Presence of simian virus 40 DNA sequences in diffuse large B-cell lymphomas

in Tunisia correlates with aberrant promoter hypermethylation of multiple

tumor suppressor genes

Khaled Amara1, Mounir Trimeche1*, Sonia Ziadi1, Adnene Laatiri2, Mohamed Hachana1, Badreddine Sriha1,Moncef Mokni

1and Sadok Korbi

1

1Laboratory of Pathology, CHU Farhat Hached, Sousse, Tunisia2Service of Clinical Hematology, CHU Farhat Hached, Sousse, Tunisia

The simian virus SV40 (SV40), a potent DNA oncogenic polyoma-virus, has been detected in several human tumors including lym-phomas, mainly in diffuse large B-cell type (DLBCL). However, acausative role for this virus has not been convincingly established.Hypermethylation in promoter regions is a frequent process ofsilencing tumor suppressor genes (TSGs) in cancers, which maybe induced by oncogenic viruses. In this study, we investigated therelationship between the presence of SV40 DNA sequences and themethylation status of 13 TSGs in 108 DLBCLs and 60 nontumoralsamples from Tunisia. SV40 DNA presence was investigated byPCR assays targeting the large T-antigen, the regulatory and theVP1 regions. Hypermethylation was carried out by methylation-specific PCR. SV40 DNA was detected in 63/108 (56%) of DLBCLand in 4/60 (6%) of nontumoral samples. Hypermethylation fre-quencies for the tested TSGs were 74% for DAPK, 70% forCDH1, SHP1, and GSTP1, 58% for p16, 54% for APC, 50% forp14, 39% for p15, 19% for RB1, 15% for BLU, 3% for p53, and0% for p300 and MGMT. No hypermethylation was observed innontumoral samples. Hypermethylation of SHP1, DAPK, CDH1,GSTP1 and p16 genes were significantly higher in SV40-positivethan in SV40-negative DLBCL samples (p values ranging from0.0006 to <0.0001). Our findings showed a high prevalenceof SV40 DNA in DLBCLs in Tunisia. The significant association ofpromoter hypermethylation of multiple TSGs with the presence ofSV40 DNA in DLBCLs supports a functional effect of the virus inthose lymphomas.' 2007 Wiley-Liss, Inc.

Key words: diffuse large B-cell lymphomas; simian virus 40; hy-permethylation; tumor suppressor genes; Tunisia

Simian virus 40 (SV40) is a potent DNA oncogenic polyomavi-rus of rhesus monkey origin which seems to have spread to humanbeings via contamination of poliovirus stocks between 1955 and1963 as well as by other means,1 and mounting evidence suggeststhat it is an emergent human pathogen.2–4 SV40 DNA sequenceshave been detected in pediatric and adult brain tumors,5,6 mesothe-liomas,7 osteosarcomas,8 bronchopulmonary carcinomas,9 bonetumors10 and papillary thyroid carcinomas.11 There also increas-ing evidence that SV40 is associated with non-Hodgkin’s lymp-homas, particularly with diffuse large B-cell lymphomas(DLBCL),12–21 in spite of several negative studies.22–24 However,although these observations indicate an association between thisvirus and specific human tumors, they do not demonstrate a causalrole, and the molecular mechanism by which SV40 thought to beinvolved is still unclear.

SV40 oncogenic potential is assumed to be associated with theprimary viral gene product, large T-antigen (Tag), protein respon-sible for SV40 replication and SV40-mediated cell transforma-tion.1 In vitro, the infection of human cells by SV40 has showedthat SV40 Tag can promote malignancy transformation by block-ing the products of several tumor suppressor genes (TSGs),1,25

inducing telomerase activity,26 and stimulating other oncogenesand growth factors.27

Hypermethylation of the DNA promoter and the related phenom-enon of histone deacetylation are epigenetic changes in chromatinstructure that do not alter the DNA sequence and can cause geneinactivation.28 Aberrant hypermethylation of promoter regionsassociated with gene silencing is one of the major mechanisms

underlying the inactivation of TSGs, resulting in transcriptionalrepression of these genes.28,29 This epigenetic alteration has beenobserved in various cancers including lymphomas.28 One interest-ing recent study has reported a correlation between promoter hyper-methylation of several TSGs and the presence of SV40 DNA in aheterogeneous group of leukemias and lymphomas, suggesting thatSV40 might cause DNAmethylation of TSGs.15

In this study, we investigate the presence of SV40 DNA sequen-ces in 108 cases of DLBCLs from patients from Tunisia and corre-late the data with methylation status of a panel of 13 TSGs knownor suspected to be altered by hypermethylation in several cancersincluding lymphomas. These tested genes included those involvedin cell-cycle regulation (p14, p15, p16, p53 and RB1), cell inva-sion and adhesion (APC and CDH1), DNA repair and detoxifica-tion (MGMT and GSTP1), apoptosis (DAPK), B-cell differentia-tion (SHP1) and cell growth (p300 and BLU).

Material and methods

Patients and tissue samples

A total of 108 archival formalin-fixed paraffin-embedded tissuesamples with sufficient DNA integrity obtained from 108 patientswith well-characterized DLBCLs (69 nodal and 39 extranodal)were investigated in this study. All cases were Tunisian patients,with no previous history of follicular lymphoma or other hemato-logical malignancy and untreated. Patients with immunodeficiencywere not included in this study. Samples investigated in this studywere clinical cases routinely examined between 1996 and 2005 inthe Laboratory of Pathology at the University Hospital Farhat-Hached of Sousse (Tunisia). This laboratory collects all cancercases from the 2 university hospitals of Sousse and from otherhospitals of a large area of the central region of Tunisia. The diag-nosis of DLBCL was made based on morphology and immunohis-tochemical analysis according to the World Health Organizationclassification of lymphoid neoplasms.30 Hematoxylin and eosinsections from each case were reviewed by 2 pathologists (MT andSK) to ensure that the material contains enough amounts of tumorcells for PCR analysis. Demographics were available for all cases,there were 61 men and 47 women with median age of 59 years(range 3–85). Beside malignant samples, we also investigated 40reactive lymph nodes obtained from patients with nonmalignantdiseases and 20 peripheral blood leukocytes samples from healthysubjects originating from the same geographic region.

DNA extraction

DNA extraction from paraffin-embedded tissues was performedfrom whole 5-lm thick sections using proteinase K digestion

Grant sponsors: Tunisian Ministy of Research, Technology and Compe-tency Development; Ministry of Public Health (Tunisia).*Correspondence to: Laboratory of Pathology, CHU Farhat Hached,

4000 Sousse, Tunisia. Fax:1216-73-210355.E-mail: m_trimech@yahoo.frReceived 27 January 2007; Accepted after revision 26 June 2007DOI 10.1002/ijc.23038Published online 27 August 2007 inWiley InterScience (www.interscience.

wiley.com).

Int. J. Cancer: 121, 2693–2702 (2007)' 2007 Wiley-Liss, Inc.

Publication of the International Union Against Cancer

method as previously described.31 DNA from blood samples wasisolated with standard phenol–chloroform procedure.32 DNA wasquantified by a 6131 Biophotometer (Eppendorf, Hamburg,Germany). To verify the integrity level and their suitability forPCR analysis, all DNA samples were further checked by PCRamplification of a 268-bp fragment of the human b-globin geneusing the set of primers described elsewhere.33 DNA sampleswere then coded by an independent investigator at the laboratoryfor a masked further PCR experiments.

