J. Inher. Metab. Dis. 18 (1995) 567-576 �9 SSIEM and Kluwer Academic Publishers. Printed in the Netherlands

Mutations in the galactose-l-phosphate uridyltransferase gene of two families with mild galactosaemia variants M. SOMMER 1, B. S. GATHOF 2, T. PODSKARBI 3, R. GIUGLIANI l, B. KLEINLEIN 4 and Y. S. SHIN 4.

~Medical Genetics Unit, HCPA, Porto Alegre, Brazil; 2Medizinische Poliklinik, Munich; 3Medizinisch Immunologische Laboratorien, Munich; 4Children's Hospital, University of Munich, Munich, Germany

*Correspondence: University Children's Hospital, Lindwurmstr. 4, 80337 Miinchen, Germany

MS received 6.01.95 Accepted 31.05.95

Summary: Classical galactosaemia, deficiency of galactose-l-phosphate uridyl- transferase (GALT), is characterized by acute symptoms of hepatomegaly, jaundice, sepsis, cataracts and growth retardation. Treatment with dietary galactose restriction corrects these complications immediately; however, most of these children develop long-term complications of verbal dyspraxia, mental retardation and ovarian failure. Our previous molecular study showed that the most common mutation of the GALT gene is a missense mutation of Q 188R (replacement of glutamine-188 by arginine) in approximately 60-65% of the German galactosaemic population. The coding region of GALT was amplified by the polymerase chain reaction from genomic DNA of classical galactosaemic individuals, who are negative or heterozygous for Q 188R, and was further characterized by direct sequencing. Three new disease-causing mutations, two missense and a stop codon mutation, were identified in three patients from two families with mild galactosaernic variants: firstly R67C, replacement of arginine-67 by cysteine and W316X, the Stop codon at tryptophan-316 in one male; secondly A330V, replacement of alanine-330 by valine in two female siblings. In the first family the patient was also heterozygous for the polymorphism N314D and in the second family both girls were compound heterozygotes for Q188R and A330V. All three galactosaemic individuals have a considerable amount of the residual GALT activity in RBC and the galactose-l-phosphate (GALP) level decreased much faster on treatment than that of other galactosaemic patients with missense mutations such as Q188R. The clinical and biochemical data of these patients were much more favourable in comparison with those of two female galactosaemic individuals, one homozygous for L195P and the other compound heterozygous for Q188R and L195P. These three missense mutations (R67C, L195P and A330V) also occur in highly conserved regions. These observations suggest that the phenotypic variation in galactosaemic individuals may be due to different molecular aetiologies.

567

568 Sommer et al.

The galactose-l-phosphate uridyltransferase (GALT) gene is a compact gene with 11 exons spanning about 4 kilobases of genomic DNA (Leslie et al 1992). Several disease- causing mutations and polymorphisms have been reported (Reichardt and Woo 1991; Leslie et al 1992; Reichardt 1992; Reichardt et al 1992a, 1992b; Elsas et al 1994; Elsas et al 1995). The most common mutation in the Caucasian population is Q 188R (replacement of glutamine-188 by arginine) which is found in 60-65% of galactosaemia alleles (Leslie et al 1992; Ng et al 1994; Podskarbi et al 1994a). The most common polymorphism N314D has generally been known to encode the Duarte variants (Elsas et al 1994; Podskarbi et al 1994a). Our previous study suggested that patients homozygous for Q188R showed late-onset manifestations of hypogonadism, speech impairment, neurological disturbances and delayed bone maturity (Podskarbi et al 1994b).

Recently we have observed three other galactosaemia missense mutations in three patients with a mild galactosaemia variant (Shin et al 1995). All three have a considerable amount of residual GALT activity in RBC and their galactose-1-phosphate (GALP) values decreased promptly on treatment, reaching the normal level within 2 years of age. They are still too young at 5 - 8 years of age to show the long-term complications of galactosaemia; however, their general clinical status is completely normal at present. In this report we describe another two new missense mutations (R67C and A330V), a stop codon mutation W316X in three patients and a previously reported mutation L 195P (Reichardt et al 1992b) in two female patients. The male infant in the first family was compound heterozygous for R67C and W316X. He was also heterozygous for the N314D polymorphism. Two females in the second family were compound heterozygous for Q188R and A330V. The biochemical and clinical parameters of the three patients are much more favourable compared with those of missense mutations such as Q188R (Kaufman et al 1994;Podskarbi et al 1994b), R333W (Podskarbi et al 1994) and L195P (Re ichardt et al 1992b). The outcomes in patients with stop codon mutations G212X and E340X (Gathof et al 1995) are much worse than in those patients with any of the missense mutations mentioned above.

