An investigation into increased cases of idiopathic infantile ...

An investigation into increased cases of idiopathic infantile

hypercalcaemia

Lisa Anne Amato

A thesis in fulfilment of the requirements for the degree of

Master of Medicine

School of Women’s And Children’s Health

Faculty of Medicine

March 2019

Acknowledgements

iii

Acknowledgements It is with deepest gratitude that I would like to acknowledge a number of people who have

assisted me during the course of my candidature.

First and foremost, I would like to acknowledge the valuable input from my supervisor, Jan

Walker, who has worked tirelessly to assist me in the preparation of this study and writing of this

manuscript. Jan has been an inspirational mentor to me for many years and I have learnt so much

from her. She has fostered my interest in paediatric endocrinology and in the course of this work

has taught me to think critically and always ask the question ‘why?’. I am deeply indebted to her

for her time, patience and commitment.

I would like to thank my co-supervisor Kristen Neville who has also been an inspiring mentor to

me for many years and greatly assisted with this work. In particular Kristen has taught me the

importance of being organized and concise in both thinking and writing.

I am grateful for the expertise of Rory Clifton-Bligh and his team members Catherine Luxford and

Anne Richardson, at the Kolling Institute who provided the genetic testing for this project. I am

particularly grateful to Rory for sharing his passion for calcium genetics, his endless patience and

willingness to spend many hours answering my questions.

Acknowledgement should also be given to Helen Woodhead, Charles Verge, Shihab Hameed and

nursing staff from the Sydney Children’s Hospital Paediatric Endocrinology Department who

helped to provide guidance with this project and assisted with patient recruitment. In addition I

would like to thank Sean Kennedy and Adam Jaffe, both members of my supervising panel, who

guided and encouraged me through this process.

There were many people at SEALS Pathology who assisted me in gathering information for this

study. In particular I am grateful to Christopher White and Rita Horvath who helped me obtain

and interpret some of the information in the early days of this study. Alex Eigenstetter and Joanna

Stoj kindly sent me the many years of calcium data. Keith Westbury helped me to set up the

Acknowledgements

iv

blood collection for families, and both Teresa Hewlett and Christine Moffat helped me to obtain

detailed information regarding the calcium analysers.

I am grateful to Kylie Mallit, biostatistician, who has spent many hours looking at SPSS data sets

with me and helping me to interpret the statistical analyses in this study. I would also like to thank

medical student Wei Shern Quek for his assistance with data entry.

I owe a big thank you to the many doctors, allied health and administration staff at Campbelltown

Hospital who have provided support and encouragement and been willing to ‘hold the fort’ whilst

I took the time to finish writing up this work.

Of course, no study would be possible without the patients who agree to take part, and so I would

like to extend a huge thank you to the parents and children who kindly participated in this study.

I would also like to thank my wonderful family and friends, in particular my parents, June and

Maurice Amato, my sister Naomi, brother in law and nephews, who have supported me

throughout this project and my entire medical career. Thank you for teaching me to work hard

and for always cheering me on.

Lastly, I would like to make special mention of my wonderful partner, Todd McFarlane, who has

always encouraged me to follow my dreams. Thank you for believing in me and being so willing to

look after me and our home so that I could get this work completed.

Table of Contents

v

Table of Contents

Originality Statement .......................................................................................................................... i

Inclusion of Publications Statement ................................................................................................... ii

Acknowledgements ........................................................................................................................... iii

Table of Contents ............................................................................................................................... v

List of Abbreviations .......................................................................................................................... vii

List of Tables ....................................................................................................................................... ix

List of Figures...................................................................................................................................... xi

List of Publications............................................................................................................................ xiii

Chapter 1 - Introduction ..................................................................................................................... 1

Chapter 2 – Review of Literature ....................................................................................................... 3

2.1. Calcium and Vitamin D Metabolism in the Foetus, Neonate and Infant ................................ 3

2.1.1. Calcium Metabolism in the Foetus ................................................................................... 3

2.1.2. Calcium Metabolism in the Neonate and Infant .............................................................. 4

2.1.3. Vitamin D Metabolism in the Neonate and Infant ........................................................... 5

2.2. Diagnosis and Treatment of Hypercalcaemia ......................................................................... 8

2.2.1. Laboratory Findings .......................................................................................................... 8

2.2.2. Clinical Findings .............................................................................................................. 10

2.2.3. Treatment of Hypercalcemia .......................................................................................... 10

2.3. Causes of Infantile Hypercalcaemia ...................................................................................... 12

2.3.1. Hypercalcaemia with High PTH ...................................................................................... 13

2.3.2. Hypercalcaemia with Normal or Low PTH ...................................................................... 14

2.4. Idiopathic Infantile Hypercalcaemia and Mutations in the CYP24A1 gene .......................... 18

2.5. Familial Hypocalciuric Hypercalcaemia and Mutations in the CASR, GNA11 or AP2S1 genes ...................................................................................................................................................... 21

2.6. Vitamin D Supplementation .................................................................................................. 24

2.6.1. Interest in Vitamin D ...................................................................................................... 24

2.6.2. Measurement of Vitamin D Reserve and Definition of Vitamin D deficiency ................ 24

2.6.3. Measurement of 1,25 Dihydroxyvitamin D .................................................................... 25

2.6.4. Vitamin D Supplementation in Infancy and Antenatally ................................................ 26

2.6.5. Vitamin D and the Calcium Content of Breast Milk ....................................................... 30

2.6.6. Vitamin D Conclusion ..................................................................................................... 30

2.7. Summary ............................................................................................................................... 31

Table of Contents

vi

Chapter 3 – Materials and Methods ................................................................................................ 32

3.1. Study Overview ..................................................................................................................... 32

3.2. Ethics ..................................................................................................................................... 32

3.3. Definitions ............................................................................................................................. 33

3.4. Subjects with Idiopathic Infantile Hypercalcaemia ............................................................... 34

3.5. Genetic Analysis .................................................................................................................... 37

3.6. Identification of Trends in Calcaemia in Infants .................................................................... 40

3.7. SEALs Laboratory Platforms .................................................................................................. 42

3.8. Statistical Analysis ................................................................................................................. 45

Chapter 4 – Results........................................................................................................................... 46

4.1. Sydney Children’s Hospital Idiopathic Infantile Hypercalcaemia Case Series 2008-2014 .... 46

4.1.1. Cases Series of Idiopathic Infantile Hypercalcaemia ...................................................... 46

4.1.2. Biochemistry of Patients with Idiopathic Infantile Hypercalcaemia .............................. 49

4.1.3. Management of Patients with Idiopathic Infantile Hypercalcaemia.............................. 52

4.1.4. High Parathyroid Hormone (PTH) During Treatment with Locasol™ ............................. 53

4.1.5. Outcome After Cessation of Locasol™ ........................................................................... 54

