Linz, Austria, http://www.paa.at).hMSC-TERT cells were produced and cultured as described[48]. Cells were cultured in Earle’s minimum essential mediumcontaining 10% FCS. BMSCs were isolated from bone marrowfrom different donors and cultivated up to seven passages by astandardized protocol [5, 49]. Bone marrows were recovered ininformed consent from the explanted femoral heads of patientsundergoing elective hip arthroplasty. The procedure was ap-proved by the local Ethics Committee of the University ofWurzburg. Briefly, bone marrow preparations were washed withmedium (Dulbecco’s modified Eagle’s medium [DMEM]-F12supplemented with 10% FCS, penicillin/streptomycin, and 50�g/mlascorbate[Sigma-Aldrich,St.Louis,http://www.sigmaaldrich.com]), and centrifuged at 100 rpm for 5 minutes. The pellet wasreconstituted in medium and washed four times, and the superna-tants of the washing steps containing the released cells were col-lected. Cells were centrifuged and cultivated at a density of 3 � 108

cells per 150-cm2 culture flask at 37°C in 5% CO2. Adherent cellswere washed after 2 days and cultivated until confluency with orwithout 100 nM sodium selenite supplementation (Sigma-Aldrich).Upon establishment of the protocol in our laboratory, we againcharacterized the BMSC population obtained by fluorescence-ac-tivated cell sorting (FACS) analyses and were able to excludeexpression of hematopoetic markers (CD14 and CD45; data notshown). The chondrogenic and osteogenic differentiation potentialof these BMSCs was repeatedly characterized [50]. Starting withpassage 1 after confluence of the first 150-cm2 flask cell numberswere determined, an equal number of selenium-deficient and sele-nium-supplemented cells were seeded into new 150-cm2 flasks(1.8 � 105 to 1.8 � 106), and cell doubling rates were calculated.THP1 cells (human monocytic leukemia cells) were grown inRPMI 1640 medium containing 10% FCS, and human fetal osteo-blasts (hFOBs; obtained from T. Spelsberg [51]) and HepG2 cells(human hepatocarcinoma cells) were cultivated in DMEM-F12containing 10% FCS. All cells were grown at 37°C, (except hFOBcells, which were grown at 34°C), in a humidified atmosphereconsisting of 5% CO2 and 95% air.

1227Ebert, Ulmer, Zeck et al.

www.StemCells.com

GPx AssayCells were sonicated in buffer containing 250 mM sucrose, 20mM HEPES, and 1 mM EDTA, pH 7.4. GPx activity wasassayed by the method of Dreher using tertiary butyl hydroper-oxide as the substrate, as described previously [52]. Cytosols ofthe cells were added to the reaction mixture in a final volume of1 ml (0.1 M Tris, 0.5 mM EDTA, pH 8, 200 mM NADPH[Roche Diagnostics, Mannheim, Germany, http://www.roche-applied-science.com], 2 mM glutathione, 1 U/ml glutathionereductase). The reaction was started by the addition of 7 �Mtertiary butyl hydroperoxide. After an initial incubation periodof 1–1.5 minutes, the oxidation of NADPH was registered at340 nm, within the linear range of the reaction for 3 minutes.The activity of GPx was expressed as nanomoles of NADPHoxidized per minutes and mg of protein. Unspecific NADPHoxidation was measured by the complete inhibition of GPx bythe addition of 100 mM of the GPx inhibitor mercaptosuccinateto the incubation mixture before starting the reaction. The back-ground values were subtracted from the results obtained. Eachmeasurement was obtained in duplicate. Protein content of cellextracts was determined by using Rotiquant Protein Assay (CarlRoth GmbH, Karlsruhe, Germany, http://www.carl-roth.de). Allchemicals were obtained from Sigma-Aldrich.

TrxR AssayTrxR activity was measured as described previously [53]. Cellswere sonicated in 1 mM EDTA, 50 mM Tris, pH 7.5. TrxRactivity was determined in a volume of 0.5 ml containing 100mM potassium phosphate, pH 7.0, 10 mM EDTA, 0.2 mMNADPH, and 2.5 mM 5,5�-dithio-bis nitrobenzoic acid. Reac-tions were started by adding 100 �l of cell extract. The changein absorption was monitored at 412 nm for 2 minutes. Allchemicals were obtained from Sigma-Aldrich. Protein contentof cell extracts was determined using Rotiquant Protein Assay(Carl Roth GmbH). The activity of TrxR was expressed asmilliunits per milligram of protein.

SOD AssayFor the determination of SOD activity, hMSC-TERT cells werecultivated with or without selenite supplementation. Cells wereharvested in 50 mM potassium phosphate buffer (pH 7.8) andsonicated, and cytosols were used for the SOD assay. We usedthe bathocuproine sulfonate-nitroblue tetrazolium (NBT) testdescribed by Beauchamp et al. [54, 55] and Spitz and Oberley[56]. The main principle of the test is the reduction of NBT toblue formazan by superoxide anions, which can be measured at560 nm at room temperature. The underlying reaction is acompetition between SOD and NBT for O2

– radicals, which aregenerated by a xanthine-xanthine-oxidase system. The rate ofNBT reduction in the absence of SOD is taken as the referencevalue. In a final volume of 1 ml, 50 mM potassium phosphatebuffer, pH 7.8, 1 mM diethylenetriaminepentaacetic acid, 1 U ofcatalase, 56 nM NBT, 0.1 mM xanthine, and 50 nM bathocu-proine disulfonate disodium salt were mixed, and reaction wasstarted by adding 20 �l of cell extract. To differentiate betweenSOD1 and SOD2 activity, samples were incubated in an addi-tional reaction with 5 mM NaCN for 45 minutes to block SOD1activities. All chemicals were obtained from Sigma-Aldrich.The background values were subtracted from the results ob-

tained. Each measurement was obtained in duplicate. Proteincontent of cell extracts was determined by using the RotiquantProtein Assay (Carl Roth GmbH).

