ORIGINAL ARTICLE

Oligonucleotide microarrays for the detection andidentification of viable beer spoilage bacteriaD.G. Weber1, K. Sahm2, T. Polen3, V.F. Wendisch3 and G. Antranikian1

1 Institute of Technical Microbiology, Hamburg University of Technology, Hamburg, Germany

2 University of Applied Science, Munich, Germany

3 Institute of Molecular Microbiology and Biotechnology, Westfalian Wilhelms University Munster, Germany

Introduction

Beer spoilage bacteria are a common problem in the

brewing industry and viable bacteria with the potential to

grow cause beer spoilage by producing a silky turbidity,

resulting in a quality loss of the beer. The presence of

nongrowing bacteria in beer is not crucial since they do

not cause any change in the quality of beer. Lactic acid

bacteria (LAB) from the genera Lactobacillus and Pedio-

coccus, however, remain the major group of micro-organ-

isms that cause beer spoilage (Chihib and Tholozan

1999). Recently, it has been shown that strictly anaerobic

bacteria from the genera Megasphaera and Pectinatus can

also play an important role (Chelack and Ingledew 1987).

The metabolic activity of these nonpathogen bacteria

leads to an increased turbidity and acidity and to the

formation of diacetyl or hydrogen sulphide ruining taste

and quality of the beer.

Cultivation and polymerase chain reaction (PCR) are

the established and commonly used methods in the brew-

ing industry to detect and identify beer spoilage bacteria.

Unfortunately, cultivation is very time-consuming, taking

up to 3 weeks and no single medium appears to be

capable of detecting all species of beer spoilage bacteria

(Jespersen and Jakobsen 1996). PCR is rapid and accu-

rate, but there is no relationship between growth and

amplification of DNA (Masters et al. 1994), because

DNA-based methods can not distinguish between growing

and nongrowing bacterial cells (Lindahl 1993). Recently

real-time PCR was sporadically applied in the brewing

industry (personal communication; brewery Beck & Co.,

Bremen, Germany), e.g. using commercial kits as the

Keywords

biotechnology, brewery, food, microarray,

PCR.

Correspondence

Garabed Antranikian, Institute of Technical

Microbiology, Hamburg University of

Technology, Kasernenstr. 12, D-21073

Hamburg, Germany.

E-mail: antranikian@tuhh.de

Present address

Daniel G. Weber, BGFA – Research Institute

of Occupational Medicine – German Social

Accident Insurance, Ruhr-University Bochum,

Germany.

2007 ⁄ 1435: received 5 September 2007,

revised and accepted 1 February 2008

doi:10.1111/j.1365-2672.2008.03799.x

Abstract

Aims: The design and evaluation of an oligonucleotide microarray in order to

detect and identify viable bacterial species that play a significant role in beer

spoilage. These belong to the species of the genera Lactobacillus, Megasphaera,

Pediococcus and Pectinatus.

Methods and Results: Oligonucleotide probes specific to beer spoilage bacteria

were designed. In order to detect viable bacteria, the probes were designed to

target the intergenic spacer regions (ISR) between 16S and 23S rRNA. Prior to

hybridization the ISR were amplified by combining reverse transcriptase and

polymerase chain reactions using a designed consenus primer. The developed

oligonucleotide microarrays allows the detection of viable beer spoilage

bacteria.

Conclusions: This method allows the detection and discrimination of single

bacterial species in a sample containing complex microbial community. Fur-

thermore, microarrays using oligonucleotide probes targeting the ISR allow the

distinction between viable bacteria with the potential to grow and non growing

bacteria.

Significance and Impact of the Study: The results demonstrate the feasibility of

oligonucleotide microarrays as a contamination control in food industry for

the detection and identification of spoilage micro-organisms within a mixed

population.

Journal of Applied Microbiology ISSN 1364-5072

ª 2008 The Authors

Journal compilation ª 2008 The Society for Applied Microbiology, Journal of Applied Microbiology 105 (2008) 951–962 951

LightCycler foodproof Beer Screening Kit (Roche, Darms-

tadt, Germany), promised to be an alternative application

for the detection of beer spoilage bacteria, because of

speed, sensitivity and specificity.

For the identification of viable micro-organisms it is

more reliable to analyse precursor ribosomal RNA

(rRNA) rather than DNA. Many arguments which sup-

port this assumption include the following: (i) RNA

molecules are abundant in growing bacterial cells (Oer-

ther et al. 2000), (ii) it has been shown that in nongrow-

ing cells precursor rRNA is rapidly degraded and it is

only detectable when cells are viable, (iii) in nongrowing

cells rRNA maturation continues and pre-rRNA synthe-

sis, however, stops resulting in depletion of pre-RNA

pool (Cangelosi et al. 1996; Cangelosi and Brabant

1997), (iv) the intergenic spacer regions (ISR), between

the 16S-23S precursor-rRNA (pre-rRNA) and 23S-5S

precursor-rRNA is highly conserved and (v) the discrimi-

nation potential of ISR for complex groups of micro-

organisms, especially for Lactobacillus species has been

also shown previously (Berthier and Ehrlich 1998; Song

et al. 2000; Blaiotta et al. 2002; Flint and Angert 2005).

Consequently, pre-rRNA based studies, which reflect the

physiological state of microbial cells (Cangelosi and

Brabant 1997), will be more effective. Especially, detec-

tion of ISR provides evidence for cells growth (Schmid

et al. 2001).

Considerable efforts have been already made to develop

efficient methods for the detection of beer spoilage

micro-organisms (March et al. 2005). Alternative methods

seem, however, not to have found their way into the

breweries as they often lack the speed, sensitivity and

specificity required (Jespersen and Jakobsen 1996). This

could change with the development of the more sensitive

and reliable microarray method (Schena et al. 1995;

Shalon et al. 1996) described above. Microarrays are a

useful method for the detection and identification of

bacteria (Jin et al. 2005), also within mixed populations

(Maynard et al. 2005). Especially in the food industry

microarrays will play a key role in food safety (Cho and

Tiedje 2001; Small et al. 2001; Al-Khaldi et al. 2002; Call

et al. 2003; Keramas et al. 2003). The microarray technol-

ogy is fast, sensitive and specific, allowing the parallel

detection and identification of different bacterial species.

In general, these microarrays applied so for contain spe-

cies-specific probes targeting the 16S rDNA region (Jin

et al. 2005; Chiang et al. 2006) and only few were

designed using probes targeting the ISR rDNA (Nubel

et al. 2004; Lin et al. 2005).

The aim of the present study was hence to develop an

alternative diagnostic method for the rapid detection of

beer spoilage bacteria. A prototype oligonucleotide micro-

array based on species-specific probes targeting the ISR

was designed and evaluated. Accordingly, growing beer

spoilage bacteria from the genera Lactobacillus, Megasph-

aera, Pectinatus and Pediococcus were detected and identi-

fied.

Material and methods

Bacterial species and growth conditions

Type strains of the bacteria used in this study were from

the Deutsche Sammlung von Mikroorganismen und Zell-

kulturen (DSMZ), Braunschweig, Germany. Other isolates

belonging to the genera Lactobacillus and Pediococcus were

obtained from the brewery Beck & Co., Bremen, Germany

(Table 1). Lactobacillus sp. was cultured at 30�C in

De Man-Rogosa-Sharpe MRS medium (De Man et al.

