Oligonucleotide motifs that disappear during the evolution of influenza virus in humans increase...

JOURNAL OF VIROLOGY, Apr. 2011, p. 3893–3904 Vol. 85, No. 80022-538X/11/$12.00 doi:10.1128/JVI.01908-10Copyright © 2011, American Society for Microbiology. All Rights Reserved.

Oligonucleotide Motifs That Disappear during the Evolution ofInfluenza Virus in Humans Increase Alpha Interferon

Secretion by Plasmacytoid Dendritic Cells�

Sonia Jimenez-Baranda,1 Benjamin Greenbaum,2† Olivier Manches,1† Jesse Handler,1 Raul Rabadan,3Arnold Levine,2 and Nina Bhardwaj1*

New York University Langone Medical Center and New York University Cancer Institute, New York, New York1; The Simons Center forSystems Biology, Institute for Advanced Study, Princeton, New Jersey2; and Department of Biomedical Informatics, Center for

Computational Biology and Bioinformatics, Columbia University College of Physicians and Surgeons, New York, New York3

Received 9 September 2010/Accepted 29 January 2011

CpG motifs in an A/U context have been preferentially eliminated from classical H1N1 influenza virusgenomes during virus evolution in humans. The hypothesis of the current work is that CpG motifs in a uracilcontext represent sequence patterns with the capacity to induce an immune response, and the avoidance of thisimmunostimulatory signal is the reason for the observed preferential decline. To analyze the immunogenicityof these domains, we used plasmacytoid dendritic cells (pDCs). pDCs express pattern recognition receptors,including Toll-like receptor 7 (TLR7), which recognizes guanosine- and uridine-rich viral single-stranded RNA(ssRNA), including influenza virus ssRNA. The signaling through TLR7 results in the induction of inflam-matory cytokines and type I interferon (IFN-I), an essential process for the induction of specific adaptiveimmune responses and for mounting a robust antiviral response mediated by IFN-�. Secretion of IFN-� is alsolinked to the activation of other immune cells, potentially amplifying the effect of an initial IFN-� secretion.We therefore also examined the role of IFN-�-driven activation of NK cells as another source of selectivepressure on the viral genome. We found direct evidence that CpG RNA motifs in a U-rich context control pDCactivation and IFN-�-driven activation of NK cells, likely through TLR7. These data provide a potentialexplanation for the loss of CpG motifs from avian influenza viruses as they adapt to mammalian hosts. Theselective decrease of CpG motifs surrounded by U/A may be a viral strategy to avoid immune recognition, astrategy likely shared by highly expressed human immune genes.

The innate immune system uses pattern recognition recep-tors (PRRs) to recognize non-self material based on factorssuch as nucleotide sequence specificity and cellular localization(2). Expression of these receptors varies among cell types andactivation states. Viral infections can strongly induce innateimmunity through replication intermediates such as double-stranded RNA and single-stranded RNA (ssRNA) sequencemotifs. Identifying viral adaptations to avoid host recognitionprovides a possible tool for identifying patterns recognized bythe innate immune system. Greenbaum et al. showed that CpGdinucleotide content in a H1N1 influenza A virus originatingfrom the 1918 pandemic decreased during its 90 years of replica-tion in humans (21). CpGs in an A/U context were preferentiallyeliminated, implying possible selection against this motif.

The coding regions of many human innate immunity genes,particularly type I interferons (IFN-I), also have an extremelylow CpG content, and mRNAs heavily expressed during theacute phase of the innate response have a bias toward lowCpG content (22). These facts led us to hypothesize thatboth ssRNA viruses and host genes involved in the innate

immune response have evolved to have low CpG content toavoid a CpG RNA sensing receptor.

Here we tested this hypothesis in vitro by examining thestimulatory effects of CpG RNA sequences in plasmacytoiddendritic cells (pDCs) (22). We introduced CpG sequencesboth in the context of oligonucleotides and in the context ofmodified influenza virions containing green fluorescent pro-tein (GFP) recoded to have variable CpG content. pDCswere singled out since they are the major IFN-I (IFN-�,IFN-�, IFN-�, and IFN-�) producers within peripheral bloodand are required to control viral replication and promote the Thelper 1 (Th1) response (10, 30). Mouse pDCs secrete largeamounts of IFN-� in response to the influenza virus, in addi-tion to chemokines implicated in effector T-cell recruitment(CXCL9, CXCL10, and CXCL1) and proinflammatory medi-ators such as lymphotoxin-� and tumor necrosis factor alpha(TNF-�) (28). pDCs also express molecules implicated in nega-tive immunoregulation, such as interleukin-10 (IL-10) and pro-grammed death ligand 1 (PD-L1), indicating possible involve-ment in limiting immune responses, including incompletecostimulatory-molecule induction (29).

pDCs exclusively express the intracellular PRRs Toll-likereceptor 7 (TLR7) and TLR9 (27). TLR7 recognizes syntheticcompounds of the imidazoline family (1) and GU-rich viralssRNA (13, 36). Although TLR7 and TLR8 can recognizessRNA with possible context specificity (24, 36), the sequencemotifs responsible for ssRNA recognition have not been fullyenumerated. Instead, poly(U) has been reported to be active

* Corresponding author. Mailing address: New York UniversityLangone Medical Center, Smilow Research Building, 522 First Ave-nue, Room 1303, New York, NY 10016. Phone: (212) 263-5814. Fax:(212) 263-6729. E-mail: [email protected].

† B.G. and O.M. contributed equally to this work.� Published ahead of print on 9 February 2011.

3893

on June 19, 2016 by guesthttp://jvi.asm

.org/D

ownloaded from

http://jvi.asm.org/

(13), and it has been proposed that GU-rich viral RNA se-quences are responsible for immune recognition (17).

Taking this into consideration, we studied the relevance ofCpG motifs in pDC activation, measuring both IFN-� pro-duction as the major antiviral response and TNF-� as aproinflammatory cytokine. IFN-� secretion is linked to ac-tivation of other immune cells, increasing natural killer (NK)cell cytotoxicity, increasing ��T cell activation, and facilitatingcross-priming (8), potentially amplifying the effect of initialIFN secretion. Therefore, we also examined the role of IFN-�-driven NK cell activation as another source of selective pres-sure on the viral genome (19). We obtained experimental ev-idence that CpG motifs in a U-rich context quantitativelycontrol pDC activation, providing a potential explanation fortheir paucity in the influenza virus genome and highly ex-pressed human innate immunity genes.

MATERIALS AND METHODS

Sequence analysis. In a study by Greenbaum et al. (22), it was shown that theCpGs in an A/U context have been eliminated over time from the strain datingfrom the 1918 flu. Inspired by these results, we constructed a stronger non-selfmeasure for emerging viruses by using the method for generating underrepre-sented tetramers from that work. The concept is to have a blind measure todetect how much of an underrepresented signal a virus carries rather thanfocusing on individual dinucleotides. Based on that work, there were 36 se-quences of length four, which was the longest length for which we had statisticalconfidence, due to the short length of viral genomes, underrepresented in ssRNAviruses. These motifs are underrepresented when codon bias, nucleotide content,and amino acid frequency are taken into account. Of these 36 motifs, 33 are alsounderrepresented in the RNA transcriptome for stimulated pDCs, as found in theprevious work. The set of these 36 motifs is {CGAA, CGAT, TTCG, ACGA,TCGA, GACG, TACG, TCGT, GTCG, ATCG, CGTT, AACG, TCCG, CGCT,TCGC, GCGA, CGTA, CGGA, CGAC, ACCG, CGGT, CGAG, CCGA, CGCA,ACGG, ACGC, TCGG, CCGT, CTCG, CCGG, CGTC, GGCG, ACGT, CCGC,AGCG, GCCG}.

Since H5N1 is a highly immunostimulatory strain in the human population, wemeasured the frequency of each of its sequences over time. We then used thesame measure to compare all influenza virus strains in the database. The resultsare an improvement upon the CpG plots presented by Greenbaum et al. (22),except these are more sequence specific and look for all underrepresentedtetramers, not just for CpGs. The CpG pressure is implied, in that most of theunderrepresented sequences, particularly the most underrepresented, containCpG in an A/U context. To measure whether the observed decline in H1N1 wassignificant, we designed a permutation test by randomly selecting sets of 36motifs and measuring the decline in their frequencies between 1918 and theirmost recent sets of available sequences, using the average values of the frequen-cies of the most recent sequences. A permutation test is valid here, becausetesting all possible ways of drawing 36 motifs from a set of 256 is impractical, asthere are about 1044 such ways of doing so. We performed this test 100,000 timesto generate a P value indicating that the observed decline was in fact significant.