Detection of SV40 DNA sequences

All cases were investigated by PCR for the detection of 3 differ-ent regions of SV40 genome, including Tag gene, regularityregion and VP1 gene. In an initial PCR screening, 2 sets of primerspecifically targeting 2 different sequences in the SV40 Tag wereused in independent reactions. The first set of primers, SV.for3(nucleotides (nt) 4,476–4,453) and SV.rev (nt 4,372–4,399),amplify a 105-bp fragment, whereas the second set of primers,SVTAGP1 (nt 4,388–4,413) and SVTAGP3 (nt 4,496–45,13),amplify a 126-bp fragment in the SV40 Tag gene.5,14,15,34–36 Forboth experiments, PCR amplifications were performed using400 ng of DNA template in a total volume of 25 ll, containing20 pmol each primer, 1 U Taq DNA polymerase (Promega, Madi-son, USA), 1.5 mM MgCl2 and 200 lM each dNTP in a PTC200TM DNA engine thermal cycler (MJ Research, Watertown,USA). The PCR reactions were as follows: 92�C for 5 min, fol-lowed by 40 cycles of denaturation at 92�C for 45 sec, annealingat 56�C (for primers SV.for3/rev) or 53�C (for primersSVTAGP1/3) for 45 sec, extension at 72�C for 45 sec and a finalextension step at 72�C for 10 min. As a positive control for ampli-fication of the SV40 DNA, the plasmid pSVSph21-N (kindly pro-vided by Dr. Regis A. Vilchez, Baylor College of Medicine, Hous-ton, USA) was used. Negative control containing water instead oftarget DNA was always tested in each PCR reaction. PCR prod-ucts were subjected to electrophoresis through 2% agarose gelscontaining ethidium bromide and visualized under ultraviolet(UV) illumination using the Gel Doc 2000 System (Bio-Rad,Marnes-la-Coquette, France). PCR experiments for each casewere repeated 4 times. Samples were considered to contain SV40DNA if they exhibit detectable signals at least 3 times under ethi-dium bromide staining conditions. To confirm the specificity ofthese assays, the PCR products were transferred to a positivelycharged nylon membrane (Hybond N1; Amersham, Buckingham-shire, UK) using the Trans-Blot SD semi-dry Transfert Cell (Bio-Rad) following the manufacturer’s instructions, and hybridizedovernight at 42�C with internal digoxigenin (DIG)-labeled oligop-robes specific for the SV40 Tag sequences analyzed, SVPROBE1(nt 4,402–4,425) and SVPROBE2 (nt 4,458–4,479), respectively,for the SV.for3/rev and SVTAGP1/3 PCR assays. The oligoprobeswere labeled with the DIG Probe Synthesis Kit (Roche, Mann-heim, Germany) following the manufacturer’s instructions.

The sensitivity of SV.for3/rev and SVTAGP1/3 PCR assayswas determined using reconstruction experiments by mixing dilu-tions of titled SV40 DNA (plasmid pSVSph21-N) in human DNAas previously described.37 Each experiment used 400 ng aliquotsof genomic DNA extracted from a human normal lymphoid tissue,mixed with serial 10-fold dilutions of the respective positive con-trol plasmid DNA (from 1 ng (1029 g) to 1 ag (10218 g)) in a totalvolume of 25 ll of PCR reactions. After amplification, 10 ll ofPCR products were run on 2% agarose gels containing ethidiumbromide and visualized under UV illumination, and subsequentlytransferred to a nylon membrane and hybridized with the oligop-robes described earlier.

Level of SV40 load was determined by semiquantitative PCRapproach in all clinical samples, with positive results in the qualita-tive PCR. Semiquantitative PCR were performed using the set ofprimers SVTAGP1/3 in the same conditions as that used in thequalitative PCR, except for the number of PCR cycles. Knownamounts of serially diluted plasmid pSVSph21-N and mixed with

human DNA as described earlier were amplified parallelly withclinical samples. The PCR products were subjected to electropho-resis in 2% agarose gel stained with ethidium bromide and visual-ized under UV illumination using the Gel Doc 2000 system (Bio-Rad). SV40 load in the clinical samples was then estimated bycomparing their PCR product densities with those of the serial dilu-tions of the plasmid using the Quantity One software, version 4.2.3(Bio-Rad). Preliminary experiments on the standardization curvesof PCR cycle number versus product yield showed that linearamplification occurred between 25 and 35 cycles (data not shown).Therefore, 33 cycles were used for the semiquantitative assays.

To be certain that SV40 DNA is specifically detected, in addi-tion to Tag PCR assays we used 2 additional sets of primers thatamplify other sequences of the SV40 genome, as previouslydescribed.6,8 The set of primers RA1 (nt 266–245) and RA2 (nt5,195–5,218) targets the SV40 regulatory region and allows thedistinction between archetypal SV40 strains containing only a72 bp insert motif (expected size of PCR product 242 bp) and lab-oratory-adapted SV40 strains with duplicated 72 bp insertsequence (expected size of PCR product 314 bp).6,38 The set ofprimers LA1 (nt 2,251–2,274) and LA2 (nt 2,545–2,522) amplifya 294-bp sequence in the VP1 gene encoding the major capsid pro-tein of the virus. PCR products were then subjected to electropho-resis through 2% agarose gels containing ethidium bromide, andvisualized under UV illumination using the Gel Doc 2000 System(Bio-Rad). PCR experiments for each sample were repeated2 times. Positive and negative controls were the same used earlier.The sensitivity of these PCR essays was assessed as described ear-lier for Tag primers.

Methylation-specific PCR

Promoter methylation status of the CDH1, SHP1, DAPK,GSTP1, p16, p15, p14, RB1, APC, BLU, p53, p300 and MGMTgenes was determined by methylation-specific PCR (MSP) usingmethylated and unmethylated gene-specific primers for each geneas described elsewhere (Table I).39,40 Before the analysis of the meth-ylation status of the target genes, the presence of bisulfite modifiedDNA in each sample was determined by amplification of 133-bpDNA fragment of the b-actin gene, using a selected primer set whichamplify bisulfite modified DNA (but not wild-type DNA), irrespec-tive of the methylation status of the sample.41