Reverse Transcription-Polymerase Chain ReactionTotal RNA was isolated from hMSC-TERT cells, primary BM-SCs obtained from different donors, hFOB, HepG2, and THP1cells as controls using the NucleoSpin RNA II kit (Macherey-Nagel, Duren, Germany, http://www.macherey-nagel.de) ac-cording to the manufacturer’s instructions. Two micrograms oftotal RNA was reverse-transcribed with Moloney murine leu-kemia virus reverse transcriptase (Promega, Mannheim, Ger-many, http://www.promega.com) in a volume of 20 �l. Forpolymerase chain reaction (PCR), 1 �l of cDNA was used as atemplate in a volume of 50 �l. Taq DNA polymerase wasobtained from Qiagen (Hilden, Germany, http://www1.qiagen.com). DNA fragments were amplified by using a standardprotocol. PCR conditions were as follows: 30 seconds at 94°C,30 seconds at annealing temperature, 60 seconds at 72°C; 40cycles. The sequences of the primers used, annealing tempera-tures, MgCl2 concentrations, and the sizes of the PCR productsare listed in Table 1.

Real-Time PCRFor monitoring SOD1 mRNA expression in hMSC-TERT cellsand primary BMSCs and to confirm its regulation by selenitesupplementation and H2O2, a real-time PCR protocol was es-tablished. Cells were cultivated with or without 100 nM selenitefor at least 1 week and stimulated with or without 50 �M H2O2

for up to 8 h. One microliter of cDNA was used for SOD1 andEF1� amplification as a housekeeping gene. PCR conditionswere as follows: 30 seconds at 94°C, 30 seconds at annealingtemperature, 60 seconds at 72°C (see Table 1 for PCR condi-tions). Real-time PCR was performed with the DNA EngineOpticon system (MJ Research, Waltham, MA, http://www.mjr.com) using SYBR Green (Biozym Scientific GmbH, HessischOldendorf, Germany, http://www.biozym.com) as fluorescentdye. For quantification and statistical analyses, SOD1 mRNAexpression was normalized to the expression levels of the house-keeping gene EF1� using the relative expression software tool(REST) [57]. Specificity of SOD1 amplicons were confirmed bymelting curve analyses.

Western BlotHMSC-TERT cells were cultivated with or without 100 nMselenite and stimulated with or without 50 �M H2O2 as de-scribed above. Cells were harvested in homogenization buffer(50 mM Tris, 1 mM EDTA, 1 mM Pefabloc, 1 mM dithiothre-itol). The protein content was determined using the Rotiquant(Carl Roth GmbH) protein assay. Twenty micrograms of proteinwere boiled for 5 minutes in SDS-polyacrylamide gel electro-phoresis buffer (100 mM Tris, pH 6.8, 7.5% glycerol, 1% SDS,0.025% bromphenol blue) and separated by SDS gel electro-phoresis. Proteins were transferred to Optitran BA S 85 mem-branes (Schleicher and Schuell, Dassel, Germany, http://www.whatman.com). The membranes were treated with a buffer con-taining 0.1% Tween 20, 2% horse serum, 2.5% bovine serumalbumin (BSA), 2.5% milk powder in phosphate-buffered saline(PBS) for 2 hours to inhibit nonspecific binding. Then, themembranes were incubated in 0.1% Tween 20, 1% horse serum,

1228 Oxidative Stress in Bone Marrow Stromal Cells

and 1% milk powder in PBS with a monoclonal antibody againstSOD1 (Santa Cruz Biotechnology Inc., Heidelberg, Germany,http://www.scbt.com). Membranes were washed with 10 mMTris, pH 7.5, 140 mM NaCl, 2 mM EDTA, 0.1% Triton X-100,1% horse serum, 1% BSA, and 1% milk powder, followed byincubation with horseradish peroxidase-conjugated goat anti-mouse IgG antibody (Sigma-Aldrich) using a solution contain-ing 0.1% Tween 20, 1% horse serum, 1% BSA, and 1% milkpowder in PBS. The expression of SOD1 was detected by usingthe enhanced chemiluminescence system (Amersham Bio-sciences, GE Healthcare Life Sciences, Freiburg, Germany,http://www.amersham.com).

Determination of Reactive Oxygen SpeciesIn hMSC-TERT cells cultivated with or without 100 nM selen-ite, the accumulation of reactive oxygen species (ROS) wasdetermined using 2�7�-dichlorodihydrofluorescin diacetate(H2DCF-DA) (Invitrogen, Karlsruhe, Germany, http://www.invitrogen.com), a nonfluorescent lipid permeable compoundthat is oxidized by intracellular ROS to form the impermeablefluorescent compound DCF [58–60]. Cells were treated with 30�M dichlorofluorescein diacetat (DCFH-DA) for 30 minutes,trypsinized, and washed twice with PBS, 1% BSA. DCF fluores-cence was determined by FACS analyses using a FACS cytometer(BD LSR I; Becton, Dickinson and Company, Heidelberg, Ger-many, http://www.bd.com) at an excitation wavelength of 488 nmand a 530 nm emission filter bandpassed for DCF. For analyzingthe flow cytometry histograms, the free software WinMDI version2.8 (Scripps Research Institute Cytometry Software, http://facs.scripps.edu/software.html) was used.

Micronucleus AssayPrimary BMSCs were cultivated with or without 100 nM selen-ite on glass slides for up to four passages until confluence. Cellswere fixed with methanol at –20°C for 4 hours. For staining ofthe nuclei and micronuclei, cells were incubated with stainingsolution (0.006% acridine orange [Sigma-Aldrich] in Sørensenbuffer [15 mM Na2HPO4, 15 mM KH2PO4]) for 3 minutes,washed twice with Sørensen buffer for 5 minutes each, andmounted for microscopy [12–14]. Cells were analyzed with aZeiss Axioskop 2 fluorescence microscope (Carl Zeiss, Gottin-gen, Germany, http://www.zeiss.com), and nuclei and micronu-clei were counted in a blinded fashion. Each MSC populationwas analyzed by evaluating three sets of 1,000 nuclei. Photo-graphs were taken with an AxioCam MRc camera and theAxioVision 4.0 software (Carl Zeiss).