Cell isolation and culture and ssRNA stimulation. Human peripheral bloodmononuclear cells (PBMCs) were separated by density gradient centrifugationon a Ficoll-Hypaque instrument (Amersham Biosciences) from leukocyte-en-riched buffy coats obtained from the New York Blood Center. pDCs and NKcells were purified by anti-BDCA-4-conjugated and anti-CD59-conjugated mag-netic beads, respectively, over 2LD columns (Miltenyi Biotec). PBMCs, freshlyisolated pDCs, and freshly isolated NK cells (in the presence or absence ofpDCs) were cultured at a concentration of 106 cells/ml in RPMI 1640 mediumwith 5% pooled human serum (Cellgro; Mediatech, Inc.), L-glutamine, nones-sential amino acids, and sodium pyruvate. For stimulation, cells were incubatedwith 10 �g/ml of ssRNAs (Integrated DNA Technologies, Inc.), whose sequencesare indicated in the manuscript, and 2 �g/ml of CpG-A oligodeoxynucleotides(ODNs) (G*G*GGGACGATCGTC*G*G*G*G*G*G; asterisks indicate phos-phorothioate modified [PS]). RNAs were formulated with N-[1-(2,3-dioleoyl-oxy)propyl]-N,N,N-trimethylammoniummethylsulfate (DOTAP, a liposomaltransfection reagent) according to instructions from the manufacturer (RocheDiagnostics Corp.).

ELISA and flow cytometry. IFN-� levels were evaluated by enzyme-linkedimmunosorbent assay (ELISA) (PBL Biomedical Laboratories). TNF-� andIFN-� were measured by flow cytometry (CBA kit; BD Biosciences Pharmingen).To analyze pDC surface activation markers, nonstimulated and ssRNA-stimu-lated purified BDCA-4� cells were stained with fluorescein isothiocyanate(FITC)-CD83 (BD), phycoerythrin (PE)-CD123 (BD) and allophycocyanin(APC)-CD40 (BD). To measure NK cell activation, purified CD56� NK cellswere stained with peridinin chlorophyll A protein (PerCP)-CD3 (BD), PE-CD56(BD), and FITC-CD69 (BD). Fluorescence was detected by flow cytometry ona FACSCalibur instrument using CellQuest and FlowJo software (BD) foranalysis.

Intracellular staining for cytokine detection. pDCs stimulated with CpG/GpCRNA for 18 h in the presence of brefeldin A (added 4 h after stimulation) werefirst stained with PE-CD123 monoclonal antibody (MAb) (BD), fixed with 4%paraformaldehyde, and treated with permeabilizing (0.1% saponin solution) andblocking solution. The fixed cells were then stained with APC-anti-TNF-� MAbfor 30 min on ice. The percentage of cells expressing cytoplasmic TNF-� wasdetermined by flow cytometry (FACSCalibur instrument).

Transwell experiment. Freshly isolated pDCs, ssRNA stimulated for 4 h, wereplated in the upper wells of 24-well plates (3-�m-pore-diameter membrane;Corning, Acton, MA) after being washed, and pure nonstimulated NK cells wereadded to lower wells. IFN-� and IFN-� levels in the lower compartment andCD69 expression on NK cells were analyzed after an 18-h culture.

Supernatant transfer experiment. Freshly isolated pDCs were stimulated for4 h with the indicated ssRNA sequences, washed, and incubated with freshmedium for 12 h. Twelve-hour supernatants were collected and transferred topure, nonstimulated NK cells. Eighteen hours after incubation, cell surfaceexpression levels of IFN-�, IFN-�, and CD69 NK were assessed.

TLR7- and TLR9-specific inhibition. Freshly isolated pDCs were preincubatedfor 30 min in the presence of different concentrations of IRS 661 (TLR7-specificinhibitor) and IRS 869 (TLR9-specific inhibitor) before 1 �g/ml of CpG-V1 andCpG-DNA type A were added. IFN-� was measured in the supernatants 18 hafter stimulation.

WSN-PB1flank-eGFP-highCpG/lowCpG virus generation. WSN-PB1flank vi-ruses were generated essentially as described in reference 9. The pHH-PB1flank-eGFP plasmid described in that reference was modified by replacing the standardGFP sequence with an enhanced GFP sequence fused to a GFP sequencerecoded to contain a high number of CpG motifs (eGFP-highCpG) or to a GFPsequence recoded to contain a low number of CpG motifs (eGFP-lowCpG). Theviruses were generated by transfecting cocultures of 293T-cytomegalovirus(CMV)-PB1 and MDCK-SIAT1-CMV-PB1 cells with either pHH-PB1flank-eGFP-highCpG or pHH-PB1flank-eGFP-lowCpG along with pHW181-PB2,pHW183-polymerase (PA), pHW184-hemagglutinin (HA), pHW185-nucleopro-tein (NP), pHW186-neuraminidase (NA), pHW187-matrix (M), and pHW188-nonstructural (NS) (25). The cells were cultured and transfected in D10 medium(Dulbecco modified Eagle medium [DMEM] supplemented with 10% heat-inactivated fetal bovine serum, 2 mM L-glutamine, 100 U/ml of penicillin, and100 �g/ml of streptomycin) at 37 C. At 12 h posttransfection, the cells werewashed once with phosphate-buffered saline (PBS) and the medium was changedto influenza virus growth medium (Opti-Mem I supplemented with 0.3% bovineserum albumin, 0.01% heat-inactivated fetal bovine serum, 100 U/ml of penicil-lin, 100 �g/ml of streptomycin, and 100 �g/ml of calcium chloride) supplementedwith 2 �g/ml of tosylsulfonyl phenylalanyl chloromethyl ketone, L-1-tosylamide-2-phenylmethyl chloromethyl ketone (TPCK)-treated trypsin. After 48 h, theviruses were collected through 0.45-um-pore-size filters and stored in aliquots at80 C. To determine the titers of the viruses, aliquots were thawed and used toinfect MDCK-SIAT1-CMV-PB1 cells. At 14 h postinfection, the cells wereanalyzed by flow cytometry and the titer of infectious particles was assessed fromthe fraction of eGFP-positive cells.

eGFP-lowCpG sequence. The sequence of eGFP-lowCpG is ATGGTCAGCAAGGGCGAGGA GCTGTTCACC GGGGTGGTGC CCATCCTGGT TGAGCTGGAC GGCGATGTAA ACGGCCACAA GTTCAGCGTG TCCGGCGAGG GCGAGGGCGA TGCCACCTAC GGCAAGCTGA CCCTGAAGTTCATCTGCACC ACCGGCAAGC TGCCCGTGCC CTGGCCCACC CTAGTGACCA CCCTGACCTA CGGCGTGCAG TGCTTCAGCC GCTACCCCGACCACATGAAG CAGCATGACT TCTTCAAGTC CGCCATGCCC GAAGGCTATG TCCAGGAGCG CACCATCTTC TTCAAGGACG ACGGCAACTACAAGACCCGC GCCGAGGTGA AGTTTGAGGG CGACACCCTG GTGAACCGCA TAGAGCTGAA GGGCATTGAC TTCAAGGAGG ACGGCAACAT CCTGGGGCAC AAGCTGGAGT ACAACTACAA CAGCCACAATGTCTATATCA TGGCCGACAA GCAGAAGAAC GGCATCAAGG TGAACTTCAA GATCCGCCAC AACATAGAGG ACGGCAGCGT GCAGCTCGCC GACCACTACC AGCAGAACAC CCCCATCGGC GACGGCCCCG

3894 JIMENEZ-BARANDA ET AL. J. VIROL.


.org/D

ownloaded from

http://jvi.asm.org/

TGCTGCTGCC CGACAACCAC TACCTGAGCA CCCAGTCCGC CCTGAGCAAA GACCCCAACG AGAAGCGCGA TCACATGGTC CTGCTGGAGT TTGTGACCGC CGCCGGGATC ACTCTCGGCA TGGATGAGCTGTACAAATAA.