4.1.6. Genetic Results ............................................................................................................... 55

4.2. Analysis of SEALS laboratory Data 2002-2014 ...................................................................... 58

4.2.1. Overview of Data ........................................................................................................... 58

4.2.2. Prevalence of Hypercalcaemia and Hypocalcaemia ....................................................... 63

4.2.3. Analysis of Calcium Concentration over time for Total Calcium and Ionised Calcium .. 65

4.2.4. Comparison of Total Calcium Concentration Between Sites According to Changes in Assay ......................................................................................................................................... 67

4.2.5 Analysis of Vitamin D ....................................................................................................... 69

4.2.6 Analysis of Calcium Related Analytes .............................................................................. 73

Chapter 5 – Discussion ..................................................................................................................... 75

References ........................................................................................................................................ 87

List of Abbreviations

vii

List of Abbreviations 25OHD 25 hydroxyvitamin D

25OHD2 25 hydroxyvitamin D2

25OHD3 25 hydroxyvitamin D3

1,25 OHD 1,25 dihydroxyvitamin D

IIH Idiopathic Infantile Hypercalceamia

AACB Australian Association of Clinical Biochemists

AF Allele Frequency

ALP Alkaline Phosphatase

ANCOVA Analysis of Covariance

APGAR Activity Pulse Grimace Appearance Respiration

AP2S1 Adaptor Related Protein Complex 2 gene

ARA Anti-rachitic activity

BAPTA Bis(o-aminophenoxy)ethan-N,N,N',N'-tetraacetic acid

CaBP9K Calbindin-9K Calcium Binding Protein

CaSR Calcium sensing receptor

CASR Calcium sensing receptor gene

CYP Cytochrome P450

Epi-25OHD Epi-25 hydroxyvitamin D

ExAC Exome Aggregation Consortium

FGF23 Fibroblast Growth Factor 23

FHH Familial Hypocalciuric Hypercalcaemia

FHH1 Familial Hypocalciuric Hypercalcaemia Type 1



FISH Fluorescence In Situ Hybridization

GNA11 G Protein Subunit Alpha 11 gene

IU International Units

IUGR Intrauterine Growth Restriction

IV Intravenous

List of Abbreviations

viii

LCMS Liquid Chromatography Tandem Mass Spectrometry

MCDA Monochorionic Diamniotic

Mg Magnesium

PCR Polymerase Chain Reaction

PO4 Phosphate

PTH Parathyroid Hormone

PTH1R Parathyroid Hormone 1 Receptor

PTHrP Parathyroid Hormone Related Peptide

RI Reference Interval

SEALS South Eastern Area Laboratory Service

SD Standard Deviation

TPN Total Parenteral Nutrition

TRPV6 Transient Receptor Potential Vallinoid 6 Calcium Channel

Ur Ca:Cr Urine Calcium:Creatinine ratio

UVB Ultraviolet B

VSD Ventricular Septal Defect

List of Tables

ix

List of Tables

Table 2-1 Calcium reference intervals for infants from harmonized data (5) and SEALS laboratory

2002 - 2014 ......................................................................................................................................... 9

Table 2-2 Ionised calcium reference intervals for infants SEALS laboratory 2002 - 2014 ................. 9

Table 2-3 The average calcium, vitamin D and phosphorous content per 1 litre of Locasol™,

compared with standard infant formula and human breast milk (25-27)

(http://www.nutricia.ie/products/view/locasol#). .......................................................................... 11

Table 2-4 Causes of hypercalcaemia in infants and association with parathyroid hormone (PTH)

levels ................................................................................................................................................. 12

Table 2-5 Genes contributing to vitamin D metabolism or calcium sensing in which mutations are

reported to have caused hypercalcaemia in infants. ....................................................................... 13

Table 2-6 Comparison of Vitamin D dosing recommendations according to Australian Guidelines in

2006 and 2013 (8, 9) ........................................................................................................................ 27

Table 3-1 SEALS reference ranges for analytes including 1,25(OH)2D, parathyroid hormone,

phosphate, magnesium and alkaline phosphatase. ......................................................................... 34

Table 3-2 Number of patients on handover lists for August, September and October (Aug-Oct) and

January, February and March (Jan-Mar) each year from March 2008 to March 2014, including

number of infants less than 6 months old identified as having hypercalcaemia and hypocalcaemia

and hypercalcaemic infants not captured in the original analysis. .................................................. 35

Table 3-3 Primer sequences for CASR, AP2S1 and GNA11 mutation analyses ................................ 38

Table 3-4 Analysers used for serum calcium, urine calcium, ionised calcium and 25 hydroxyvitamin

D at SEALS Randwick and peripheral site 2002-2014 ....................................................................... 44

Table 3-5 Analysers used for biochemical analytes at SEALS Randwick and peripheral site 2002-

2014 .................................................................................................................................................. 44

Table 4-1 Clinical Characteristics of patients managed for idiopathic infantile hypercalcaemia at

Sydney Children’s Hospital 2011-2014 ............................................................................................. 47

Table 4-2 Reason for initial calcium measurement and comorbidities in patients managed for

idiopathic infantile hypercalcaemia at Sydney Children’s Hospital 2011-2014 ............................... 48

Table 4-3 Baseline biochemistry in patients who developed nephrocalcinosis and those who did

not, in a cohort of infants treated for idiopathic infantile hypercalcaemia at Sydney Children’s

Hospital 2011-2014 .......................................................................................................................... 49

List of Tables

x

Table 4-4 Biochemical data at baseline (or within 1 week of baseline) from 14 patients treated for

idiopathic infantile hypercalcaemia at Sydney children’s Hospital 2011-2014 ............................... 51

Table 4-5 PTH values and associated biochemical data in infants whilst on Locasol™ treatment for

idiopathic hypercalcaemia at Sydney Children’s Hospital 2011-2014 ............................................. 54

Table 4-6 Follow up biochemistry, taken after stopping Locasol™, in 14 patients treated for

idiopathic infantile hypercalcaemia at Sydney Children’s Hospital 2002 to 2014 ........................... 55

Table 4-7 Genetic testing results including common variants in AP2S1, CASR, GNA11 and CYP24A1,

in 9 patients treated for idiopathic infantile hypercalcaemia at Sydney children’s Hospital 2011-

2014 .................................................................................................................................................. 57