1960) under aerobic conditions and Pediococcus sp. was

cultured at 20�C in the same medium under aerobic condi-

tions. Pectinatus sp. and M. cerevisiae were cultured under

anaerobic conditions at 30�C in peptone-yeast extract plus

Fildes solution medium (Engelmann et al. 1985).

Table 1 Specific oligonucleotide probes used in this study to detect and identify beer spoiling bacterial species

Target species Probe sequence (5¢ fi 3¢)Probe

length (bp) Strain

Lactobacillus brevis TTGACGATCACGAAGTGAC 19 Isolate from Beck & Co., Bremen, Germany

Lact. casei TGAGGGGATCACCCTCAA 18 Isolate from Beck & Co., Bremen, Germany

Lact. paracasei TGAGGGGATCACCCTCAA 18 DSMZ 5622T

Lact. coryniformis CCGAGAATTAACATGCGTT 20 DSMZ 20001T*

Lact. perolens AAGTCCGCCGAATCAAGC 19 DSMZ 12745T

Pediococcus damnosus AACCGAGAACATTGCGTTTT 20 Isolate from Beck & Co., Bremen, Germany

Ped. inopinatus AACCGAGAACATTGCGTTTT 20 DSMZ 20285T

Megasphaera cerevisiae TCCGGCGAAGTAGAGATACAG 21 DSMZ 20462T

Pectinatus cerevisiiphilus ATGGCGGGGAATAGTTGG 18 DSMZ 20467T

Pectinatus frisingensis ATGGCGGGGAATAGTTGG 18 DSMZ 6306T

*Deposited by Ingrid Bohak, TU Munchen, Technologie der Brauerei I, 85350 Freising-Weihenstephan, Germany.

Oligonucleotide microarrays D.G. Weber et al.

952 Journal compilation ª 2008 The Society for Applied Microbiology, Journal of Applied Microbiology 105 (2008) 951–962

ª 2008 The Authors

Cell treatment

The exponentially growing bacterial cultures were treated

with the following methods to examine the ISR rRNA

and 16S rRNA contents in growing and inactivated bacte-

rial cells using the developed RT-PCR: (i) chlorampheni-

col was added to a final concentration of 0Æ25 mg ml)1

and incubated for 4 h at RT, (ii) cultures were incubated

at 80�C for 4 h, (iii) cultures were autoclaved at 120�C

for 20 min.

Preparation of total RNA and quantification

Portions (40 ml) of exponentially growing cultures

(OD600 of approx. 0Æ8) were chilled on ice and cells were

harvested immediately by centrifugation (10 min, 300 g,

4�C) (Polen and Wendisch 2004). All plastic wares were

treated with 0Æ1% DEPC at 37�C over night and auto-

claved. Total RNA was isolated according to Hurt et al.

(Hurt et al. 2001) with the following modifications: steps

were performed at 4�C, the volumes were adapted and

the precipitation was done over night at )20�C. The

samples were saturated with 170 ll denaturation solution

containing 0Æ85 ll 2-mercaptoethanol and 1Æ5 ml extrac-

tion buffer and incubated for 30 min at 65�C, gently

mixed and centrifuged at 1800 g for 10 min. The super-

natants were poured into tubes and chilled on ice. The

pellet was resuspended in 830 ll extraction buffer, incu-

bated for 10 min at 65�C gently mixed and centrifuged at

1800 g for 10 min. The supernatants were combined, the

same volume of phenol-chloroform was added and the

sample was centrifuged at 1800 g for 20 min. The aque-

ous phase was transferred to a new tube and precipitated

with 0Æ6 volumes ice cold ethanol (100%) at )20�C over

night. The sample was centrifugated at 16 000 g for

20 min, washed with ice cold ethanol (70%) and centrifu-

gated at 16 000 g for 10 min. The pellet was dried at 4�C

and resuspended in 200 ll H2O. RNA concentration was

determined by measurement of the optical density at

260 nm (OD260).

Preparation of DNA

Forty millilitre of exponentially growing cultures (OD600

of approx. 0Æ8) were chilled on ice and cells were harvested

immediately by centrifugation (10 min, 300 g, 4�C). Total

DNA was isolated according to Zhou et al. (1996) with

modifications. Supernatants were combined with phenol-

chloroform and DNA was precipitated in ice cold ethanol

(100%). DNA concentration was determined by measure-

ment the optical density at 260 nm (OD260). If necessary,

the nucleic acids were diluted to a maximal concentration

of 500 ng ll)1 and used as template for PCR.

PCR amplification

Amplification was carried out using T3 Thermocycler

(Whatman Biometra, Gottingen, Germany). The reaction

mixture contained 5 ll 10 · PCR buffer (Invitrogen,

Carlsberg, CA, USA), 2 mmol l)1 deoxynucleoside tri-

phosphates, 10 pmol of each primer (MWG AG Biotech,

Ebersberg, Germany) (Table 2), 1Æ5 mmol l)1 MgCl2, a

maximum of 500 ng template DNA and 2Æ5 U Taq-Poly-

merase (Invitrogen) in a total reaction volume of 50 ll.

Samples were initially denatured at 94�C for 3 min,

followed by 40 sequential cycles, denaturation at 95�C

(1 min), annealing at 55�C (1 min), extension at 72�C

(1 min) and a final extension at 72�C for 5 min followed

by a cooling step down to 4�C. PCR products were analy-

sed for correct size by agarose gel electrophoresis and

ethidium bromide staining. For sequencing the PCR

products were purified using the NucleoSpin Extract Kit

(Macherey-Nagel, Duren, Germany) according to the

manufacturer’s instructions.

RT-PCR amplification

All plastic wares were treated with 0Æ1% DEPC at 37�C

over night and autoclaved. The RT-PCR amplification

was carried out using T3 Thermocycler (Whatman Biom-

etra). The RT reaction mixture contained 2Æ5 ll pd(N)6

random hexamer 5¢-phosphate (500 ng ll)1) (Roche,

Darmstadt, Germany), 20 mmol l)1 deoxynucleoside tri-

phosphates, 0Æ5 ll T4 gene 32 protein (5 mg ml)1)

(Roche Diagnostics, Mannheim, Germany), 2 ll H2O and

a maximum of 1Æ5 lg RNA. Samples were incubated at

65�C for 5 min, immediately chilled on ice and centri-

fuged. First-strand buffer (4 ll) (Invitrogen), 2 ll

0Æ1 mol l)1 DTT, 1 ll 2Æ5 mmol l)1 MgCl2 and 40 U

RNase-Inhibitor (Roche Diagnostics, Mannheim, Ger-

many) were added to the mixture and incubated at 42�C

for 2 min. Then, 200 U SuperScript II (Invitrogen) were

added to the mixture and incubated at 42�C for 50 min

followed by an incubation at 70�C for 15 min. An aliquot

of 5 ll of the RT reaction mixture was used for PCR

amplification. The PCR reaction mixture contained 5 ll

10 · PCR buffer (Invitrogen), 2 mmol l)1 deoxynucleo-

side triphosphates, 10 pmol of each primer (MWG AG

Table 2 PCR primers used in this study for PCR and RT-PCR

Primer

target Target Sequence (5¢ fi 3¢) Reference

fpISR ISR GGTGAAGTCGTAACAAGGTAGC This study

R23-2R ISR TCCGGGTACTTAGATGTTTC 44

27F 16S AGAGTTTGATCCTGGCTCAG 61

1492R 16S GGTTACCTTGTTACGACTT 61

D.G. Weber et al. Oligonucleotide microarrays

ª 2008 The Authors

Journal compilation ª 2008 The Society for Applied Microbiology, Journal of Applied Microbiology 105 (2008) 951–962 953

Biotech) (Table 2), 1Æ5 mmol l)1 MgCl2, 5 U Taq-

Polymerase (Invitrogen) in a total reaction volume of

50 ll. Samples were initially denatured at 94�C for 3 min,

followed by 40 sequential cycles, denaturation at 95�C

(1 min), annealing at 40�C (1 min), extension at 72�C

(1 min) and a final extension at 72�C for 5 min followed

by a cooling step down to 4�C. PCR products were analy-

sed for correct size by agarose gel electrophoresis and

ethidium bromide staining.

