Biochimica et Biophysica Acta 1830 (2013) 3846–3857

Contents lists available at SciVerse ScienceDirect

Biochimica et Biophysica Acta

j ourna l homepage: www.e lsev ie r .com/ locate /bbagen

Protein disulfide isomerase and glutathione are alternative substratesin the one Cys catalytic cycle of glutathione peroxidase 7

Valentina Bosello-Travain a, Marcus Conrad b, Giorgio Cozza c, Alessandro Negro c, Silvia Quartesan a,Monica Rossetto a, Antonella Roveri a, Stefano Toppo a, Fulvio Ursini a, Mattia Zaccarin a, Matilde Maiorino a,⁎a Department of Molecular Medicine, University of Padova, Viale G. Colombo, 3, I-35121-Padua, Italyb Institute of Developmental Genetics, Deutsches Zentrum für Neurodegenerative Erkrankungen and Helmholtz Zentrum München, Ingolstädter Landstrasse 1,D-85764 Munich-Neuherberg, Germanyc Department of Biomedical Sciences, University of Padova, Viale G. Colombo, 3, I-35121-Padua, Italy

Abbreviations: CysGPxs, subfamily of glutathione perocenter; 1CysGPx, a glutathione peroxidase containing theperoxidases containing both the CP and the CR; CP, peroGPx7, glutathione peroxidase 7; ER, endoplasmic reticulGSSG, oxidized glutathione; GPxs, glutathione peroxidasease; PCOOH, phosphatidylcholine hydroperoxide; Prdxs,peroxide; Sec, Selenocysteine; SecGPxs, subfamily of gluta Sec redox center; Syn, synuclein; Trx, thioredoxin; Trperoxidatic Selenocysteine⁎ Corresponding author at: Department of Molecular

I-35121 Padova, Italy. Tel.: +39 049 8276103; fax: +39E-mail address: matilde.maiorino@unipd.it (M. Maio

0304-4165/$ – see front matter © 2013 Elsevier B.V. Alhttp://dx.doi.org/10.1016/j.bbagen.2013.02.017

a b s t r a c t

a r t i c l e i n f o

Article history:

Received 15 November 2012Received in revised form 11 February 2013Accepted 19 February 2013Available online 27 February 2013

Keywords:KineticsGlutathione peroxidasePeroxideRedox switchRedoxin

Background: Mammalian GPx7 is a monomeric glutathione peroxidase of the endoplasmic reticulum (ER),containing a Cys redox center (CysGPx). Although containing a peroxidatic Cys (CP) it lacks the resolvingCys (CR), that confers fast reactivity with thioredoxin (Trx) or related proteins to most other CysGPxs.Methods: Reducing substrate specificity and mechanism were addressed by steady-state kinetic analysis of wildtype or mutated mouse GPx7. The enzymes were heterologously expressed as a synuclein fusion to overcomelimited expression. Phospholipid hydroperoxide was the oxidizing substrate. Enzyme–substrate and protein–protein interaction were analyzed by molecular docking and surface plasmon resonance analysis.Results:Oxidation of the CP is fast (k+1 > 103 M−1 s−1), however the rate of reduction by GSH is slow (k′+2 =12.6 M−1 s−1) even though molecular docking indicates a strong GSH–GPx7 interaction. Instead, the oxidizedCP can be reduced at a fast rate by human protein disulfide isomerase (HsPDI) (k+1 > 103 M−1 s−1), but not byTrx. By surface plasmon resonance analysis, a KD = 5.2 μMwas calculated for PDI–GPx7 complex. Participation

of an alternative non-canonical CR in the peroxidatic reaction was ruled out. Specific activity measurements inthe presence of physiological reducing substrate concentration, suggest substrate competition in vivo.Conclusions: GPx7 is an unusual CysGPx catalyzing the peroxidatic cycle by a one Cys mechanism in which GSHand PDI are alternative substrates.General significance: In the ER, the emerging physiological role of GPx7 is oxidation of PDI, modulated by theamount of GSH.

© 2013 Elsevier B.V. All rights reserved.

1. Introduction

Non-hemeperoxidases include two non-homolog families that havein common the typical thioredoxin (Trx) fold and ping-pong catalyticmechanism. Thus, glutathione peroxidases (GPxs), using either seleni-um or sulfur as their redox center, and peroxiredoxins (Prdxs), whichonly use sulfur in their redox centers [1], have major similarities.

xidases containing a Cys redoxCP only; 2CysGPxs, glutathionexidatic Cys; CR, resolving Cys;um; GSH, reduced glutathione;s; PDI, protein disulfide isomer-peroxiredoxins; ROOH, hydro-athione peroxidases containingxR, thioredoxin reductase; UP,

Medicine, Viale G. Colombo 3,049 8073310.rino).

l rights reserved.

Selenoperoxidases (SecGPxs) are typical of vertebrates. The catalyticmoiety selenium is incorporated as selenocysteine, the ‘peroxidatic’selenocysteine, UP- in the growing peptide chain [2]. The members ofthis subfamily encompass both monomeric and tetrameric members,typically using glutathione (GSH) as the electron donor. Kinetics sug-gested that the UP selenol, upon oxidation by a hydroperoxide (ROOH),is oxidized to selenenic acid (Eq. (1)), in turn reacting with GSH andforming amixed seleno-disulfide (Eq. (2)). The latter is reduced by a sec-ond GSH, releasing GSSG and regenerating the catalyst (Eq. (3)) [3,4]:

ROOHþHSe⋯ SecGPxð Þ→ROHþHOSe⋯ SecGPxð Þ ð1Þ

GSHþ HOSe⋯ SecGPxð Þ→H2Oþ GS–Se⋯ SecGPxð Þ ð2Þ

GSHþ GS–Se⋯ SecGPxð Þ→GSSGþHSe⋯ SecGPxð Þ: ð3Þ

In contrast, in invertebrates and the plant kingdom, the sub-familyof sulfur-containing peroxidases (CysGPxs) encompasses almost ex-clusively monomeric proteins containing a peroxidatic Cys residue

3847V. Bosello-Travain et al. / Biochimica et Biophysica Acta 1830 (2013) 3846–3857

(Cp) in place of the UP. Here the CP is accompanied by an intra-chainCys residue located within the so-called ‘Cys block’ (Fig. 1), within theα4 helix of the thioredoxin fold. This second Cys participates in the re-action as the ‘resolving Cys’ (CR). Hence invertebrate and plantCysGPxs can be referred to as ‘2CysGPxs’. The CR endows reactivitywith some redoxins, i.e. the Trx or Trx-related proteins, while muta-tion of the CR, abolishes the peroxidase activity [5].

The reaction mechanism of invertebrate and plant 2CysGPxs is sim-ilar to that of atypical Prdxs [1,6]. The CP, oxidized to the sulfenic acidderivative upon reaction with ROOH, reacts with the CR, to form anintra-chain disulfide (Eqs. (4) and (5)). This disulfide intermediate is re-duced by a CXXC motif of the redoxin in two steps: the N-terminal Cysof the CXXCmotif attaches the CR of the peroxidase forming amixed di-sulfide (Eq. (6)), which is displaced by the C-terminal Cys of the CXXCmotif of the redoxin (Eq. (7)) [5,7]:

ROOHþHS⋯ CPCysGPxCRð Þ⋯SH→ROHþHOS⋯ CPCysGPxCRð Þ⋯SH ð4Þ

Fig. 1. Alignment of different GPx7 homologues with other GPxs. Human GPx1 and 4 have2CysGPxs. The peroxidatic residue of GPxs (either Cys or Sec) is indicated by an arrow. Thein the 2CysGPxs, is indicated. Note that the CR is present in the DmGPx and the yeast GPx3retention sequence of GPx7 are boxed. Accession numbers are the following: NP_05651NP_001088904.1, for Xenopus laevis GPx7 (X. laevis GPx7); AAF47761.1, for the GPx of DGPx1 (HsGPx1). Sequence identity score between HsGPx7 and MmGPx7 is 90%.

termediate is produced upon reaction with the hydroperoxide thatis then efficiently reduced by the CXXC motif of the redoxin. In the

Briefly, in 2CysGPx and atypical Prdx, an intra-chain disulfide in-

peroxidases relying on Sec catalysis, typically lacking the CR, the reac-tion with the hydroperoxide generates a selenenic acid intermediate,which is reduced by GSH in two steps. This, seemingly, descends fromthe peculiar reactivity of selenium. The recent discovery of rare Prdxsand GPxs, containing the CP but missing the CR residue, hence referredto as 1CysPrdx and 1CysGPxs, challenges this paradigm.