Table 4-8 Descriptive data for biochemical analytes paired with total calcium at SEALS Randwick

and peripheral site 2002-2014 ......................................................................................................... 59

Table 4-9 Mean calcium ± SD for total calcium and ionised calcium at the Randwick and peripheral

sites approximately 2 years before and after the analyser and assay changes for infants 1 day to 6

months of age................................................................................................................................... 68

List of Figures

xi

List of Figures

Figure 2-1 Overview of Calcium Metabolism ..................................................................................... 7

Figure 2-2 Overview of Vitamin D Metabolism .................................................................................. 8

Figure 3-1 Decision tree used to identify infants with idiopathic infantile hypercalcaemia at Sydney

Children’s Hospital March 2008 to March 2014 .............................................................................. 36

Figure 4-1 Total calcium data set: Cohort diagram of the number of total calcium measurements

in infants 1 day to 6 months of age at SEALS Randwick and peripheral site 2002-2014 ................. 59

Figure 4-2 Ionised calcium data set: Cohort diagram of the number of ionised calcium

measurements in infants 1 day to 6 months of age at SEALS Randwick and the peripheral site

2002-2014 ........................................................................................................................................ 60

Figure 4-3 25OHD data set: Cohort diagram of the number of 25 hydroxyvitamin D measurements

(25OHD) in infants 1 day to 6 months of age at SEALS Randwick and the peripheral site .............. 60

Figure 4-4 Age distribution (days) of all total calcium measurements in infants aged 1 day to 6

months at SEALS either site (Randwick and peripheral site) between 2002 and 2014 ................... 61

Figure 4-5 Number of infants per year aged 1 day to 6 months, who had a total calcium

concentration measured at SEALS Randwick (blue) and peripheral site (red) between 2002 and

2014 .................................................................................................................................................. 61

Figure 4-6 Number of infants per year aged 1 day to 6 months who had an ionised calcium

concentration measured at SEALS at either site (Randwick and peripheral site) between 2002 and

2014 .................................................................................................................................................. 62

Figure 4-7 Prevalence of hypercalcaemia and hypocalcaemia by year at the Randwick site 2002 to

2014 based on age related reference intervals and the first total calcium measurement per

patient in infants 1 day to 6 months of age. .................................................................................... 63

Figure 4-8 Prevalence of hypercalcaemia and hypocalcaemia by year at the peripheral site 2002 to

2014 based on age related reference intervals and the first total calcium measurement per

patient in infants 1 day to 6 months of age. .................................................................................... 64

Figure 4-9 Prevalence of hypercalcaemia and hypocalcaemia by year at all sites 2002 to 2014

based on age related reference intervals and the first ionised calcium measurement per patient in

infants 1 day to 6 months of age. ..................................................................................................... 64

Figure 4-10 Total calcium concentration by date collected at the Randwick site 2002 to 2014 for


List of Figures

xii

Figure 4-11 Total calcium concentration by date collected at the peripheral site 2002 to 2014 for


Figure 4-12 Ionised calcium concentration by date collected at all sites 2002 to 2014 for infants 1

day to 6 months of age. .................................................................................................................... 66

Figure 4-13 Ionised calcium concentration (paired with calcium levels from the total calcium data

set) by date collected at all sites 2009 to 2014 for infants 1 day to 6 months of age. .................... 67

Figure 4-14 Measurements of 25 hydroxyvitamin D by year at all sites (Randwick and peripheral

site) in infants 1 day to 6 months of age, and defined as sufficient (25OHD ≥50nmol/L) or

insufficient (25OH D<50 nmol/L)...................................................................................................... 69

Figure 4-15 25 hydroxyvitamin D and total calcium correlation all sites (Randwick and peripheral

site) in infants 1 day to 6 months of age. ......................................................................................... 70

Figure 4-16 25 hydroxyvitamin D and PTH correlation all sites (Randwick and peripheral site) in


Figure 4-17 25 hydroxyvitamin D concentration (nmol/L) by date collected at all sites (Randwick

and peripheral site) 2002 to 2014 in infants 1 day to 6 months of age. .......................................... 72

Figure 4-18 Calcium concentration (paired with 25 hydroxyvitamin; mmol/L) by date collected at

all sites (Randwick and peripheral site) 2002 to 2014 in infants 1 day to 6 months of age. ........... 73

List of Publications

xiii

List of Publications

Increased rates of infantile hypercalcaemia following guidelines for antenatal vitamin D3

supplementation

Co Authors: Dr Jan Walker, Dr Shihab Hameed, Dr Kristen Neville, Dr Charles Verge, Dr Helen

Woodhead, Dr Wei Shern Quek, Dr Chris White, Dr Andrea Rita Horvath

Poster category P1 ESPE Scientific Meeting Dublin 2014

Increased rates of infantile hypercalcaemia following guidelines for antenatal vitamin D3

supplementation

Co Authors: Dr Jan Walker, Dr Shihab Hameed, Dr Kristen Neville, Dr Charles Verge, Dr Helen

Woodhead, Dr Wei Shern Quek, Dr Chris White, Dr Andrea Rita Horvath

Young Investigator presentation APEG Scientific meeting Darwin 2014

- Introduction

1

Chapter 1 - Introduction Hypercalcaemia in infants is rare, but can have potentially serious sequelae including failure to

thrive, vomiting, dehydration, nephrocalcinosis and death. The cause of infantile hypercalcaemia

is often not identified and many infants are classified as having idiopathic infantile

hypercalcaemia.

The term, Idiopathic infantile hypercalcaemia (IIH) was first coined in the 1950s when Lightwood

reported on the occurrence of an epidemic of hypercalcaemia in Great Britain during which some

infants died (1, 2). The epidemic seemed to relate to increased doses of Vitamin D in infant

formula and fortified milk, although many infants receiving this treatment were unaffected. A

number of these children have now been found to have loss of function mutations in the gene

responsible for metabolizing active vitamin D, CYP24A1(3). A small number of children with

infantile hypercalcaemia have also been found to have loss of function mutations in the genes

responsible for calcium sensing, consistent with a diagnosis of familial hypocalciuric

hypercalcaemia, but with biochemical findings that overlap with IIH (4).

At our tertiary children’s hospital, referrals for idiopathic infantile hypercalcaemia increased

markedly after 2011. In addition, there were nationwide shortages of low calcium formula at

least 3 times between 2012 and 2014, and in that same time the Australian Association of Clinical

Biochemists (AACB) proposed a small increase to serum calcium reference intervals of infants (5).