eGFP-highCpG sequence. The sequence for eGFP-highCpG is ATGGTATCGA AAGGCGAGGA GCTGTTCACC GGGGTGGTGC CCATCCTTGTCGAATTAGAC GGAGACGTAA ATGGCCACAA GTTCAGCGTG TCCGGCGAGG GCGAGGGCGA TGCCACCTAC GGCAAGCTGA CGTTAAAGTT CATCTGCACC ACCGGCAAGC TGCCCGTGCC CTGGCCCACCCTCGTGACCA CCCTAACGTA TGGCGTGCAG TGCTTTAGTC GATATCCCGA CCACATGAAG CAGCACGACT TCTTCAAGTC CGCCATGCCCGAAGGCTACG TCCAGGAGCG CACCATCTTC TTCAAGGACG ACGGCAACTA CAAGACCCGC GCCGAGGTGA AGTTCGAGGG CGATACGTTA GTTAATCGAA TCGAATTGAA GGGAATCGAT TTCAAGGAGGACGGCAACAT CCTGGGGCAC AAGCTGGAGT ACAACTACAA CAGCCATAAC GTATATATCA TGGCCGACAA GCAGAAGAAC GGCATCAAGG TGAACTTCAA GATCCGCCAC AACATCGAGG ACGGCAGCGTGCAGCTCGCC GACCACTACC AGCAGAACAC CCCCATCGGC GACGGCCCCG TGCTGCTGCC CGACAACCAC TACCTGAGCA CCCAGTCCGC CCTGAGCAAA GACCCCAACG AGAAGCGCGA TCACATGGTCCTGCTGGAGT TCGTGACCGC CGCCGGTATT ACGTTAGGCA TGGACGAGCT GTACAAATAA.

WSN-PB1flank-eGFP-highCpG/lowCpG virus infection. Human pDCs werepurified from 13 healthy donors as previously explained. For viral infection, 2.5 104 cells were infected with WSN-PB1flank-eGFP-highCpG and WSN-PB1flank-eGFP-lowCpG viruses at a multiplicity of infection of one infectious particle percell, based on viral titers in the MDCK-SIAT1-CMV-PB1 cells. The cells wereincubated in RPMI medium containing 10% heat-inactivated fetal bovine serum,2 mM L-glutamine, 100 U/ml of penicillin, 100 �g/ml of streptomycin, nonessen-tial amino acids, and sodium pyruvate at 37 C. At 18 h posttransfection, thesupernatants were collected to measure IFN-� as previously described, and cellswere collected. Flow cytometry using a FACSCalibur instrument was carried outto detect the cellular expression of eGFP. The data were acquired and analyzedwith CellQuest and FlowJo software (BD). Uninfected cells were used as nega-tive controls. Mean fluorescence intensity (MFI) was used as an indicator ofrelative levels of eGFP expression.

RNA isolation and RT-PCR. Total RNA was isolated using an RNeasy kit(Qiagen, Inc., Valencia, CA), and its concentration was determined using aNanoDrop instrument. First-strand cDNA was synthesized using 60 ng of totalRNA (DNase-treated) in a reverse transcriptase (RT) reaction mixture. A regionof the influenza virus NP RNA was amplified using primers NP-F (5�-ACGGCTGGTCTGACTCACAT-3�) and NP-R (5�-GATGGAGTTGAAGGTAGTTTCGTG-3�). PCRs were performed in a 25-�l mixture containing a cDNA prep-aration (1 �l). PCR products were analyzed in a 2% agarose gel, together withglyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a control.

RESULTS

Motifs containing CpG dinucleotides distinguish avian andmammalian influenza viruses. It was previously found that 36tetrameric sequences are underrepresented in primate ssRNAviral genomes, independently of nucleotide content, aminoacid composition, or codon bias (22). Of these 36 motifs, 33motifs were also found to be underrepresented in the RNAtranscriptome for stimulated pDCs. Nearly all these motifsconsist of CpGs in an A/U context. These motifs are present atfairly high levels in the 1918 H1N1 influenza virus strain, whichis thought to have been of recent avian origin (15). However,the number of motifs decreased as this viral strain continued toevolve in the human population (21). We used the measure ofthe frequency of this set of underrepresented tetramers (rela-tive to the total number of tetramers) for all influenza virusesavailable from the National Center for Biotechnology Infor-mation (NCBI) Influenza Virus Resource. Unless otherwiseindicated, the frequency was calculated for the eight longestopen reading frames. Since these tetramers are also largelyunderrepresented in the host-stimulated pDC transcriptomeand “avoided” by the virus, a high frequency could indicate

“non-self” motifs that may be potentially immunostimulatory.On average, H5N1 avian influenza virus has the highest fre-quency of these tetramers among human influenza virus se-quences. Influenza B virus, which circulates only in humans,has a much lower, unchanging frequency (22). Thus, the te-tramer set seems to capture the information about CpG con-tent we had found previously.

Figure 1A shows this non-self measure for sequenced influ-enza A virus strains that have circulated in humans. Includedare the H1N1, H2N2, H3N2, H5N1, and pandemic H1N1(H1N1pdm) viruses. The topmost values are measures ofH5N1 sequences, with a line drawn through the mean scoreand perforated lines showing the standard deviation. As withthe frequencies of CpG content, the frequencies of these CpG-containing tetramer motifs declined from 1918 to the presentday. To establish that this decline is significant, we performeda permutation test by randomly selecting 36 of 256 tetramers100,000 times and comparing the decline in the frequency in1918 and the average frequencies in the most recent set ofH1N1 viruses. The decline exceeded the observed decline forour tetramer set 4 times; hence, one can say that with a P valueof 0.00004, our observed decline is significant. It should benoted that it could be difficult to observe the decline from theplots because the 1977 virus, which reemerged after manyyears of no reported H1N1 activity, is essentially identical tothe 1950 virus (40). For clarity, we included a plot of the H1N1decline with the time axis for all viruses after 1977 shifted tothe left by 27 years (Fig. 1D). Additionally, many viruses be-tween 1930 and 1957 were passaged before sequencing, possi-bly adding additional mutations.

As with CpG content, the tetramer content is comparable tothat of H5N1 only in the 1918 H1N1 strain. Noteworthy is theinclusion of recent 2009 H1N1 pandemic sequences, of whichthe six longest open reading frames were used. These se-quences contain CpG motifs at a much lower level than H5N1,possibly due to the fact that the pandemic H1N1 strain hasbeen evolving in mammalian hosts for many years (see Mate-rials and Methods). We repeated this process for swine andequine strains alongside human H5N1 for comparison. Figure1B shows swine strains with more than a few available se-quences (H1N1, H1N2, H3N2, H5N1, and H9N2). None of thestrains have near the frequency of CpG motifs found in humanH5N1 sequences except for a small set of swine H5N1 viruses.For the strains with the longest sequence record, H1N1 strains,the content appears to have, at least initially, declined. Figure1C shows the same plot for available H3N8 horse flu se-quences. This strain, which caused a severe panzootic (38, 44,47) when it emerged in 1963, initially had a high frequency thatdecreased over time.

In Table 1, we listed avian strains by the means and mediansof this measure. Many strains have quite high frequencies,while others do not, and there seems to be little discernible lossof influenza virus CpG dinucleotides in birds, implying that thestrains circulating in avian populations are less sensitive toevolutionary selection pressures against CpG motifs than thosein mammals. If our hypothesis is proven correct, such a mea-sure could be used to monitor circulating avian strains forstimulatory potential, as all avian strains would not be as stim-ulatory in regard to this specific signal should they enter thehuman population.

VOL. 85, 2011 LOSS OF INFLUENZA VIRUS pDC ACTIVATION-ENHANCING MOTIFS 3895


.org/D

ownloaded from

http://jvi.asm.org/

CpG motif and uracil content determine the capacity ofssRNA to induce IFN-� production by pDCs. Based on thehypothesis that the most underrepresented sequences in theviral genomes that replicated in humans contain immuno-stimulatory elements, the six most underrepresented tetramersin ssRNA viruses in the previous analysis (22) were chosen forfurther testing (see Table 8 of that work; [1] CGAU, [2]CGAA, [3] UUCG, [4] ACGA, [5] UCGA, and [6] GACG, indescending order of representation). For experimental pur-poses, longer sequences are required; however, our statisticalpower limits us to tetramers. Therefore, these sequences wereconcatenated by pairs to yield 6 mers: UUCGAU (1 � 3),UUCGAA (2 � 3), GACGAU (1 � 6), and GACGAA (2 �6). However, one would expect some noise to be introduced bythis process, which may make some of the tested tetramersinvalid. To further lengthen our motifs for testing, we searchedfor endogenous viral sequences encompassing these 6 merswithin the 1918 H1N1 genome, and 14 occurrences werefound. While, unfortunately, one lacks the statistical power toderive fully testable motifs from the virus itself, we testedwhether some portion of the assembled oligomers capturestimulatory motifs. We focused on 4 of these 14 18-mer se-

quences, each representing one endogenous occurrence of theabove hexamers: V1-CpG, V2-CpG, V3-CpG, and V4-CpG(Table 2). Given the noise likely introduced in the assemblyprocess, we focused on these four since at least one wouldlikely elicit a response if our hypothesis is correct, and testingall possible combinations is not practical.