In mammalian cells, two monomeric 1CysGPxs (GPx7 and GPx8)have been described in endoplasmic reticulum (ER) [8,9]. Phylogenysuggests that they represent a branch in the evolution of themonomericSecGPx4. Given that the common ancestor of GPxs is a Cys-containingenzyme, the evolution of GPx7 and GPx8 from SecGPx4 indicates a re-cent, intriguing reversion to usage of Cys in the catalytic center [10].

been taken as examples for SecGPxs, Drosophila melanogaster GPx and yeast GPx3 for‘Cys block’ within the α4 helix of the dimer interface, where the CR is usually locatedsequences only. The putative signal peptide, the conserved PCNQF motif, and the ER1.2, for human GPx7 (HsGPx7); NP_077160.1, for Mus musculus GPx7 (MmGPx7);rosophila melanogaster (DmGPx); P40581.1, for yeast GPx3; NP_000572.2, for human

3848 V. Bosello-Travain et al. / Biochimica et Biophysica Acta 1830 (2013) 3846–3857

According to the above paradigm both, GPx7 and GPx8 areexpected to not accept electrons from a redoxin. Yet, it has been re-cently suggested that they react faster with protein disulfide isomer-ase (PDI) and other PDI family members, than GSH [9]. In that studyhowever, the assay with PDI was carried out in the presence of GSH,thus preventing the precise assessment of the actual capability ofthe peroxidase to use PDI directly as a reducing substrate. Moreover,an unrealistically low second order rate constant, deduced from thespecific activity, was reported. In this study, we specifically addressthe analysis of the kinetics of the catalytic cycle of GPx7, aiming toget information on the rate constant of the oxidative and reductivesteps of the cycle that are relevant for gaining an insight into thephysiological function of the enzyme.

2. Material and methods

2.1. RT-PCR analysis

Detection of GPx7 in human tissues was performed by PCR using ahuman cDNA panel as template (Clontech laboratories, Inc., Palo Alto,CA, USA). QuantumRNA classic II 18S (Ambion Inc., Austin, TX, USA)was used for internal control. GPx7 primers were the following: fw:ACTGGTGTCGCTGGAGAAGT rev: GTCTGGGCCAGGTACTTGAA. FortyPCR cycles were applied at the annealing temperature of 58 °C.

2.2. Plasmid constructs

The expression vector containing chimeric mouse GPx7 (MmGPx7)(accession number NM_024198) fused to human synuclein–pRSET/(Syn)GPx7-, was obtained by conventional cloning of the PCR productobtained using a cDNA from mouse liver tissue using the followingprimers fw: GCGGATCCCAATCCGAGCAGGACTTCTACG; rev: GTGGAATTCCACAAGTCTTTCGTTTCCGAAG. After digestion, the PCR productwas cloned in the BamHI and EcoRI sites of the plasmid pSynA, preparedas described below. The product of this vector is (Syn)GPx7. The pRSETplasmid encoding for human alpha-synuclein (pSynA) has been de-scribed [11]. A modified nucleotide sequence without the inner restric-tion sites BamHI and EcoRI encoding the same protein sequence wasobtained by site-directed mutagenesis. The stop codon was replacedby a nucleotide linker sequence encoding for a thrombin cleavage site(ASLVPRGS amino acid sequence) and by nucleotide sequence con-taining the restriction sites BamHI and EcoRI in order tomake the fusionvector pSynA encoding for GPx7-pSynA/(Syn)GPx7-.

(Syn)GPx7 was mutated at the residue Cys 85 of the MmGPx7sequence to yield (Syn)GPx7C85A by PCR, using pRSET/(Syn)GPx7 astemplate and iProof High Fidelity Polymerase turbo (Bio-Rad Laborato-ries, Veenendaal, Holland) using the following primers (changed co-dons in italics): fw: TAATGTGCTTGCCTTCCCTGCCAACCAGTTTGGCCAACAGG; rev: CCTGTTGGCCAAACTGGTTGGCAGGGAAGGCAAGCACATTA.

HsPDI was obtained by cloning in the multicloning site (BamHI/KpnI) of the pQE30 vector (Qiagen, Hilden, Germany) the PCR productobtained from human cDNA by the primers

fw: ATAAGGATCCGACGCCCCCGAGGAGGAGGACrev: ATTAGGTACCTTACAGTTCATCTTTCACAGCT (NCBI ReferenceSequence: NP_000909.2), which yielded the plasmid PQE30/HsPDI.

Correctness of constructs was verified by sequencing.

2.3. Heterologous expression, preparation of the bacterial extract andquantification of recombinant enzymes

For production of recombinant (Syn)GPx7 or (Syn)GPx7C85A, com-petent BL21 (DE3) pLysS Escherichia coli cells, which allows high-efficiency protein expression of genes under the control of a T7 promot-er, were transformed with the vector pSynA/(Syn)GPx7. Expression

was induced by adding 1 mM isopropyl-b-D-thiogalactopyranoside(IPTG) and cells were harvested after 3 h by centrifugation at 5000 ×gfor 30 min. The pellet was stored at −80 °C for no longer than oneweek or immediately lysed. For lysis, bacterial pellets obtained from1 l of culture were suspended by 30 ml of cold lysis buffer (0.1 MTris–HCl, pH 7.4, 5% Nonidet, 0.15 M KCl, 0.1% Triton X-100, 3 mMGSH containing protease inhibitors (–0.1 mg/ml PMSF, 0.7 mg/mlpepsatin, 0.5 mg/ml leupeptin – for 15 min at 4 °C, under slow agita-tion. After centrifugation at 29,000 ×g for 30 min at 4 °C, the superna-tant was immediately used as enzyme source for activity/kineticanalysis. Protein was quantified by the Bradford assay [12].

Quantitation of (Syn)GPx7 or (Syn)GPx7C85A within the 29,000 ×gsupernatant from induced bacterial lysate was obtained by westernblotting (see below) using known amounts of purified (Syn)GPx7 forthe standard curve and polyclonal antibody to human GPx7 obtainedfrom Abnova (Heidelberg, Germany). To this end, the bacterial extractexpressing (Syn)GPx7 was purified by nickel affinity chromatography(Ni-NTA, Qiagen, Hilden, Germany), followed by a Superdex 75 column(26 mm × 620 mm) as described [5]. This procedure yielded the per-oxidase in its inactive form. A calibration curve was obtained from thedigitized read-out of western blot spots.

Human recombinant PDI (HsPDI) was obtained as indicated above,after transforming the E. coli JM 109 strain by the PQE30/HsPDI con-struct. Bacterial pellets obtained from 1 l of culture were suspendedby 60 ml of cold B-Per extraction reagent (Pierce, Rockford, IL, USA)containing protease inhibitors as above, and stirred for 10 min onice to obtain cell lysis. After centrifugation (20,000 ×g, 30 min), thesupernatant was diluted 1:1 (v/v) with 50 mM Tris–HCl, 1 M NaCl,20% (v/v) glycerol, 0.2% (v/v) Triton X-100 (pH 7.4), purified byNi-NTA chromatography and size exclusion chromatography as de-scribed, except that the reductant was omitted [5]. The protein wasthen concentrated and quantified as above [12]. HsPDI is recoveredin its disulfide form after this procedure.

Human thioredoxin, having the wild type sequence except for aCys72 to Ser mutation to prevent dimerization (HsTrxC72S) [13], wasobtained by recombinant expression and purification as described [5].

2.4. Western blotting

For quantifying (Syn)GPx7 in the supernatant from the induced bac-terial lysate, western blotting was performed as previously described[14] using commercially available polyclonal antibody toGPx7 (Abnova,Heidelberg, Germany), and revealed using horseradish peroxidase-conjugated secondary antibody (Santa Cruz Biotechnology, Santa Cruz,CA, USA) and a freshly prepared luminol solution (1.1 mM luminol,1 mM 4-jodophenol, 0.12% BSA, 1.4 M H2O2, 0.025 mM Tris–HClpH 9.25). Densitometric analysis of immunoblots was obtained usingan Image Station 440 (Kodak, Rochester, NY, USA).