The conversion of DNA by sodium bisulfite was performed asdescribed previously.39,40 Initially, 1–2 lg of genomic DNA wasdenatured with 2 M NaOH at 50�C for 20 min (final concentrationof 0.2 M NaOH), followed by incubation with freshly prepared2.5 M sodium bisulfite/1 M hydroquinone, pH 5.0, in a total vol-ume of 520 ll, at 70�C for 18 hr. The DNA was purified with theWizard DNA Clean-UP System (Promega), according to manufac-turer’s instructions. The modification of the DNA was completedby the addition of 5 ll of 3 M NaOH at room temperature during10 min. The precipitation of the modified DNA was carried outthrough the addition of 75 ll of ammonium acetate 5 M (pH 7.0),and 350 ll of ethanol. The bisulfite-modified DNA was resus-pended in 100 ll of sterile water and stored at 220�C or immedi-ately used for MSP analysis. The PCR amplifications was per-formed with treated DNA as template in a total volume of 25 llcontaining 0.25 lM of each primer pair, 200 lM of each dNTP,20 mM Tris-HCl, pH 8.4, 50 mM KCl, 2.5 mM MgCl2, 5%DMSO and 1 U of Taq DNA polymerase (Promega). Cycling con-ditions were as follows: denaturation at 95�C for 5 min, followedby 35 cycles of 30 sec at 95�C, for 30 sec at the specific tempera-ture (Table I) and for 30 sec at 72�C. The reaction was finishedwith a 5-min extension at 72�C. DNA from paraffin-embeddedcolorectal and breast carcinomas specimens, identified in our labo-ratory as showing hypermethylation for respective genes, wereused as positive controls for methylated alleles. DNA from bloodsamples (healthy volunteers) was used as control for unmethylatedalleles. As negative control, water blanks were always included ineach experiment. Amplified products were visualized under UV

2694 AMARA ET AL.

TABLE

I–SUMMARY

OF

PRIM

ER

SEQUENCES,CHROMOSOMAL

LOCATIO

NS,ANNEALIN

GTEMPERATURES

AND

PRODUCT

SIZES

USED

FOR

METHYLATIO

N-SPECIFIC

PCR

ANALYSES

Genes

Chromosomal

locations

CpG

status

Forw

ardprimer

(50 fi

30 )

Reverse

primer

(50 fi

30 )

Annealing

temperatures(�C)

Product

size

(bp)

Reference

b-actin

TGGTGATGGAGGAGGTTTAGTAAGT

AACCAATAAAACCTACTCCTCCCTTAA

60

133

41

p16

9p21

MTTATTAGAGGGTGGGGCGGATCGC

GACCCCGAACCGCGACCGTAA

60

150

42

UTTATTAGAGGGTGGGGTGGATTGT

CAACCCCAAACCACAACCATAA

58

151

DAPK

9q34

MGGATAGTCGGATCGAGTTAACGTC

CCCTCCCAAACGCCGA

60

106

43

UGGAGGATAGTTGGATTGAGTTAATGTT

CAAATCCCTCCCAAACACCAA

60

106

APC

5q21-22

MTATTGCGGAGTGCGGGTC

TCGACGAACTCCCGACGA

58

98

44

UGTGTTTTATTGTGGAGTGTGGGTT

CCAATCAACAAACTCCCAACAA

60

151

SHP1

12p13

MGAACGTTATTATAGTATAGCGTTC

TCACGCATACGAACCCAAACG

56

159

45

UGTGAATGTTATTATAGTATAGTGTTTGG

TTCACACATACAAACCCAAACAAT

59

159

CDH1

16q22.1

MTGTAGTTACGTATTTATTTTTAGTGGCGTC

CGAATACGATCGAATCGAACCG

56

112

46

UTGGTTGTAGTTATGTATTTATTTTTAGTGGTGTT

ACACCAAATACAATCAAATCAAACCAAA

58

120

GSTP1

11q13

MTTCGGGGTGTAGCGGTCGTC

GCCCCAATACTAAATCACGACG

59

91

47

UGATGTTTGGGGTGTAGTGGTTGTT

CCACCCCAATACTAAATCACAACA

59

97

p15

9p21

MGCGTTCGTATTTTGCGGTT

CGTACAATAACCGAACGACCGA

59

148

39

UTGTGATGTGTTTGTATTTTGTGGTT

CCATACAATAACCAAACAACCAA

59

154

p14

9p21

MGTGTTAAAGGGCGGCGTAGC

AAAACCCTCACTCGCGACGA

58

122

42

UTTTTTGGTGTTAAAGGGTGGTGTAGT

CACAAAAACCCTCACTCACAACAA

60

132

p53

17p13.1

MTTCGGTAGGCGGATTATTTG

AAATATCCCCGAAACCCAAC

58

193

48

UTTGGTAGGTGGATTATTTGTTT

CCAATCCAAAAAAACATATCAC

58

147

RB1

13q14

MGGGAGTTTCGCGGACGTGAC

ACGTCGAAACACGCCCCG

60

163

49

UGGGAGTTTTGTGGATGTGAT

ACATCAAAACACACCCCA

60

163

p300

22q13

MCGTTGTTCGGTTCGGTTTTTTC

CGCAAAAAACTCGCCCGAACCG

59

138

50

UTGTTGTTTGGTTTGGTTTTTTT

CACAAAAAACTCACCCAAACCA

59

138

MGMT

10q26

MTTTCGACGTTCGTAGGTTTTCGC

GCACTCTTCCGAAAACGAAACG

59

93

51

UTTTGTGTTTTGATGTTTGTAGGTTTTTGT

AACTCCACACTCTTCCAAAAACAAAACA

59

81

BLU

3p21.3

MTTCGTGGGTTATAGTTCGAGAAAGCG

AACGAATTAACCGCGCCTACGC

60

156

52

UTTTGTGGGTTATAGTTTGAGAAAGTG

AACAAATTAACCACACCTACAC

60

156

M,methylatedprimers;U,unmethylatedprimers.

2695SV40 AND HYPERMETHYLATION IN DLBCL

illumination after electrophoresis in 2% agarose gels containingethidium bromide using the Gel Doc 2000 System (Bio-Rad). Allexperiments were performed at least 2 times and evaluated with-out investigator knowing the SV40 infection status.

Statistics

The frequencies of methylation between groups were comparedusing v2 test or Fisher’s exact test where appropriate. The methyl-ation index (MI), a reflection of the methylation status of all of thegenes tested, is defined as the total number of genes methylated di-vided by the total number of genes analyzed.35 To compare theoverall degree of methylation for the panel of genes examined, wecalculated the MI for each case and then determined the mean forthe different groups. Statistical analysis of MI between 2 groupswas performed using the Mann-Whitney nonparametric U test.For all of the tests, probability values of p < 0.05 were regardedas statistically significant.

Results

SV40 DNA detection

SV40 Tag DNA sequences were detected in 63 of 108 (56%)DLBCL cases, in 3 of 40 (7%) reactive lymph nodes samples, andin 1 of 20 (5%) blood samples. In all cases, Southern blotting hasconfirmed the specific nature of the detected products but has notimproved the sensitivity of the PCR assays used. Representativeexamples of SV40 Tag DNA positive and negative cases are illus-trated (Fig. 1). The mean age of patients was 56 years (range3–85) for SV40-positive DLBCL cases and 59 years (range 11–81) for SV40-negative DLBCL cases. Statistical analysis showedno significant correlation between the presence of SV40 DNA andpatient’s age, year of the birth, gender, tumor location or clinicalstage (data not shown).

PCR assays to determine the sensitivity of the primer setsSV.for3/rev and SVTAGP1/3 have been assessed in reconstruction

experiments by mixing dilutions of the plasmid pSVSph21-N in abackground of normal lymphoid DNA. With both set of primers,we were able to detect up to 1 fg of the plasmid DNA in 400 ng ofhuman DNA (Figs. 2a and 2b). Taking an approximate DNA con-tent of a single human cell as 6 pg and the size of the positive con-trol plasmid used in our study (7.4 kb including the SV40genome), the SV.for3/rev and SVTAGP1/3 PCR experiments, inour conditions, could detect at least 120 copies of the targetsequence among 400 ng of human DNA (approximately equiva-lent to 66,000 cells), corresponding to at least 1.8 copies of theviral genome per 1,000 cells.