To measure the contribution of the CpG motif to the stim-ulatory capacity of each sequence, we replaced it with GpC,obtaining V1-GpC, V2-GpC, V3-GpC, and V4-GpC. All se-quences were synthetic phosphorothioate-modified (PS) RNAs.PS-modified ODNs have been shown to be taken up efficientlyand to induce immune activation (34, 45). The CpG RNAsequences were delivered together with DOTAP, which is notstimulatory but is required as a vehicle for CpG RNA stimu-lation (7).

A successful host antiviral defense depends largely on rapidand robust IFN-� production (4, 12). As pDCs are the majorIFN-� producers, BDCA-4-purified pDCs were stimulated for18 h with CpG- and GpC-containing sequences, and IFN-�levels were measured. We employed a GU-rich sequence fromthe U5 region of HIV-1 RNA (RNA40) as a positive controland a derivative, RNA41, in which the U or G nucleotide was

FIG. 1. Non-self measure determined by replication in a mammalian host. (A to C) The non-self measure based on the presence ofunderrepresented tetramer motifs classifies avian versus mammalian viruses for human (A), swine (B), and horse (C) influenza. (D) Thefrequencies of a randomly selected set of 36 motifs in H1N1 influenza viruses from 1918 and the average values for these frequencies in their mostrecent sets of available sequences were analyzed. hH5N1, human H5N1; H1N1pdm, 2009 pandemic H1N1.



.org/D

ownloaded from

http://jvi.asm.org/

replaced with A, as a negative control (24) (Table 2). In Fig.2A, we show that V1-CpG and V2-CpG induced high levels ofIFN-� production, whereas V3-CpG induced low levels and V4-CpG was not stimulatory. This was reproducibly observed in

PBMC samples from 10 donors (Fig. 3A). Importantly, the GpCversion of each sequence consistently induced smaller amounts ofIFN-� in pDCs and PBMC samples (Fig. 2B and 3A).

Replacing CpG with GpC showed that IFN-� secretion isnot entirely dependent on the CpG motif but was reduced in itsabsence. As depicted in Table 2, there are clear differences inthe numbers and distributions of uracils in stimulatory (V1/V2-CpG) and less stimulatory or nonstimulatory (V3/V4-CpG)sequences. U-rich domains are known to induce immunoacti-vation (14, 17, 24, 46), and Greenbaum et al. (22) showed thatCpG frequencies in the influenza genome decreased in humanhosts in an A/U context. To demonstrate that U’s in viralsequences are important for IFN-� secretion by pDCs, all U’sin V1-CpG, V2-CpG, and V3-CpG sequences were replacedwith A’s, obtaining V1-CpG-A, V2-CpG-A, and V3-CpG-Asequences (Table 2). Replacing U’s with A’s almost abrogatedIFN-� secretion (Fig. 2C), indicating that pDC IFN-� secre-tion triggered by ssRNA depends on U content.

Since some U’s seem essential for stimulation and theirnumbers in native sequences loosely correlate with IFN-� pro-duction when the CpG presence is fixed, we considered that ahigh number of U’s around the CpG motif could mask theeffect of the CpG motif by inducing higher levels of IFN-�production. Sequences with lower U contents around CpGcould show higher dependence on the CpG motif. We testedthis hypothesis on the V1-CpG sequence, which has the highestcapacity to induce IFN-� production in pDCs and contains 3U’s 5� of the CpG motif and 1 U in position 2 after the CpG(Table 2). We generated different sequences by decreasing thenumber of U’s around the CpG motif sequence from 4 U’s to1 U (Table 3), and we also tested the V1-CpG-5A sequence, inwhich no U’s were present in the core hexamer around themotif but which contained 2 U’s 5� of the motif. In addition, wegenerated the GpC version of these sequences (Table 3). V1-CpG-1U and V1-CpG-2U induced lower IFN-� levels thanV1-CpG-4U, in which induction was comparable to that of thenative V1-CpG sequence. In addition IFN-� secretion wasreduced when the CpG motif was mutated to GpC (Fig. 2D).These results indicate that a minimal number of U’s close tothe CpG motif are required to induce IFN-� production bypDCs and that increased U’s around CpG motifs induce astronger response. Also, CpG motifs determine the intensity ofthe response in all cases, being stronger where U’s are less wellrepresented. As expected, an intermediate number of U’s(V1-1U and V1-2U) allow the higher inhibitory effect of CpGreplacement (Fig. 3B). Serially diluted V1-CpG-4U or V1-GpC-4U confirmed that at all doses the CpG RNA was morepotent than the GpC RNA, indicating that this feature is notdose dependent but is intrinsic (Fig. 2E). Altogether, we foundtwo critical features for IFN-� secretion, the number of U’saround the core CpG motif and the motif itself, which cancompletely control IFN-� production when the U content islowered.

However, there is not a strict correlation between the num-ber of U’s and IFN-� production; the 2U motif was less stim-ulatory than the 1U motif, and the 5A motif and 1U motif werecomparable even though, for the 5A motif, the U’s were not inthe core hexamer region. This suggests that stimulation maydepend on sequence context beyond the hexameric CpG mo-

TABLE 1. Ranking of avian strains by “non-self” motifsa

Strain Mean frequency Median frequency N Std

H5N1 0.0592 0.0595 399 0.0013H7N4 0.0591 0.0591 3 0.0001H5N8 0.0583 0.0583 1 0H5N6 0.058 0.058 1 0H10N3 0.058 0.058 1 0H13N9 0.0579 0.0579 1 0H10N6 0.0576 0.0576 2 0H7N1 0.0574 0.0574 39 0.0014H5N7 0.0571 0.0562 3 0.0016H7N7 0.057 0.057 12 0.0013H13N2 0.0566 0.0564 3 0.0009H7N3 0.0565 0.0569 41 0.0022H8N4 0.0563 0.0564 6 0.001H5N3 0.0562 0.0566 16 0.0018H7N5 0.0562 0.0562 1 0H10N7 0.0561 0.0553 12 0.0018H5N9 0.0558 0.0558 1 0H9N6 0.0557 0.054 3 0.0031H16N3 0.0557 0.0557 2 0.0003H4N9 0.0555 0.0555 1 0H2N2 0.0551 0.0543 5 0.0015H11N9 0.0551 0.0549 22 0.0016H4N2 0.055 0.0551 11 0.0017H4N6 0.055 0.0548 36 0.0017H7N8 0.055 0.055 1 0H9N5 0.055 0.055 2 0.0002H10N8 0.0549 0.0549 2 0.0011H2N9 0.0548 0.0546 6 0.0009H4N3 0.0548 0.055 3 0.001H6N4 0.0548 0.0548 1 0H5N2 0.0547 0.055 38 0.0022H11N3 0.0547 0.0544 4 0.0026H4N4 0.0545 0.0545 1 0H7N9 0.0545 0.0545 1 0H2N7 0.0544 0.0542 3 0.0003H3N6 0.0544 0.0544 9 0.0021H1N9 0.0543 0.0543 1 0H9N2 0.054 0.0539 89 0.0017H2N3 0.0539 0.054 8 0.002H6N6 0.0539 0.0544 7 0.0008H2N1 0.0538 0.053 7 0.0017H6N9 0.0538 0.0538 1 0H3N2 0.0537 0.0531 16 0.0013H6N5 0.0537 0.0538 7 0.002H2N5 0.0536 0.0536 2 0.0016H1N5 0.0535 0.0535 1 0H6N2 0.0535 0.0534 48 0.0017H10N1 0.0535 0.0535 1 0H10N9 0.0535 0.0535 1 0H1N1 0.0534 0.0531 30 0.0017H15N9 0.0534 0.0534 3 0H3N3 0.0532 0.0532 2 0.0003H11N1 0.0532 0.0532 2 0.0012H1N6 0.0531 0.0531 2 0.0018H3N8 0.0529 0.0524 36 0.0026H4N1 0.0528 0.0528 2 0.0012H6N8 0.0528 0.0533 19 0.0028H6N1 0.0527 0.0524 52 0.0026H13N6 0.0527 0.0532 4 0.001H3N5 0.0526 0.0526 2 0.0013H4N8 0.0526 0.0523 8 0.0017H2N4 0.0524 0.0524 1 0H11N2 0.0524 0.0531 4 0.0021H7N2 0.0523 0.0514 17 0.0024H2N8 0.0522 0.0522 2 0.0013H3N1 0.0522 0.0525 3 0.001H9N1 0.0522 0.0513 5 0.0024H12N5 0.0522 0.0525 11 0.0021H11N6 0.052 0.052 1 0H6N3 0.0519 0.0519 5 0.0008H12N1 0.0512 0.0512 1 0H1N2 0.0506 0.0506 2 0.0018

a N, number of sequences available; Std, standard deviation.