2.5. Peroxidase activity assay and kinetic analysis

The coupled assay for glutathione peroxidases was used for mea-surements of peroxidase activitywith different substrates and for kinet-ic analysis. A single-beamBeckman DU70 spectrophotometer was used.Before the assay, the buffer of the supernatant from the induced bacte-rial lysate expressing (Syn)GPx7/Syn/(Syn)GPx7C85A was exchangedwith the assay buffer (0.1 M Tris–HCl, pH 7.6 containing 5 mM EDTA,1 mM NaN3, 0.1% Triton X-100) by a NAP-5 column chromatography,repeated twice (GE healthcare, Buckinghamshire, UK).

For GSH peroxidase activity, 3 mM GSH was then added, togetherwith 0.15–0.3 mM NADPH and 3 U/ml glutathione reductase and vol-ume adjusted to 2.5 ml with the assay buffer. Reaction started by20–25 μM, phosphatidylcholine hydroperoxide (PCOOH). Reactionwas recorded until complete consumption of substrate. PCOOH dis-persion was prepared and quantitated as described [15].

3849V. Bosello-Travain et al. / Biochimica et Biophysica Acta 1830 (2013) 3846–3857

Trx or PDI peroxidase activities were determined as above by re-placing GSH with 5.0 μM HsTrxC72S or 10 μM HsPDI, respectively,and glutathione reductase with a nonlimiting amount of Plasmodiumfalciparum thioredoxin reductase (PfTrxR) prepared as described [5],or a non-limiting amount of rat liver thioredoxin reductase (RrTrxR)(Sigma-Aldrich, Saint Louis,Missouri, USA) [16]. A non-limiting amountis an appropriate amount of ancillary enzyme whose activity is at leastone order of magnitude higher than the activity under scrutiny. Thiscorresponded to 3 U/ml for PfTrxR and 4 U/ml for RrTrxR. The extinc-tion coefficient of 6220 M−1 cm−1 was used for calculations [17].

HsTrxC72S or HsPDI concentration was routinely calculated spectro-photometrically, recording, as a function of time, the fast phase ofNADPH oxidation following a definite amount of Trx or PDI addition inthe presence of PfTrxR or RrTrxR, respectively. One mole of HsTrxC72S

contains one CXXC center, thus 1 mol of NADPH reduces 1 mol of oxi-dized HsTrxC72S. One molecule of HsPDI contains two reducible CXXCcenters, thus 2 mol of NADPH reduces 1 mol of oxidized HsPDI. Thisquantitation procedure was previously validated by titrating redoxinthiol groups by reaction with 5,5′-dithiobis-2-nitrobenzoic acid (DTNB)and monitoring at 412 nm [16].

Kinetic analysis was carried out by analyzing the single progressioncurve of NADPH oxidation, as already reported for GPx4 or DmGPx[5,18,19]. Briefly, the digitized absorbance data vs. time, produced bythe spectrophotometer, were used to evaluate the substrate concentra-tion and the reaction rate at each time interval (typically from 1 to3 min). The reaction rate was corrected for the non-specific GSH/HsPDIoxidation rate. Non-specific PCOOH reduction in the absence of cell ex-tract was negligible and thus not considered. The data obtained werefitted to the simple version of the Dalziel equation [20], which, forGPxs, can be written as follows:

E=vo ¼ Φ0 þΦ1= ROOH½ � þΦ2= RSH½ �: ð8Þ

Where [ROOH] and [RSH] represent the molar concentration of hy-droperoxide and thiol respectively. The Φ1 and Φ2 parameters wereobtained by double reciprocal plot, in which the reciprocal velocitiesweremultiplied by enzymemolarity [18–20], as the slope and the inter-cept, respectively.Φ1 represents the reciprocal value of the rate constantfor the first enzyme oxidation reaction (Eqs. (1) and (4) and Scheme 1)andΦ2 represents the reciprocal value of the sumof the rate constants ofthe two reducing half reactions (Eqs. (2–3) and (6–7) and Scheme 1).The value of Φ0, which is equivalent to the reciprocal of the maximumturnover number, is 0 in themajority of GPxs so far studied [5], in agree-ment with non-saturation kinetics where substrate transformation ismuch faster than enzyme substrate interaction. In our kinetic analysis,the value ofΦ0 calculated for GSH resulted > 0, suggesting a saturationkinetics in respect to GSH. To better describe this aspect, in this studywe

GPx(red)

ROOH ROH RSH H2 O

GPx(ox) GPx-SRk+1 k+2

k+3

k+2 + k+3= +2

Scheme 1. General reaction pathway of GPxs describing the enzyme-substitutionmechanism. The rate constant k+1 is equivalent to reciprocal of the value of theslope in double reciprocal plot, where 1/ROOH is plotted vs. [E]/v, which yields theterm Φ1 in the Dalziel Eq. (8). The rate constant k′+2 represents the sum of the rateconstants of the two reducing half reactions (i.e. k+2 + k+3) and is equivalent to thereciprocal of the intercept in the same plot, yielding Φ2 in the Dalziel Eq. (8). RSHand R′SH can be either two molecules of GSH or the N-terminal and C-terminal SH ofthe CXXC motif of the redoxins. See also Eqs. (1–3) and (4–7).

used a direct computational approach to give an account for the interac-tion between enzyme andGSH (see below) and the calculation of the ki-netic coefficientΦo was not specifically addressed.

2.6. Identification of the adduct between the CP of GPx7 and GSH

The supernatant from the induced bacterial lysate, containingapprox. 60 μg of (Syn)GPx7, obtained as described above was reducedby 1 mM dithiotreitol (DTT) on ice. After 30 min, the buffer was ex-changed to 0.1 MTris–HCl pH 7, containing 1 mMEDTA, 0.1% v/v TritonX-100, 1 mMGSH in two consecutive passages through Micro Bio-Spinchromatography columns (Bio Rad Laboratories, Inc). To the recoveredsample, approximately 2 μM PCOOH was added. After 10 min of incu-bation at RT, the reaction ended by adding 25 mM N-ethyl maleimide(NEM) to avoid thiol scrambling. The sample then underwent acidicprecipitation, tryptic digestion and MS/MS analysis as reported below.

2.7. MS/MS analysis

After NEM addition, samples were incubated for 30 min andsubjected to multiple acidic precipitation with 0.01% (w/v) sodiumdeoxycholate (DOC) and 6% (v/v) trichloroacetic acid (TCA). Trypticdigestion of ethanol washed sample pellets was performed overnightat 37 °C in the presence of 40 mM ammonium bicarbonate bufferpH 8.0, containing 1 mM EDTA, with a protease to protein ratio of1:50. After stopping digestion by formic acid acidification, sampleswere dried by vacuum centrifugation and suspended in 0.1% (v/v)formic acid aqueous solution for MS analysis. Peptides mix fromeach digested sample were separated before ionization by reversephase chromatography on a 1200 Rapid Resolution system equippedwith a nanofluidic chip directly interfaced with a nanoESI sourcefrom the 6520 Accurate-Mass Q-TOF LC/MS mass spectrometer(Agilent Technologies, Santa Clara, CA, USA). Separation was achievedby a 3% to 70% acetonitrile gradient onto a C18 Zorbax capillary col-umn at a flow of 300 nl/min. MS acquisition was performed from350 to 2400 m/z at a scan rate of 2 spectra/s, while MS/MS analysiswas performed from 59 to 3000 m/z at the same scan rate in a data-dependent way on the four most abundant precursor in each MSscan. Collision Induced Dissociation (CID) was used for selected pre-cursor ion fragmentation given a function for collision energy of3.7 V/(100 Da) with an offset of 2.5 V. Obtained MS and MS/MS datawere processed by the MassHunter Workstation — Qualitative Analy-sis (B.02.00) suite (Agilent Technologies, Santa Clara, CA, USA). Suit-able custom database was developed for use with Mascot release 2.3(www.matrixscience.com) merging the entire bacterial proteomewith sequence from GPx7 fusion construct. Tolerance of ±5 ppmand ±0.05 Da was considered respectively for precursor and frag-ment ions database matching. Identified peptides containing Cysfrom GPx7 were compared using in house tuned LabKey Server v11.2.