RESULTS

Expression Profile of Antioxidative Enzyme Systemsin Primary BMSCs and hMSC-TERT CellsBoth primary BMSCs obtained from different subjects andhMSC-TERT cell cultures expressed a broad variety of antioxi-dative enzyme systems and selenoproteins, as determined byreverse transcription-PCR analyses (Fig. 1, lanes 2–6). As acontrol, the genes of interest were also amplified from THP1(monocytic), hFOB, and HepG2 (hepatocarcinoma) cells (lanes7–9). The selenoproteins TrxR1 and TrxR2, cGPx, phospholip-id-hydroperoxide glutathione peroxidase, and the nonselenopro-teins SOD1, SOD2, and catalase were expressed in equalamounts in all samples analyzed. The pGPx could be detected in

Table 1. Primers used for reverse transcription polymerase chain reaction

Primer name Sequence 5� 3 3� Product size (bp)Annealing

temperature (°C) MgCl2 (mM)

TrxR1 sense TCGCTTTGGAGTGCGCTGGA 439 58 2TrxR1 antisense GATTGCAACTGGGGTGAGCTTrxR2 sense ATGCGCAGGTGATGCGGACCGTG 381 62 1.5TrxR2 antisense GTCGTCATCATCTGGCACCAGGAGcGPx sense ATGTGTGCTGCTCGGCTAGC 300 58 2cGPx antisense GCCGGACGTACTTGAGGGAAGI-GPx sense TCACTCTGCGCTTCACCATG 601 63 2.5GI-GPx antisense AGCAGTTCACATCTATATGGCpGPx sense GGACAAGAGAAGTCGAAGATG 467 62 2pGPx antisense GATGTCGTGAACCTTCATGGGTTCPH-GPx sense TGTGCGCGCTCCATGCACGAGT 481 68 2PH-GPx antisense AAATAGTGGGGCAGGTCCTTCTCTSeP sense GGCCCGTTGGAAGTGGTTGT 926 60 2.5SeP antisense CCTAGGAGCCAACTCTGAATSOD1 sense TGAAGGTGTGGGGAAGCATTA 359 60 2SOD1 antisense TTACACCACAAGCCAAACGACSOD2 sense TGTTGAGCCGGGCAGTGT 631 55 1.5SOD2 antisense CTCCCAGTTGATTACATTCCAT sense TTTGGCTACTTTGAGGTCAC 439 53 1.5CAT antisense TCCCCATTTGCATTAACCAGEF1� sense AGGTGATTATCCTGAACCATCC 234 54 1.5EF1� antisense AAAGGTGGATAGTCTGAGAAGC

Designations and sequences of the primers used are shown with the corresponding product sizes, annealing temperatures, andconcentrations of MgCl2.Abbreviations: bp, base pair(s); CAT, catalase; cGPx, cellular glutathione peroxidase; GI-GPx, gastrointestinal glutathione peroxidase;pGPx, plasma glutathione peroxidase; SeP, selenoprotein P; SOD, superoxide dismutase; TrxR, thioredoxin reductase.

1229Ebert, Ulmer, Zeck et al.

www.StemCells.com

different preparations of primary BMSCs (lanes 3–6) and in thecontrol sample HepG2. In the more osteogenic differentiatedhFOB cell line, the amplified signal was weaker, and no ampli-cons, or a very faint band, appeared when using cDNA fromhMSC-TERT cells (lanes 2 and 7). BMSCs express selenopro-tein P (SeP) in a high amount (lane 3–6), comparable to theexpression in liver cells (lane 8), whereas hMSC-TERT andhFOB cells show much weaker signals (lanes 2 and 7). Thegastrointestinal glutathione peroxidase was only expressed inHepG2 cells (lane 8) but was undetectable in BMSCs and

hMSC-TERT cells (lane 2–6). The selenoproteins thioredoxinglutathione reductase (TGR, TrxR3) and glutathione peroxidase6 (GPx6) could not be detected in all samples (data not shown).As a control, the housekeeping gene EF1� was amplified.

GPx and TrxR Activity in hMSC-TERT Cellsand BMSCsWhen cultured in the presence of 100 nM sodium selenite, boththe activities of GPx and TrxR were considerably enhanced inBMSCs and hMSC-TERT cells. BMSCs show basal GPx activ-ities ranging between 50 and 80 mU/mg protein, varying be-tween different subjects (Fig. 2A). The activity could be en-hanced 1.8-fold by cultivating cells in the presence of 100 nMselenite. The stimulation varied between different subjects. Thebasal GPx activity of hMSC-TERT cells is much lower andranges between 6 and 7 mU/mg protein. Activity could bestimulated twofold in the presence of selenite.

BMSCs showed basal TrxR activity between 9 and 100mU/mg protein, varying between different subjects (Fig. 2B).Activity could be enhanced 1.5-fold by cultivating the cells inthe presence of 100 nM selenite, with a variation betweendifferent subjects. HMSC-TERT cells show a basal TrxR activ-ity of 22 mU/mg protein. A 1.4-fold stimulation could be alsodetermined after selenite supplementation.

ROS Accumulation in hMSC-TERT CellsTo obtain reproducible results, avoid individual biases, and getsufficient amounts of cells, we used hMSC-TERT cells to mea-sure the accumulation of ROS in selenium adequate (100 nMselenite) versus selenium-deficient cultures. The determinationof ROS accumulation in hMSC-TERT cells showed a higherROS load in selenite-deficient cells (Fig. 2C, left panel, grayline) compared with selenite-supplemented cells (black line).The selenium-deficient hMSC-TERT cells showed a DCFH-DAfluorescence intensity median of 14.75 (Fig. 2C, right panel,gray bar), which was significantly reduced to 6.03 in selenium-supplemented cells (black bar).