By using a semiquantitative PCR approach, we estimated thatSV40 DNA was present in human tested positive samples, in therange of �1.8–1,800 genome copies per 1,000 cells (Table II andFig. 3). In SV40-positive DLBCLs, ‘‘high’’ SV40 DNA load(>180 copies per 1,000 cells) was found in 32 (51%) cases and‘‘low’’ SV40 DNA load (<180 copies per 1,000 cells) was found

TABLE II – RANGE OF SV40 LOAD IN POSITIVE DIFFUSE LARGEB-CELL LYMPHOMAS AND NONTUMORAL SAMPLES ESTIMATED BY

SEMIQUANTITATIVE ANALYSIS

Range of SV40 loadin positive samples(copies/1,000 cells)

DLBCL samplesNontumoralsamples p-value

1.8–18 12 (19)1 3 (75) 0.0218–180 19 (30) 1 (25)180–1,800 32 (51) 0 (0)Total 63 (100) 4 (100)

1Values in parentheses indicate percentages.

FIGURE 1 – Representative examples of PCR detection of SV40Tag DNA in DLBCLs. (Panel a) Ethidium bromide stained agarosegel electrophoresis (top) and hybridization with the internal oligop-robe (bottom) for SV40 DNA detection using primers SV.for3/revwhich amplify a 105-bp fragment in the Tag region; lanes L58, L73,L61, L48, L59, L93, L69, L46, L53 and L64 represent SV40-positivecases; lanes L1, L6, L5, L36, L8 and L24 represent SV40-negativecases. (Panel b) Ethidium bromide stained agarose gel electrophoresis(top) and hybridization with the internal oligoprobe (bottom) forSV40 DNA detection using primers SVTAGP1/3 which amplify a126-bp fragment in the Tag region; lanes L73, L58, L68, L91, L78,L46, L93 and L53 represent SV40-positive cases; lanes L22, L16,L12, L18, L34, L42, L45 and L42 represent SV40-negative cases.Lanes MW show 100-bp DNA ladder (Promega); Lanes P and N rep-resent positive control (plasmid pSVSph21-N) and negative control(without DNA template), respectively.

FIGURE 2 – Sensitivity of the PCR assays used for the detection ofSV40 Tag DNA. Different amounts of the control plasmid pSVSph21-N (from 1 ng to 1 ag) were mixed with 400 ng of DNA prepared fromhuman normal lymphoid tissue. PCR was performed for 40 cycleswith primers SV.for3/SV.rev (Panel a) or primers SVTAGP1/3 (Panelb), and PCR products were analyzed with ethidium bromide stainedagarose gel electrophoresis (top) and hybridization with the internaloligoprobe (bottom). Both primer sets detected �1 fg of plasmidDNA diluted in 400 ng of human lymphoid DNA. This indicates thatboth PCR assays could detect at least 1.8 copies of SV40 genome per1,000 cells. Lane MW shows molecular weight markers; lane N repre-sents negative control (without DNA template). The arrows indicatethe product size obtained by PCR.

2696 AMARA ET AL.

in 31 (49%) cases. In SV40-positive nontumoral cases, SV40DNA load was significantly lower than found in DLBCL cases,p 5 0.02 (Table II and Fig. 3).

To confirm the presence of SV40 DNA in clinical samples, allcases were further investigated by PCR targeting the regularityand the VP1 regions of the SV40 genome using RA1/RA2 andLA1/LA2 primer set, respectively. Thirty eight (35%) and24 (22%) of the 108 DLBCL cases were, respectively, positive(Figs. 4a and 4b). Interestingly, only positive cases with primerstargeting Tag region showed positive results. Twenty-four (22%)DLBCL cases were positive for the 3 SV40 regions investigated(Tag, regularity region and VP1). Only 1 of the 4 nontumoralcases positive for Tag DNA showed positivity with RA1/RA2 andLA1/LA2 primer sets. The sensitivity of these 2 PCR assayswas found to be lower than Tag PCR assays; up to 10 fg and up to

100 fg for RA1/RA2 and LA1/LA2 primer sets corresponding toat least 18 and 180 copies of the viral genome per 1,000 cells,respectively (Figs. 5a and 5b).

Methylation status of TSGs

The results of MSP analysis in DLBCL cases are presented inFigure 6 (by individual sample). All cases investigated by MSPdemonstrated hypermethylation in at least 1 gene and about 44%carry 6 or more hypermethylated genes. Multigene hypermethyl-ation, defined as aberrant hypermethylation involving more than 3gene promoters,53 was present in more than 93% of cases. Overall,the frequency of hypermethylation of each gene varied notablyand it was as follows: 74% for DAPK, 70% for CDH1, SHP1 andGSTP1, 58% for p16, 54% for APC, 50% for p14, 39% for p15,19% for RB1, 15% for BLU, 3% for p53, and 0% for p300 andMGMT (Fig. 7).

There was no significant correlation between overall gene hy-permethylation status and patient’s age, gender, tumor location orclinical stage (data not shown). Representative examples of hyper-methylation-positive and -negative cases are illustrated in Figure8. Interestingly, none of the nontumoral samples showed aberranthypermethylation in any of the genes tested (data not shown).

Relationship between the presence of SV40 DNA and methylationof TSGs

To examine whether there was any association between methyl-ation status of each genes investigated and the presence of SV40DNA, we compared the frequencies of promoter hypermethylationfor each gene between SV40-positive and SV40-negative DLBCLcases. Aberrant hypermethylation in SHP1, DAPK, GSTP1, p16and CDH1genes were significantly higher in SV40-positive thanin SV40-negative cases with p values ranging from 0.0006 to<0.0001 (Fig. 9a). However, hypermethylation of p53 was inver-sely associated with the presence of the virus in DLBCL caseswith p 5 0.02 (Fig. 9a). To quantify the extent of methylation in

FIGURE 3 – Gel electrophoresis examples of semiquantitative PCRamplification of SV40 DNA. SV40 load was determined using theQuantity One software V.4.2.3 (Bio-Rad) by comparing the densitiesof PCR products of the clinical samples to the signals obtained withserial 10-fold dilutions of the plasmid pSVSph21-N as described in‘‘Material and Methods’’ section. PCR assays were performed for 33cycles with primers SVTAGP1/3. Lanes L60, L66, L83, L76, L107and L63 represent DLBCL cases; lanes R1 and R2 represent 2 nontu-moral samples. Lane MW shows 50 bp DNA ladder (Promega).

FIGURE 4 – Representative examples of PCR detection of SV40regulatory region and VP1 gene in DLBCLs. (Panel a) Ethidium bro-mide stained agarose gel electrophoresis for SV40 DNA detectionusing primers RA1/RA2 targeting the regulatory region; lanes L73,L58, L82, L56 and L53 represent SV40-positive cases; lanes L8, L19,L38, L28, L34 and L26 represent SV40-negative cases. (Panel b) Ethi-dium bromide stained agarose gel electrophoresis for SV40 DNAdetection using primers LA1/LA2 targeting the VP1 gene; lanes L53,L58, L93, L44 and L46 represent SV40-positive cases; lanes L3, L8,L22, L16, L18 and L12 represent SV40-negative cases. Lane MWshows 50 bp DNA ladder; lanes P and N represent positive (plasmidpSVSph21-N) and negative (without DNA template) controls, respec-tively.