MATERIALS AND METHODS

DNA isolation and polymerase chain reaction (PCR): Genomic DNAs were prepared from 200#1 EDTA blood using the QIA Amp kit (Qiagen Inc., Germany). The PCR ampli- cation of genomic DNA was done using 0.3/.tg DNA, 1U Taq DNA-polymerase (Perkin- Elmer; Germany) and 30pmol of each primer (2-5 ' : GGAGCTCTGAGGACTGATC; 2 - 3': GTTCTAAGAGGGAACTACTC; 7 - 5 ' : CAATGATGTGGAGGCTTGG; 7 -3 ' : GAAAGTTAGGGACTCCTTG; 10-5': GGGTTTGGGAGTAGGTGCT; 10-3': GGGC- AACAGAAGTCAGGT). The PCR products were digested by the restriction enzymes AciI (New England Biolabs, Germany) for R67C and BsiYI (Boehringer-Mannheim, Germany) for A330V.

Single-strand conformation polymorphism (SSCP) analysis: The PCR product was denatured in 95% formaldehyde at 95~ for 5 min and subjected to SSCP analysis by 15% polyacrylamide gel non-denaturing electrophoresis. The gels were stained with 0.1% silver nitrate solution for 30min and developed in a solution containing NaOH, sodium borohydride and formaldehyde.

J. lnher. Metab. Dis. 18 (1995)

Mutations in the galactose-l-phosphate uridyltransferase gene 569

Sequencing and amplification: The primers for amplification of the fragments containing exons 1 to 6 and 7 to 10 were 5'-BIOTIN-GGTGGCCTCATGTCGCGC and 3'-CACAG- TGCTGGCTCAGACTC for exons 1 -6 and 5'-BIOTIN-CAATGATGGAGGCTTGG and 3'-GGGCAACAGAAGTATCAGGT for exons 7-10. The amplified products were purified using a Geneclean II kit (BIO 101, La Jolla, CA, USA) to remove the primers and further immobilized with magnetic beads coated with streptavidin (Dynal, Hamburg, Germany). These were directly sequenced by the dideoxy termination method of Sanger et al (1977) with Sequenase 2.0 from USB (Amersham, Braunschweig, Germany) using the 3' primers of each exon.

Biochemical analysis: The galactose-1-phosphate uridyltransferase (GALT) activity and the concentration of galactose-1-phosphate (GALP) and UDP-hexose (glucose and galactose) were determihedas described before (Shin 1991, 1995).

PATIENTS

Patient 1: B.A. is a 9-month-old German male, the third child of a healthy father and a mother with rheumatism since 1989. He was a hyperbilirubinaemic floppy infant and galactosaemia was detected by newborn screening. At 10 days of age dietary treatment was begun and since then he has remained free of any complication.

Patient 2: A.B. is a 27-year-old female, the second child of healthy German parents. The first child died of galactosaemia in the newborn period and she was therefore diagnosed and treated immediately after birth. She has ovarian insufficiency which developed at puberty. Her verbal-DQ and IQ is slightly below 85 (Schweitzer et al 1993).

Patient 3: M.S. is a 15-year-old German female of healthy German parents. She was admitted to hospital at the age of 10 days with jaundice and hepatomegaly and weight loss. The diagnosis was made by the clinical symptoms of hyperbilirubinaemia and vomiting which was reversed by a lactose-free diet started relatively late at 3 months of age. She shows mild speech impairment, but otherwise does not show any galactosaemia-related complications at present.

Patient 4: H.J. is a 7.5-year-old German female of healthy parents, in whom galactosaemia was detected by the newborn galactosaemia screening. She presented with hyperbilirubin- aemia and was treated with a galactose-free diet at 10 days of age. Clinically she is healthy and developing well.

Patient 5: H.N. is the 5.5-year-old sister of patient 4 (H.J.). Her mother was maintained on a galactose reduced diet during the pregnancy and the patient was also treated immediately after birth. She has never had any galactosaemia-related symptoms and develops normally.