Sequencing, sequence analysis and probe design

The amplified DNA fragments were sequenced with primer

fpISR (Table 2) by cycle sequencing using the sequencing

service of SeqLab, Gottingen, Germany. The ISR sequences

were analysed using the public database EMBL-EBI of the

European Bioinformatics Institute. Sequences were aligned

using the software ClustalX (Thompson et al. 1997).

Specific probes were designed using the primer3 software

(Rozen and Skaletsky 2000). The two closely related species

of the genera Pediococcus and Pectinatus, respectively, were

detected in each case by a single probe.

cDNA labelling

The cDNA was labeled with Cy3-fluorescent dyes using

the Mirus Label IT-Kit (MoBiTec, Gottingen, Germany)

according to the manufacturer’s instructions.

Oligonucleotide microarrays

Standard glass microscope slides were coated with a poly-

l-lysine solution and stored for several weeks to allow the

surface to become sufficiently hydrophobic (Eisen and

Brown 1999). Species-specific probes (Table 1) were spot-

ted in 3 · SSC onto the glass surface using a robotic print-

ing system (Shalon et al. 1996). For routine experiments

50 lmol l)1 was used as probe concentrations. The diame-

ter of the spots was 150 lm and the space between the

centres of two spots was 205 lm allowing the preparation

of seven grids each containing 70 spot replicates (Fig. 1).

To distribute the oligonucleotides more evenly, the

spots were rehydrated using a 1 · SSC bath at 40�C until

the spots were glistening, followed by snapped-drying at

120�C using a heat block. To increase the amount of

hybridisable oligonucleotides, stably attached to each spot,

the nucleic acids were cross-linked by UV irradiation

(Eisen and Brown 1999; Polen et al. 2003).

Oligonucleotide microarray hybridization and washing

One microgram of Cy3-labelled cDNA was mixed with 3 ll

20 · SSC, 0Æ5 ll 1 mmol l)1 HEPES (pH 7) and 0Æ5 ll

10% SDS, heated to 99�C for 2 min, chilled on ice,

incubated at room temperature for 5 min, applied to the

microarrays which were covered with a lifterslip (Erie

Scientific Company, Portsmouth, VA, USA) and incubated

for 12–16 h at 30�C in a moist chamber (1 · SSC). After

hybridization the microarrays were washed in a solution

containing 2 · SSC and 0Æ1% SDS, then in 1 · SSC and

then in 0Æ5 · SSC. After washing microarrays were dried

by centrifugation (15 min at 50 g). All microarray

hybridizations were repeated for each target.

Oligonucleotide microarray scanning and analysis

After drying the microarrays the fluorescence at 532 nm

(Cy3) was determined using an Axon Inc. GenePix 4000

laser scanner (Axon, Union City, CA, USA). Acquired

raw fluorescence data were stored as image files in TIFF

format and were analysed quantitatively by using GenePix

Pro 3Æ0 software (Axon, Union City, USA). Signal was

defined of median spot fluorescence signal at 532 nm

wavelength (F532) minus median background fluores-

cence signal (B532), defined by surrounding pixel inten-

sity (Heiskanen et al. 2000) and the mean value was

calculated. Negative signal intensities resulting from

B532 > F532 were set to 0 according to no detectable

signal intensities. Otherwise no normalization was used,

because there was only a single dye and the number of

samples was low (Nelson et al. 2004).

Figure 1 Layout of the used microarrays with seven grids each con-

taining 70 spot replicates. The diameter of the spots was 150 lm and

the space between the centres of two spots was 205 lm.

Oligonucleotide microarrays D.G. Weber et al.

954 Journal compilation ª 2008 The Society for Applied Microbiology, Journal of Applied Microbiology 105 (2008) 951–962

ª 2008 The Authors

Statistical analysis

Using Prism 4Æ0 (GraphPad Software, Inc., San Diego,

CA, USA), in a paired Student’s t-test, signal intensities

of the species-specific probes and the nontargeting probes

were analysed.

Microarray platform and data are submitted to the

Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/

geo). The accession numbers are: GPL5157, GPL5158

(platforms), GSM190233, GSM190235, GSM190236,

GSM190237, GSM190239, GSM190240, GSM190242,

GSM190244, GSM190246, GSM190247, GSM190248,

GSM190249 (samples) and GSE7840 (series).

Results

Design of a consensus primer

The primer fpISR, targeting the conserved sequences

flanking the 3¢ end of the 16S rRNA region, was designed

in order to amplify in combination with the reverse

primer R23-2R (Nakagawa et al. 1994) the ISR of beer

spoilage bacteria used in this study (Table 2). Primer

specificity for fpISR was examined using the software

ClustalX (Thompson et al. 1997) and the public database

of EMBL-EBI of the European Bioinformatic Institute.

The results obtained show that fpISR targets the 16S

rRNA of all beer spoilage bacteria used in this study and

additionally to a multitude of other bacterial species of

the genera Lactobacillus and Pediococcus.

Stability of pre-rRNA and 16S rRNA

Since our aim was to develop a method that detects active

bacteria, we investigated the stability of pre-rRNA and

16S rRNA after different inactivation treatments. Three

approaches were performed to inactivate the most com-

mon beer spoiling bacteria: (i) chloramphenicol was

added to exponentially growing cultures to a final con-

centration of 0Æ25 mg ml)1, (ii) exponentially growing

cultures were incubated at 80�C and (iii) exponentially

growing cultures were autoclaved. The cells were incu-

bated under these conditions for 4 h to let the pre-rRNA

pool deplete. Detection of ISR rRNA and 16S rRNA was

performed using RT-PCR. As a control assay aliquots of

autoclaved, antibiotic treated and incubated (80�C) bacte-

rial cells were cultured under optimal conditions.

No nucleic acids could be detected in autoclaved bacte-

rial cells, neither the ISR rRNA nor the 16S rRNA. In

cells treated with chloramphenicol or those incubated at

80�C for 4 h the situation was different. In both cases the

amplification of the 16S rRNA using the primer pair 27F

and 1492R in the RT-PCR assay was successful. Whereas

RT-PCR using the primer pair fpISR and 23R-2R did not

detect any ISR. The results for the detection of viable beer

spoilage bacteria are summarized in Table 3.