2.8. Molecular modeling

Human GPx7 structure was retrieved from the PDB (PDB code:2P31) and processed in order to remove water molecules. Hydrogenatoms were added using standard geometries to the protein structureby the MOE program [21]. To minimize contacts between hydrogens,the structures were subjected to Amber99 force field minimizationuntil the rms of conjugate gradient was b0.1 kcal mol−1 Å−1 keepingthe heavy atoms fixed at their crystallographic positions [21]. GSHstructure was built using MOE-builder tool, part of the MOE suite[21] and was subjected to MMFF94x energy minimization until therms of conjugate gradient was 0.05 kcal mol−1 Å−1. Charges werecalculated using ESP methodology. Three different programs havebeen used: MOE-Dock [21], GOLD [22] and Glide [23]. The estimatedassociation constant (pK), was calculated using MOE suite, expressedas the summation of a directional hydrogen-bonding term, a

Fig. 2. Human tissues expressing GPx7. PCR analysis was performed on cDNAs fromhuman tissues using specific GPx7 primers. 18S was detected as internal standard.Lanes are as follows: 1: heart, 2: brain, 3: liver, 4: placenta, 5: skeletal muscle. M.W.,molecular weight markers. The expected length of GPx7 and 18S is 298 and 320 bp, re-spectively. Since 40 PCR cycles were applied, no judgment of tissue-specific expressionis possible. Represented is one of two replicates.

3850 V. Bosello-Travain et al. / Biochimica et Biophysica Acta 1830 (2013) 3846–3857

directional hydrophobic interaction term, and an entropic term. Thecenter of the docking box or of the docking sphere was set at Cys 57with a radius of 12 Å.

2.9. Surface plasmon resonance (SPR) analysis of the GPx/PDI interaction

(Syn)GPx7 was purified and digested by thrombin to obtain pureMmGPx7, lacking the Syn fusion. To this end, (Syn)GPx7 was purifiedby Ni-NTA [5] and digested by thrombin, and further Ni-NTA purified toremove Syn. This procedure yielded homogeneous MmGPx7. After ex-changing protein buffer into 20 mM Tris–HCl, 100 mM NaCl, 1 mMMgCl2, 10 units of thrombin (Sigma) per milligram of protein wasadded and incubated overnight at room temperature. Reaction wasstopped by adding protease inhibitors. Purified GPx of Drosophilamelanogaster, DmGPxwt, or its CR mutant DmGPxC91K [5] were subjectedto SPR analysis to quantify the kinetic constants for PDI binding using aBiacore T100 biosensor system (BIAcore, Upsala Sweden). To this end, pu-rified HsPDI was bound to the sensor surface (CM5 sensor chip) utilizingthe reaction between amino groups of the protein and the carboxylgroups of the sensor chip. Following the activation of the latter with1-ethyl-3-(3-dimethylaminopropyl)carbodiimide/N-hydroxysuccinimide(EDC/NHS) (0.2/0.05 M), a 10 μl/min constant flux of HsPDI (30 μg/ml in10 mM acetate at pH 4.0) was injected in the flow cell, until the immobi-lization level of 600 RU was reached. Ethanolamine (1 M, pH 8.5) wasused for the deactivation of excess reactive carboxyl groups. For blanksubtraction, the reference flow cell was activated with EDC/NHS andthen deactivated with ethanolamine. Before proceeding with protein–protein interaction experiment, the HsPDI modified sensor chip wasequilibrated with the running buffer HBS-EP + (10 mM Hepes pH 7.4,150 mM NaCl, 3 mM EDTA, 0.05% Biacore surfactant P20) at flow rate of30 μl/min. In addition, 30 μl/min of 50 mM DTT was injected 10 min be-fore each daily experimental set. Kinetic analysis of the binding wasperformed by successive injections of different concentrations of each pu-rified enzyme (ranging 0.10–40 μM), diluted in HBS-EP+. Regenerationof the sensor chip after each binding events was obtained with 0.1% SDS.

3. Results

3.1. GPx7 structural organization and expression in human tissues

The primary structure of GPx7 from different species, aligned withthat of homologous GPxs, shows the conserved CP in the expected posi-tion and the absence of the canonical CR that is almost invariably foundin other members of the CysGPx subfamily (Fig. 1). As in the latter, thetetramerization interface in GPx7 is absent, consistently with a mono-meric structure. Peculiar to GPx7 however, is the N-terminal stretchthat is a putative signal peptide typical of the proteins of the secretorypathway, as computationally predicted (Signal Pv3 program (http://www.cbs.dtu.dk/services/SignalP/)). A C-terminal (K)REDL (KKEEL inXenopus laevis GPx7) motif is also present, which suggests ER retention.The latter, however, does not fully match the annotation in Prosite([KRHQSA]-[DENQ]-E-L) for ER resident proteins [24,25]. Although ini-tially reported to be in a cytosolic location [8], GPx7 was subsequentlydescribed as an ER protein by immunohistochemical studies [9]. Itwas also shown that deletion of the REDL motif moves the proteinfrom the ER to the Golgi [25].

In this study we provide further evidence for ER localization ofmature GPx7, by demonstrating that both the N-terminal signal pep-tide and the C-terminal KREDL motif of mammalian GPx7 are func-tional (Supplementary Fig. 1). In fact, the putative N-terminal signalpeptide is cleaved off in the mature protein, indicating that GPx7 fol-lows the secretory pathway (Supplementary Fig. 1A). Furthermore,deletion of the KREDL motif, allows mature GPx7 to partially escapethe cell, demonstrating that the KREDL motif is involved at least par-tially in retaining GPx7 within the cell (Supplementary Fig. 1B).

In the human tissues investigated, GPx7 specific primers detectedthe transcript. Notably the transcript was observed also in the liver,where, in the mouse, it was not previously detected [8] (Fig. 2).

3.2. Heterologous expression of GPx7

Kinetic analysis of the reaction of GPx7 requires an amount of en-zyme that can only be obtained by heterologous expression. In ourhands, the expression of GPx7 in E. coli by the usual pQE30 expressionsystem yielded an amount of enzyme too low for kinetic studies. Toovercome this limit, we expressed GPx7 as a fusion protein withsynuclein (Syn), a methodology previously adopted successfully inour laboratory to prepare otherwise poorly expressed proteins.Human Syn was fused with the N terminus of mouse GPx7, devoidof the signal peptide by the pSynA expression vector, which producesN terminal His-tagged proteins (pSynA/(Syn)GPx7) (Fig. 3A). Thisstrategy led to the required high yield of the chimeric peroxidase(Syn)GPx7, which resulted in it being the most abundant protein inthe bacterial supernatant (approx. 65% of the total proteins) (Fig. 3B).

Although bacterial extract exhibited a peroxidase activity withGSH suitable for kinetic studies, purification by Ni-NTA affinity chro-matography caused an irreversible loss of activity. The most likely hy-pothesis for this loss is an oxidative inactivation of the active site,which was examined by MS/MS analysis. In the purified protein, themolecular weight of the CP increased in a variable, but always rele-vant percentage, of 32 or 48 amu (Fig. 4), demonstrating that thelack of activity was due to an artifactual oxidation of the CP to sulfinicand sulfonic acid derivatives. The oxidative lability of CP, which wasalso observed in the presence of metal chelating agents and reduc-tants such as mercaptoethanol or GSH, discouraged us from tryingother chromatographic approaches.

3.3. Kinetics of GSH peroxidase activity

Previous studies suggest that monomeric GPxs reduce bothPCOOH and H2O2 at similar rates [18]. Thus both substrates are suit-able substrates for kinetic analysis of chimeric GPx7. Nonetheless, asin this study a non-homogeneous enzyme was used, the specificityof the assay required validation. The complete absence of any perox-idase activity with PCOOH in the bacterial extract, transformed with acontrol plasmid, eliminated the possibility of competing activities(Fig. 5A). Competing activity was however, observed when H2O2

A

B

Fig. 3. The pSynA/GPx7 vector containing the fusion (Syn)GPx7 and heterologous ex-pression thereof. A) Scheme of the pSynA/GPx7construct. It contains an inducible T7RNA polymerase promoter, and encodes for an N terminal His6 tag fused to humanα-synuclein and mouse GPx7, which lacks the putative N-terminal signal peptide.The asterisk indicates the thrombin cleavage site. B) SDS-PAGE analysis of the29,000 ×g supernatant from induced bacterial lysate. Lanes are as follows: 1, 2 μl of a1:50 dilution of the 29,000 ×g supernatant from the induced bacterial lysate express-ing (Syn)GPx7; MW, molecular weight markers. The amount of (Syn)GPx7 was quan-tified by densitometric analysis and estimated as 65% of the total supernatant proteins.Typical yield is around 40 mg of (Syn)GPx7 per liter of bacterial culture.