.org/D

ownloaded from

http://jvi.asm.org/

tifs, which we were able to analyze statistically in viral se-quences.

It was previously shown that TLR7 recognizes viral ssRNA,including influenza virus RNA (13, 36), making it a candidatefor recognition of CpG RNA in pDCs. We stimulated purifiedpDCs with V1-CpG in the presence of different concentrationsof an immunoregulatory sequence (24) that specifically blockssignaling from TLR7 (IRS 661) and TLR9 (IRS 869) (6). TheTLR9 agonist CpG-A was used as a control for TLR9 activa-tion. V1-CpG-induced IFN-� production was blocked by IRS661, without affecting CpG-A responses. Conversely, IRS 869blocked CpG-A-induced IFN-� but did not affect the V1-CpGresponse (Fig. 3C and D). Based on these results, we con-cluded that TLR7 recognition likely mediates V1 pDC stimu-lation.

CpG motifs in RNA sequences influence NK cell activationthrough pDCs. Recent findings demonstrated that humanpDCs induce NK cell activation in vitro, supporting a role forcytokines and cell-cell contact (23, 35) in the enhancement ofNK cell function. DC-mediated NK cell activation increasesNK cell cytolytic activity with increased expression of activa-tion markers such as CD69 and/or IFN-�. pDC-derived IFN-Ihas been shown to be implicated in NK cell activation (5, 20,35, 37). Since we observed differential levels of IFN-� produc-tion by pDCs depending on CpG and U content, NK cells wereincubated with V1-1U-CpG/GpC, V1-2U-CpG/GpC, and V1-4U-CpG/GpC in the presence or absence of pDCs (10:1 ratio

of NK cells to pDC) to explore functional consequences ofIFN-� secretion that could amplify the effect in vivo. We ob-served that coculture of NK cells with IFN-�-producing pDCs(i.e., CpG RNA-stimulated pDCs) increased CD69 levels onthe NK cell surface (Fig. 4A) and induced high levels of IFN-�production (Fig. 4B). The activation was completely abrogatedwhen all U’s were replaced with A’s and was dependent on theU’s around the CpG dinucleotide (Fig. 4A). Furthermore, NKcell activation (Fig. 4A and B) was reduced (V1-4U) or com-pletely abolished (V1-1U and V1-2U) upon the change of CpGto GpC, suggesting that the CpG/GpC motifs in the RNAaffect pDC IFN-� production, which in turn modulates NK cellactivation. Thus, the presence of CpG motifs in the RNA notonly controls IFN-� induction but can also mediate differentialNK cell activity through pDCs.

When supernatants from CpG/GpC-activated pDCs weretransferred to nonstimulated NK cells, we observed increasesin CD69 (Fig. 4E) and IFN-� production (Fig. 4.D) when NKcells were incubated with supernatants from IFN-�-producingpDCs (Fig. 4C). The effect of supernatants on NK cell activa-tion paralleled IFN-� production from pDCs stimulated withCpG-RNA versus GpC-RNA (Fig. 4C to E). To directly testthe role of IFN-�, pDCs stimulated with CpG/GpC-containingsequences were placed in the upper chamber of a transwell andnonstimulated NK cells in the lower chamber. Again, IFN-�levels in the NK cell compartment paralleled IFN-� levels inthe same chamber (Fig. 4F and G), corresponding to the

FIG. 2. Uracil content and CpG motif determine the ssRNA capacity to induce IFN-� production by pDCs. (A, B, and C) Purified human pDCsfrom different donors were cultured with V1-CpG, V2-CpG, V3-CpG, and V4-CpG ssRNA sequences (A), with CpG- and GpC-containing V1,V2, V3, and V4 ssRNA sequences (B), or with the adenine (-A) versions of V1-CpG, V2-CpG, and V3-CpG (C). One representative experimentwith several donors is shown (� standard deviations [SDs]). (D) Purified human pDCs from different donors were stimulated with CpG- andGpC-containing V1, V1-A, V1-1U, V1-2U, V1-4U, and V1-5A ssRNA sequences. Statistical analysis was done using unpaired Student’s t test(2-tailed). Error bars represent SDs. *, P 0.05; **, P 0.01. (E) pDCs were stimulated with V1-CpG-4U (black bars) or V1-GpC-4U (patternedbars) at 10 �g/ml, 5 �g/ml, and 2.5 �g/ml. In all cases, IFN-� was measured in the supernatants 18 h after stimulation. One representativeexperiment is shown.



.org/D

ownloaded from

http://jvi.asm.org/

condition in which pDCs were stimulated by CpG RNA.Importantly, we observed that NK cell incubation with spe-cific IFN-�/IFN-receptor (R)-blocking antibodies inhibitedCD69 expression and IFN-� production, and the addition ofexogenous IFN-� to NK cultures mimicked the effects of ac-tivated pDCs (Fig. 4H and I). This demonstrates that NK cell

activation is strongly driven by pDC-derived IFN-� and isdependent on CpG motifs present in viral RNA sequences.

CpG motifs and uracil content are directly implicated inTNF-� production by pDCs after ssRNA recognition. In addi-tion to IFN-�, pDCs produce proinflammatory cytokines andupregulate cell surface activation/maturation marker expres-sion following activation by CpG-containing RNA (13, 24, 36).We determined whether the inflammatory response triggered

FIG. 3. CpG motifs in a U-rich context determine the ssRNA capacity to induce IFN-� production through TLR7 recognition. (A and B)PBMCs from several healthy donors were stimulated in the presence of the indicated CpG or GpC RNAs (1 �g/ml) for 18 h. After the PBMCswere stimulated, IFN-� was measured in the supernatants. (A) V1-CpG/GpC, V2-CpG/GpC, V3-CpG/GpC, and V4-CpG/GpC sequences wereanalyzed. The results show the means (pg/ml) for IFN-� production levels. n.s., nonstimulated. (B) RNA sequences with various amounts of uracils(1U, 2U, 3U, 4U, and 5A) and their CpG/GpC versions were tested. For each individual experiment, IFN-� production was scaled to a value of100 for the CpG version. Statistical analysis was done using unpaired Student’s t test (2-tailed), comparing CpG- and GpG-induced cytokineproduction in each sequence. *, P 0.05; **, P 0.01; ***, P 0.001. (C and D) Purified human pDCs were nonstimulated (NS) or wereincubated with V1-CpG (1 �g/ml) and CpG-DNA-A (1 �g/ml) in the absence or presence of IRS 661 at 1, 0.5, 0.25, and 0.1 �M (C) or in thepresence of IRS 661 and IRS 869 at 0.1, 0.05, and 0.025 �M (D). IFN-� was measured in the supernatants 18 h after stimulation. Results arerepresentative of three individual experiments with similar results.

TABLE 2. ssRNA oligonucleotide sequencesa

Sequence name CpG-ORN sequence (5�–3�)

V1-CpG .......................................GUGUCUUU-CG-AUCAAAACV1-GpC .......................................GUGUCUUU-GC-AUCAAAACV1-CpG-A ...................................GAGACAAA-CG-AACAAAACV2-CpG .......................................AUUGAUUU-CG-AAUCUGGAV2-GpC .......................................AUUGAUUU-GC-AAUCUGGAV2-CpG-A ...................................AAAGAAAA-CG-AAACAGGAV3-CpG .......................................GAAAUUGA-CG-AUAACUUAV3-GpC .......................................GAAAUUGA-GC-AUAACUUAV3-CpG-A ...................................GAAAAAGA-CG-AAAACAAAV4-CpG .......................................GGGAGAGA-CG-AACAGUCGV4-GpC .......................................GGGAGAGA-GC-AACAGUGCRNA 40 .......................................GCCCGUCUGUUGUGUGACUCRNA 41 .......................................GCCCGACAGAAGAGAGACAC

a Active CpG/GpC motifs are in bold. In CpG-A sequences, the underlinedsequences are adenines replacing uracils from the original sequence.