RESULTS

Biochemical parameters: A considerable residual GALT activity in RBC was found in patients 1, 4 and 5. On the other hand, no detectable RBC GALT activity was found in

J. lnher. Metab. Dis. 18 (1995)

570

Table 1 Biochemical data and genotype data of galactosaemie patients

S o m m e r et al.

Patient Age ~ GALP ~ UDP-hexose ~ GAL7 ~ Genotype

1 (B.A.) 8 m 1.0 0.25 1.5 R67C/N314D/W316X (+/-)

2 (A.B.) 28 y 1.6 0.22 0 L195P (+/+) 3 (M.S.) 15 y 2.8 0.23 0 L195P (+/-) 4 (H.J.) 7 y 0.4 0.29 2.5 Q 188R/A330V (+/-) 5 (H.N.) 5y 0.3 0.30 2.5 Q188R/A330V (+/-) Q188R 8 - 2 0 y 1.8-3.0 0.17-0.23 Q188R (+/+) Normal 1 -50y 0-0.3 0.25-0.50 Wild type

~y = year; m = month ~mg/dl RBC r Hb aln RBC, expressed as percentage of normal activity

~ ', %:....:~:~,.

�9 :.:..!:.::::.::::-~:~::-:~,

, . .:~-:'%%~:~--!;y~;~::::-~ \ I ~'::::~.~::':" ':'::::':':::::~:~5:' %::':#:~:::-;. :.':,. ~

\ ', ~':"<':~':~Y':"~':~5"~'.+":~.'.':::~.." : - ~ ' " ~ . - : ~ x.S. , �9 '" ':. "::'::':':. "~- ": :':,2." ;:::::~:'-::~-:':.'(~.::~: ~r '. --§ ~ ~__~. a . . ~ . . "'.': ;::'.: �9 :<-:<:6'.-:'.': :..:...'.. :. ".~'..." :'.' .:.' .:.'-:." .:..~ .': .: ::::: .:..' .:.. �9 �9 ,~ ~ - - ~ . "'""*"~:'"~::.:'~'~::;:::9:!.'~':.':'~%"-";':.~-~i

~ ~ * " �9 ..... " ~ ' - ' 1 - - I - - _ . " . . . . . . . . . .

AGE

F i g u r e 1 Decrease in the galactose-l-phosphate (GALP) concentration in RBC of galactosaemic patients with age. The shaded area represents values from galactosaemic patients homozygous for Q188R (n=35). k , patient 1 (B.A.); II, patient 4 (H.J.); 0 , patient 5 (H.N.)

patients 2 and 3 (Table 1). The GALP levels in RBC are inversely correlated with the residual GALT activity, showing much lower age-matched GALP levels in patients 1, 4 and 5. UDP-hexose values are also normal in these patients (Table 1). The decrease in the GALP level with age is much faster in these groups than in the patients homozygous for Q188R (Figure I), even though GALP levels during the newborn period were still quite high. It is interesting to note that the GALP level in patient 5, whose mother restricted milk intake during pregnancy, is lower than that in the older sibling (Figure 1). Concerning the

J. Inher. Metab. Dis. 18 (1995)

Mutations in the galactose-l-phosphate uridyltransferase gene

Table 2 Biochemical and molecular data of the family of patient 1

571

Mutation GALT activity

Member (/tmol/h per g Hb) N314D W316X R67C Q188R

Patient 1 0.4 +/- +/- +/- - / - Father 12.8 - / - - / - +/- - / - Mother 14.0 +/- +/- - / - - / - Sister 13.8 +/- +/- - / - - / - Duarte 1 -galactosaemia 13-15 +/- - / - - / - +/- Duarte 2 - galactosaemia 3.5- 6 +/- - / - - / - +/- N-Galactosaemia 9 -13 - / - - / - - / - +/- N-N *a 20-30 - / - - / - - / - - / -

~*= wild type

Figure 2 SSCP analysis of the PCR-amplified fragment of exon 7 of the GALT gene. Lanes 1 and 4 are normal individuals; lane 2 is patient 3 (M.S.); lane 3 is patient 2 (A.B.). The direct sequencing analysis showed that patient 2 is homozygous and patient 3 is heterozygous for L195P. Nevertheless, both SSCP patterns are identical. The arrow indicates a unique band suggesting sequence variation

heterozygotes of the family of patient 1, the GALT activities in the mother and the sister were found to be somewhat higher than that in the father (Table 2).