3851V. Bosello-Travain et al. / Biochimica et Biophysica Acta 1830 (2013) 3846–3857

was the hydroperoxide substrate (not shown). Thus PCOOH fulfilledRacker's rule dictating that there must be no more than one enzymeactivity on with the same substrate in the sample [26].

The unlikely hypothesis that recombinant GPx7 could react withan E coli redoxin and that a redoxin-catalyzed GSH oxidation wouldthen take place could not be excluded in principle.

It was however, falsified by the observation that reactivitywith con-taminating proteins in crude samples, was never observed even forthose enzymes forwhich reactivitywith a ‘redoxin’was positively dem-onstrated (e.g. DmGPx and/or peroxiredoxins). Moreover, the identifi-cation of the addition product between the CP of the chimeric GPx7and GSH demonstrated a direct enzyme–substrate interaction (Fig. 5B).

The steady-state kinetic analysis of (Syn)GPx7 was carried out, aspreviously reported for GPx4 and DmGPx [5,18,19], using data on reac-tion rate and hydroperoxide concentration calculated from digitizedread-out at defined time intervals along each trace of the spectrophoto-metric assay. Consistently with the canonical ping-pong mechanism ofGPxs, the double reciprocal plots, obtained at different concentrationsof GSH, produced parallel regression lines of the same slope (notshown), confirming that also the chimeric GPx7 fits the enzyme substi-tution kinetic mechanism (Scheme 1).

Calculated specific activity, kinetic coefficients and second orderapparent rate constants of the different steps of the catalytic cycleof (Syn)GPx7 using GSH as reducing substrate are reported in

Table 1. The active site of the GPx7 is oxidized by PCOOH with arate constant (k+1 = 9.5 × 103 M−1 s−1) approximately three or-ders of magnitude faster than the non-catalyzed oxidation of athiolate by a hydroperoxide [27]. The rate constant for the reductivesteps, instead, is quite low (k′+2 = 12.6 M−1 s−1), in agreementwith that calculated for the reductive step of artificial 1CysGPxs anal-ogous to GPx7, namely the Cys mutant of SecGPx4 and the CR mutantof the 2CysGPx of Drosophila (DmGPxC91K) [5,19]. Notably, this rateconstant is in the range of the non-enzymatic thiol–disulfide ex-change reaction [28].

3.4. Molecular docking of GSH to GPx7

In light of the low rate of reductive part of the cycle, we questionedwhether GSHmight be considered as a “real” GPx7 substrate. This issuewas addressed by a computational analysis of the interaction betweenGSH and GPx7 in comparison with other GPxs. The molecular dockingpose for the complex GSH–GPx7 indicates that GSH is bound to GPx7in a manner similar to GPx1 and GPx4, and that the interaction is evenstronger (Fig. 6) [1]. In the case of GPx7, the electrostatic network be-tween GSH negative charges and Arg 180/Arg 52 (GPx1 human num-bering), Lys 135/Lys 148 (GPx4 human numbering), is replaced by theinteractions with His 63 and Thr 162 and a relevant hydrophobic net-work (provided by Pro 161, and in particular by Phe 59). This arrange-ment provides an important contribution to the complex stabilization.The association constant (pK) of GSH indicates that the GSH–GPx7 com-plex is evenmore stable than the GSH-GPx1 and GSH-GPx4. The hydro-phobic term (hyd) contribution in the association constant appears tobe critical for the strength of interaction.

All together, kinetic and docking data indicate that GSH interactswith GPx7 even though the rate of the overall peroxidatic reactionis limited. This most likely occurs at the thiol–disulfide exchange re-action and/or the release of GSSG (Scheme 1).

3.5. Kinetics of PDI peroxidase activity

Measuring the peroxidatic reaction of chimeric GPx7 by the reducingsubstrate HsPDI, 4 U of the mammalian RrTrxR was used as nonrate-limiting ancillary enzyme in the assay. In fact, the P. falciparumTrxR, used for tracking HsTrxC72S oxidation [5], does not reduce PDI[16]. As for the GSH peroxidase activity measurement, the use of non-homogeneous enzyme and PCOOH in this reaction, eliminated the pres-ence of any competing activity satisfying Racker's rule [26] (not shown).

Steady-state kinetic treatment of the data showed that the oxi-dized (Syn)GPx7 oxidizes HsPDI (k′+2 = 3.5 × 103 M−1 s−1) ordersof magnitude faster than it does GSH (Table 2). As expected, the cal-culated k+1 value was very close to that measured when GSH wasthe reductant (Tables 1 and 2). Furthermore, no activity was detectedin the presence of HsTrxC72S.

Consistently with kinetic data, despite the different reactivity of(Syn)GPx7 with GSH or HsPDI, the specific activity is indeed quite simi-lar in the presence of either 3 mMGSH or 10 μMHsPDI (Tables 1 and 2).

3.6. The reaction mechanism of GPx7 does not involve any Cys residuebesides the CP

Absence of the canonical CR in GPx7, despite the reduction of theactive site by a redoxin such as PDI, suggested the need to screenwhether a different Cys residue could substitute for it. Besides CP,

the only Cys present in (Syn)GPx7 is the Cys 85 of mature mouseGPx7, which lies within the strictly conserved PCNQF motif (Fig. 1).The Cys85/Ala substitution in (Syn)GPx7Ala85 failed to affect activityand kinetics of the peroxidatic reaction, irrespective of whether thereducing substrate was GSH or HsPDI (Table 3). This evidence defi-nitely rules out the formation of a non-canonical disulfide in the reac-tion mechanism of GPx7, and conclusively supports the notion that

MS2 spectrum from 759.6843 [z = 3], Cys + 2O

C + 2 O

MS2 spectrum from 765.0173 [z = 3], Cys + 3O

Fig. 4. MS/MS analysis of the fragment of containing the catalytic Cys of (Syn)GPx7 purified by nickel chromatography. MS/MS spectrum of a 759.6843 (left) and 765.0173 (right) amu tryptic peptide obtained from Ni-NTA purified (Syn)GPx7. The spectrum represents theMmGPx7 44-64 peptide containing the CP (Cys56) in the sulfenic or sulfinic acid form (left or right panel respectively). Dotted lines point out identified peaks with Mascot matched m/z value within searchtolerance constraints. Upon such values, b and y ion series are shown with possible modifications. Double headed arrows link ion fragments from various series and upon them the amino acid sequence assignment is reported for each massdelta.

3852V.Bosello-Travain

etal./

Biochimica

etBiophysica

Acta

1830(2013)

3846–3857

A

B

Fig. 5. Glutathione peroxidase activity measurements in the 29,000 ×g supernatant from induced bacteria (A) and MS/MS identification of the reaction intermediate (B). In (A) thespectrophotometric cuvette contained the assay mixture of GSH peroxidase activity, as reported under Material and methods, and the enzyme source, which was: the 29,000 ×gsupernatant from the induced bacterial lysate transformed with pSynA/GPx7, containing 0.6 μg (Syn)GPx7 (a); the 29,000 ×g supernatant from the induced bacterial lysatetransformed with pSynA, expressing equal amounts of Syn (b). In (c) two nanograms of purified GPx4 from rat testis was used as control. Reaction started by adding PCOOH atthe time indicated. Only the sample containing (Syn)GPx7 (a) exhibited activity. In (b) the absence of PCOOH reactivity was confirmed by addition of GPx4 that consumed thewhole substrate. Numbers represent the reaction rate expressed in nmol/min. In (B) the reduced 29,000 ×g supernatant from (Syn)GPx7 induced bacteria was incubated in thepresence of GSH and PCOOH and treated for MS analysis, as reported under Material and methods. Annotated MS/MS spectra for the CP within a tryptic peptide are reported, show-ing the adduct between the CP of GPx7 and GSH.

3853V. Bosello-Travain et al. / Biochimica et Biophysica Acta 1830 (2013) 3846–3857

(Syn)GPx7 catalyzes a catalytic cycle in which the oxidized CP, but notthe CP–CR disulfide, is the actual oxidized intermediate that is subse-quently reduced by the redoxin.