FIGURE 5 – Sensitivity of the PCR assays used for the detection ofSV40 regulatory region and VP1 gene. Different amounts of the plas-mid pSVSph21-N (from 1 ng to 1 ag) were mixed with 400 ng ofDNA prepared from human normal lymphoid tissue. PCR was per-formed for 40 cycles with primers RA1/RA2 targeting the regulatoryregion (Panel a) or primers LA1/LA2 targeting the VP1 gene (Panelb), and PCR products were analyzed on ethidium bromide stained aga-rose gel. The RA1/RA2 and LA1/LA2 PCR protocols were able todetect �10 and 100 fg of plasmid DNA diluted in 400 ng of humanlymphoid DNA, respectively. This indicates that these two PCRassays could detect at least 18 and 180 copies of SV40 genome per1,000 cells, respectively. Lane MW shows 100 bp DNA ladder; laneN represents negative control (without DNA template). The arrowsindicate the product size obtained by PCR.

2697SV40 AND HYPERMETHYLATION IN DLBCL

our series of DLBCLs, we calculated for each case the MI ofSV40-negative and -positive cases; the MI ranged from 0.07 to0.69, with an average of 0.40. The mean of MI in the SV40-positive group was higher than that in the SV40-negative group(0.4706 0.014 vs. 0.2766 0.016; p 5 0.0007; Fig. 9b).

Also, we further analyzed the relationship between methylationstatus of TSGs and the load of SV40 DNA. Significant increase inhypermethylation frequencies proportionally to the level of SV40load was observed for SHP1, DAPK, GSTP1, p16 and CDH1genes, with p values ranging from 0.03 to 0.0001 (Fig. 10a). A sig-nificant increase in the mean of MI level was also observedaccording to the level of SV40 load, with p values ranging from0.001 to 0.0005 (Fig. 10b).

Discussion

SV40 is a potent tumorigenic DNA virus that causes varioustumors when injected into hamsters, including leukemias and lym-phomas,1–4,54 and is a unique carcinogen that is shown to promotein vitro malignancy transformation simultaneously by inactivatingmany TSGs,1,25 inducing telomerase activity,26 and activating sev-eral oncogenes and growth factors.27 Several previous studies

have detected SV40 DNA sequences in a subset of hematologicalmalignancies lymphomas mainly in DLBCLs.12–21 However, it isimportant to distinguish between association (i.e., the presence ofSV40 virus sequences) in a tumor and its role in tumor causality.DNA hypermethylation of the promoter region of genes hasemerged as a common mechanism of inactivation of TSGs. Inmany tumors, aberrant hypermethylation of the CpG island geneshas been correlated with loss of gene expression, and DNA meth-ylation provides an alternative pathway to gene deletion or muta-tion for the loss of TSGs function.28 Markers for aberrant hyper-methylation may represent a promising avenue for monitoring theonset and progression of cancer. Aberrant promoter hypermethyl-ation has been described for several genes in DLBCLs, and eachtumor-associated gene may have its own distinct pattern of hyper-methylation.55 Because previous reports suggest an associationbetween aberrant hypermethylation of TSGs and oncogenicviruses including SV40,15,34,35 it was relevant to determinewhether SV40 would be associated with aberrant methylation ofmultiple TSGs in DLBCLs.

To the best of our knowledge, this current report is the first ofits kind investigating the prevalence of SV40 in patients with lym-phomas from Africa, and the most extensive study in which alarge series of DLBCLs has been evaluated for the presence of

FIGURE 6 – Summary of methylation statusof 13 tumor suppressor genes in SV40-negative (Panel a) and SV40-positive (Panel b)DLBCL cases. Black boxes indicate the pres-ence of promoter hypermethylation; whiteboxes indicate the absence of promoter hyper-methylation;1, presence of SV40 DNA; –, ab-sence of SV40 DNA.

2698 AMARA ET AL.

SV40 DNA sequences and correlated with aberrant promoter hy-permethylation profiles of multiple TSGs involved in several cellfunctions. Using PCR and subsequent Southern blotting, we havesuccessfully demonstrated the presence of SV40 DNA sequencesin 56% of DLBCLs in Tunisian patients prevalence, which is atthe higher end of those reported from other countries.12–21 How-ever, these findings are at variance with those presented by otherinvestigators,22–24 who did not detect SV40 DNA in any of thelymphomas samples analyzed. This discrepancy in SV40 detectionin lymphoma between several parts of the world is not clear, but itcould be at least in part due to differences in laboratory techniquesused for virus detection, the criteria of requirements for confirma-tion of the presence of virus,1,19,22,54,56 the characteristics ofpatients populations that were the source of specimens1,54 andmainly the difference in histological types of lymphomastested.1,12,54 In the current study of a large series of only 1 histo-logical type of lymphoma, the precautions taken and the controlsused do not support a contamination source. Moreover, the pres-ence of SV40 DNA was confirmed by independent PCRapproaches targeting 3 different regions in the SV40 genome(Tag, regulatory region and VP1) in a significant fraction of cases(n 5 24). The absence of total concordance between the detectionrates obtained for the 3 genomic regions of SV40 in our studyseems to be due to differences in the sensitivity of the PCR assaysused. Indeed we have found that PCR approaches based on Tagregion were more sensitive than those based on regulatory andVP1 regions (1.8 vs. 18 and 180 copies of SV40 genome per 1,000human cells, respectively).

More important than technical issues in affecting differencesbetween studies is that the prevalence of SV40-associated lympho-mas may vary among geographic regions in relation with differen-ces in exposition and/or ethnic susceptibility to SV40 infec-tion.1,3,4,54 The major source of known human exposure to polyo-mavirus SV40 was immunization with SV40-contaminatedpoliovaccines in the period from 1955 to 1963, during which largenumber of people worldwide were inadvertently exposed to liveSV40.1–3,54,57 In Tunisia, nationwide antipoliomyelitis vaccinationcampaigns were initiated in early 1960s; however, we do notknow whether SV40-contaminated poliovaccine lots were used.Nevertheless, in the current study, no correlation was foundbetween the presence of SV40 DNA in DLBCLs and age ofpatient at diagnosis or year of birth, suggesting that the high prev-alence of SV40 in Tunisian DLBCLs may not be related to suchexposition. Interestingly, a previous survey of SV40 neutralizing

antibodies in human sera by Minor et al.,58 included a small serumpanel from children under the age of 5 years from another NorthAfrican country (Morocco) has showed a prevalence of 100%seropositivity. The authors had no explanation for that high fre-quency of SV40-neutralizing antibody, but they discard any rela-tionship with the exposure to poliovaccine usage, because all serawere from patients with poliomyelitis who were assumed to be notsuccessfully vaccinated with any poliovaccine. Taken together,these observations further suggest that SV40 infection may bewidespread in North African populations. Further studies areneeded to explore the seroprevalence and the sources of expositionto SV40 in those populations.