Design of oligonucleotide probes for microarray

hybridization

ISR rDNA of the bacterial species under investigation was

amplified using the consensus primer pair fpISR and

Table 3 Detection of beer spoiling bacteria by cultivation or RT-PCR

after treatment

Treatment

Detection methods

Cultivation RT-PCR 16S RT-PCR ISR

No treatment + + +

Autoclaving ) ) )80�C for 4 h ) + )Chloramphenicol ) + )

+: detection, ): no detection.

Table 4 ISR sequences of the studied beer spoilage bacteria. ISR length was determined as described previously (Loughney et al. 1982)

Species Strain

IST length

(bp) Similarity

Accession

number

Lactobacillus brevis –� 221 – X74221

Lactobacillus casei –� 221 – X74220

Lactobacillus paracasei DSMZ 5622 T 223 – AB109026

Lactobacillus coryniformis DSMZ 20001 T 203 Lactobacillus salivarius (76%) DQ314274

Lactobacillus perolens DSMZ12745 T* 243 Lactobacillus plantarum (75%) DQ314275

Pedoicoccus damnosus –� 232 – AF405383

Pediococcus inopinatus DSMZ 20285 T 232 – AF405385

Megasphaera cerevisiae DSMZ 20462 T 491 Bacillus halodurans (72%) DQ314276

Pectinatus cerevisiiphilus DSMZ 20467 T 456 – AB022061

Pectinatus frisingensis DSMZ 6306 T 376 – AB022063

The similarity levels were mentioned for the three novel evaluated ISR sequences.

*Deposited by Ingrid Bohak, TU Munchen, Technologie der Brauerei I, 85350 Freising-Weihenstephan, Germany.

�Obtained from the brewery Beck & Co., Bremen, Germany.

D.G. Weber et al. Oligonucleotide microarrays

ª 2008 The Authors

Journal compilation ª 2008 The Society for Applied Microbiology, Journal of Applied Microbiology 105 (2008) 951–962 955

L. brevisL. casei

L. paracaseiL. corynformis

L. perolensL. damnosusP. inopinatus

P. frisingensisP. cerevisiiphilus

M. cerevisiae

L. brevisL. casei

L. paracaseiL. corynformis

L. perolensL. damnosusP. inopinatus

P. frisingensisP. cerevisiiphilus

M. cerevisiae

L. brevisL. casei

L. paracaseiL. corynformis

L. perolensL. damnosusP. inopinatus

P. frisingensisP. cerevisiiphilus

M. cerevisiae

L. brevisL. casei

L. paracaseiL. corynformis

L. perolensL. damnosusP. inopinatus

P. frisingensisP. cerevisiiphilus

M. cerevisiae

L. brevisL. casei

L. paracaseiL. corynformis

L. perolensL. damnosusP. inopinatus

P. frisingensisP. cerevisiiphilus

M. cerevisiae

L. brevisL. casei

L. paracaseiL. corynformis

L. perolensL. damnosusP. inopinatus

P. frisingensisP. cerevisiiphilus

M. cerevisiae

L. brevisL. casei

L. paracaseiL. corynformis

L. perolensL. damnosusP. inopinatus

P. frisingensisP. cerevisiiphilus

M. cerevisiae

Figure 2 ISR nucleotide sequences of the studied beer spoilage bacteria. The designed specific probes are inverted. Start sequence (TCTA) and

end sequence (GGT) are boxed (Loughney et al. 1982).

Oligonucleotide microarrays D.G. Weber et al.

956 Journal compilation ª 2008 The Society for Applied Microbiology, Journal of Applied Microbiology 105 (2008) 951–962

ª 2008 The Authors

R23-2R and the short spacers (Nour 1998) were

sequenced. The short spacer sequences of the three beer

spoilage bacteria Lactobacillus coryniformis, Lactobacillus

perolens and Megasphaera cerevisiae have not been

described before (Table 4). On the basis of the ISR

sequences species-specific probes were designed in order

to detect and identify these micro-organisms. Probe

design was performed applying the primer3 software

(Rozen and Skaletsky 2000). The aim was to develop

probes with similar lengths (range: 18–22 nt), GC

contents (range: 40–60%) and dissociation temperature

(optimum: 60�C).

Each probe perfectly matched its target sequence for

species-specific identification (Fig. 2). Only the probe

targeting the ISR of L. casei and L. paracasei is able to

anneal to the ISR of the lactic acid bacterium L. curvatus

(data not shown), which also causes beer spoilage (Jesper-

sen and Jakobsen 1996), but seems to be of minor impor-

tance (Yansanjav et al. 2003).

Applicability of the new probes for microarray

hybridization

The newly developed probes were spotted on microarrays

and hybridized to pure RT-PCR amplicons from all

species under investigation. Optimal labelling and hybrid-

ization conditions had been determined previously. The

developed microarrays detected the species-specific

RT-PCR products with high degrees of specificity, whereas

no significant signals from the nontargeting probes could

be detected, e.g. in Fig. 3 a fluorescent image illustrating

the results from hybridizing Cy3-labelled P. cerevisiiphilus

RT-PCR amplicons to the oligonucleotide microarray was

shown. Microarray experiments were performed for all

beer spoilage bacteria using identical hybridization condi-

tions. Always the highest signal intensity is given by the

species-specific probe, showing the correct identification

of the target, whereas all other nontargeting probes show

only low or no detectable signal intensities (Fig. 4). Differ-

ences in means of signal intensities between the species-

specific probe and the nontargeting probes are significant

(P < 0Æ05).

Specificity of the microarrays to identify beer spoilage

bacteria from pooled nucleic acids

For the use of microarrays as a routine contamination

control method in the beer brewing industry, the micro-

arrays must be able to detect and identify specific

sequences in a complex mixture of different nucleic

acids. In order to evaluate the applicability of the micro-

arrays to identify different bacteria, the RT-PCR ampli-

cons of two bacterial species were pooled in a ratio of

1 : 1, labelled with the Cy3 fluorescent dyes and hybrid-

ized to the microarray under optimal experimental con-

ditions. Signals appeared in the correct locations,

indicating the correct identification of the pooled nucleic

acids by the species-specific probes. The quantitative

analysis showed that the microarray was able to detect

and to identify different nucleic acids from different beer

spoilage bacteria from a pooled mix in one approach.

Similar experiments were successfully done for different

mixed RT-PCR amplicons. Results of quantitative analy-

sis for mixed RT-PCR amplicons of two different

bacteria are shown in Fig. 5 for M. cerevisiae and

P. cerevisiiphilus (Fig. 5a), P. inopinatus and P. cerevisii-

philus (Fig. 5b), L. brevis and P. frisingensis (Fig. 5c).

L. brevis

P. damnosusM. cerevisiae

P. cerevisiiphilusP. frisingensisP. inopinatus

L. caseiL. paracasei L. coryniformis L. perolens

Figure 3 Fluorescent images of the seven grids (each with 70 repli-

cate spots) representing the seven probes to detect the beer spoilage

bacteria. In this microarray hybridization P. cerevisiiphilus crDNA was

labeled with Cy3 as target. No detectable signals were obtained from

nontargeting probes.