3.7. Reducing substrate preferences of monomeric GPxs

The notion that the catalytic cycle of GPx7 does not include theformation of a CP–CR disulfide, prompted the question whether theother monomeric GPxs, whose catalysis does not rely on disulfide,

might also oxidize PDI. SecGPx4, DmGPxC91K as well as DmGPxwt, atypical 2CysGPx, were analyzed as controls. None of these enzymesaccepted HsPDI as a reducing substrate (Table 4). Oxidation of PDIemerges therefore as a rather specific feature of GPx7.

3.8. Kinetic constants of the interaction between GPx7 and PDI

The interaction between MmGPx7 and HsPDI was quantitativelyevaluated by surface plasmon resonance (SPR) (Fig. 7). To escape

Table 1Specific activity, kinetic coefficients and apparent rate constants of (Syn)GPx7 for the reduction of PCOOH by GSH.

Enzyme Reducing substrate Specific activity(μmol/min/mg prot.)

Φ1

(μM s)k+1

(M−1 s−1)Φ2

(μM s)k′+2

(M−1 s−1)

(Syn)GPx7 GSH 0.065 ± 0.014 105 ± 51 9.5 × 103 7.9 ± 8 × 103 12.6

Specific activity was measured in the 29,000 ×g supernatant from the bacterial lysate expressing (Syn)GPx7. Specific activity was measured in the presence of 25 μM PCOOH and3 mM GSH, in the presence of NADPH and a non-limiting amount of GSH reductase. Enzyme concentration was calculated as described under Material and methods. Kinetic coef-ficients are reported as mean ± standard deviation of three independent experiments.

Fig. 6. Molecular docking pose for the complex GSH–GPx7. Molecular docking of GSHbound to the active site of the human GPx7 (PDB code: 2P31); on the right side, hydro-philic (red) and hydrophobic (green) residues contribution for GSH–HsGPx1, GSH–HsGPx4, and GSH–HsGPx7 complexes, with associated constants values (pK). The pKvalues of GSH with GPx1, GPx4 and GPx7 indicate that the GSH–GPx7 complex ismore stable, where the hydrophobic term (Hyd) brings major contribution to bindingstrength.

3854 V. Bosello-Travain et al. / Biochimica et Biophysica Acta 1830 (2013) 3846–3857

possible artifacts, for these measurements the protein used was GPx7lacking the N-terminal Syn fusion. We assumed that the oxidation ofthe catalytic residue would not affect protein–protein interaction,which involves a large surface of the protein. This approach was in-trinsically validated by the positive result. Indeed, the analyticaldata could be successfully fitted with a 1:1 binding model and the av-erage values of the kinetic constants of binding could be preciselymeasured: ka = 346 M−1 s−1, kd = 0.0018 s−1, KD = 5.2 μM(being KD = kd/ka). The very weak, non-specific interaction detectedbetween HsPDI and other peroxidases (DmGPxwt and the CR mutantDmGPxC91K) did not permit any meaningful evaluation of interactionconstants, in agreement with kinetic evidence.

Table 2Specific activity, kinetic coefficients and apparent rate constants of (Syn)GPx7 for the redu

Enzyme Reducing substrate Specific activity(μmol/min/mg prot.)

(Syn)GPx7 HsPDI 0.048 ± 0.016

Specific activity and kinetic analysis as reported under Table 1, except that PDI (10 μM) rep

Table 3Specific activity, kinetic coefficients and apparent rate constants of (Syn)GPx7C85A for the r

Enzyme Reducing substrate Specific activity(μmol/min/mg prot.)

(Syn)GPx7C85A GSH 0.057 ± 0.018(Syn)GPx7C85A HsPDI 0.059 ± 0.010

Specific activity and kinetic analysis as reported under Table 1 and 2 except that the 29,00

4. Discussion

GPx7 belongs to the subfamily of glutathione peroxidases that usea Cys residue for catalysis. It was first identified as a cytoplasmic pro-tein [8] and then found within the ER. In this study we provide furtherevidence for the localization previously supported by immunohisto-chemistry [9,25].

In a previous study, GPx7 was claimed to be not a glutathione per-oxidase but a PDI peroxidase [9]. However in that study the require-ments for a correct definition of enzymatic activity were notsatisfied because the assay was conducted in the presence of GSH.Moreover, for the reaction in the presence of GSH, an unrealisticallylow rate constant was measured (0.58 M−1 s−1). This was indeedcalculated without any kinetic steady-state treatment to dissect thedifferent steps of the catalytic cycle [9]. On the other hand, the factthat the canonic criteria for a monomeric glutathione peroxidase toreact with a Trx-related protein is not fulfilled by the GPx primarystructure, further questioned the real substrate specificity of GPx7.Besides having a monomeric nature, the subfamily of CysGPxs re-quires a canonical CR to react with a protein of the Trx family. In con-trast, this canonical CR is missing in GPx7 [5].

In this study the validated procedure for the kinetic analysis ofGPxs was used, which required a suitable source of enzymatic activi-ty. Unfortunately, GPx7 revealed to be extremely prone to oxidativeinactivation. The peroxidase activity was indeed largely lost duringNi-NTA chromatography, even in the presence of reductants such asmercaptoethanol or GSH. MS/MS analysis confirmed the artifactualover-oxidation of the CP. It is this marked susceptibility to oxidationof the active site during Ni-NTA chromatography that probably ex-plains why low or even absent GSH peroxidase activity was previous-ly reported [8,9].

Searching for an expression system allowing minimal sample pro-cessing, we found that mouse GPx7 could be expressed in bacteria athigh yield as a N-terminal fusion with human synuclein, (Syn)GPx7.The soluble fraction of the bacterial lysate was used as source of activ-ity for kinetic studies, validated by the absence of competing reac-tions. Actually Racker's rule requiring a single enzymatic activity for

ction of PCOOH by HsPDI.

Φ1

(μM s)k+1

(M−1 s−1)Φ2

(μM s)k′+2

(M−1 s−1)

204 ± 60 4.9 × 103 285 ± 50 3.5 × 103

laced GSH, and rat Trx reductase replaced GSH reductase.

eduction of PCOOH by GSH or HsPDI.

Φ1

(μM s)k+1

(M−1 s−1)Φ2

(μM s)k′+2

(M−1 s−1)

153 ± 40 6.5 × 103 80 ± 6 × 103 12.4172 ± 30 5.8 × 103 166 ± 70 6.0 × 103

0 ×g supernatant contained the (Syn)GPx7 mutant (Syn)GPx7C85A.

Table 4Specific activity of individual GPxs with different reducing substrates.

Enzyme Reducing substrate Specific activity (μmol/min/mg protein)

(Syn)GPx7GSH 0.065⁎

HsTrxC72S UndetectableHsPDI 0.048⁎

RrGPx4GSH 17.2HsTrxC72S UndetectableHsPDI Undetectable

DmGPxwt

GSH 0.08HsTrxC72S 5.12HsPDI Undetectable

DmGPxC91K

GSH 0.26HsTrxC72S UndetectableHsPDI Undetectable

Specific peroxidase activity of the indicated enzymes was measured as described underMaterial and methods with 25 μM PCOOH as the oxidizing substrate. GSH, HsTrxC72S orHsPDI when present were 3 mM, 5 μM or 10 μM, respectively. The source of (Syn)GPx7, the supernatant from the bacterial lysate expressing the enzyme, RrGPx4, wasa purified preparation of GPx4 from rat testis, DmGPxwt and DmGPxC91K representthe wild type and the CR mutated forms of the DmGPx, respectively [5].⁎ Data from Table 1.

3855V. Bosello-Travain et al. / Biochimica et Biophysica Acta 1830 (2013) 3846–3857

kinetic studies was satisfied using PCOOH as the oxidizing substratewhen either GSH or HsPDI was the reducing substrate. Using H2O2,however, did not satisfy that requirement.

In the active site, conserved among GPxs, the oxidation rate of(Syn)GPx7 peroxidatic Cys by PCOOH (k+1 > 103 M−1 s−1) is with-in the range of that observed for the other CysGPxs [4]; i.e., orders ofmagnitude faster than the non-enzymatic oxidation of a thiolate [27].