In the current study, the presence of SV40 Tag DNA was foundsignificantly correlated with the hypermethylation of five (GSTP1,SHP1, DAPK, CDH1 and p16) of the 13 TSGs analyzed. Inactiva-tion of these genes by hypermethylation of the promoter regionhas been previously reported in several studies investigating

FIGURE 7 – Histogram of frequencies of aberrant promoter hyper-methylation of DAPK, GSTP1, CDH1, SHP1, p16, APC, p14, p15,RB1, BLU, p53, p300 and MGMT genes in 108 DLBCL cases ana-lyzed by methylation-specific PCR.

FIGURE 8 – Representative examples of methylation-specific PCRassays of the methylated alleles (M) and unmethylated alleles (U) ofSHP1, DAPK, GSTP1, CDH1, p16, APC, p15, p14, BLU, RB1 andp53 genes in SV40-positive and SV40-negative DLBCL cases. The b-actin gene was used as an internal control for bisulfite treatment. LaneMW shows molecular weight markers; lane P represents positive con-trols; lane N represents negative control.

2699SV40 AND HYPERMETHYLATION IN DLBCL

hypermethylation patterns of multiples TSGs in lymphomas(reviewed in Ref. 55). Interestingly, our current study is the firstinvestigating the relationship between hypermethylation of theGSTP1 gene and the detection of the SV40 DNA sequences, andwe showed a significant correlation between the methylation ofthis gene and the presence of SV40 DNA (p 5 0.0005). It hasbeen reported that downregulation of GSTP1 in lymphomas byCpG islands hypermethylation was observed in more than 50% ofcases.55 GSTP1 belongs to a family of phase II metabolic enzymesthat has been shown to play a crucial role in detoxification anddrugs cytotoxication by conjugating them with glutathione.59

Moreover, our present report showed a significantly high hyper-methylation rates (MI) in SV40-positive DLBCL cases comparedwith SV40-negative cases. Therefore, the significant association

of promoter hypermethylation of several TSGs with the presenceof SV40 DNA in DLBCLs supports a functional effect of the virusin those lymphomas. Also, our study provides confirmation of theprevious report by Shivapurkar et al.,15 showing an associationbetween hypermethylation of several TSGs and the presence ofSV40 DNA in a smaller series of lymphomas. Similar results havealso been shown in human malignant mesotheliomas.34,35

Semiquantitative PCR analysis revealed that the level of SV40DNA load in DLBCLs (ranging between 1.8 and 1,800 SV40 cop-ies/1,000 cells) was found significantly higher than in nontumoralsamples (less than 180 SV40 copies/1,000 cells) (p 5 0.02, TableII). Furthermore, for 5 TSGs, a significant relationship was foundbetween the increase of methylation frequency and the level ofSV40 DNA load in DLBCL samples (see Fig. 10). Taken into

FIGURE 9 – Frequencies of aberrant methylation and methylation index in SV40-negative (n 5 45; open bars) and SV40-positive (n 5 63;dark bars) DLBCLs. Methylation of SHP1, DAPK, GSTP1, p16 and CDH1 genes was more frequently detected in SV40-positive than in SV40-negative tumors (Panel a). The mean of the methylation index (MI) was significantly higher in SV40-positive cases (Panel b). P valuesare shown only when there was a significant difference between 2 groups. One asterisk, p < 0.05; double asterisk, p < 0.001; triple asterisk,p < 0.0001.

FIGURE 10 – Frequencies of aberrant methylation and methylation index in DLBCLs according to the level of SV40 load. Cases were catego-rized as negative (n 5 45; open bars), positive with SV40 load < 180 copies/1,000 cells (n 5 31; striped bars), and positive with SV40 load >180 copies/1,000 cells (n 5 32; dark bars). Significant increase in hypermethylation frequencies proportionally to the level of SV40 load wasobserved for SHP1, DAPK, GSTP1, p16 and CDH1 genes (panel a). The mean of the methylation index (MI) increased according to the level ofSV40 load (panel b). P values are shown only when there was a significant difference between 2 groups. One asterisk, p < 0.05; double asterisk,p < 0.001; triple asterisk, p < 0.0001.

2700 AMARA ET AL.

consideration that aberrant methylation of TSGs was in this studyspecifically associated with tumoral cases, these data strongly sup-port that SV40 might cause DNA methylation of TSGs in DLBCLsand that SV40 DNA detected in DLBCL samples was most likelycoming from malignant cells. However, these observations shouldbe regarded with precaution because of the limits of the semiquanti-tative approach used and the potential DNA-degrading effects offormalin fixation on the tissue specimens. Studies which attemptedmorphological analysis of the nature of infected cells in PCR-posi-tive SV40 lymphomas have been based on immunohistochemistryfor Tag oncoprotein. Overall, Tag expression has been detected inthe nuclei of malignant cells and not in reactive lymphocytes, butthe percentage of positive cells varied from tumor to tumor.18,20

In the present study, the 5 involved TSGs found associated withthe presence of SV40 DNA (GSTP1, SHP1, DAPK, CDH1 andp16) are located on 4 different chromosomes. Thus, SV40-associ-ated hypermethylation is not a localized process restricted to oneor a limited number of chromosomal loci but is an extensive phe-nomenon affecting CpG islands at multiple sites through the ge-nome.15,60 In addition, in our study, p16, p15 and p14 genes whichare located in tandem at chromosome 9p21 showed differentialmethylation profiles with p16, but not p15 and p14, being associ-ated with SV40 DNA presence, suggesting that aberrant hyper-methylation of the promoter region is also a selective event. Inter-estingly, in this study p53 gene was found to be more commonlymethylated in SV40-negative tumors than in SV40-positivetumors (see Fig. 9). This may reflect the fact that SV40 Tag targetsp53 and functionally inactivates it, and so there is no need for p53to be inactivated by another mechanism such as mutation or

hypermethylation during tumorigenesis involving SV40. This ob-servation needs more intention in further studies.

Several mechanisms are likely to play a role in viral oncogene-sis, including insertion mutations and chromosomal rearrange-ments. Apart from introducing genetic changes, the presence ofsome oncogenic viruses was found to be correlated with the aber-rant methylation profile of multiple TSGs in human cancers.61,62 Itis nowadays likely that SV40 may activate an aberrant methyla-tion pathway that affects multiples TSGs during lymphomagene-sis; however, the molecular mechanism underlying SV40-relatedaberrant methylation is currently still unknown. Determining pre-cisely how SV40 infection leads to aberrant hypermethylation ofpromoter genes in human cancers seems to be a key question to beaddressed in future studies.

In summary, our study showed the presence of SV40 DNAsequences in more than half of 108 cases of DLBCLs in Tunisia.Interestingly, the presence of the SV40 was significantly corre-lated to the aberrant hypermethylation of multiple TSGs, whichsuggests that the virus may have a functional effect in DLBCLs.Further studies are requested to elucidate whether SV40 pro-motes the malignant phenotype in a subset of DLBCLs and toevaluate the clinical relevance of the presence of SV40 in thoselymphomas.

Acknowledgements

The authors thank Dr. Regis A. Vilchez from the Baylor Col-lege of Medicine, Houston, TX, USA for his kind gift of the plas-mids containing SV40 genomes.