TABLE 3. ssRNA oligonucleotide sequencesa

Sequence name CpG-ORN sequence (5�–3�)

V1-CpG .......................................GUGUC (UUU-CG-AU) CAAAACV1-1U-CpG.................................GAGAC (AAA-CG-AU) CAAAACV1-2U-CpG.................................GAGAC (AAU-CG-AU) CAAAACV1-4U-CpG.................................GAGAC (UUU-CG-AU) CAAAACV1-5A-CpG.................................GUGUC (AAA-CG-AA) CAAAACV1-1U-GpC.................................GAGAC (AAA-GC-AU) CAAAACV1-2U-GpC.................................GAGAC (AAU-GC-AU) CAAAACV1-4U-GpC.................................GAGAC (UUU-GC-AU) CAAAACV1-5A-GpC.................................GUGUC (AAA-GC-AA) CAAAAC

a Active CpG/GpC motifs are in bold. We obtained 1U, 2U, and 4U sequencesby replacing all U’s from V1 except those that are underlined. The 5A sequenceretained all U’s except those in the core region. Parentheses delimit the core ofthe sequence.



.org/D

ownloaded from

http://jvi.asm.org/

by CpG RNA is also dependent on the CpG/GpC motif andU’s by comparing production levels of TNF-�. We used intra-cellular staining for TNF-� detection, gating on pDCs asCD123� cells. As observed with IFN-�, V1-CpG and V2-CpGsequences induce higher levels of TNF-� than V3-CpG andV4-CpG (Fig. 5A), an effect also modulated by CpG motifs(Fig. 5B). The A version of the sequences also did not inducecytokine production (Fig. 5A and B). TNF-� production afterssRNA recognition by pDCs is also modulated by the numberof U’s surrounding the CpG motifs (Fig. 5C and D), asdemonstrated upon stimulation with V1-1U-CpG/GpC, V1-2U-CpG/GpC, V1-4U-CpG/GpC, and V1-5A-CpG/GpC. Thus,proinflammatory cytokine release from pDCs after ssRNA rec-ognition depends on CpG and U content. This implies that themechanisms of induction or the transcriptional programs for

both TNF-� and IFN-� production may occur through sharedupstream pathways in pDCs.

Influenza-modified viruses with low/high CpG content in-duce differential IFN-� production after pDC infection. All ofthe effects described thus far were for cells stimulated withRNA oligonucleotide sequences containing the specific motifs.To test whether similar effects would be observed if the motifswere instead placed in a viral context, we generated modifiedinfluenza virions. These viruses packaged eGFP in place ofmost of the viral PB1 polymerase-coding sequence (Fig. 6A).They were grown and their titers were determined in cell linesengineered to constitutively express the PB1 protein (9). Be-cause the PB1 polymerase protein is not required for viral cellentry and fusion, these modified viruses can infect unmodifiedcells, including the human pDCs. However, they are able to

FIG. 4. CpG RNA-activated pDCs enhance IFN-� and CD69 expression in NK cells, strongly mediated by IFN-�. (A and B) Purified humanNK cells were cocultured for 18 h with sorted pDCs or alone in the presence of CpG or GpC RNAs as indicated on the figure (V1-1U, V1-2U,V1-4U, or V1-5A). CD69 expression in a gated CD3-CD56� NK cell population (A) and IFN-� production (B) were measured after stimulation.(C to E) Supernatants from CpG/GpC RNA-activated pDCs were transferred to nonstimulated NK cells (US). Eighteen hours after incubation,IFN-� (C) and IFN-� (D) production and CD69 expression (E) were measured. (F and G) Sorted nonstimulated NK cells (US) were cultured inthe bottoms of transwell wells in the presence of nonstimulated RNA or CpG/GpC RNAs stimulated with pDCs in the upper well. After 18 h, theproduction of IFN-� (F) and IFN-� (G) was measured. (H and I) Transwell experiment with pDC and NK cells was performed in the presenceof IFN-�/IFN-R-blocking antibodies, nonspecific antibodies, and recombinant IFN-� protein, as indicated. CD69 expression on NK cells (H) andIFN-� production (I) were measured after 18 h.



.org/D

ownloaded from

http://jvi.asm.org/

transcribe only a modest amount of viral and mRNA after cellinfection since they are limited to the amount of PB1 proteinpackaged into the virion.

We created two variants of these viruses in the backgroundof the A/WSN/33 (H1N1) influenza virus strain. The variantswere identical in all aspects except for the nucleotide sequenceof the eGFP protein. In one variant, the GFP nucleotide se-quence was recoded to contain a high number of CpG motifs,while in the other variant it was recoded to contain a lownumber of CpG motifs (the full eGFP sequences are detailedin Materials and Methods). In both cases, the recoding wasdone so as to keep the eGFP protein sequence unchanged.These viruses were named WSN-PB1flank-eGFP-highCpGand WSN-PB1flank-eGFP-lowCpG, respectively. The eGFP-highCpG sequence contains 21 (A/U)CG(A/U) motifs, while

the eGFP-lowCpG sequence contains 2 of these motifs. Theremainder of the viral genome, which is identical in both virusvariants, contains 79 (A/U)CG(A/U) motifs. Note, however,that the effect of flanking sequences on any immunostimula-tory property of the CpG motifs is not fully defined, so thecounts for this tetrameric motif may not fully capture therelevant differences in viral motif content.

We infected human pDCs with WSN-PB1flank-eGFP-low-CpG or WSN-PB1flank-eGFP-highCpG viruses at a multiplic-ity of infection of one, based on the titers of infectious particlesdetermined by flow cytometry in cell lines engineered to con-stitutively express PB1. After 18 h, we measured both theextent of GFP expression and the level of IFN-� secretionfrom the pDCs. Because RNA transcription from these virusesin the unmodified pDCs is relatively low, the intensity of GFP

FIG. 5. CpG motifs and in a U-rich context determine the ssRNA capacity to induce TNF-� production by pDCs. Pure pDCs were stimulatedwith the indicated CpG/GpC RNA sequences for 18 h in the presence of brefeldin A. Intracellular detection of TNF-� was carried out using specificantibodies for the cytokine in previously gated pDCs (CD123� cells). (A) Cytometry panels show TNF-� production in stimulated pDCs from onedonor after CpG/GpC RNA stimulation. (B) TNF-�-induced production comparing GpC RNA and CpG RNA sequences is shown. The value forCpG RNA-induced production was set at 100%. The MFI for TNF-� is represented (n � 4, in duplicate). Statistical analysis was done usingunpaired Student’s t test (2-tailed), comparing in each sequence CpG RNA- and A RNA- versus GpC-induced cytokine production. *, P 0.05;**, P 0.01; ***, P 0.001. (C) Cytometry panels show TNF-� production in stimulated pure pDCs from one donor after CpG/GpC RNAstimulation. (D) TNF-�-induced production comparing GpC RNA with CpG RNA sequences is shown. The value for CpG RNA-inducedproduction was set at 100%. The MFI for TNF-� is represented. Results (n � 8, in duplicate) represent mean levels of cytokines. Statistical analysiswas done using unpaired Student’s t test (2-tailed), comparing in each sequence (V1-1U, V1-2U, V1-4U, V1-5A) CpG- versus GpG-inducedcytokine production. *, P 0.05; **, P 0.01; ***, P 0.001.



.org/D

ownloaded from

http://jvi.asm.org/

expression was also low. Nonetheless, we were able to detectfluorescence by flow cytometry and saw no significant dif-ference in mean fluorescent intensity (MFI) between thehighCpG and lowCpG viruses, indicating comparable levels ofviral infection and GFP transcription/expression (Fig. 6B).However, the highCpG viruses induced substantially higherlevels of IFN-� than their lowCpG counterparts (Fig. 6C). Tovalidate that both viruses enter equally into pDCs, we alsomeasured the amounts of influenza NP RNA by RT-PCR (Fig.6D), detecting similar amounts of NP RNA in both the low-CpG and highCpG viruses. This result demonstrates that theCpG content of influenza viral RNA may affect pDC IFN-�secretion, much as was observed for the RNA oligonucleo-tides. Such effects might influence both viral replication andthe host immune response.