SOD1 Regulation by Selenite and H2O2 in PrimaryBMSCs and hMSC-TERT CellsBy performing a dot blot screening procedure on the mRNAexpression of antioxidative enzymes in selenium-deficient andselenium-adequate primary BMSCs (BMSC73) and hMSC-TERT cultures, we realized a marked stimulation of SOD1mRNA species in both cell types by selenite supplementation(data not shown). As a consequence, we measured SOD1mRNA in primary BMSCs and hMSC-TERT, and protein andactivity of SOD1 in hMSC-TERT, during H2O2 stimulation inthe presence and absence of 100 nM selenite. mRNA levelswere determined by quantitative PCR, protein expression wasdetermined by Western blotting, and semiquantitative densitom-etry and SOD1 activity was measured by using an enzymaticassay. Under selenium deficiency, SOD1 mRNA expressionwas modulated slightly, by 50 �M H2O2 after 0.5–8 hours oftreatment in hMSC-TERT cells (Fig. 3A, gray bars). SOD1mRNA expression was significantly higher in cells culturedunder adequate selenite supplementation (Fig. 3A, black bars).Under basal conditions, without H2O2 treatment, SOD1 mRNAcontent of selenite-supplemented cells was 1.75-fold higher thanin untreated cells. After 1 hour of stimulation of cells with

Figure 1. Reverse transcription-polymerase chain reaction expressionprofile of antioxidative enzyme systems in hMSC-TERT (lane 2) andprimary BMSCs (lanes 3–6). BMSCs were obtained from four differentsubjects (BMSC53, BMSC73, BMSC113, and BMSC158). cDNAsfrom THP1 (human monocytic leukemia), hFOB, and HepG2 (hepato-carcinoma) cells were used for comparison and positive controls (lanes7–9). Experiments were done in triplicates, and a representative result isshown. Abbreviations: BMSC, bone marrow stromal cell; CAT, cata-lase; cGPx, cellular glutathione peroxidase; GI-GPx, gastrointestinalGPx; hFOB, human fetal osteoblast; hMSC, human mesenchymal stemcell; pGPx, plasma GPx; PH-GPx, phospholipid-hydroperoxide GPx;SeP, selenoprotein P; SOD, superoxide dismutase; TrxR, thioredoxinreductase.

1230 Oxidative Stress in Bone Marrow Stromal Cells

H2O2, SOD1 mRNA was markedly enhanced under adequateselenite supplementation compared with selenium-deficientcells and compared with untreated cells.

In selenite-deficient primary BMSC271 and BMSC280,SOD1 mRNA expression was not modulated by 50 �M H2O2

treatment after 0.5–7 hours and 0.5–1 hours, respectively (Fig.3B, gray bars). When BMSC271 and BMSC280 were supple-mented with 100 nM selenite and stimulated with 50 �M H2O2,

SOD1 mRNA expression was significantly enhanced time-de-pendently and at any time point, with a maximal twofold stim-ulation after 0.5 and 4 hours in BMSC271 and a maximal1.5-fold stimulation after 1 hour in BMSC280 (Fig. 3B, blackbars). Values were normalized to the expression of the house-keeping gene EF1�.

SOD1 protein expression as detected by Western blottingwas enhanced in hMSC-TERT cells cultivated under selenite

Figure 2. Selenoenzyme activity in hMSC-TERT and primary BMSC and ROS accu-mulation in hMSC-TERT. GPx (A) andTrxR activity (B) of hMSC-TERT and pri-mary BMSCs isolated from different sub-jects. Cells were cultivated with (black bars)or without (gray bars) 100 nM selenite sup-plementation. Activity assays were done intriplicates, and the results are expressed asmean � SEM. Statistical analyses were per-formed by using analysis of variance (�, p �.05; ��, p � .005). (C): Reactive oxygenspecies (ROS) accumulation in hMSC-TERTcells. Left: Cells were cultivated in the pres-ence (black line) and absence (gray line) of100 nM selenite. DCFH-DA fluorescence ofcells was determined by fluorescence-acti-vated cell sorting cytometry as an indicatorof ROS accumulation within the cells. Arepresentative result is shown. Right: Me-dian of fluorescence intensity of selenium-deficient (gray bar) and selenium-supple-mented (black bar) hMSC-TERT cells. Theexperiments were repeated three times anddone in triplicates. The results are shown asmean � SEM. Statistical analyses were per-formed by using analysis of variance (��,p � .005). Abbreviations: BMSC, bone mar-row stromal cell; DCFH-DA, dichloro-fluorescein diacetat; GPx, glutathione perox-idase; hMSC-TERT, telomerase-immortalizedhuman mesenchymal stem cell; n.s., not signif-icant; TrxR, thioredoxin reductase.

1231Ebert, Ulmer, Zeck et al.

www.StemCells.com

supplementation and stimulated with 50 �M H2O2 for 8 hours(Fig. 3C, black bar). In cells grown under selenium-deficient con-ditions, SOD1 expression was independent of H2O2 treatment.

SOD1 activity was measured in hMSC-TERT cells cultivatedwith or without selenite supplementation and stimulation with 10,25, and 50 �M H2O2 for 8 hours (Fig. 3D). In selenite-deficientcells, SOD1 activity was only slightly modulated by H2O2 treat-ment and ranged between 70 and 100 U/mg protein (gray bars).Under adequate selenite supplementation, hMSC-TERT cellsshowed a twofold enhancement of SOD1 activity after 8 hours oftreatment with 10 �M H2O2 (black bars). Higher doses of H2O2

could not further stimulate SOD1 activity.