References

1. Butel JS, Lednicky JA. Cell and molecular biology of simian virus40: implications for human infections and disease. J Natl Cancer Inst1999;91:119–34.

2. Butel JS. Increasing evidence for involvement of SV40 in human can-cer. Dis Markers 2001;17:167–72.

3. Stratton K, Almario DA, McCormick MC, eds. Immunization safetyreview: SV40 contamination of polio vaccine and cancer. Washing-ton, DC: The National Academies Press, 2003.

4. Vilchez RA, Butel JS. Emergent human pathogen simian virus 40 andits role in cancer. Clin Microbiol Rev 2004;17:495–508.

5. Bergsagel DJ, Finegold MJ, Butel JS, Kupsky WJ, Garcea RL. DNAsequences similar to those of simian virus 40 in ependymomas andchoroid plexus tumors of childhood. N Engl J Med 1992;326:988–93.

6. Lednicky JA, Garcea RL, Bergsagel DJ, Butel JS. Natural simian vi-rus 40 strains are present in human choroid plexus and ependymomatumors. Virology 1995;212:710–17.

7. Carbone M, Pass HI, Rizzo P, Marinetti M, Di Muzio M, Mew DJ,Levine AS, Procopio A. Simian virus 40-like DNA sequences inhuman pleural mesothelioma. Oncogene 1994;9:1781–90.

8. Lednicky JA, Stewart AR, Jenkins JJ, Finegold MJ, Butel JS. SV40DNA in human osteosarcomas shows sequence variation among T-antigen genes. Int J Cancer 1997;72:791–800.

9. Galateau-Salle F, Bidet P, Iwatsubo Y, Gennetay E, Renier A, Letour-neux M, Pairon JC, Moritz S, Brochard P, Jaurand MC, Freymuth F.SV40-like DNA sequences in pleural mesothelioma, bronchopulmo-nary carcinoma, and non-malignant pulmonary diseases. J Pathol1998;184:252–7.

10. Gamberi G, Benassi MS, Pompetti F, Ferrari C, Ragazzini P, SollazzoMR, Molendini L, Merli M, Magagnoli G, Chiesa F, Gobbi AG,Powers A, et al. Presence and expression of the simian virus-40genome in human giant cell tumors of bone. Genes ChromosomesCancer 2000;28:23–30.

11. Pacini R, Vivaldi A, Santoro M, Fedele M, Fusco A, Romei C, BasoloF, Pinchera A. Simian virus 40-like DNA sequences in human papil-lary thyroid carcinomas. Oncogene 1998;16:665–9.

12. Vilchez RA, Madden CR, Kozinetz CA, Halvorson SJ, White ZS,Jorgensen JL, Finch CJ, Butel JS. Association between simian virus40 and non-Hodgkin lymphoma. Lancet 2002;359:817–23.

13. Shivapurkar N, Harada K, Reddy J, Sceuermann RH, Xu Y, McKennaRW, Milchgrub S, Kroft SH, Feng Z, Gazdar AF. Presence of simianvirus 40 DNA sequences in human lymphomas. Lancet 2002;359:851–2.

14. Nakatsuka S, Liu A, Dong Z, Nomura S, Takakuwa T, Miyazato H,Aozasa K, Osaka Lymphoma Study Group. Simian virus 40 sequencesin malignant lymphomas in Japan. Cancer Res 2003;63:7606–8.

15. Shivapurkar N, Takahashi T, Reddy J, Zheng Y, Stastny V, Collins R,Toyooka S, Suzuki M, Parikh G, Asplund S, Kroft SH, Timmons C,et al. Presence of simian virus 40 DNA sequences in human lymphoidand hematopoietic malignancies and their relationship to aberrant pro-moter methylation of multiple genes. Cancer Res 2004;64:3757–60.

16. Chen PM, Yen CC, Yang MH, Poh SB, Hsiao LT, Wang WS, Lin PC,Lee MY, Teng HW, Bai LY, Chu CJ, Chao SC, et al. High Prevalenceof SV40 Infection in patients with nodal Non-Hodgkin’s lymphomabut not acute leukemia independent of contaminated polio vaccines inTaiwan. Cancer Invest 2006;24:223–8.

17. Heinsohn S, Golta S, Kabisch H, zur Stadt U. Standardized detectionof Simian virus 40 by real-time quantitative polymerase chain reac-tion in pediatric malignancies. Haematologica 2005;90:95–100.

18. Vilchez RA, Lopez-Terrada D, Middleton JR, Finch CJ, Killen DE,Zanwar P, Jorgensen L, Butel JS. Simian virus 40 tumor antigenexpression and immunophenotypic profile of AIDS-related non-Hodg-kin’s lymphoma. Virology 2005;342:38–46.

19. Daibata M, Nemoto Y, Kamioka M, Imai S, Taguchi H. Simian vi-rus 40 in Japanese patients with lymphoproliferative disorders. Br JHaematol 2003;121:190–1.

20. Meneses A, Lopez-Terrada D, Zanwar P, Killen DE, Monterroso V,Butel JS, Vilchez RA. Lymphoproliferative disorders in Costa Ricaand simian virus 40. Haematologica 2005;90:1635–42.

21. David H, Mendoza S, Konishi T, Miller CW. Simian virus 40 is pres-ent in human lymphomas and normal blood. Cancer Lett 2001;162:57–64.

22. MacKenzie J, Wilson KS, Perry J, Gallagher A, Jarrett RF. Associa-tion between simian virus 40 DNA and lymphoma in the United king-dom. J Natl Cancer Inst 2003;95:1001–3.

23. Schuler F, Dolken SC, Hirt C, Dolken MT, Mentel R, Gurtler LG,Dolken G. No evidence for simian virus 40 DNA sequences in malig-nant non-Hodgkin lymphomas. Int J Cancer 2006;118:498–504.

24. Sui LF, Williamson J, Lowenthal RM, Parker AJC. Absence of simianvirus 40 (SV40) DNA in lymphoma samples from Tasmania,Australia. Pathology 2005;37:157–9.

25. White MK, Khalili K. Polyomaviruses and human cancer: molecularmechanisms underlying patterns of tumorigenesis. Virology 2004;324:1–16.

26. Soejima K, Fang W, Rollins BJ. DNA methyltransferase 3b contrib-utes to oncogenic transformation induced by SV40T antigen and acti-vated Ras. Oncogene 2003;22:4723–33.

27. Gazdar AF, Butel JS, Carbone M. SV40 and human tumours: myth,association or causality? Nat Rev Cancer 2002;2:957–64.

28. Esteller M. Relevance of DNA methylation in the management ofcancer. Lancet Oncol 2003;4:351–8.

2701SV40 AND HYPERMETHYLATION IN DLBCL

29. Esteller M. CpG island hypermethylation and tumor suppressorgenes: a booming present, a brighter future. Oncogene 2002;21:5427–40.

30. Jaffe ES, Harris NL, Stein H, Vardiman JW, eds. World Health Orga-nization Classification of Tumours. Pathology and Genetics ofTumours of the Haematopoietic and Lymphoid Tissues. Lyon: Inter-national Agency for Research on Cancer (IARC) Press, 2001.