100 000

10 000

1000

100

10

1

0·1

0·01

Log 10

sign

al in

tens

ity

L. br

evis

P. da

mno

sus

M. c

erev

isiae

P. ce

revis

iiphil

us

P. fri

singe

nsis

P. ino

pinat

us

L. ca

sei

L. co

rynif

orm

is

L. pe

rolen

s

Figure 4 Mean signal intensities (F532–B532) of the specific oligonu-

cleotide probes to their ISR targets and the nontargeting probes. Sig-

nals of specific probes (h) gave high signal intensities, whereas signals

of nontargeting probes ( ) gave low or no detectable signal intensi-

ties. Presented data were obtained from nine microarray hybridiza-

tions. Differences in signal intensities were significant (P < 0Æ05).

D.G. Weber et al. Oligonucleotide microarrays

ª 2008 The Authors

Journal compilation ª 2008 The Society for Applied Microbiology, Journal of Applied Microbiology 105 (2008) 951–962 957

Differences in means of signal intensities between the

species-specific probes and the nontargeting probes are

significant (P < 0Æ05).

Discussion

Based on the alignment using the published 16S

rDNA ⁄ ISR sequences of four beer spoiling species, the

consensus forward primer fpISR was designed in order to

amplify the ISR of all beer spoiling bacteria from the

genera Lactobacillus, Pediococcus, Megasphaera and Pectin-

atus. Positioning the primer within the 3¢ end of the 16S

region, which is highly conserved in the bacterial king-

dom (Gurtler and Stanisich 1996), it was possible to find

a primer which amplifies several related genera. The

forward primer fpISR which targets the 3¢ end of the 16S

region in combination with the reverse primer R23-2R

(Nakagawa et al. 1994) which targets the conserved 5¢end of 23S region successfully amplifies the ISR rDNA of

all studied beer spoiling bacteria and is able to anneal to

a multitude of different bacterial species. Therefore, in

further studies the primer combination fpISR and R23-2R

may be established as a consensus primer pair for amplifi-

cation of the ISR of many different bacterial species.

In order to examine the suitability of pre-rRNA as a

molecular marker of growing beer spoilage bacteria, we

investigated the detectability of RNA in nongrowing cells.

Since different inactivation methods had given different

results (Bej et al. 1991; Patel et al. 1993; Cangelosi et al.

1996; McKillip et al. 1998; Sheridan et al. 1998; Schmid

et al. 2001) several methods for cell inactivation were

examined. While autoclaving completely destroyed rRNA

and pre-rRNA, inactivation by pasteurization and

chloramphenicol treatment lead to the loss of pre-rRNA

but not to the loss of rRNA.

The ISR as part of the pre-rRNA could not be detected

in RT-PCR amplification of cells treated in this manner.

As chloramphenicol inhibits the final steps in rRNA

maturation (Forget and Jordan 1970; Pace 1973), it

inhibits growth of bacterial cells and the synthesis of pre-

rRNA. The degradation of pre-rRNA seems to proceed

even after cell inactivation (Cangelosi and Brabant 1997),

resulting in the depletion of the pre-rRNA pool after

antibiotic treatment. Our results are in agreement with

the examination of the depletion of the pre-rRNA pool

from Mycobacterium tuberculosis after treatment with

rifampin. In this study it was shown that the pre-rRNA

pool decreased to nearly undetectable levels within 3 h

100 000(a)

(b)

(c)

10 000

1000

100

10

1

1

0·1

0·01

Log

sign

al in

tens

ity

100 000

10 000

1000

100

10

0·1

0·01

Log

sign

al in

tens

ity

1

100 000

10 000

1000

100

10

0·1

0·01

Log

sign

al in

tens

ity

L. br

evis

P. da

mno

sus/P

. inop

inatu

s

M. c

erev

isiae

P. ce

revis

iiphil

us/P.

frisi

ngen

sis

L. ca

sei/L

. par

acas

ei

L. co

rynif

orm

is

L. pe

rolen

s

L. br

evis

P. da

mno

sus/P

. inop

inatu

s

M. c

erev

isiae

P. ce

revis

iiphil

us/P.

frisi

ngen

sis

L. ca

sei/L

.par

acas

ei

L. co

rynif

orm

is

L. pe

rolen

s

L. br

evis

P. da

mno

sus/P

. inop

inatu

s

M. c

erev

isiae

P. ce

revis

iiphil

us/P.

frisi

ngen

sis

L. ca

sei/L

. par

acas

ei

L. co

rynif

orm

is

L. pe

rolen

s Figure 5 Spot intensities (F532–B532) of microarray assays with

pooled ISR crDNA from two different beer spoiling bacterial species

M. cerevisiae and P. cerevisiiphilus (a), P. inopinatus and P. cerevisiiph-

ilus (b), L. brevis and P. frisingensis (c). Signals of specific probes (h)

gave high signal intensities, whereas signals of nontargeting probes

( ) gave low or no detectable signal intensities. Presented data were

obtained from a single microarray hybridization per target. Differences

in signal intensities were significant (P < 0Æ05).

Oligonucleotide microarrays D.G. Weber et al.

958 Journal compilation ª 2008 The Society for Applied Microbiology, Journal of Applied Microbiology 105 (2008) 951–962

ª 2008 The Authors

after antibiotic treatment of the bacterial cells (Cangelosi

and Brabant 1997).

These results suggest that rRNA contents do not neces-

sarily correlate with growth while pre-rRNA is a suitable

marker of growing bacterial strains. Therefore, RT-PCR

targeting the ISR rRNA is a very effective method to

detect growing bacterial cells. If RT-PCR amplifies ISR-

sequences it indicates the presence of growing or very

recently inactivated cells. Similar results have been

obtained in a study with ammonium oxidizing bacteria.

Here, ISR rRNA was detected no longer than 4 h after

inactivating treatment, in contrast to 16S rRNA and 23S

rRNA, which was still detectable for more than 24 h

(Schmid et al. 2001).

Several other studies used an RT-PCR approach for the

detection of growing cells of Legionella pneumophila, Vib-

rio cholerae (Bej et al. 1991, 1996), Mycobacterium leprae

(Patel et al. 1993), and Listeria monocytogenes (Klein and

Juneja 1997). All have in common that they use mRNA

as target in RT-PCR, in contrast to this study where pre-

rRNA is used. For the detection of growing bacterial cells

pre-rRNA seems to be more suitable than mRNA, because

persistence of mRNA in nongrowing cells depends on the

inactivation treatment (Sheridan et al. 1998). Therefore,

mRNA might be still detectable in inactivated bacterial

cells and is not a useful indicator of growth (Schmid

et al. 2001).

In our two step approach towards identification of

growing beer spoiling bacteria, we established an oligonu-

cleotide microarray for the species-specific detection of

species from the four different genera Lactobacillus, Pedio-

coccus, Megasphaera and Pectinatus. We first had to

develop oligonucleotide probes to target diagnostic

regions of the ISR sequences. Since it has been proposed

that L. casei and L. paracasei may be identical (Acedo-

Felix and Perez-Martinez 2003), with differences probably

due to random events and random mutations, or PCR

errors (Chen et al. 2000), the two bacterial species L. casei

and L. paracasei were handled as one in this study.