Micronucleus Assay in Primary BMSCsThe occurrence of micronuclei (MN) as a biomarker for DNAdamage was analyzed in primary BMSCs cultivated with orwithout 100 nM selenite. BMSCs of three donors (BMSC274,BMSC276, and BMSC278) in different passages were investi-gated by determining the number of MN per 1,000 cells. Of eachsample, three sets of 1,000 cells were analyzed in a blindedfashion. The results are summarized in Table 2. In cells culti-vated under adequate selenite concentrations, the number of MNwas reduced by a mean of 40% (28.8%–58.3%) compared withcells cultivated under selenite deficiency. MN frequency variedconsiderably between different donors. Figure 4 shows micro-nuclei formation in BMSC276 cultivated under selenium-defi-cient conditions.

Cell Proliferation and Population DoublingWe did not find a significant difference in population doublingtime between selenium-supplemented and control cultures (data

not shown). As is known from the literature, primary BMSCculture could be maintained for three to seven passages inde-pendent of donor age but with a great deal of variation amongindividual donors. The cell doubling rates starting with passage1 varied between 50 and 280 hours.

DISCUSSIONAdult stem cells are rare cells with low proliferation capacity,which according to present hypotheses reside in stem cell nichesand give rise to a transient amplifying cell pool that differenti-ates, thereby regenerating the respective tissues [61]. Mesen-chymal stem cells can be isolated from bone marrow stroma andother sources, and the transient amplifying pool derived from itcan be differentiated towards various mesenchymal pathways,for example, osteogenesis, chondrogenesis, adipogenesis andothers. We used the immortalized cell line hMSC-TERT andprimary cultures of BMSCs to demonstrate that cells cultured invitro under conditions of low selenium supply show symptomsof oxidative stress and that supplementation of selenium repre-sents an adequate countermeasure. The immortalized cell sys-tem was used to get sufficient, reproducible, and unbiased cellmaterial, propagated under long-term low selenium culture con-ditions to yield significant results. The translation of the resultsobtained with this system into primary cultures is of coursehampered by donor differences in expression levels of antioxi-dative systems and in nutritional selenium uptake. This is prob-ably why differences in cellular TrxR activity in individualdonor cell populations were not always significant if basalactivity was individually high (Fig. 2B), whereas GPx activitywas always significantly enhanced in all samples after seleniumsupplementation, probably due to its lower rank in protein

Figure 3. SOD1 expression in hMSC-TERT and primary BMSCs and activity inhMSC-TERT cells cultivated with or without100 nM selenite and stimulated with H2O2.(A): Real-time PCR amplification of SOD1in hMSC-TERT cultivated with (black bars)or without (gray bars) 100 nM selenite sup-plementation and H2O2 stimulation for 0.5–8h. SOD1 expression is normalized to EF1�as a housekeeping gene. Experiments weredone in triplicates; the results are expressedas mean � SEM. Statistical analyses wereperformed by using the relative expressionsoftware tool (REST) [57] (�, p � .05). (B):Real-time PCR amplification of SOD1 inprimary BMSC271 and BMSC280 with(black bars) or without (gray bars) 100 nMselenite supplementation and H2O2 stimula-tion for 0.5–7 h (BMSC271) and 0.5 and 1 h(BMSC280), respectively. SOD1 expressionis normalized to EF1� as a housekeepinggene. Statistical analyses were performed byusing the REST [57] (�, p � .05). (C): West-ern blot detection of SOD1 in hMSC-TERTcells cultivated with or without 100 nM se-

lenite supplementation and stimulation with or without 50 �M H2O2 for 8 h. Signals were quantified by optical densitometry. Experiments were donethree times, and a representative experiment is shown. White bar: No selenite, no H2O2; light gray bar: no selenite, 50 �M H2O2; dark gray bar: 100nM selenite, no H2O2; black bar: 100 nM selenite, 50 �M H2O2. (D): SOD1 activity in hMSC-TERT cells cultivated with (black bars) or without(gray bars) 100 nM selenite supplementation and stimulation with H2O2 with 10, 25, and 50 �M for 8 h. Experiments were done four times, and the resultsare expressed as mean � SEM. Statistical analyses were performed by using analysis of variance (�, p � .05). Abbreviations: BMSC, bone marrow stromalcell; hMSC-TERT, telomerase-immortalized human mesenchymal stem cell; PCR, polymerase chain reaction; SOD, superoxide dismutase.

1232 Oxidative Stress in Bone Marrow Stromal Cells

hierarchy for selenium incorporation [9]. This indicates that—albeit with individual variability—cellular antioxidative capac-ity rapidly decreases ex vivo and/or is primarily low in donorsat risk.

There is ample evidence and consensus that reactive oxygenspecies are indispensable for redox signaling, hormone synthe-sis, and intracellular killing of bacteria [9, 43, 46], but if notappropriately controlled by neutralization and compartmental-ization, they may damage DNA, proteins, and lipids. Preventionand repair of damage by ROS is mediated in a concerted actionof antioxidative systems and DNA repair mechanisms. Anythingbeyond their capacities may cause irreversible damage followedby senescence or tumor promotion [19, 62–66].

As we could show both in immortalized and in primarycells, basal and ROS-stimulated expression of SOD1 is dimin-

ished under conditions of selenium deficiency in standard cellculture systems. Thus, these cells produce less hydrogen perox-ide at the expense of superoxide anion accumulation; for exam-ple, they harbor an increased risk of cell damage [67]. TheSOD1 promoter hydrogen peroxide response element is locatedbetween bases –533 and –520 [68] and may be blocked underthese conditions for unknown reasons, but it is effective afterselenite supplementation. However, this mechanism avoids ad-ditional hydrogen peroxide production—albeit at the risk ofsuperoxide anion accumulation—in a situation in which theneutralization capacity for hydrogen peroxide is impaired due tolow GPx activity.