31. Man Y, Moinfar F, Bratthauer GL, Kuhls EA, Tavassoli FA. Animproved method for DNA extraction from paraffin sections. PatholRes Pract 2001;197:635–42.

32. Lednicky JA, Butel JS. Consideration of PCR methods for the detec-tion of SV40 in tissue and DNA specimens. Dev Biol Stand1998;94:155–64.

33. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT,Mullis KB, Erlich HA. Primer-directed enzymatic amplification ofDNA with a thermostable DNA polymerase. Science 1988;239;487–91.

34. Toyooka S, Pass HI, Shivapurkar N, Fukuyama Y, Maruyama R,Toyooka KO, Gilcrease M, Farinas A, Minna JD, Gazdar AF. Aber-rant methylation and simian virus 40 tag sequences in malignant mes-othelioma. Cancer Res 2001;61:5727–30.

35. Suzuki M, Toyooka S, Shivapurkar N, Shigematsu H, Miyajima K,Takahashi T, Stastny V, Zern AL, Fujisawa T, Pass HI, Carbone M,Gazdar AF. Aberrant methylation profile of human malignant meso-theliomas and its relationship to SV40 infection. Oncogene 2005;24:1302–8.

36. Toyooka S, Carbone M, Toyooka KO, Bocchetta M, Shivapurkar N,Minna JD, Gazdar AF. Progressive aberrant methylation of theRASSF1A gene in simian virus 40 infected human mesothelial cells.Oncogene 2002;2:4340–4.

37. Weggen S, Bayer TA, Von Deimling A, Reifenberger G, Von Schwei-nitz D, Wiestler OD, Pietsch T. Low frequency of SV40, JC and BKpolyomavirus sequences in human medulloblastomas, meningiomasand ependymomas. Brain Pathol 2000;10:85–92.

38. Shah KV. Does SV40 infection contribute to the development ofhuman cancers? Rev Med Virol 2000;10:31–43.

39. Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB. Methyla-tion-specific PCR. a novel PCR assay for methylation status of CpGislands. Proc Natl Acad Sci USA 1996;93:9821–6.

40. Fan X, Inda MM, Tunon T, Castresana JS. Improvement of the meth-ylation specific PCR technical conditions for the detection of p16 pro-moter hypermethylation in small amounts of tumor DNA. Oncol Rep2002;9:181–3.

41. Singal R, Ferdinand L, Reis IM, Schlesselman JJ. Methylation of mul-tiple genes in prostate cancer and the relationship with clinicopatho-logical features of disease. Oncol Rep 2004;12:631–637.

42. Esteller M, Tortola S, Toyota M, Capella G, Peinado MA, Baylin SB,Herman JG. Hypermethylation-associated inactivation of p14(ARF) isindependent of p16(INK4a) methylation and p53 mutational status.Cancer Res 2000;60:129–33.

43. Katzenellenbogen RA, Baylin SB, Herman JG. Hypermethylation ofthe DAP-kinase CpG island is a common alternation in B-cell malig-nancies. Blood 1999;93:4347–53.

44. Esteller M, Sparks A, Toyota M, Sanchez-Cespedes M, Capella G,Peinado MA, Gonzalez S, Tarafa G, Sidransky D, Meltzer SJ, Baylin

SB, Herman JG. Analysis of adenomatous polyposis coli promoterhypermethylation in human cancer. Cancer Res 2000;60:4366–71.

45. Oka T, Ouchida M, Koyama M, Ogama Y, Takada S, Nakatami Y,Tanaka T, Yoshino T, Hayashi K, Ohara N, Kondo E, Takahashi K,et al. Gene silencing of the tyrosine phosphatase SHP1 gene by aber-rant methylation in leukemias/lymphomas. Cancer Res 2002;62:6390–4.

46. Corn PG, Heath RH, Fogt F, Forastiere AA, Herman JG, Wu T. Fre-quent hypermethylation of the 50 CpG island of E-Cadherin in esopha-geal adenocarcinomas. Clin Cancer Res 2001;7:2765–9.

47. Esteller M, Corn PG, Urena JM, Gabrielson E, Baylin SB, HermanJG. Inactivation of glutathione S-transferase P1 gene by promoterhypermethylation in human neoplasia. Cancer Res 1998;58:4515–18.

48. Amatya VJ, Naumann U, Weller M, Ohgaki H. TP53 promoter meth-ylation in human gliomas. Acta Neuropathol 2005;110:178–84.

49. Simpson DJ, Hibberts NA, McNicol AM, Clayton RN, Farrell WE.Loss of pRb expression in pituitary adenomas is associated with meth-ylation of the RB1 CpG island. Cancer Res 2000;60:1211–16.

50. Chim CS, Wong ASY, Kwong YL. Absence of p300 gene promotermethylation in acute leukemia. Cancer Genet Cytogenet 2004;150:164–7.

51. Esteller M, Hamilton SR, Burger PC, Baylin SB, Herman JG. Inacti-vation of the DNA repair gene O6-methylguanine-DNA methyltrans-ferase by promoter hypermethylation is a common event in primaryhuman neoplasia. Cancer Res 1999;59:793–7.

52. Agathanggelou A, Dallol A, Zochbauer-Muller S, Morrissey C, Hon-orio S, Hesson L, Martinsson T, Fong KM, Kuo MJ, Yuen PW, MaherER, Minna JD, et al. Epigenetic inactivation of the candidate 3p21.3suppressor gene BLU in human cancers. Oncogene 2003;22:1580–8.

53. House MG, Guo MZ, Efron DT, Lillemoe KD, Cameron JL, SyphardJE, Hooker CM, Abraham SC, Montgomery EA, Herman JG, BrockMV. Tumor suppressor gene hypermethylation as a predictor of gas-tric stromal tumor behavior. J Gastrointest Surg 2003;7:1004–14.

54. Vilchez RA, Kozinetz CA, Butel JS. Conventional epidemiology and thelink between SV40 and human cancers. Lancet Oncol 2003;4:188–91.

55. Esteller M. Profiling aberrant DNA methylation in hematologic neo-plasms: a view from the tip of the iceberg. Clinical Immunology2003;109:80–8.

56. Shah KV. SV40 and human cancer: a review of recent data. Int JCancer 2007120:215–23.

57. Vilchez RA, Kozinetz CA, Arrington AS, Madden CR, Butel JS. Sim-ian virus 40 in human cancers. Am J Med 2003;114:675–84.

58. Minor P, Pipkin P, Jarzebek Z, Knowles WA. Studies of neutralizingantibodies to SV40 in human sera. J Med Virol 2003;70:490–5.

59. Coles BF, Kadlubar FF. Detoxification of electrophilic compounds byglutathione S-transferase catalysis: determinants of individualresponse to chemical carcinogens and chemotherapeutic drugs? Bio-factors 2003;17:115–30.

60. Toyota M, Ahuja N, Ohe-Toyota M, Herman JG, Baylin SB, Issa JP.CpG island methylator phenotype in colorectal cancer. Proc NatlAcad Sci USA 1999;96:8681–6.

61. Lanagan JM. Host epigenetic modifications by oncogenic viruses. BrJ Cancer 2007;96:183–8.

62. Li HP, Leu YW, Chang YS. Epigenetic changes in virus-associatedhuman cancers. Cell Res 2005;15:262–71.

2702 AMARA ET AL.