Fig. 7. Representative SPR analysis of binding of different GPxs to reduced HsPDI. Typical senimmobilized and reduced HsPDI. Curve a = MmGPx7; Curve b = DmGPxC91K; Curve c = DmpH 7.4 buffer by NAP chromatography before analysis. (RU = response unit, where 1 RU repanalysis of the digestion product of the chimeric GPx7 used for SPR experiments (MmGPx7, tuct obtained after digestion by thrombin, which representsMmGPx7 (0.8 and 0.4 μg respecti19 kDa, respectively.

As suggested, a proton shuffling in the active site seems to facilitateboth deprotonation of the chalcogen and protonation of the anionicleaving group (RO−), on which the catalytic efficiency depends. Nota-bly, this oxidation mechanism of the active site is shared by all GPxs,irrespective of the presence of selenium or sulfur as redox center [4].

GPx7 strongly binds GSH and accepts it as reducing substrate, andthus the enzyme must be rated as a true ‘GSH peroxidase’. The calcu-lated k′+2 value (12.6 M−1 s−1) is similar to that of the artificial mu-tant UP/CP of GPx4, where the enzymatic activity is limited, as inGPx7, by the reductive part of the catalytic cycle. This step of the cat-alytic cycle is very fast when the redox center is a selenol or when Trxreduces the CP–CR disulfide [4]. Despite the slow turnover, GSH bindsto GPx7 similarly to GPx1 and GPx4 [1,29] although on different res-idues. A strong hydrophobic network significantly contributes to thecomplex stabilization.

Searching for an alternative substrate to GSH, we confirmed by ki-netic analysis the previous indication that PDI is oxidized by the ac-tive site of GPx7. Notably, the rate constant for the oxidation ofHsPDI by (Syn)GPx7 (k′+2 = 3.5 × 103 M−1 s−1) is more than twoorders of magnitude faster than that for the step encompassing oxida-tion of GSH and release of GSSG. At first glance, this was somehowsurprising as GPx7 does not contain the CR partner of the CP in con-trast to all the other redoxin peroxidases of the CysGPx subfamilythus far analyzed [5,7,30]. The option that a non-canonical Cys resi-due could substitute for the missing CR was positively ruled out bymutagenesis of the sole non-peroxidatic Cys (Cys 85) of the mouseGPx7. Thus GPx7 breaks the paradigm of the structure–function rela-tionship of CysGPx. Apparently, the rule that dictates that theN-terminal Cys of the CXXC motif of the redoxin can only attach theCR participating to the disulfide in the peroxidase (Eq. (6)) is not ab-solute. In the reaction with GPx7 the N-terminal Cys of the CGHCmotif of PDI seemingly reacts with the oxidized CP of the peroxidase

sograms of the binding of 5 μM each of purifiedMmGPx7, DmGPxwt, and DmGPxC91K toGPxwt; Curve d = HBS-EP+, pH 7.4. All samples were exchanged with the HBS-EP+,resents the binding of 1 pg of protein per square mm.) The insert shows the SDS-PAGErace a). Lanes are as follows: 1: Ni-NTA purified (Syn)GPx7; 2 and 3: the purified prod-vely); 4: Molecular weight size markers. The M.W. of (Syn)GPx7 andMmGPx7 is 36 and

3856 V. Bosello-Travain et al. / Biochimica et Biophysica Acta 1830 (2013) 3846–3857

to form a mixed disulfide intermediate that rearranges, forming a di-sulfide on PDI, according to the reactions:

ROOHþ CysGPx7ð Þ⋯SH→ROHþ CysGPx7ð Þ⋯SOH ð9Þ

CysGPx7ð Þ⋯SOHþHS⋯ CGHCð Þ⋯SH→ CysGPx7ð Þ⋯S–S⋯ CGHCð Þ⋯SHþH2O ð10Þ

Furthermore, the absence of a reactive CR on the peroxidase isexpected to favor the oxidation of PDI. As the C-terminal Cys of theCGHCmotifs of PDI is a poor nucleophile [31], following the formationof the mixed disulfide between GPx7 and PDI, the formation of the di-sulfide on the peroxidase would compete with the formation of thedisulfide on PDI.

Recently, a paper showing that in cells GPx7 forms a disulfide be-tween the CP and Cys 85 was published [32]. Admittedly, this was asurprise, since we failed to detect such a product in our chimericGPx7, which was specifically screened by MS/MS analysis for this spe-cies. Although our finding obviously does not exclude that the disul-fide is formed in vivo, there were differences in the technicalconditions for the MS analysis between our work and the paper ofWei et al. that supports the disulfide identification. Protein thiolgroups, indeed were not blocked during trypsin digestion under alka-line conditions. Thus the common artifact, due to thiol scramblingduring the digestive procedure cannot be ruled-out.

Besides specific redox chemistry at the active site, oxidation ofHsPDI by MmGPx7 also relies on specific protein–protein interaction.SPR affinity constant measurement confirms the specificity of the in-teraction between HsPDI and MmGPx7 in agreement with activitymeasurements showing that PDI does not react with monomeric per-oxidases other than GPx7, nor does GPx7 react with Trx.

Unfortunately, due to the presence of competing reactions, our ex-perimental set-up did not permit the study of reactivity betweenGPx7 and H2O2. Regardless, in view of both the simplest structure ofH2O2 vs. PCOOH and that the monomeric peroxidases generallyreact almost identically with PCOOH or H2O2 [18], we may safely pre-sume that the GPx7 active site is oxidized by H2O2 as well as PCOOH.Which of the two substrates that is relevant in vivo cannot be deter-mined at this stage of knowledge. What we do know is that mono-meric structure is the crucial constraint for fast reactivity withPCOOH [29] and that this might be relevant to GPx7 physiologicalfunction as is indeed becoming evident for GPx4 [33].

5. Conclusions

GPx7 emerges as a unique member of the CysGPx subfamily ofglutathione peroxidases. It efficiently oxidizes PDI by a mechanisminvolving a peroxidatic Cys residue only. In this context, the use ofGSH as a substrate is very intriguing. The observed low rate, despitethe strong interaction with the active site, argues against a function-ally relevant reduction of hydroperoxides using GSH. Consideringthe expected concentration of GSH and PDI in vivo, compatible withthose used in this study [34,35], kinetic analysis reveals a competitionbetween the alternative substrates GSH and PDI. Upon a fast oxida-tion by ROOH, the oxidized active site of GPx7 can oxidize PDI onlywhen GSH concentration is permissively low. This considerationframes the discussion of the physiological role of GPx7 in the oxida-tion of PDI within the ER as a reaction compatible with control ormodulation by the actual concentration of GSH [35].

Acknowledgements

We thank Professor Stefano Moro, Molecular Modeling Section ofthe University of Padova, for invaluable technical support and Dr Lucio

Zennaro, Department of Molecular Medicine, University of Padova forSPR analysis. This study was supported in parts by grants to M.M.(Progetto di Ateneo CPDA087343/08) and to F.U. (Strategic ProjectSTPD082FN3-002).

Appendix A. Supplementary data

Supplementary data to this article can be found online at http://dx.doi.org/10.1016/j.bbagen.2013.02.017.

References

[1] L. Flohé, S. Toppo, G. Cozza, F. Ursini, A comparison of thiol peroxidase mecha-nisms, Antioxid. Redox Signal. 15 (2011) 763–780.

[2] I. Chambers, J. Frampton, P. Goldfarb, N. Affara, W. McBain, P.R. Harrison, The struc-ture of the mouse glutathione peroxidase gene: the selenocysteine in the active siteis encoded by the “termination” codon, TGA, EMBO J. 5 (1986) 1221–1227.

[3] P. Mauri, L. Benazzi, L. Flohé, M. Maiorino, P.G. Pietta, S. Pilawa, A. Roveri, F. Ursini,Versatility of selenium catalysis in PHGPx unraveled by LC/ESI-MS/MS, Biol.Chem. 384 (2003) 575–588.

[4] S. Toppo, L. Flohé, F. Ursini, S. Vanin, M. Maiorino, Catalytic mechanisms and spec-ificities of glutathione peroxidases: variations of a basic scheme, Biochim.Biophys. Acta 1790 (2009) 1486–1500.

[5] M. Maiorino, F. Ursini, V. Bosello, S. Toppo, S.C.E. Tosatto, P. Mauri, K. Becker, A.Roveri, C. Bulato, L. Benazzi, A. De Palma, L. Flohé, The thioredoxin specificity ofDrosophila GPx: a paradigm for a peroxiredoxin-like mechanism of many gluta-thione peroxidases, J. Mol. Biol. 365 (2007) 1033–1046.