These findings coincide with an increased interest in vitamin D supplementation in Australia,

reflected by much higher rates of vitamin D testing and sales (6, 7). In addition, position

statements released in 2006 and updated in 2013 recommended antenatal vitamin D

supplementation in vitamin D deficient women, supported by trials demonstrating efficacy and

safety (8-11).

To date there have been no population-based reports of the prevalence of infantile

hypercalcaemia since vitamin D supplementation became more common and few studies looking

for a genetic predisposition. Although maternal vitamin D plays little role in foetal calcium

- Introduction

2

homeostasis, it has been shown to modify neonatal vitamin D status and post-natal calcium

concentrations. Therefore, we hypothesized that in infants born with variations in genes involved

in calcium sensing or vitamin D metabolism, there may be an increased susceptibility to

hypercalcaemia. We hypothesized that in the general population an increased rate of vitamin D

supplementation during pregnancy might be associated with a gradual rise in infantile calcium

concentration, an increased prevalence of hypercalceamia and a decreased prevalence of

hypocalcemia. We also hypothesized that in infants identified with symptomatic hypercalcaemia,

maternal vitamin D supplementation might have unmasked a predisposition to hypercalcaemia

due to variants in genes associated with calcium sensing or vitamin D metabolism.

This study therefore aimed to examine 1) the biochemical profiles, history of maternal vitamin D

supplementation and response to treatment of infants presenting to our department with

idiopathic hypercalcaemia; 2) the possibility that variants in a panel of genes responsible for

calcium sensing and vitamin D metabolism might have contributed to the presentation with

hypercalcaemia in this cohort; and 3) the trend in calcaemia and prevalence of infantile

hypercalcaemia in our hospital region over a 12 year period.

Chapter 2 – Review of Literature

3


2.1. Calcium and Vitamin D Metabolism in the Foetus, Neonate and Infant The ability to understand hypercalcaemia in infants and the possible mechanisms that may

contribute to its development requires an understanding of calcium metabolism and in particular

the complex changes that occur in the first weeks of life, when the neonate transitions from

foetal to postnatal life.

2.1.1. Calcium Metabolism in the Foetus

The main goal of foetal calcium metabolism is to mineralize the foetal skeleton and maintain

appropriate calcium levels for foetal tissues. Human foetuses accrete 80% of their mineral

content during the third trimester. Serum calcium levels in the foetus exceed maternal levels and

appear to be necessary for skeletal mineralization, as without this state of ‘foetal

hypercalcaemia’, foetal skeletal mineralization is reduced and the foetus is at greater risk of

hypocalcaemia after birth. The foetus maintains calcium levels by flux of calcium across the

placenta but also from the foetal skeleton, kidney and intestine. Evidence suggests that the foetal

blood calcium concentration is set at a level independent of the maternal calcium concentration

(12). It is therefore largely independent of acute alterations in maternal calcium concentration;

however chronic alterations in maternal calcium have been shown to be harmful. The foetus has

low levels of parathyroid hormone (thought to be suppressed by the high calcium); however

animal models have shown that loss of parathyroid hormone results in foetal hypocalcaemia,

suggesting it still plays a key role in foetal calcium regulation (12, 13). Foetal concentration of

1,25 dihydroxyvitamin D (1,25(OH)2D) is low, thought to be due to both its inability to cross from

the maternal circulation and decreased activity of foetal renal 1 alpha hydroxylase secondary to

low parathyroid hormone (PTH) and high calcium concentrations. The foetus has high levels of

calcitonin, derived from the foetal thyroid gland and high levels of parathyroid hormone related

peptide (PTHrP), derived mostly from the placenta. Animal models suggest that PTHrP stimulates

placental calcium transfer from the maternal circulation. In the foetus, loss of foetal PTH or

PTHrP results in hypocalcaemia and hyperphosphatemia whereas loss of 1,25 dihydroxyvitamin D,

25 hydroxyvitamin D (25OHD) or the vitamin D receptor causes no change to serum calcium (12,

13).


4

2.1.2. Calcium Metabolism in the Neonate and Infant

Once the umbilical cord has been cut, the placental infusion of calcium and PTHrP is lost so the

neonate must rely on intestinal calcium absorption and skeletal calcium to maintain serum levels.

Therefore, PTH and 1,25 (OH)2D become more important. In the first 24 hours after birth, PTHrP

concentrations decline rapidly, calcium levels fall 20-30% and phosphorus rises. PTH increases to

normal adult values by 24-48 hours, followed by a rise in 1,25(OH)2D and calcium, and a decline in

phosphorous (13). Concentrations of calcium, phosphorous, PTH and 1,25(OH)2D approach

normal adult levels by around day 5-10 of life. The neonatal intestinal absorption of calcium

initially occurs via passive non-saturable mechanisms, thought to be facilitated by the high lactose

content of milk. As the neonate matures, 1,25(OH)2D plays a more active role in intestinal calcium

absorption.(12-14)

Calcium metabolism throughout the infantile period is thought to be the same as calcium

metabolism in older childhood and adulthood, reliant on an ongoing interplay between calcium

absorption by the small intestine, calcium reabsorption in the kidneys and remodeling of bone

(Figure 2-1). The main hormones that directly affect these processes and maintain tight control of

serum calcium are parathyroid hormone (PTH) and 1,25(OH)2D. Calcitonin and PTHrP play more

minor roles. Calcium metabolism is closely linked with phosphate and magnesium metabolism.

Magnesium can directly influence calcium levels by altering PTH secretion in response to

hypocalcaemia. PTH and 1,25(OH)2D, along with fibroblast growth factor 23 (FGF23), influence

phosphate metabolism. FGF23 requires another factor, Klotho, for FGF signaling (15).

Almost all calcium (99%) is contained within bone and the remainder is present intracellularly and

in plasma. In plasma, 50% of calcium exists in ionised form and the remainder is mostly bound to

albumin. The concentration of calcium in plasma is kept within a narrow range to maintain

neuromuscular stability.

Calcium binds to the calcium sensing receptor (CaSR), which is present mostly in the parathyroid

glands and renal tubules, but also in many other tissues. When calcium binds, PTH secretion is

altered to maintain the ionised calcium concentration within narrow limits ‘set’ by the CaSR.

Mutations in the CaSR gene (CASR) can lead to activation or inactivation of the receptor, causing


5

hypo or hypercalcaemia. In addition, mutations in the AP2S1 gene, which encodes the adaptor

related protein complex 2, a protein critical for clathrin mediated endocytosis of the calcium

sensing receptor, and GNA11, the gene encoding the alpha subunit of G11, which is involved in

signaling by the calcium receptor, can also affect calcium sensing receptor function. (16-18)

Parathyroid hormone (PTH) is encoded by a gene on chromosome 11. The half-life of PTH in the

circulation is only 1-2 minutes (15). Various fragments of PTH can be measured in the circulation.