SSCP analysis: For patients 2 and 3, changes in the SSCP pattern of exon 7 (L195P) were clearly seen (Figure 2); however, those of exon 2 (R67C) and exon 10 (A330V) were not distinct from that of the wild type (data not shown).

Sequence analysis: As shown in Figure 3a, a C-to-A transition at nucleotide 507 replaces the amino acid arginine-67 by cysteine (R67C) in patient 1. He and his father were heterozygous for R67C. From the proband and the mother, the termination of the amino acid at 316 through a G-to-A transition at nucleotide 2751 was found (Figure 3b). In the same figure an A-to-G transition at nucleotide 2744 changing the amino acid asparagine to aspartate (the N314D polymorphism) is also shown. The proband and the mother were

J. lnher. Metab. Dis. 18 (1995)

572 S o m m e r et al.

J. lnher. Memb. Dis. 18 (1995)

Mutations in the galactose-l-phosphate uridyltransferase gene

1 2 3 4 5 1 2 3 4

573

(a) (b)

, 1 7 2 . .228 - - 115 "--- 167 - - - 5 7 "-- 79

" '"61 Figure 4 Ethium bromide-stained agarose gel containing the PCR-amplified exon 2 (a) and exon 10 (b) of the GALT gene. (a) Restriction with AciI for examination of the R67C mutation. Lanes 1 and 5 are markers; lane 2 is patient 1 (B.A.) and lane 3 is his father with 172, 115 and 57 base pair fragments; lane 4 is a normal individual with 115 and 57 base pair fragments. Patient 1 and his father show three bands with 172, 115 and 57 base pair fragments, which is characteristic for the heterozygous state. (b) Restriction with BsiYl for examination of the A330V mutation. Lane 1 is a normal control with 375, 292 and 264 base pair fragments; lane 2 is patient 5 (H.J.~ with 436, 375,292 and 264 base pair fragments, which is characteristic for the heterozygous status for this mutation; lane 3 is a marker

heterozygous for W316X and for the N314D polymorphism (Figure 3b). In patients 2 and 3, a T-to-C transition at nucleotide 1653 replaced the amino acid leucine-195 by proline (L195P). Patient 2 is homozygous for L195P and patient 3 is heterozygous for L195P (Figure 3c). As shown in Figure 3d, a C-to-T transition at nucleotide 2793 replaced the amino acid alanine-330 by valine (A330V) in patient 4. Patients 4 and 5 were compound heterozygotes for A330V and Q188R (data not shown).

Restriction enzyme analysis: The R67C mutation, which was verified by digestion of the PCR products with AciI was in a heterozygous state in patient 1 and his father (Figure 4a). The mother and the sister were negative for the R67C mutation (data not shown), but heterozygous for the N314D polymorphism like the index patient (Table 2). The A330V mutation was checked by restriction with BsiYI, and patient 5 was found to be heterozygous (Figure 4b).

Figure 3 (Opposite) Autoradiograms of direct sequencing of the PCR-amplified exon 2 (a), exon 10 (b), exon 7 (c) and exon 10 (d) of the GALT gene. (a) The sequence of patient 1 (B.A.) is for codons of amino acids numbered 66-69. The arrow indicates the single base substitution of a C to a T in one of the proband alleles. The mutation changes arginine-67 to cysteine (R67C) (b) The sequence of patient 1 (B.A.) and his mother is for codons of amino acids numbered 313-317. The arrows indicate the single base substitution of A to G at nucleotide 2744 and of G to A at nucleotide 2751 in one of the proband's and the mother's alleles. These lead to a change of asparagine-314 to aspartate (N314D) and a termination at tryptophan-316 (W316X), respectively. (c) The sequence of patient 2 (A.B.) and patient 3 (M.S.) is for codons of amino acids numbered 194-196. The arrow indicates the single base substitution of a T to a C in the proband alleles. This leads to a change of leucine-195 to proline. Lane 1 is a normal individual; lane 2 is patient 3 (M.S.), who is heterozygous for L195P; lane 3 is patient 2 (A.B.) who is homozygous for L195P. (d) The sequence of patient 4 (H.J.) here is for codons of amino acids numbered 329-331. The arrow indicates the single base substitution of a C to a T in one of the proband alleles. This leads to a change of alanine-330 to valine