Having clearly demonstrated these biochemical phenomena,the question of biological consequences was evaluated applyingan ROS production assay in hMSC-TERT cells. Again, in thiscase, the immortalized cells were used to get reproducibleresults and sufficient amounts of cells, and the difference washighly significant in selenium-supplemented versus controlcells. The telomerase transfection overcomes fail-safe programs,and as we have shown previously, these cells in fact harbormutations in culture if maintained under high proliferation pres-sure (Ink4a/ARF, KRAS), which can lead to tumor formation innude mice [69]. Using the micronuclei formation assay in pri-mary cells, we could also demonstrate that in fact significantamounts of micronuclei are formed in culture and that seleniumsupplementation reduced the number of micronuclei up to 58%.The amount of 30–50 micronuclei per 1,000 cells found in somecultures is comparable to reports about micronuclei formation inlymphocytes in patients on chronic hemodialysis [12].

Stem cells are widely used in research to elucidate molec-ular mechanisms of differentiation and to establish cell-basedstrategies of tissue repair, tissue engineering, and transplanta-tion. Thus it appears to be very important to care for the integrityof the genome and proteome of these cells for various reasons,for example, quality and survival of stem cell preparations. Aswe can show here, micronuclei formation as readout of damageof BMSCs ex vivo can be effectively reduced and the antioxi-dative capacity enhanced by the simple means of adding ade-quate amounts of selenium to the culture medium. Seleniumdeficiency has been described to cause cell death in vitro in

Figure 4. Micronuclei formation in BMSC276 cultivated under sele-nium-deficient conditions. Arrows mark micronuclei in four differentcells (magnification �400).

Table 2. MN frequency per 1,000 cells in primary bone marrow stromal cells cultivated with or without 100 nM selenite

PassageMN per 1,000

cells SEM p valueReduction of MN frequency

(%)

BMSC278 2Control 17.4 �4.37 n.s. 28.8Selenite 12.4 �1.45

BMSC276 3Control 39.0 �4.73 n.s. 37.6Selenite 24.4 �4.34

BMSC276 4Control 28.7 �1.20 p � .005 41.9Selenite 16.7 �2.73

BMSC274 6Control 80.0 �1.53 p � .05 58.3Selenite 33.3 �4.84

Data were obtained by using cells from three donors, one in two different passages, and by counting three samples of 1,000 cells persample each in a blinded fashion. The number of micronuclei per 1,000 cells, SEM, p values, and the reduction of MN frequency (%)after selenite supplementation are shown. Statistical analyses were performed using analysis of variance.Abbreviations: MN, micronucleus frequency; n.s., not significant.

1233Ebert, Ulmer, Zeck et al.

www.StemCells.com

Jurkat cells [70], and several specific stem cell media are sup-plemented with selenite for empirical reasons [71]. Our datadeliver a molecular explanation.

In the setting of primary BMSC cultures, it is obvious thatwe can control for the oxidative load and that endogenousfail-safe programs do work since the population doubling ceasesby time and cells stop proliferating in vitro in higher passages.Further translational research is warranted to ever optimizequality and security issues in cell-based therapeutic strategies.

SUMMARYWe show here that under standard cell culture conditions, pri-mary BMSCs have low antioxidative capacity and show symp-toms of cellular stress, such as formation of micronuclei. Thesimple means of selenium supplementation in cultures enhancesmechanisms of selenium-dependent and selenium-independentROS scavenging, restores their antioxidative capacity, and ef-fectively reduces micronuclei formation. We therefore conclude

that selenite supplementation should be part of good medicalpractice in cell cultures used for tissue engineering, geneticengineering, and transplantation to optimize scavenging mech-anisms of ex vivo-manipulated stem cells.

ACKNOWLEDGMENTSWe thank Prof. Dr. Katja Becker-Brandenburg, Giessen, Ger-many, for helpful discussions; Dr. Norbert Schutze, Wurzburg,Germany, for providing the hFOB cell line; Dr. Ulrich Noth andMartina Regensburger, Wurzburg, Germany, for the preparationof primary MSC cultures; and Kristin Kobras, Wurzburg, Ger-many, for help with the micronucleus assay. This work wassupported by German Research Society Priority Program 1087and Research Training Group 639.

DISCLOSURESThe authors indicate no potential conflicts of interest.

REFERENCES

1 Tuan RS, Boland G, Tuli R. Adult mesenchymal stem cells and cell-based tissue engineering. Arthritis Res Ther 2003;5:32–45

2 Cancedda R, Dozin B, Giannoni P et al. Tissue engineering and celltherapy of cartilage and bone. Matrix Biol 2003;22:81–91.

3 Caplan AI, Bruder SP. Mesenchymal stem cells: Building blocks formolecular medicine in the 21st century. Trends Mol Med 2001;7:259–264.

4 Bianco P, Robey PG. Stem cells in tissue engineering. Nature 2001;414:118–121.

5 Noth U, Osyczka AM, Tuli R et al. Multilineage mesenchymal differ-entiation potential of human trabecular bone-derived cells. J Orthop Res2002;20:1060–1069.

6 Pelled GGT, Aslan H, Gazit Z et al. Mesenchymal stem cells for bonegene therapy and tissue engineering. Curr Pharm Des 2002;8:1917–1928.

7 Bianco P, Riminucci M, Gronthos S, Robey PG. Bone marrow stromalstem cells: Nature, biology, and potential applications. STEM CELLS2001;19:180–192.

8 Turgeman G, Aslan H, Gazit Z et al. Cell-mediated gene therapy for boneformation and regeneration. Curr Opin Mol Ther 2002;4:390–394.

9 Kohrle J, Jakob F, Dumont J. Selenium and the endocrine system. EndocrRev 2005;26:944–984.

10 Ghezzi P, Bonetto V. Redox proteomics: Identification of oxidativelymodified proteins. Proteomics 2003;3:1145–1153.

11 Barzilai A, Yamamoto K. DNA damage responses to oxidative stress.DNA Repair (Amst) 3:1109–1115, 2004.

12 Stopper H, Meysen T, Bockenforde A et al. Increased genomic damagein lymphocytes of patients before and after long-term maintenance he-modialysis therapy. Am J Kidney Dis 1999;34:433–437.