Most current assays measure ‘intact’ PTH which ignores the inactive fragments and is a good

indication of bioactive PTH. PTH acts mostly on the bone and kidney. In the bone, PTH stimulates

bone resorption and in the kidney PTH has several actions: it stimulates conversion of 25

hydroxyvitamin D to 1,25 dihydroxyvitamin D; it stimulates reabsorption of calcium and

magnesium; and it promotes excretion of phosphate so that phosphate which has been resorbed

from bone is excreted. PTH acts via two receptors: PTH1R (PTH/PTHrP receptor) which responds

to both PTH and PTHrP ; and PTH2R which binds only PTH and is mostly found in the central

nervous system. Intracellular signaling of the PTH receptors is mediated by G-protein second

messengers.

Parathyroid hormone related peptide (PTHrP) is a hormone with similar biological activity to PTH.

It is coded for by a gene on chromosome 12. Post-natal circulating concentrations are below

levels of detection. It is secreted physiologically in breast milk during lactation and pathologically

by some malignancies, causing hypercalcaemia of malignancy.

Calcitonin is produced by the para follicular cells of the thyroid gland. It is secreted in response to

high calcium and acts to lower calcium by inhibiting osteoclastic activity in bone and inhibiting

reabsorption of calcium and phosphate, leading to increased urinary calcium and phosphate

excretion

2.1.3. Vitamin D Metabolism in the Neonate and Infant Vitamin D is synthesized from 7 dehydrocholesterol following exposure to UV light and is

metabolized in the skin to form vitamin D3 (cholecalciferol). Concentrations therefore vary with

sun exposure. It is also ingested in the diet in the form of vitamin D2 (ergocalciferol). Both vitamin

D3 and vitamin D2 are collectively known as vitamin D and once absorbed, follow the same


6

metabolic pathway (Figure 2-2). Vitamin D is transported bound to vitamin D binding protein. It is

first hydroxylated to 25 hydroxyvitamin D (25OHD) in the liver and then to 1,25 dihydroxyvitamin

D (1,25(OH)2D) in the kidney. 1,25(OH)2D is the active metabolite which acts via the vitamin D

receptor to exert its effects. 1,25(OH)2D plays a key role in promoting calcium absorption in the

small intestine, suppressing PTH secretion and stimulating differentiation of osteoclasts (19).

Cytochrome P450 (CYP) enzymes are required in all steps of vitamin D metabolism. The first step

is catalyzed in the liver by cytochrome P450 25 hydroxylases including CYP2R1 (the major

enzyme), CYP27A1, CYP3A4 and CYP2J2. The second step is catalyzed by the 25 hydroxyvitamin D

1 alpha hydroxylase enzyme, CYP27B1. Activity is stimulated by PTH and inhibited by FGF23 and

1,25(OH)2D. Another cytochrome P450 enzyme, CYP24A1, is responsible for breakdown of 25

hydroxyvitamin D into 24,25 dihydroxyvitamin D and 1,25 dihydroxyvitamin D into calcitroic acid.

It is inhibited by PTH and stimulated by 1,25(OH)2D and FGF23 (19).


7

Figure 2-1 Overview of Calcium Metabolism

Binding of calcium to the calcium sensing receptors in the parathyroid gland influences the amount of PTH that is released. PTH acts on osteoblasts and increases osteoclastic activity, which mobilises calcium from bone. In the kidney, PTH increases reabsorption of calcium from the distal renal tubule and promotes phosphate excretion. It also stimulates hydroxylation of 25 hydroxyvitamin D to 1,25 dihydroxyvitamin D. 1,25 dihydroxyvitamin D is the active metabolite of vitamin D and increases intestinal calcium and phosphate absorption. In bone, 1,25 dihydroxyvitamin D mobilises calcium and phosphate and in the kidney 1,25 dihydroxyvitamin D increases calcium resorption. Calcitonin is produced by the para follicular cells of the thyroid gland. It inhibits osteoclastic activity in bone and inhibits resorption of calcium and phosphate, leading to increased urinary excretion.


8

Figure 2-2 Overview of Vitamin D Metabolism

Vitamin D is synthesized in the skin from 7 dehydrocholesterol following exposure to UV light. It is also ingested in the diet. It comes in the form of vitamin D2 (ergocalciferol) and vitamin D3 (cholecalciferol). Vitamin D is transported bound to vitamin D binding protein. Vitamin D is hydroxylated to 25 hydroxyvitamin D in the liver via the action of 25 hydroxylase. It is further hydroxylated in the kidney to 1,25 dihydroxyvitamin D, via the action of 1 a hydroxylase. 1,25 dihydroxyvitamin D is the active metabolite which acts via the vitamin D receptor to exert its effects. Cytochrome P450 (CYP) enzymes are involved in all steps of vitamin D metabolism. Direction of action is indicated by blue arrows. Stimulatory effects are indicated by red arrows. Inhibitory effects are indicated by purple arrows.

2.2. Diagnosis and Treatment of Hypercalcaemia

2.2.1. Laboratory Findings

Hypercalcaemia of infancy is considered to be a total calcium concentration more than 2 standard

deviations above the mean, which is defined according to age. At our own laboratory, South

Eastern Area Laboratory Service (SEALS), between 2002 and 2014, the period relevant to our

study, the upper limit of normal was unchanged for the first year of life, but the lower limit of


9

normal was lowest in the first two weeks of life, accounting for the changes that occur in the

transition from foetal to neonatal life. In 2014, The Australian Association of Clinical Biochemists

published a harmonization project establishing reference intervals for calcium and other analytes,

to be used throughout Australia and New Zealand following a number of working parties between

2012-2014, largely driven by the desire to be able to amalgamate an individual patient’s results

from different laboratories into the one health record (5). The group used a data mining approach

and included 1.8 million results from 15 laboratories. The reference ranges agreed upon for

calcium levels in infancy and childhood included an upper limit of normal that was 0.5 mmol/L

higher than our laboratory in the first 6 months of life and a lower limit of normal that was 0.5

mmol/L lower in the first week of life. The AACB publication did not indicate the time interval

during which data were collected (although we understand from personal communication that

collection started in 2012), nor how the harmonized reference intervals compared to the

reference intervals of the laboratories studied. The reference intervals used by our laboratory

between 2002 and 2014 and the reference intervals established by the harmonization project are

detailed in Table 2-1. Our laboratory adopted the harmonized reference intervals after they were

published in 2014, which was after completion of our study.