Alignment of the ISR showed that significant sequence

differences between the ISR of the different bacterial spe-

cies existed within the Gram-positive bacteria from the

genera Lactobacillus and Pediococcus as well as within the

Gram-negative bacteria from the genera Megasphaera and

Pectinatus. These results confirm the suggestion that the

sequence variation within the ISR of different bacterial

species is significant (Barry et al. 1991) with high

sequence variability (Nour 1998). The high variations of

the ISR sequences suggest that the ISR might be suitable

for the detection of bacteria using probes especially for

the discrimination of fine levels (Boyer et al. 2001). It is

proposed that the ISR is more suitable for species-specific

identification than the commonly used 16S region (Fox

et al. 1992), because the identification of 16S sequences is

not necessarily a sufficient criterion to guarantee species

identity. ISR on the other hand is useful for the definition

of species-specific probes (Nour 1998), because the evolu-

tionary rate of the ISR rRNA between 16S region and 23S

region is ten times greater than that of the 16S rRNA

(Leblond-Bourget et al. 1996). In addition, the species-

specific sequences in combination with the possibility to

detect growing bacteria give ISR an enormous advantage

compared to the 16S region. ISR is a highly feasible target

for species-specific probes to detect and identify growing

bacterial species. Specificity is one of the most critical

parameters for any method used to detect and identify

micro-organisms.

Based on the ISR alignment we designed probes with

similar length, GC content and dissociation temperature

values to avoid the known effects of base composition

and sequence on duplex stability and to achieve uniform

hybridization intensity across the microarray under the

experimental conditions (Beattie et al. 1995; Doktycz

et al. 1995). In order to evaluate the potential of micro-

arrays as contamination detector, a set of ten beer spoil-

age bacteria representing both divergent phylogenies

(Gram-negative and Gram-positive) was selected. The

microarrays were composed of probes specific to the ISR

sequences of this beer spoiling bacterial species.

Successful hybridization of species-specific probes was

achieved. In all hybridization experiments probes with

100% match gave high signal intensities while all other

probes showed signal intensities of background values.

These results confirm that the probes were suitable to

resolve target from nontarget (Liu et al. 2001) and give a

better discrimination capability than previously reported

(Yershov et al. 1996; Zheng et al. 1996; Drobyshev et al.

1997). However, to discriminate two closely related spe-

cies like P. damnosus and P. inopinatus with 97% ISR

sequence homology (data not shown), it will be meaning-

ful to use additional probes, e.g. targeting the ISR

between 23S and 5S pre-rRNA. Additional probes for the

identification of one species will also result in higher sen-

sitivity and specificity. Additionally, to avoid false-positive

signals from nontargeting probes further optimization of

the microarray prototype will be necessary, e.g. using

PNA (peptide nucleic acids) instead of DNA as probes

(Weiler et al. 1997) or using longer probes (Relogio et al.

2002). Differences in signal intensities were observed for

the different probes after specific hybridization to their

complementary targets. This observation depends on

many factors that influence the kinetics of the hybridiza-

tion reaction (Behr et al. 2000) as well as the labelling

reaction. Also, variations of the background spot signal

intensities occur as a result of different sources of fluctua-

tions (Schuchhardt et al. 2000; Wildsmith et al. 2001) like

D.G. Weber et al. Oligonucleotide microarrays

ª 2008 The Authors

Journal compilation ª 2008 The Society for Applied Microbiology, Journal of Applied Microbiology 105 (2008) 951–962 959

systematic variations in pin geometry, random fluctua-

tions in probe volume and target fixation. Therefore, slide

to slide comparison is difficult (Schuchhardt et al. 2000).

In this article, we primarily focused on the development

of the prototype microarray, but some efforts were also

undertaken to improve the RT-PCR conditions. It should

be noted that for real samples the RNA extraction and

the RT-PCR conditions have to be altered.

Since beer is a coculture of many different micro-

organisms we also tested whether the microarray could

identify multiple targets in a mixed sample. The detection

and species-specific identification of pooled nucleic acids

from different bacterial species was successfully shown for

many different combinations of nucleic acids from two

species. However, the number of real potential beer spoil-

age micro-organisms is much higher than the bacterial

species investigated in this study and may increase in

future, because new spoilage micro-organisms will be

identified. Accordingly, the use of microarrays is a single

approach will be more efficient than the currently used

RT-PCR where multiple reactions are needed.

In summary, with the microarray prototype developed

in this study we now have an instrument, which enables

us in a single approach to identify a multitude of bacte-

rial species, of a microbial community known to be

responsible for beer spoiling and to give a reliable picture

about the growth status of these species.

Acknowledgement

This study was supported by DBU (Deutsche Bundesstif-

tung Umwelt) grant no. 13040 ⁄ 16 (joint project biocataly-

sis).

References

Acedo-Felix, E. and Perez-Martinez, G. (2003) Significant dif-

ferences between Lactobacillus casei subsp. casei ATCC

393T and a commonly used plasmid-cured derivative

revealed by a polyphasic study. Int J Syst Evol Microbiol 53,

67–75.

Al-Khaldi, S.F., Martin, S.A., Rasooly, A. and Evans, J.D.

(2002) DNA microarray technology used for studying

foodborne pathogens and microbial habitats: minireview.

J AOAC Int 85, 906–910.

Barry, T., Glennon, C.M., Dunican, L.K. and Gannon, F.

(1991) The 16s ⁄ 23s ribosomal spacer region as a target for

DNA probes to identify eubacteria. PCR Methods Appl 1,

149.

Beattie, W.G., Meng, L., Turner, S.L., Varma, R.S., Dao, D.D.

and Beattie, K.L. (1995) Hybridization of DNA targets to

glass-tethered oligonucleotide probes. Mol Biotechnol 4,

213–225.

Behr, T., Koob, C., Schedl, M., Mehlen, A., Meier, H., Knopp,

D., Frahm, E., Obst, U. et al. (2000) A nested array of

rRNA targeted probes for the detection and identification

of enterococci by reverse hybridization. Syst Appl Microbiol

23, 563–572.

Bej, A.K., Mahbubani, M.H. and Atlas, R.M. (1991) Detection

of viable Legionella pneumophila in water by polymerase

chain reaction and gene probe methods. Appl Environ

Microbiol 57, 597–600.

Bej, A.K., Ng, W.Y., Morgan, S., Jones, D.D. and Mahbubani,

M.H. (1996) Detection of viable Vibrio cholerae by

reverse-transcriptase polymerase chain reaction (RT-PCR).

Mol Biotechnol 5, 1–10.

Berthier, F. and Ehrlich, S.D. (1998) Rapid species identifica-

tion within two groups of closely related lactobacilli using

PCR primers that target the 16S ⁄ 23S rRNA spacer region.

FEMS Microbiol Lett 161, 97–106.

Blaiotta, G., Pepe, O., Mauriello, G., Villani, F., Andolfi, R.

and Moschetti, G. (2002) 16S-23S rDNA intergenic spacer

region polymorphism of Lactococcus garvieae, Lactococcus

raffinolactis and Lactococcus lactis as revealed by PCR and

nucleotide sequence analysis. Syst Appl Microbiol 25, 520–

527.

Boyer, S.L., Flechtner, V.R. and Johansen, J.R. (2001) Is the 16S-

23S rRNA internal transcribed spacer region a good tool for

use in molecular systematics and population genetics? A

case study in cyanobacteria Mol Biol Evol 18, 1057–1069.