13 Stopper H, Hempel K, Reiners C et al. Pilot study for comparison ofreticulocyte-micronuclei with lymphocyte-micronuclei in human bio-monitoring, Toxicol Lett 2005;156:351–360.

14 Fenech M. Chromosomal biomarkers of genomic instability relevant tocancer. Drug Discov Today 2002;7:1128–1137.

15 Fenech M. In vitro micronucleus technique to predict chemosensitivity.Methods Mol Med 2005;111:3–32.

16 Fenech M. The Genome Health Clinic and Genome Health Nutrigenom-ics concepts: Diagnosis and nutritional treatment of genome and epig-enome damage on an individual basis. Mutagenesis 2005;20:255–269.

17 Ruppitsch W, Meisslitzer C, Hirsch-Kauffmann M et al. Overexpressionof thioredoxin in Fanconi anemia fibroblasts prevents the cytotoxic andDNA damaging effect of mitomycin C and diepoxybutane. FEBS Lett1998;422:99–102.

18 Kontou M, Adelfalk C, Ramirez MH et al. Overexpressed thioredoxincompensates Fanconi anemia related chromosomal instability. Oncogene2002;21:2406–2412.

19 Kirkwood TB, Austad SN. Why do we age? Nature 2000;408:233–238.

20 Aigaki T, Seong KH, Matsuo T. Longevity determination genes inDrosophila melanogaster. Mech Ageing Dev 2002;123:1531–1541.

21 Toussaint O, Royer V, Salmon M et al. Stress-induced premature senes-cence and tissue ageing. Biochem Pharmacol 2002;64:1007–1009.

22 Smith SK, Kipling D. The role of replicative senescence in cancer andhuman ageing: Utility (or otherwise) of murine models. Cytogenet Ge-nome Res 2004;105:455–463.

23 Kipling D, Davis T, Ostler EL et al. What can progeroid syndromes tellus about human aging? Science 2004;305:1426–1431.

24 Ito K, Hirao A, Arai F et al. Regulation of oxidative stress by ATM isrequired for self renewal of hematopoetic stem cells. Nature 2004;431:997–1002.

25 Zelko IN, Mariani TJ, Folz RJ. Superoxide dismutase multigene family:A comparison of the CuZn-SOD (SOD1), Mn-SOD (SOD2), and EC-SOD (SOD3) gene structures, evolution, and expression. Free Radic BiolMed 2002;33:337–349.

26 Noor R, Mittal S, Iqbal J. Superoxide dismutase: Applications andrelevance to human diseases. Med Sci Monit 2002;8:RA210–RA215.

27 Kirby K, Hu J, Hilliker AJ et al. RNA interference-mediated silencing ofSod2 in Drosophila leads to early adult-onset mortality and elevatedendogenous oxidative stress. Proc Natl Acad Sci U S A 2002;99:16162–16167.

28 Huang TT, Carlson EJ, Raineri I et al. The use of transgenic and mutantmice to study oxygen free radical metabolism. Ann N Y Acad Sci1999;893:95–112.

29 Huang TT, Raineri I, Eggerding F et al. Transgenic and mutant mice foroxygen free radical studies. Methods Enzymol 2002;349:191–213.

30 Andreassen OA, Ferrante RJ, Dedeoglu A et al. Mice with a partialdeficiency of manganese superoxide dismutase show increased vulnera-bility to the mitochondrial toxins malonate, 3-nitropropionic acid, andMPTP. Exp Neurol 2001;167:189–195.

31 Asikainen TM, Huang TT, Taskinen E et al. Increased sensitivity ofhomozygous Sod2 mutant mice to oxygen toxicity. Free Radic Biol Med2002;32:175–186.

32 Zhang J, Graham DG, Montine TJ et al. Enhanced N-methyl-4-phenyl-1,2,3,6-tetrahydropyridine toxicity in mice deficient in CuZn-superoxidedismutase or glutathione peroxidase. J Neuropathol Exp Neurol 2000;59:53–61.

1234 Oxidative Stress in Bone Marrow Stromal Cells

33 Copin JC, Gasche Y, Chan PH. Overexpression of copper/zinc superox-ide dismutase does not prevent neonatal lethality in mutant mice that lackmanganese superoxide dismutase. Free Radic Biol Med 2000;28:1571–1576.

34 Rushmore TH, Morton MR, Pickett CB. The antioxidant responsiveelement. Activation by oxidative stress and identification of the DNAconsensus sequence required for functional activity. J Biol Chem 1991;266:11632–11639.

35 Chang MS, Lee SG, Rho HM. Transcriptional activation of Cu/Znsuperoxide dismutase and catalase genes by panaxadiol ginsenosidesextracted from Panax ginseng. Phytother Res 1999;13:641–644.

36 Chang MS, Yoo HY, Rho HM. Positive and negative regulatory elementsin the upstream region of the rat Cu/Zn-superoxide dismutase gene.Biochem J 1999;339:335–341.

37 Kim HT, Kim YH, Nam JW et al. Study of 5�-flanking region of humanCu/Zn superoxide dismutase. Biochem Biophys Res Commun 1994;201:1526–1533.

38 Kim YH, Yoo HY, Chang MS et al. C/EBP alpha is a major activator forthe transcription of rat Cu/Zn superoxide dismutase gene in liver cell.FEBS Lett 1997;401:267–270.

39 Minc E, de Coppet P, Masson P et al. The human copper-zinc superoxidedismutase gene (SOD1) proximal promoter is regulated by Sp1, Egr-1, andWT1 via non-canonical binding sites. J Biol Chem 1999;274:503–509.

40 Park EY, Rho HM. The transcriptional activation of the human copper/zinc superoxide dismutase gene by 2,3,7,8-tetrachlorodibenzo-p-dioxinthrough two different regulator sites, the antioxidant responsive elementand xenobiotic responsive element. Mol Cell Biochem 2002;240:47–55.