Table 2-1 Calcium reference intervals for infants from harmonized data (5) and SEALS laboratory 2002 - 2014

Age Harmonised data RI SEALS Laboratory RI

0 – 7 days 1.85 – 2.8 mmol/L 1.90 – 2.75 mmol/L

7 days – 14 days 2.20 – 2.8 mmol/L 1.90 – 2.75 mmol/L

14 days – 26 week 2.20 – 2.8 mmol/L 2.25 – 2.75 mmol/L

26 weeks - 1 year 2.20 – 2.70 mmol/L 2.25 – 2.75 mmol/L RI: Reference interval

The harmonization project by Tate et al (5) did not report on harmonized ionised calcium levels.

Our own laboratory uses a reference range of 1.1-1.3 mmol/L from 1 year of life and throughout

adulthood. Slightly higher and lower ionised calcium levels are accepted in younger children as

detailed in Table 2-2.

Table 2-2 Ionised calcium reference intervals for infants SEALS laboratory 2002 - 2014

Age SEALS Laboratory RI

0 - 1 month 0.97-1.5 mmol/L

1 – 6 months 0.93 – 1.48 mmol/L RI: Reference Interval


10

Although it is not always practical, because of the method of collection, an ionised calcium level is

considered more accurate than a total calcium level. This is because it eliminates variables

affecting the total calcium measurement such as albumin concentration. Calcium adjustment

equations, accounting for albumin concentration, have been used in adults to produce a

‘corrected calcium’, but may not be reliable in young children due to variations in the relationship

between albumin and calcium at different ages, particularly in neonates. Jassam et al showed

that whilst adjusted calcium equations used for adult data sets can be applied to children greater

than 1 year of age they are less reliable in children during the first year of life (20).

Serum calcium can be influenced by collection technique. When measuring calcium, the

recommended technique for blood collection is fasting, from a free flowing vein, without

tourniquet. Prolonged tourniquet leading to venous occlusion has been reported to increase

serum calcium by up to 0.3 mmol/L in adults. Falsely elevated levels also can be observed in

patients in liver or renal failure, as well as those in whom the specimen is haemolysed or lipaemic.

In addition, standing posture, immediate prior exercise and non-fasting collection have all been

implicated as possible causes for falsely elevated results (21).

2.2.2. Clinical Findings

Many infants with mild hypercalcaemia (serum calcium < 3.0 mmol/L) are asymptomatic at

diagnosis and the elevated calcium level is picked up incidentally. Whilst there is variation in the

concentration associated with clinical abnormality, most infants with a serum calcium

concentration above 3.5 mmol/L are symptomatic with vomiting, weight loss, failure to thrive,

irritability, lethargy, polyuria or seizures. Upon clinical examination, these infants may be

dehydrated, lethargic and hypotonic. They can have bradycardia, short QT intervals and

hypertension. They may also develop nephrocalcinosis and renal impairment (22).

2.2.3. Treatment of Hypercalcemia

To appropriately treat hypercalcaemia it is important to determine, if possible, the underlying

diagnosis and to stop any medications such as vitamin D and calcium supplements, or reduce the

calcium content of parenteral or enteral feeds that may be exacerbating the problem. The main

goals of treatment are then to treat dehydration, increase renal excretion of calcium and reduce

gut absorption of calcium or bone resorption.


11

First line treatment is with hydration, to overcome the dehydration associated polyuria that

results from hypercalcaemia induced nephrogenic diabetes insipidus. The mechanism for the

latter is incompletely understood but may be related to downregulation of aquaporin 2 water

channels (23). Hydration will help to expand intravascular volume and dilute the calcium. In many

cases, IV hydration is indicated with 0.9% normal saline, sometimes up to 1.5-2 times

maintenance (22). In addition to correcting dehydration, the normal saline will help to further

reduce calcium, as the sodium load reduces the need for sodium and therefore calcium

reabsorption (24). Loop diuretics such as frusemide can also be useful, as they promote urinary

calcium excretion, but need to be used with caution as they can exacerbate the dehydration and

predispose to nephrocalcinosis.

Low calcium formula may be all that is needed in the infant, particularly in PTH or vitamin D

mediated hypercalcaemia, in which gut calcium absorption is increased. Locasol™ is the low

calcium formula available in Australia. The average calcium and vitamin D content in Locasol™,

compared with standard formula and breast milk, is detailed in Table 2-3.

Table 2-3 The average calcium, vitamin D and phosphorous content per 1 litre of Locasol™, compared with standard infant formula and human breast milk (25-27) (http://www.nutricia.ie/products/view/locasol#).

Nutrients per litre Locasol™ Standard Infant Formula Human Breast Milk

Calcium <70mg 400-700 mg 250-280 mg

Phosphorous 460 mg 230-480 mg 110-160 mg

Vitamin D 0 400 IU 10-80 IU ARA*

*ARA: antirachitic activity Hypercalcaemia can also be treated with glucocorticoids, which reduce the absorption of calcium

in the gut by reducing conversion of 25OHD to 1,25(OH)2D (28). They may also have an effect on

bone resorption; however, they are not useful for long term treatment due to undesirable side

effects. Calcitonin is given by subcutaneous injection and acts to oppose the action of PTH;

however the effects of calcitonin are usually not prolonged as tachyphylaxis is common.

Cinacalcet is a calcimimetic that binds the CASR within the transmembrane domain (rather than

the extracellular domain, where calcium binds) and increases CASR sensitivity to calcium. It has

been used in some cases of hyperparathyroidism in children (29, 30). Bisphosphonates rapidly

inhibit osteoclastic bone resorption and lower serum and urine calcium. The effects are usually


12

seen within 12-24 hours of treatment, and can last for weeks (28). It is important to monitor for

potential side effects including an acute phase reaction, hypocalcaemia, hypophosphataemia and

hypomagnesaemia. Parathyroidectomy has been used in cases of severe hyperparathyroidism,

and haemodialysis or peritoneal dialysis, using a low calcium dialysate, may be needed in cases of

severe or life threatening hypercalcaemia.

2.3. Causes of Infantile Hypercalcaemia The exact prevalence of hypercalcaemia in infancy is not known; however it is reported to be rare

and the causes can be grouped according to whether or not PTH is high (Table 2-4). ‘Idiopathic

Infantile hypercalcaemia’ by definition is a diagnosis of exclusion. In the past few years, genetic

variants related to vitamin D metabolism have been identified as causes of hypercalcaemia in

infants who previously were labelled as idiopathic (

Table 2-5). The likelihood is that more genetic variations in the genes governing vitamin D and

calcium metabolism will explain the hypercalcaemia in others from this idiopathic group.