J. Inher. Metab. Dis. 18 (1995)

574 Sommer et aL

cys phe his pro his

c p v H. sapiens tvPrHDP sSFLPdi LRSATVR E. coli vlPaHDP nSFLPnE LRSATVR S. cerevisiae taPlyDP lesiPsE LRSATVR

R67C LI95P A330V

COOH

Figure 5 Homology analysis for three galactosaemia mutations. Upper-case residues are conserved in two species, and bold-face letters denote residues identical in all three organisms. Putative active-site residues are indicated and the active-site nucleophile is in italic letters

Homology analysis: The sequences surrounding all three substitutions in the homologous enzymes gaiT from E. coli (Lemaire and M011er-Hill 1986) and from bakers' yeast (Tajima et al 1985) and GALT from humans (Leslie et al 1992) were compared (Figure 5). Alanine- 330 is well conserved in all three species; however, arginine-67 and leucine-195 are not conserved domains. There is, however, some homology surrounding these amino acids.

DISCUSSION

Molecular characterization and expression analyses of various galactosaemia mutations and polymorphisms have been studied (Reichardt and Woo 1991; Leslie et al 1992; Reichardt 1992; Reichardt et al 1992a, 1992b; Elsas et al 1994, 1995). However, reports concerning the correlation of the different mutations with the clinical and biochemical data of the patients have been scarce. We describe here two new missense mutations and a new stop codon mutation in three German patients whose biochemical data and clinical course are much more favourable than those in galactosaemic individuals with stop codon mutations (Gathof et al 1995) or other missense mutations such as Q188R (Kaufman et al 1994; Podskarbi et al 1994b) or L195P (Reichardt et al 1992b). Biochemical parameters (a residual GALT activity in RBC and a prompt decrease in the GALP levels on treatment) in the patients with A330V indicate that they have a mild variant form of galactosaemia. Concerning the first family with R67C and W316X, we first speculated that R67C might be the cause for the mild clinical course in this patient. However, a somewhat higher GALT activity in the mother and the sister (heterozygous for N314D and W316X) than in the father (heterozygous for R67C) led us to speculate that the stop codon (W316X) might be the major cause for encoding the mild variant. The coexistence of the stop codon and the neighbouring N314D polymorphism may compensate for the complete loss of the activity. The overexpressed GALT activity of the N314D polymorphism has been shown to be about 130% of normal (Reichardt and Woo 1991).

We have also observed a relatively low but measurable residual GALT activity in a 3- year-old boy heterozygous for Q188R, N314D and W316X (unpublished observation). Clinically all three patients currently are free of galactosaemia-related complications. On the other hand, the patients homozygous for Q188 or L195P have no residual GALT activity and relatively high GALP levels (Table 1 and Figure 1). Clinically these patients with

J. lnher. Metab. Dis. 18 (1995)

Mutations in the galactose-l-phosphate uridyltransferase gene 575

Q188R or L195P exhibit long-term complications of galactosaemia. These results imply that the R67C mutation and/or W316X together with N314D and the A330V mutation encode a mild galactosaemia. Kaufman and colleagues (1994) reported little correlation between the genotype and phenotype in classical galactosaemia. The results shown here as well as our observations of stop codon mutations of the GALT gene (Gathof et al 1995) suggest that it may be possible to predict the outcome of some galactosaemic patients through molecular analysis. For this, however, we need an internationally based longitudinal study to assess outcome and a genotype-phenotype correlation.

A C K N O W L E D G E M E N T S

The authors gratefully acknowledge Drs I. Berkefeld of D~isseldorf, C. Renner of Erlangen, van Hasselt of Korschenbroich, and A. Klar of Kassel for providing clinical data and the blood samples. M. Sommer is a grantee of Brazilian National Research Foundation.

REFERENCES

Elsas LJ, Dembure PP, Langley S, Paulk EM, Hjelm LN, Friedovich-Keil J (1994) A common mutation associated with the Duarte galactosemia allele. Am J Hum Genet 54: 1030-1036.

Elsas LJ, Langley S, Steele E, et al (1995) Galactosemia: a strategy to identify new biochemical phenotypes and molecular genotypes. Am J Hum Genet 56: 630-639.

Gathof BS, Sommer M, Podskarbi T, et al (1995) Characterization of two stop codon mutations in the galactose-l-phosphate uridyltransferase gene of three male galactosemic patients with severe clinical manifestation. Hum Genet, in press.