41 Driscoll DM, Copeland PR. Mechanism and regulation of selenoproteinsynthesis. Annu Rev Nutr 2003;23:17–40.

42 Kyriakopoulos A, Behne D. Selenium-containing proteins in mammalsand other forms of life. Rev Physiol Biochem Pharmacol 2002;145:1–46.

43 Burk RF, Hill KE, Motley AK. Selenoprotein metabolism and function:Evidence for more than one function for selenoprotein P. J Nutr 2003;133:1517S–1520S

44 McKenzie RC, Arthur JR, Beckett GJ. Selenium and the regulation ofcell signaling, growth, and survival: Molecular and mechanistic aspects.Antioxid Redox Signal 2002;4:339–351.

45 Jakob F, Becker K, Paar E et al. Expression and regulation of thioredoxinreductases and other selenoproteins in bone. Methods Enzymol 2002;347:168–179.

46 Ebert-Dumig R, Schutze N, Jakob F. The thioredoxin reductase/thiore-doxin system in cells of the monocyte/macrophage pathway of differen-tiation. Biofactors 1999;10:227–235.

47 Schutze N, Fritsche J, Ebert-Dumig R et al. The selenoprotein thiore-doxin reductase is expressed in peripheral blood monocytes and THP1human myeloid leukemia cells: Regulation by 1,25-dihydroxyvitamin D3and selenite. Biofactors 1999;10:329–338.

48 Simonsen JL, Rosada C, Serakinci N et al. Telomerase expressionextends the proliferative life-span and maintains the osteogenic potentialof human bone marrow stromal cells. Nat Biotechnol 2002;20:592–596.

49 Pittenger MF, Mackay AM, Beck SC et al. Multilineage potential ofadult human mesenchymal stem cells. Science 1999;284:143–147.

50 Schutze N, Noth U, Schneidereit J et al. Differential expression ofCCN-family members in primary human bone marrow-derived mesen-chymal stem cells during osteogenic, chondrogenic and adipogenic dif-ferentiation. Cell Commun Signal 2005;3:5.

51 Harris SA, Enger RJ, Riggs BL et al. Development and characterizationof a conditionally immortalized human fetal osteoblastic cell line. J BoneMiner Res 1995;10:178–186.

52 Dreher I, Schmutzler C, Jakob F et al. Expression of selenoproteins invarious rat and human tissues and cell lines. J Trace Elem Med Biol1997;11:83–91.

53 Holmgren A, Bjornstedt M. Thioredoxin and thioredoxin reductase.Methods Enzymol 1995;252:199–208.

54 Beauchamp C, Fridovich I. Superoxide dismutase: Improved assays andan assay applicable to acrylamide gels. Anal Biochem 1971;44:276–287.

55 Beauchamp CO, Fridovich I. Isozymes of superoxide dismutase fromwheat germ. Biochim Biophys Acta 1973;317:50–64.

56 Spitz DR, Oberley LW. An assay for superoxide dismutase activity inmammalian tissue homogenates. Anal Biochem 1989;179:8–18.

57 Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool(REST©) for group-wise comparison and statistical analysis of relativeexpression results in real-time PCR. Nucleic Acids Res 2002;30:e36.

58 Royall JA, Ischiropoulos H. Evaluation of 2�,7�-dichlorofluorescin anddihydrorhodamine 123 as fluorescent probes for intracellular H2O2 incultured endothelial cells. Arch Biochem Biophys 1993;302:348–355.

59 Kane DJ, Sarafian TA, Anton R et al. Bcl-2 inhibition of neural death:Decreased generation of reactive oxygen species. Science 1993;262:1274–1277.

60 Carter WO, Narayanan PK, Robinson JP. Intracellular hydrogen perox-ide and superoxide anion detection in endothelial cells. J Leukocyte Biol1994;55:253–258.

61 Fuchs E, Tumbar T, Guasch G. Socializing with the neighbors: Stemcells and their niche. Cell 2004;116:769–778.

62 Soti C, Sreedhar AS, Csermely P. Apoptosis, necrosis and cellularsenescence: Chaperone occupancy as a potential switch. Aging Cell2003;2:39–45.

63 de Boer J, Andressoo JO, de Wit J et al. Premature aging in micedeficient in DNA repair and transcription. Science 2002;296:1276–1279.

64 Bohr VA. DNA-related pathways defective in human premature aging.Scientific World Journal 2002;2:1216–1226.

65 Linton S, Davies MJ, Dean RT. Protein oxidation and ageing. ExpGerontol 2001;36:1503–1518.

66 Mohaghegh P, Hickson ID. Premature aging in RecQ helicase-deficienthuman syndromes. Int J Biochem Cell Biol 2002;34:1496–1501.

67 Boonstra J, Post JA. Molecular events associated with reactive oxygenspecies and cell cycle progression in mammalian cells. Gene 2004;337:1–13.

68 Yoo HY, Chang MS, Rho HM. The activation of the rat copper/zincsuperoxide dismutase gene by hydrogen peroxide through the hydrogenperoxide-responsive element and by paraquat and heat shock through thesame heat shock element. J Biol Chem 1999;274:23887–23892.

69 Serakinci N, Guldberg P, Burns JS et al. Adult human mesenchymal stemcell as a target for neoplastic transformation. Oncogene 2004;23:5095–5098.

70 Saito Y, Yoshida Y, Akazawa T et al. Cell death caused by seleniumdeficiency and protective effect of antioxidants. J Biol Chem 2003;278:39428–39434.

71 Guan K, Furst DO, Wobus AM. Modulation of sarcomere organizationduring embryonic stem cell-derived cardiomyocyte differentiation. EurJ Cell Biol 1999;78:813–823.

1235Ebert, Ulmer, Zeck et al.

www.StemCells.com