Table 2-4 Causes of hypercalcaemia in infants and association with parathyroid hormone (PTH) levels

PTH High PTH Normal or Low

High PTH Levels Primary Hyperparathyroidism Secondary Hyperparathyroidism

- Following maternal hypocalcaemia

- Mucolipidosis type II

Normal PTH Levels Familial hypocalciuric hypercalcaemia Low/Suppressed PTH Levels Idiopathic infantile hypercalcaemia (IIH) Vitamin D toxicity Williams Beuren syndrome Subcutaneous fat necrosis Phosphate depletion in prematurity Vitamin A intoxication Down syndrome Hypophosphatasia Congenital hypothyroidism Congenital lactase deficiency Bartter syndrome Blue diaper syndrome Renal tubular acidosis Incontinentia Pigmenti Jansen Type Metaphyseal Dysplasia


13

Table 2-5 Genes contributing to vitamin D metabolism or calcium sensing in which mutations are reported to have caused hypercalcaemia in infants.

Vitamin D Calcium sensing

CYP24A1 SLC34A1

CASR AP2S1 GNA11

2.3.1. Hypercalcaemia with High PTH

Primary or secondary hyperparathyroidism

Primary Hyperparathyroidism

Primary hyperparathyroidism was first reported in 1982 and is extremely rare in infants (31). It is

an autosomal recessive condition in which inactivating mutations of the calcium sensing receptor

(CaSR) lead to inappropriate secretion of PTH. Infants usually present in the neonatal period with

life-threatening hypercalcaemia. Calcium levels up to 7.1 mmol/L have been reported (31). In

addition to raised PTH, affected infants have marked elevation of alkaline phosphatase (ALP).

Serum phosphate is generally low (reflecting the increased PTH) and urinary calcium excretion has

been reported to be both high and low (31). Clinical features leading to presentation are often

related to hypercalcaemia and include failure to thrive, dehydration, irritability and constipation.

Hypotonia and respiratory distress are also frequent. Skeletal abnormalities include osteopenia,

deformity of the rib cage, metaphyseal splaying, sub-periosteal erosion and fractures (29, 32).

Parathyroid hyperplasia has been reported on post-surgical or postmortem examination of the

parathyroids. The condition can be fatal if not treated. Infants can be managed with intravenous

fluids and bisphosphonates and, more definitively, parathyroidectomy. Recently, a type 2

calcimimetic drug (cinacalcet) has been used successfully (29, 30, 33). Calcium binds the CaSR

within the extracellular domain, whereas calcimemtics bind within the transmembrane domain,

which increases CaSR sensitivity to calcium (34).

Secondary Hyperparathyroidism

Secondary hyperparathyroidism is a rare cause of hypercalcaemia in infants, but may occur in the

neonatal period in infants born to mothers with hypocalcaemia due to hypoparathyroidism,

pseudohypoparathyroidism, chronic renal failure or renal tubular acidosis (35). Maternal

hypocalcaemia leads to foetal hypocalcaemia and thus stimulation of foetal parathyroid tissue.


14

These infants more commonly present with hypocalcaemia and bone demineralization, but may

have normal or even high calcium levels. The condition is usually transient and resolves within

weeks, though some infants have persistently elevated parathyroid hormone levels for up to 3-4

months (35, 36). Secondary hyperparathyroidism has also been reported in infants with

mucolipidosis type II, presumed to be due to impaired foetal placental calcium transport.

2.3.2. Hypercalcaemia with Normal or Low PTH

Conditions with Hypercalcaemia as a Predominant Feature

Idiopathic infantile hypercalcaemia

See 2.4. Idiopathic Infantile Hypercalcaemia and Mutations in the CYP24A1, page18

Familial hypocalciuric hypercalcaemia

See 2.5. Familial Hypocalciuric Hypercalcaemia and Mutations in the CASR, GNA11 or AP2S1,

page21

Iatrogenic vitamin D toxicity

Vitamin D toxicity was first reported in 1931 (37) attributable to an overdose of Vitamin D

supplementation given as irradiated ergosterol (37). Further cases have been reported since then

following fortification of milk and preterm formula with Vitamin D, as well as high dose vitamin D

either prescribed or following errors in dosing or manufacturing (37-40). Both the dose of vitamin

D administered and the serum concentration of vitamin D associated with toxicity vary. Toxicity

has been described in very high doses 40,000 to 560, 000 units, resulting in serum vitamin D levels

250-670 ng/ml (624-1672 nmol/L) and serum calcium concentrations 3.5-4.5 mmol/L (38).

However mild asymptomatic hypercalcaemia has also been reported in children receiving lower

doses of 1400 – 2000 IU per day (41). Serum levels of 25 hydroxyvitamin D (25OHD) above 250

nmol/L have been associated with hypercalcaemia and hypercalciuria, and levels above 375

nmol/L have been associated with symptomatic hypercalcaemia; however there does not appear

to be a strict relationship between vitamin D dose, the serum levels achieved and calcaemia (37,

38, 42).Variations in assays and the timing of the testing in relation to intoxication may explain

some of the variability. It is also likely that mutations or polymorphisms in the genes involved in


15

metabolism of vitamin D may partly explain the poor relationship between vitamin D dose and

toxicity (38).

The typical biochemical findings in Vitamin D intoxication include high 25 hydroxyvitamin D

(25OHD), elevated calcium, normal or elevated phosphate, low PTH, elevated urinary calcium and

normal 1,25 dihydroxyvitamin D (1,25(OH)2D). The pathologic basis for the toxicity is not

completely understood but may be due to high 25OHD concentrations (and possibly other vitamin

D metabolites) displacing 1,25(OH)2D from its binding proteins or direct entry of 25OHD into the

target cell where it acts on intracellular transcription (37, 38). Due to lipophilic storage, vitamin D

intoxication can take weeks to resolve (38). Symptomatic infants can be treated in the acute

phase with hyper-hydration, frusemide, glucocorticoids, calcitonin or bisphosphonates (38, 43,

44). Haemodialysis has been used as a last resort in life threatening cases (38, 43).