Call, D.R., Borucki, M.K. and Loge, F.J. (2003) Detection of

bacterial pathogens in environmental samples using DNA

microarrays. J Microbiol Methods 53, 235–243.

Cangelosi, G.A. and Brabant, W.H. (1997) Depletion of pre-

16S rRNA in starved Escherichia coli cells. J Bacteriol 179,

4457–4463.

Cangelosi, G.A., Brabant, W.H., Britschgi, T.B. and Wallis,

C.K. (1996) Detection of rifampin- and ciprofloxacin-resis-

tant Mycobacterium tuberculosis by using species-specific

assays for precursor rRNA. Antimicrob Agents Chemother

40, 1790–1795.

Chelack, B.J. and Ingledew, W.M. (1987) Anaerobic gram-neg-

ative bacteria in brewing – a review. J Am Soc Brew Chem

45, 123–127.

Chen, H., Lim, C.K., Lee, Y.K. and Chan, Y.N. (2000) Com-

parative analysis of the genes encoding 23S-5S rRNA inter-

genic spacer regions of Lactobacillus casei-related strains.

Int J Syst Evol Microbiol 50, 471–478.

Chiang, Y.C., Yang, C.Y., Li, C., Ho, Y.C., Lin, C.K. and Tsen,

H.Y. (2006) Identification of Bacillus spp., Escherichia coli,

Salmonella spp., Staphylococcus spp. and Vibrio spp. with

16S ribosomal DNA-based oligonucleotide array hybridiza-

tion. Int J Food Microbiol 107, 131–137.

Chihib, N.E. and Tholozan, J.L. (1999) Effect of rapid cooling

and acidic pH on cellular homeostasis of Pectinatus frising-

ensis, a strictly anaerobic beer-spoilage bacterium. Int J

Food Microbiol 48, 191–202.

Oligonucleotide microarrays D.G. Weber et al.

960 Journal compilation ª 2008 The Society for Applied Microbiology, Journal of Applied Microbiology 105 (2008) 951–962

ª 2008 The Authors

Cho, J.C. and Tiedje, J.M. (2001) Bacterial species determina-

tion from DNA–DNA hybridization by using genome frag-

ments and DNA microarrays. Appl Environ Microbiol 67,

3677–3682.

De Man, J.C., Rogosa, M. and Sharpe, M.E. (1960) A medium

for the cultivation of lactobacilli. J Appl Bacteriol 23,

130–135.

Doktycz, M.J., Morris, M.D., Dormady, S.J., Beattie, K.L. and

Jacobson, K.B. (1995) Optical melting of 128 octamer DNA

duplexes. Effects of base pair location and nearest neighbors

on thermal stability. J Biol Chem 270, 8439–8445.

Drobyshev, A., Mologina, N., Shik, V., Pobedimskaya, D.,

Yershov, G. and Mirzabekov, A. (1997) Sequence analysis

by hybridization with oligonucleotide microchip: identifi-

cation of beta-thalassemia mutations. Gene 188, 45–52.

Eisen, M.B. and Brown, P.O. (1999) DNA arrays for analysis

of gene expression. Methods Enzymol 303, 179–205.

Engelmann, U., Weiss, N. and Mackey, B.M. (1985) Mega-

sphaera cerevisiae sp. nov.: a new gram-negative obligately

anaerobic coccus isolated from spoiled beer. Syst Appl

Microbiol 6, 287–290.

Flint, J.F. and Angert, E.R. (2005) Development of a strain-

specific assay for detection of viable Lactobacillus sp.

HOFG1 after application to cattle feed. J Microbiol Meth-

ods 61, 235–243.

Forget, B.G. and Jordan, B. (1970) 5S RNA synthesized by

Escherichia coli in presence of chloramphenicol: different

5’-terminal sequences. Science 167, 382–384.

Fox, G.E., Wisotzkey, J.D. and Jurtshuk, P. Jr. (1992) How

close is close: 16S rRNA sequence identity may not be suf-

ficient to guarantee species identity. Int J Syst Bacteriol 42,

166–170.

Gurtler, V. and Stanisich, V.A. (1996) New approaches to typ-

ing and identification of bacteria using the 16S-23S rDNA

spacer region. Microbiology 142, 3–16.

Heiskanen, M.A., Bittner, M.L., Chen, Y., Khan, J., Adler, K.E.,

Trent, J.M. and Meltzer, P.S. (2000) Detection of gene

amplification by genomic hybridization to cDNA micro-

arrays. Cancer Res 60, 799–802.

Hurt, R.A., Qiu, X., Wu, L., Roh, Y., Palumbo, A.V., Tiedje,

J.M. and Zhou, J. (2001) Simultaneous recovery of RNA

and DNA from soils and sediments. Appl Environ Micro-

biol 67, 4495–4503.

Jespersen, L. and Jakobsen, M. (1996) Specific spoilage organ-

isms in breweries and laboratory media for their detection.

Int J Food Microbiol 33, 139–155.

Jin, L.Q., Li, J.W., Wang, S.Q., Chao, F.H., Wang, X.W. and

Yuan, Z.Q. (2005) Detection and identification of intestinal

pathogenic bacteria by hybridization to oligonucleotide

microarrays. World J Gastroenterol 11, 7615–7619.

Keramas, G., Bang, D.D., Lund, M., Madsen, M., Rasmussen,

S.E., Bunkenborg, H., Telleman, P. and Christensen, C.B.

(2003) Development of a sensitive DNA microarray suit-

able for rapid detection of Campylobacter spp. Mol Cell

Probes 17, 187–196.

Klein, P.G. and Juneja, V.K. (1997) Sensitive detection of via-

ble Listeria monocytogenes by reverse transcription-PCR.

Appl Environ Microbiol 63, 4441–4448.

Leblond-Bourget, N., Philippe, H., Mangin, I. and Decaris,

B. (1996) 16S rRNA and 16S to 23S internal transcribed

spacer sequence analyses reveal inter- and intraspecific

Bifidobacterium phylogeny. Int J Syst Bacteriol 46,

102–111.

Lin, M.C., Huang, A.H., Tsen, H.Y., Wong, H.C. and Chang,

T.C. (2005) Use of oligonucleotide array for identification

of six foodborne pathogens and Pseudomonas aeruginosa

grown on selective media. J Food Prot 68, 2278–2286.

Lindahl, T. (1993) Instability and decay of the primary struc-

ture of DNA. Nature 362, 709–715.

Liu, W.T., Mirzabekov, A.D. and Stahl, D.A. (2001) Optimiza-

tion of an oligonucleotide microchip for microbial identifi-

cation studies: a non-equilibrium dissociation approach.

Environ Microbiol 3, 619–629.

Loughney, K., Lund, E. and Dahlberg, J.E. (1982) tRNA genes

are found between 16S and 23S rRNA genes in Bacillus

subtilis. Nucleic Acids Res 10, 1607–1624.

March, C., Manclus, J.J., Abad, A., Navarro, A. and Montoya,

A. (2005) Rapid detection and counting of viable beer-

spoilage lactic acid bacteria using a monoclonal chemilu-

minescence enzyme immunoassay and a CCD camera.

J Immunol Methods 303, 92–104.