DISCUSSION

A recent genomic analysis of the evolutionary history of theclassical H1N1 influenza virus originating from the 1918 influ-enza pandemic revealed that CpG motifs in an A/U context inthe viral genome are being preferentially eliminated. In thiswork, we tested the hypothesis that avoidance of an immuno-stimulatory signal is the reason for the observed preferentialdecline in these motifs in the RNA viral genome. We used thefour most underrepresented CpG-containing tetramers in theinfluenza virus genome and influenza-modified virions withdifferent CpG contents.

The first important conclusion derived from these experi-ments is that different CpG-containing RNA sequences triggerquantitatively different IFN-� responses in pDCs due to thepresence of CpG dinucleotides in the context of various U

contents. There is a relation between the U content of theRNA and the pDC response, both in terms of IFN-� produc-tion and inflammatory cytokine secretion. Changing all uracilsto adenines eliminates the response. At a low U content, CpGmotifs determine IFN-� secretion, and at a higher content theystrongly modulate the amount secreted. These results indicatethat IFN-� production by pDCs after stimulation by ssRNAoligonucleotides depends on sequence composition and is in-fluenced by the number of U’s and the CpG content. Thesedata indicate that the induction of IFN-� by these ssRNAoligonucleotides is dependent on TLR7.

Strikingly, we found that IFN-� secreted by CpG RNA-stimulated pDCs activates NK cells to upregulate CD69 andsecrete IFN-�. Alter et al. described cross talk between NKcells and ssRNA-activated pDCs through direct contact withpDCs or monocytes but not through IFN-� alone (3). In ourexperiments, NK cell activation did not require direct contactwith pDCs and was almost completely abrogated in the pres-ence of specific IFN-�/IFN-R-blocking antibodies. Clearly, acomplex mechanism controls cross talk between the popula-tions. Thus, CpG motifs contribute to activation of both pDCsand downstream cells mobilized by IFN-�.

A second important observation is that different sequencesinduced differential responses. While V1-CpG and V2-CpGinduced IFN-� and TNF-� production, V3-CpG mildly in-duced both and V4-CpG induced neither, possibly due to thenear absence of uracils. In all cases, TNF-� secretion wascorrelated with IFN-� production, and both are dependent oncore U’s and CpG motifs. Differential affinity of TLR7 forV1/V2-CpG and V3/V4-CpG could modulate engagement ofdifferent adaptor/signaling molecules, causing distinct functional

FIG. 6. WSN-PB1flank-eGFP-highCpG viruses induce higher levels of IFN-� production after pDC infection than WSN-PB1flank-eGFPlowCpG viruses. (A) Two variants of the A/WSN/33 (H1N1) influenza virus were generated by replacing most of the PB1 coding sequence witheGFP. Variants of eGFP with high or low CpG content were used to generate WSN-PB1flank-eGFP-highCpG and WSN-PB1flank-eGFP-lowCpGviruses, respectively. Human pDCs (2.5 104) were infected with lowCpG or highCpG viruses. (B) At 18 h postinfection, cell expression of eGFPwas quantified by flow cytometry. The overall average MFI is shown for each virus. (C) IFN-� production in the supernatants at 18 h postinfection.For each individual experiment, the IFN-� was scaled to have a value of 100 for the highCpG virus. The results for panels B and C are for 13different infections, each with pDCs from a different human donor, and show means � standard errors of the means (SEMs). Statistical analysiswas done using unpaired Student’s t test (2-tailed). (D) pDCs isolated from a healthy donor were infected with WSN-PB1-flank-eGFP-highCpG(H) or -lowCpG (L) for 8 h and 12 h at different virus dilutions. IFN-� production was measured in the supernatants, and influenza NP andGAPDH RNA levels were analyzed by RT-PCR in cell extracts.



.org/D

ownloaded from

http://jvi.asm.org/

activities and explaining the differentially induced responses. Thecytoplasmic transductional-transcriptional processor (CTTP) hasbeen described in a TLR9-MyD88-IRF7 environment wherecomplex composition, overexpression of specific transcription fac-tors, and different CTTP subcellular localizations determinedownstream gene expression (26). Whatever the mechanisms ofrecognition and differential signaling, our study uncovered a strik-ing parallel between the ssRNA motifs required for stimulation ofpDCs and NK cells and their specific disappearances in the clas-sical H1N1 genome upon emergence in humans.

While most of the results reported here use ssRNA oligo-nucleotides, the experiments using modified influenza virionsprovide evidence that the CpG motifs in a viral context alsoenhance IFN-� secretion. The virions we used are identical inall viral genes and differ only in the nucleotide composition ofthe eGFP sequence introduced into the PB1 viral segment,which constitutes less than 10% of the total viral genomelength. Yet this difference in nucleotide composition is suffi-cient to cause a �2-fold difference in the IFN-� secretion levelthat the viruses stimulated in pDCs. More extensive analysiswith other influenza virus strains will be required to elucidatethis process.

This suggests that the CpG nucleotide composition couldcontribute to influenza-induced immune stimulation in a man-ner that could well have implications for both viral fitness andthe overall host response. Some studies have demonstrated animportant role for IFN-� in limiting the spread of influenzavirus infection (18). Other studies have shown how the type IIFN response can make a tissue restrictive or susceptible toinfection by influenza virus (29, 42) and how it enhances thelytic ability of CD8 T cells (33). The IFN-� response sets up achain of antiviral agents, such as activated NK cells, tumornecrosis factor-related apoptosis-inducing ligand (TRAIL)-ex-pressing macrophages, and DCs (11, 16), or cross-presentationof viral antigens for activation of adaptive immunity (34a). Thekinetics of immune activation during influenza infection is stilla matter of investigation. In humans, peak IFN-� responsesoccur simultaneously or 1 day after the virus titer peak andprobably reflect IFN production by epithelial cells as well as bypDCs. In contrast to epithelial cells, in which influenza viralRNA activates intracellular RIG-I (41), pDCs may rely heavilyand perhaps exclusively on endosomal recognition of viralRNA by TLR7 (31). Thus, the influenza virus may haveevolved to avoid IFN-� secretion by decreasing the stimulatoryCpG motif content in humans.

Altogether, these data provide a potential explanation for theloss of CpG motifs from avian influenza viruses as they adapt tomammalian hosts (3). More speculatively, it seems possible thatthe CpG motifs could play a role in the pathogenesis by theimmune responses that are sometimes observed with the infectionof mammals with avian-like influenza viruses (32, 43).

ACKNOWLEDGMENTS

We thank Jesse D. Bloom for the influenza-modified viruses used inthis work.

This project was supported by National Institutes of Health grantsRC1AI087097, R37AI044628, R01AI071078, and R01AI061684. B.G.is the Eric and Wendy Schmidt Scholar at the Institute for AdvancedStudy, which he thanks for its support.

REFERENCES

1. Akira, S., and H. Hemmi. 2003. Recognition of pathogen-associated molec-ular patterns by TLR family. Immunol. Lett. 85:85–95.

2. Akira, S., S. Uematsu, and O. Takeuchi. 2006. Pathogen recognition andinnate immunity Cell 124:783–801.

3. Alter, G., et al. 2007. Single-stranded RNA derived from HIV-1 serves as apotent activator of NK cells. J. Immunol. 178:7658–7666.

4. Asselin-Paturel, C., and G. Trinchieri. 2005. Production of type I interfer-ons: plasmacytoid dendritic cells and beyond. J. Exp. Med. 202:461–465.

5. Barr, D. P., et al. 2007. A role for plasmacytoid dendritic cells in the rapidIL-18-dependent activation of NK cells following HSV-1 infection. Eur.J. Immunol. 37:1334–1342.

6. Barrat, F. J., et al. 2005. Nucleic acids of mammalian origin can act asendogenous ligands for Toll-like receptors and may promote systemic lupuserythematosus. J. Exp. Med. 202:1131–1139.

7. Beignon, A. S., et al. 2005. Endocytosis of HIV-1 activates plasmacytoiddendritic cells via Toll-like receptor-viral RNA interactions. J. Clin. Invest.115:3265–3275.

8. Beignon, A. S., M. Skoberne, and N. Bhardwaj. 2003. Type I interferonspromote cross-priming: more functions for old cytokines. Nat. Immunol.4:939–941.