Kaufman FR, Reichardt JKV, Ng WG, Manis FR, Mcbride-Chang C, Wolff JA (1994) Correlation of cognitive, neurologic and ovarian outcome with the Q188R mutation of the galactose-l- phosphate uridyltransferase gene. J Pediatr 125: 225-227.

Lemaire HG, Miiller-Hill B (1986) Nucleotide sequences of GALE gene and the GAL T gene of E. coli. Nucleic Acids Res 14:7705-7711.

Leslie ND, Immerman EB, Flach JE, Florez M, Friedovich-Keil JL, Elsas LJ (1992) The human galactose-1-phosphate uridyltransferase gene. Genomics 14: 474-480.

Ng WG, Xu YK, Kaufman FR, et al (1994) Biochemical and molecular studies of 13 patients with galactosemia. Hum Genet 94: 359-363.

Podskarbi T, Reichardt J, Shin YS (1994a) Studies of DNA in galactose-l-phosphate uridyltrans- ferase deficiency and the Duarte variant in Germany. J lnher Metab Dis 17: 149-150.

Podskarbi T, Shin YS, Reichardt J (1994b) Progress toward a genotype/phenotype correlation in classic galactosemia. Abstracts of the 32nd Annual Symposium of the SSIEM p. 201.

Reichardt JKV (1992) Genetic basis of galactosemia. Hum Mutat 1: 190-196. Reichardt JKV, Woo SLC (1991) Molecular basis of galactosemia: mutations and polymorphisms in

the gene encoding human galactose-1-phosphate uridyltransferase. Proc Natl Acad Sci USA 88: 2633-2637.

Reichardt JKV, Levy HL, Woo SLC (1992a) Molecular characterization of two galactosemia muta- tions and one polymorphism: Implication for structure-function analysis of human galactose-1- phosphate uridyltransferase. Biochemistry 31: 5430-5433.

Reichardt JKV, Belmont JW, Levy HL, Woo SLC (1992b) Characterization of two missense mutations in human GALT: different molecular mechanisms for galactosemia. Genomics 12: 596-600.

Sanger E Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci 74: 5434-5467.

Schweitzer S, Shin Y, Jakobs C, Brodehl J (1993) Long-term outcome in 134 patients with galacto- semia. Eur J Pediatr 152: 36-43.

Shin YS (1991) Galactose metabolism and disorders of galactose metabolism. In: Hommes FA, ed. Techniques in Diagnostic Human Biochemical Genetics. New York: Wiley-Liss, 267-283.

J. lnher. Metab. Dis. t8 (1995)

576 Sommer et al.

Shin YS (1995) Nucleotide sugars: determination of cellular levels and discrepancies in results. Eur J Pediatr 154: 75-76.

Shin YS, Gathof BS, Podskarbi T, S6mmer M, Giugliani R, Gresser U (1995) Three mutations in the galactose-l-phosphate uridyltransferase gene of three families with mild galactosemia. Eur J Pediatr, in press.

Tajima M, Nogi Y, Fukasawa T (1985) Primary structure of the Saccharomyces cerevisiae GAL7 gene. Yeast 1: 67-77.

SOCIETY FOR THE STUDY OF INBORN ERRORS OF METABOLISM

The SSIEM was founded in 1963 by a small group in the North of England but now has more than 70% of its members outside the UK. The aim of the Society is to promote the exchange of ideas between professional workers in different disciplines who are interested in inherited metabolic disorders. This aim is pursued in scientific meetings and publications.

The Society holds an annual symposium concentrating on different topics each year with facilities for poster presentations. There is always a clinical aspect as well as a laboratory component. The meeting is organized so that there is ample time for informal discussion; this feature has allowed the formation of a network of contacts throughout the world. The international and multidisciplinary approach is also reflected in the Journal o f Inheri ted Metabol ic Disease.

If you are interested in joining the SSIEM then contact the Treasurer: Dr J. R. Bonham, Department of Paediatric Chemical Pathology, Sheffield Children's Hospital (NHS) Trust, Sheffield, S10 2TH, UK. The subscription includes the 6 issues of the Journal o f Inheri ted Metabol ic Disease as well as the regular circulation of a newsletter.

J. lnher. Metab. Dis. 18 (1995)