Masters, C.I., Shallcross, J.A. and Mackey, B.M. (1994) Effect

of stress treatments on the detection of Listeria monocyto-

genes and enterotoxigenic Escherichia coli by the polymer-

ase chain reaction. J Appl Bacteriol 77, 73–79.

Maynard, C., Berthiaume, F., Lemarchand, K., Harel, J.,

Payment, P., Bayardelle, P., Masson, L. and Brousseau, R.

(2005) Waterborne pathogen detection by use of oligonu-

cleotide-based microarrays. Appl Environ Microbiol 71,

8548–8557.

McKillip, J.L., Jaykus, L.A. and Drake, M. (1998) rRNA stabil-

ity in heat-killed and UV-irradiated enterotoxigenic

Staphylococcus aureus and Escherichia coli O157:H7. Appl

Environ Microbiol 64, 4264–4268.

Nakagawa, T., Shimada, M., Mukai, H., Asada, K., Kato, I.,

Fujino, K. and Sato, T. (1994) Detection of alcohol-toler-

ant hiochi bacteria by PCR. Appl Environ Microbiol 60,

637–640.

Nelson, P.T., Baldwin, D.A., Scearce, L.M., Oberholtzer, J.C.,

Tobias, J.W. and Mourelatos, Z. (2004) Microarray-based,

high-throughput gene expression profiling of microRNAs.

Nat Methods 1, 155–161.

Nour, M. (1998) 16S-23S and 23S-5S intergenic spacer regions

of lactobacilli: nucleotide sequence, secondary structure

and comparative analysis. Res Microbiol 149, 433–448.

Nubel, U., Schmidt, P.M., Reiss, E., Bier, F., Beyer, W. and

Naumann, D. (2004) Oligonucleotide microarray for iden-

tification of Bacillus anthracis based on intergenic tran-

scribed spacers in ribosomal DNA. FEMS Microbiol Lett

240, 215–223.

D.G. Weber et al. Oligonucleotide microarrays

ª 2008 The Authors

Journal compilation ª 2008 The Society for Applied Microbiology, Journal of Applied Microbiology 105 (2008) 951–962 961

Oerther, D.B., Pernthaler, J., Schramm, A., Amann, R. and

Raskin, L. (2000) Monitoring precursor 16S rRNAs

of Acinetobacter spp. in activated sludge wastewater

treatment systems. Appl Environ Microbiol 66,

2154–2165.

Pace, N.R. (1973) Structure and synthesis of the ribosomal

ribonucleic acid of prokaryotes. Bacteriol Rev 37, 562–603.

Patel, B.K., Banerjee, D.K. and Butcher, P.D. (1993) Determi-

nation of Mycobacterium leprae viability by polymerase

chain reaction amplification of 71-kDa heat-shock protein

mRNA. J Infect Dis 168, 799–800.

Polen, T. and Wendisch, V.F. (2004) Genomewide expression

analysis in amino acid-producing bacteria using DNA

microarrays. Appl Biochem Biotechnol 118, 215–232.

Polen, T., Rittmann, D., Wendisch, V.F. and Sahm, H. (2003)

DNA microarray analyses of the long-term adaptive

response of Escherichia coli to acetate and propionate. Appl

Environ Microbiol 69, 1759–1774.

Relogio, A., Schwager, C., Richter, A., Ansorge, W. and

Valcarcel, J. (2002) Optimization of oligonucleotide-based

DNA microarrays. Nucleic Acids Res 30, e51.

Rozen, S. and Skaletsky, H. (2000) Primer3 on the WWW for

general users and for biologist programmers. Methods Mol

Biol 132, 365–386.

Schena, M., Shalon, D., Davis, R.W. and Brown, P.O. (1995)

Quantitative monitoring of gene expression patterns with

a complementary DNA microarray. Science 270, 467–470.

Schmid, M., Schmitz-Esser, S., Jetten, M. and Wagner, M.

(2001) 16S-23S rDNA intergenic spacer and 23S rDNA of

anaerobic ammonium-oxidizing bacteria: implications for

phylogeny and in situ detection. Environ Microbiol 3,

450–459.

Schuchhardt, J., Beule, D., Malik, A., Wolski, E., Eickhoff, H.,

Lehrach, H. and Herzel, H. (2000) Normalization strategies

for cDNA microarrays. Nucleic Acids Res 28, E47.

Shalon, D., Smith, S.J. and Brown, P.O. (1996) A DNA micro-

array system for analyzing complex DNA samples using

two-color fluorescent probe hybridization. Genome Res 6,

639–645.

Sheridan, G.E., Masters, C.I., Shallcross, J.A. and MacKey,

B.M. (1998) Detection of mRNA by reverse transcription-

PCR as an indicator of viability in Escherichia coli cells.

Appl Environ Microbiol 64, 1313–1318.

Small, J., Call, D.R., Brockman, F.J., Straub, T.M. and

Chandler, D.P. (2001) Direct detection of 16S rRNA in

soil extracts by using oligonucleotide microarrays. Appl

Environ Microbiol 67, 4708–4716.

Song, Y., Kato, N., Liu, C., Matsumiya, Y., Kato, H. and

Watanabe, K. (2000) Rapid identification of 11 human

intestinal Lactobacillus species by multiplex PCR assays

using group- and species-specific primers derived from the

16S-23S rRNA intergenic spacer region and its flanking

23S rRNA. FEMS Microbiol Lett 187, 167–173.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. and

Higgins, D.G. (1997) The CLUSTAL_X windows interface:

flexible strategies for multiple sequence alignment aided by

quality analysis tools. Nucleic Acids Res 25, 4876–4882.

Weiler, J., Gausepohl, H., Hauser, N., Jensen, O.N. and Hohei-

sel, J.D. (1997) Hybridisation based DNA screening on

peptide nucleic acid (PNA) oligomer arrays. Nucleic Acids

Res 25, 2792–2799.

Wildsmith, S.E., Archer, G.E., Winkley, A.J., Lane, P.W. and

Bugelski, P.J. (2001) Maximization of signal derived from

cDNA microarrays. Biotechniques 30, 202–206.

Yansanjav, A., Svec, P., Sedlacek, I., Hollerova, I. and Nemec,

M. (2003) Ribotyping of lactobacilli isolated from spoiled

beer. FEMS Microbiol Lett 229, 141–144.

Yershov, G., Barsky, V., Belgovskiy, A., Kirillov, E., Kreindlin,

E., Ivanov, I., Parinov, S., Guschin, D. et al. (1996) DNA

analysis and diagnostics on oligonucleotide microchips.

Proc Natl Acad Sci USA 93, 4913–4918.

Zheng, D., Alm, E.W., Stahl, D.A. and Raskin, L. (1996) Char-

acterization of universal small-subunit rRNA hybridization

probes for quantitative molecular microbial ecology stud-

ies. Appl Environ Microbiol 62, 4504–4513.

Zhou, J., Bruns, M.A. and Tiedje, J.M. (1996) DNA recovery

from soils of diverse composition. Appl Environ Microbiol

62, 316–322.

Oligonucleotide microarrays D.G. Weber et al.

962 Journal compilation ª 2008 The Society for Applied Microbiology, Journal of Applied Microbiology 105 (2008) 951–962

ª 2008 The Authors