9. Bloom, J. D., L. I. Gong, and D. Baltimore. 2010. Permissive secondarymutations enable the evolution of influenza oseltamivir resistance. Science328:1272–1275.

10. Cella, M., F. Facchetti, A. Lanzavecchia, and M. Colonna. 2000. Plasma-cytoid dendritic cells activated by influenza virus and CD40L drive a potentTH1 polarization. Nat. Immunol. 1:305–310.

11. Chaperot, L., et al. 2006. Virus or TLR agonists induce TRAIL-mediatedcytotoxic activity of plasmacytoid dendritic cells. J. Immunol. 176:248–255.

12. Colonna, M., G. Trinchieri, and Y. J. Liu. 2004. Plasmacytoid dendritic cellsin immunity. Nat. Immunol. 5:1219–1226.

13. Diebold, S. S., T. Kaisho, H. Hemmi, S. Akira, and C. Reis e Sousa. 2004.Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA. Science 303:1529–1531.

14. Diebold, S. S., et al. 2006. Nucleic acid agonists for Toll-like receptor 7 aredefined by the presence of uridine ribonucleotides. Eur. J. Immunol. 36:3256–3267.

15. dos Reis, M., A. J. Hay, and R. A. Goldstein. 2009. Using non-homogeneousmodels of nucleotide substitution to identify host shift events: application tothe origin of the 1918 ‘Spanish’ influenza pandemic virus. J. Mol. Evol.69:333–345.

16. Fanger, N. A., C. R. Maliszewski, K. Schooley, and T. S. Griffith. 1999.Human dendritic cells mediate cellular apoptosis via tumor necrosis factor-related apoptosis-inducing ligand (TRAIL). J. Exp. Med. 190:1155–1164.

17. Forsbach, A., et al. 2008. Identification of RNA sequence motifs stimulatingsequence-specific TLR8-dependent immune responses. J. Immunol. 180:3729–3738.

18. García-Sastre, A., et al. 1998. The role of interferon in influenza virus tissuetropism. J. Virol. 72:8550–8558.

19. Gazit, R., et al. 2006. Lethal influenza infection in the absence of the naturalkiller cell receptor gene Ncr1. Nat. Immunol. 7:517–523.

20. Gerosa, F., et al. 2005. The reciprocal interaction of NK cells with plasma-cytoid or myeloid dendritic cells profoundly affects innate resistance func-tions. J. Immunol. 174:727–734.

21. Greenbaum, B. D., A. J. Levine, G. Bhanot, and R. Rabadan. 2008. Patternsof evolution and host gene mimicry in influenza and other RNA viruses.PLoS Pathog. 4:e1000079.

22. Greenbaum, B. D., R. Rabadan, and A. J. Levine. 2009. Patterns of oligo-nucleotide sequences in viral and host cell RNA identify mediators of thehost innate immune system. PLoS One 4:e5969.

23. Hanabuchi, S., et al. 2006. Human plasmacytoid predendritic cells activateNK cells through glucocorticoid-induced tumor necrosis factor receptor-ligand (GITRL). Blood 107:3617–3623.

24. Heil, F., et al. 2004. Species-specific recognition of single-stranded RNA viaToll-like receptor 7 and 8. Science 303:1526–1529.

25. Hoffmann, E., G. Neumann, Y. Kawaoka, G. Hobom, and R. G. Webster.2000. A DNA transfection system for generation of influenza A virus fromeight plasmids. Proc. Natl. Acad. Sci. U. S. A. 97:6108–6113.

26. Honda, K., et al. 2004. Role of a transductional-transcriptional processorcomplex involving MyD88 and IRF-7 in Toll-like receptor signaling. Proc.Natl. Acad. Sci. U. S. A. 101:15416–15421.

27. Hornung, V., et al. 2002. Quantitative expression of Toll-like receptor 1-10mRNA in cellular subsets of human peripheral blood mononuclear cells andsensitivity to CpG oligodeoxynucleotides. J. Immunol. 168:4531–4537.

28. Iparraguirre, A., et al. 2008. Two distinct activation states of plasmacytoiddendritic cells induced by influenza virus and CpG 1826 oligonucleotide.J. Leukoc. Biol. 83:610–620.

29. Julkunen, I., et al. 2001. Molecular pathogenesis of influenza A virus infec-tion and virus-induced regulation of cytokine gene expression. CytokineGrowth Factor Rev. 12:171–180.

30. Kadowaki, N., S. Antonenko, J. Y. Lau, and Y. J. Liu. 2000. Natural inter-



.org/D

ownloaded from

http://jvi.asm.org/

feron alpha/beta-producing cells link innate and adaptive immunity. J. Exp.Med. 192:219–226.

31. Kato, H., et al. 2005. Cell type-specific involvement of RIG-I in antiviralresponse. Immunity 23:19–28.

32. Kobasa, D., et al. 2007. Aberrant innate immune response in lethal infectionof macaques with the 1918 influenza virus. Nature 445:319–323.

33. Kohlmeier, J. E., T. Cookenham, A. D. Roberts, S. C. Miller, and D. L.Woodland. 2010. Type I interferons regulate cytolytic activity of memoryCD8(�) T cells in the lung airways during respiratory virus challenge. Im-munity 33:96–105.

34. Latz, E., et al. 2004. TLR9 signals after translocating from the ER to CpGDNA in the lysosome. Nat. Immunol. 5:190–198.

34a.Le Bon, A., et al. 2003. Cross-priming of CD8� T cells stimulated by virus-induced type I interferon. Nat. Immunol. 4:1009–1015.

35. Liu, C., et al. 2008. Plasmacytoid dendritic cells induce NK cell-dependent,tumor antigen-specific T cell cross-priming and tumor regression in mice.J. Clin. Invest. 118:1165–1175.

36. Lund, J. M., et al. 2004. Recognition of single-stranded RNA viruses byToll-like receptor 7. Proc. Natl. Acad. Sci. U. S. A. 101:5598–5603.

37. Marshall, J. D., D. S. Heeke, C. Abbate, P. Yee, and G. Van Nest. 2006.Induction of interferon-gamma from natural killer cells by immunostimula-tory CpG DNA is mediated through plasmacytoid-dendritic-cell-producedinterferon-alpha and tumour necrosis factor-alpha. Immunology 117:38–46.

38. Minuse, E., J. L. McQueen, F. M. Davenport, and T. Francis, Jr. 1965.Studies of antibodies to 1956 and 1963 equine influenza viruses in horses andman. J. Immunol. 94:563–566.

39. Reference deleted.40. Nakajima, K., U. Desselberger, and P. Palese. 1978. Recent human influenza

A (H1N1) viruses are closely related genetically to strains isolated in 1950.Nature 274:334–339.

41. Opitz, B., et al. 2007. IFNbeta induction by influenza A virus is mediated byRIG-I which is regulated by the viral NS1 protein. Cell. Microbiol. 9:930–938.

42. Ronni, T., T. Sareneva, J. Pirhonen, and I. Julkunen. 1995. Activation ofIFN-alpha, IFN-gamma, MxA, and IFN regulatory factor 1 genes in influ-enza A virus-infected human peripheral blood mononuclear cells. J. Immu-nol. 154:2764–2774.

43. Sandbulte, M. R., A. C. Boon, R. J. Webby, and J. M. Riberdy. 2008. Analysisof cytokine secretion from human plasmacytoid dendritic cells infected withH5N1 or low-pathogenicity influenza viruses. Virology 381:22–28.

44. Scholtens, R. G., J. H. Steele, W. R. Dowdle, W. B. Yarbrough, and R. Q.Robinson. 1964. U.S. epizootic of equine influenza, 1963. Public Health Rep.79:393–402.

45. Sester, D. P., S. Naik, S. J. Beasley, D. A. Hume, and K. J. Stacey. 2000.Phosphorothioate backbone modification modulates macrophage activationby CpG DNA. J. Immunol. 165:4165–4173.

46. Sioud, M. 2006. Single-stranded small interfering RNA are more immuno-stimulatory than their double-stranded counterparts: a central role for 2�-hydroxyl uridines in immune responses. Eur. J. Immunol. 36:1222–1230.

47. Winkler, W. G. 1970. Influenza in animals: its possible public health signif-icance. J. Wildl. Dis. 6:239–242.



.org/D

ownloaded from

http://jvi.asm.org/

Oligonucleotide motifs that disappear during the evolution of influenza virus in humans increase...

Documents

Transcript of Oligonucleotide motifs that disappear during the evolution of influenza virus in humans increase...