[6] Z.A. Wood, E. Schröder, J. Robin Harris, L.B. Poole, Structure, mechanism and reg-ulation of peroxiredoxins, Trends Biochem. Sci. 28 (2003) 32–40.

[7] T. Schlecker, M.A. Comini, J. Melchers, T. Ruppert, R.L. Krauth-Siegel, Catalyticmechanism of the glutathione peroxidase-type tryparedoxin peroxidase ofTrypanosoma brucei, Biochem. J. 405 (2007) 445–454.

[8] A. Utomo, X. Jiang, S. Furuta, J. Yun, D.S. Levin, Y.-C.J. Wang, K.V. Desai, J.E. Green,P.-L. Chen, W.-H. Lee, Identification of a novel putative non-selenocysteinecontaining phospholipid hydroperoxide glutathione peroxidase (NPGPx) essen-tial for alleviating oxidative stress generated from polyunsaturated fatty acidsin breast cancer cells, J. Biol. Chem. 279 (2004) 43522–43529.

[9] V.D. Nguyen, M.J. Saaranen, A.-R. Karala, A.-K. Lappi, L. Wang, I.B. Raykhel, H.I.Alanen, K.E.H. Salo, C.-C. Wang, L.W. Ruddock, Two endoplasmic reticulum PDIperoxidases increase the efficiency of the use of peroxide during disulfide bondformation, J. Mol. Biol. 406 (2011) 503–515.

[10] S. Toppo, S. Vanin, V. Bosello, S.C.E. Tosatto, Evolutionary and structural insightsinto the multifaceted glutathione peroxidase (Gpx) superfamily, Antioxid.Redox Signal. 10 (2008) 1501–1513.

[11] A. Negro, A.M. Brunati, A. Donella-Deana, M.L. Massimino, L.A. Pinna, Multiplephosphorylation of alpha-synuclein by protein tyrosine kinase Syk preventseosin-induced aggregation, FASEB J. 16 (2002) 210–212.

[12] M.M. Bradford, A rapid and sensitive method for the quantitation of microgramquantities of protein utilizing the principle of protein-dye binding, Anal. Biochem.72 (1976) 248–254.

[13] X.X. Ren, M.M. Björnstedt, B.B. Shen, M.L.M. Ericson, A.A. Holmgren, Mutagenesisof structural half-cystine residues in human thioredoxin and effects on the regu-lation of activity by selenodiglutathione, Biochemistry 32 (1993) 9701–9708.

[14] A. Roveri, M. Maiorino, C. Nisii, F. Ursini, Purification and characterization ofphospholipid hydroperoxide glutathione peroxidase from rat testis mitochondri-al membranes, Biochim. Biophys. Acta 1208 (1994) 211–221.

[15] M. Maiorino, C. Gregolin, F. Ursini, Phospholipid hydroperoxide glutathione per-oxidase, Methods Enzymol. 186 (1990) 448–457.

[16] J. Lundström, A. Holmgren, Protein disulfide-isomerase is a substrate for thioredoxinreductase and has thioredoxin-like activity, J. Biol. Chem. 265 (1990) 9114–9120.

[17] G. Weber, C. Long, Biochemists' Handbook, Ltd., C. Long, E. and FN Spon, London,1961.

[18] F. Ursini, M. Maiorino, C. Gregolin, The selenoenzyme phospholipid hydroperox-ide glutathione peroxidase, Biochim. Biophys. Acta 839 (1985) 62–70.

[19] M. Maiorino, K.D. Aumann, R. Brigelius-Flohé, D. Doria, J. van den Heuvel, J.McCarthy, A. Roveri, F. Ursini, L. Flohé, Probing the presumed catalytic triad ofselenium-containing peroxidases by mutational analysis of phospholipid hydro-peroxide glutathione peroxidase (PHGPx), Biol. Chem. Hoppe Seyler 376 (1995)651–660.

[20] K. Dalziel, Initial steady state velocities in the evaluation of enzyme–coenzyme-substrate reaction mechanisms, Acta Chem. Scand. 11 (1958) 1706–1723.

[21] MOE-Dock, Molecular Operating Environment (MOE 2009.10), The ChemicalComputing Group, Montreal, Canada, 2009, http://www.chemcomp.com.

[22] GOLD suite (version 5.1), The Cambridge Crystallographic Data Centre (CCDC),Cambridge, UK, 2011, www.ccdc.cam.ac.uk/products/life_sciences/gold/.

[23] R.A. Friesner, J.L. Banks, R.B. Murphy, T.A. Halgren, J.J. Klicic, D.T. Mainz, M.P.Repasky, E.H. Knoll, M. Shelley, J.K. Perry, D.E. Shaw, P. Francis, P.S. Shenkin,Glide: a new approach for rapid, accurate docking and scoring. 1. Method and as-sessment of docking accuracy, J. Med. Chem. 47 (2004) 1739–1749.

[24] N. Hulo, A. Bairoch, V. Bulliard, L. Cerutti, E. De Castro, P.S. Langendijk-Genevaux, M.Pagni, C.J.A. Sigrist, The PROSITE database, Nucleic Acids Res. 34 (2006) D227–D230.

3857V. Bosello-Travain et al. / Biochimica et Biophysica Acta 1830 (2013) 3846–3857

[25] I. Raykhel, H. Alanen, K. Salo, J. Jurvansuu, V.D. Nguyen, M. Latva-Ranta, L.Ruddock, A molecular specificity code for the three mammalian KDEL receptors,J. Cell Biol. 179 (2007) 1193–1204.

[26] P. Hinkle, Efraim Racker, 1913–1991, J. Bioenerg. Biomembr. 24 (1992) 517–519.[27] C.C. Winterbourn, D. Metodiewa, Reactivity of biologically important thiol com-

pounds with superoxide and hydrogen peroxide, Free Radic. Biol. Med. 27(1999) 322–328.

[28] M.M. Gallogly, D.W. Starke, J.J. Mieyal, Mechanistic and kinetic details of catalysisof thiol–disulfide exchange by glutaredoxins and potential mechanisms of regu-lation, Antioxid. Redox Signal. 11 (2009) 1059–1081.

[29] F. Ursini, M. Maiorino, R. Brigelius-Flohé, K.D. Aumann, A. Roveri, D. Schomburg, L.Flohé, Diversity of glutathione peroxidases, Methods Enzymol. 252 (1995) 38–53.

[30] H. Sztajer, B. Gamain, K.D. Aumann, C. Slomianny, K. Becker, R. Brigelius-Flohé, L. Flohé, The putative glutathione peroxidase gene of Plasmodiumfalciparum codes for a thioredoxin peroxidase, J. Biol. Chem. 276 (2001)7397–7403.

[31] A.K. Lappi, M.F. Lensink, H.I. Alanen, K.E.H. Salo, M. Lobell, A.H. Juffer, L.W.Ruddock, A conserved arginine plays a role in the catalytic cycle of the protein di-sulphide isomerases, J. Mol. Biol. 335 (2004) 283–295.

[32] P.-C. Wei, Y.-H. Hsieh, M.-I. Su, X.J. Jiang, P.-H. Hsu, W.-T. Lo, J.-Y. Weng, Y.-M.Jeng, J.-M. Wang, P.-L. Chen, Y.-C. Chang, K.-F. Lee, M.-D. Tsai, J.-Y. Shew, W.-H.Lee, Loss of the oxidative stress sensor NPGPx compromises GRP78 chaperone ac-tivity and induces systemic disease, Mol. Cell (2012) 1–13.

[33] A. Seiler, M. Schneider, H. Förster, S. Roth, E.K. Wirth, C. Culmsee, N. Plesnila, E.Kremmer, O. Rådmark, W.Wurst, G.W. Bornkamm, U. Schweizer, M. Conrad, Gluta-thione peroxidase 4 senses and translates oxidative stress into 12/15-lipoxygenasedependent- and AIF-mediated cell death, Cell Metab. 8 (2008) 237–248.

[34] F.Q. Schafer, G.R. Buettner, Redox environment of the cell as viewed through theredox state of the glutathione disulfide/glutathione couple, Free Radic. Biol. Med.30 (2001) 1191–1212.

[35] A.-K. Lappi, L.W. Ruddock, Reexamination of the role of interplay between gluta-thione and protein disulfide isomerase, J. Mol. Biol. 409 (2011) 238–249.