Williams Beuren Syndrome

Williams Beuren syndrome is a rare genetic disorder caused by the deletion of 28 contiguous

genes on chromosome 7 at 7q11.23. It occurs with a frequency of 1 in 20,000 to 50,000. It is

characterized by a number of clinical features including structural cardiac abnormalities,

distinctive facial features and personality traits, intellectual disability and endocrine problems

including poor growth, thyroid abnormalities (subclinical hypothyroidism and thyroid hypoplasia),

precocious puberty and hypercalcaemia. Of note, the phenotypic features may be difficult to

identify in neonates and infants. Hypercalcaemia was reported in some of the first described

cases of Williams Beuren syndrome in 1963 (45), and has been reported to occur in up to 40% of

patients (46). Efforts to identify the cause of the hypercalcaemia have been inconclusive, with

various reports suggesting abnormalities involving intestinal absorption of calcium and impaired

vitamin D metabolism, as well as defective calcitonin release (46-49). Hypercalcaemia usually

occurs in the first year of life, resolving by 4 years (48). Occasionally, the hypercalcaemia is severe

and associated with nephrocalcinosis (50). Most patients can be managed with reduced calcium

and vitamin D intake, but more severe cases have been treated with bisphosphonate therapy (50-

52).

Subcutaneous fat necrosis

Subcutaneous fat necrosis occurs in the neonatal period and is a rare form of lobular panniculitis

with necrotic fatty plaques. It is characterised by palpable areas of subcutaneous tissue


16

presenting as firm flesh coloured or blue subcutaneous nodules or plaques usually occurring on

the trunk, buttocks, thighs arms and cheeks. Histology shows subcutaneous, needle-shaped clefts

surrounded by an inflammatory infiltrate containing macrophages. It generally occurs following

birth asphyxia, meconium aspiration or therapeutic cooling (53, 54). Risk factors include maternal

smoking, hypertension and maternal exposure to cocaine or calcium antagonists (53, 55).

Hypercalcaemia has been reported to occur in 28-69% of cases, usually after the onset of skin

lesions (53, 56). The hypercalcaemia is usually moderate, but severe hypercalcaemia has been

reported, as has nephrocalcinosis (56). The infants with hypercalcaemia typically are found to

have low/normal serum phosphate, suppressed PTH, normal 25OHD and elevated 1,25(OH)2D

(57). The cause of hypercalcaemia is postulated to arise from 1 alpha hydroxylase in macrophages

leading to excess production of 1,25(OH)2D and increased calcium absorption from the gut (53,

55, 58). Other theories include release of calcium from necrotic fat cells, increased prostaglandin

E which stimulates bone resorption, and differentiation of particle filled macrophages into

osteoclasts (55, 59, 60). The skin lesions and associated hypercalcaemia tend to resolve

spontaneously within months (60). Treatment has included hydration, corticosteroids, frusemide

and low calcium feeds. Pamidronate has also been used successfully in some infants (60).

Dietary phosphate deficiency

Phosphate deficiency has been described in preterm very low birth weight infants receiving

human milk or total parenteral nutrition (TPN) with inadequate phosphate content to meet their

increased needs (61-63). The foetus accretes 80% of its mineral content during the third

trimester so preterm infants are born deficient in total body phosphorous. These infants have

increased 1 alpha hydroxylase activity leading to increased 1,25(OH)2D which increases intestinal

absorption of calcium and stimulates bone resorption, causing hypercalcaemia. The addition of

phosphate to TPN and infant formula for preterm babies has largely eliminated this problem.

Conditions in which Hypercalcaemia Has Been Reported

There are a number of very rare disorders in which hypercalcaemia has been described and some

more common conditions in which hypercalcaemia is very rarely described. Given the rarity of the

conditions or hypercalcaemia, the incidence and mechanism of hypercalcaemia is often poorly

understood and management is not always clearly defined.


17

The rare conditions in which hypercalcaemia has been described include: Jansen type

metaphyseal dysplasia, due to mutations of the PTH/PTHrP gene, causing constitutive activation

of the receptor (64-67); autosomal recessive hypophosphatasia, a rare inborn error of metabolism

due to mutations in the akaline phosphatase liver like gene (68-70); blue diaper syndrome, an

inborn error of metabolism due to a defect in the intestinal transport of tryptophan (71);

congenital lactase deficiency, due to mutations in the lactase phloricin hydrolase gene (72, 73);

vitamin A toxicity (74) and incontinentia pigmenti (75).

Some more common conditions in which hypercalcaemia has rarely been reported include

disorders of the thyroid (76-78); adrenal insufficiency and congenital adrenal hyperplasia (28, 79);

Down syndrome (80); distal (or type 1) renal tubular acidosis (81, 82) and Bartter syndrome (4).


18

2.4. Idiopathic Infantile Hypercalcaemia and Mutations in the CYP24A1 gene Idiopathic infantile hypercalcaemia (IIH) is, by definition, a diagnosis of exclusion. It was first

described by Lightwood in the 1950s (1, 2, 83) when he reported on an epidemic of

hypercalcaemia in Great Britain, during which some infants died. At the time Lightwood noted

that infants were typically diagnosed around 5 months of age but some at a few weeks of age.

The infants were found to have elevated serum calcium and urinary excretion of calcium, normal

serum phosphate and magnesium and sometimes low ALP. It was noted that these findings were

similar to those seen in children who had received large doses of vitamin D so Lightwood

postulated a role for vitamin D which was being given in fortified infant formula at the time,

sometimes in doses up to 4000 units daily (1, 3). Given that many infants receiving the treatment

were unaffected, he hypothesized variability in infants’ sensitivity to vitamin D.

With the passage of time, causes for some cases of hypercalcaemia previously classified as

idiopathic have emerged. Some of the infants originally reported by Lightwood were also noted to

have elfin facies and heart defects, and were later found to have what is now known as Williams

Beuren Syndrome (84). More recently, Schlingman and colleagues identified loss of function

mutations in the CYP24A1 gene, encoding 25 hydroxyvitamin D, 24 hydroxylase, responsible for

degradation of 25OHD and 1,25 dihydroxyvitamin D into water soluble calcitroic acid (3). Six

patients from 4 families and 4 patients with suspected Vitamin D toxicity were found to carry such

mutations. CYP24A1 mutations in patients classified as IIH have subsequently been reported by

other authors (85-88). In one study of hypercalcaemia, mostly in adults, CYP24A1 mutations were

found in 25 of 72 patients studied, and 20 of these patients had biallelic mutations (89).

Studies of families affected by infantile hypercalcaemia secondary to CYP24A1 mutations show

that these patients typically have elevated calcium levels with low levels of parathyroid hormone,

high urinary calcium, normal 25 hydroxyvitamin D (25OHD)and high 1,25 dihydroxyvitamin D

(1,25(OH)2D)(3, 90). The normal level of 25OHD in the face of high 1,25(OH)2D is explained by the

finding that 25OHD levels are reduced by both CYP27B1 and CYP24A1, whereas 1,25(OH)2D levels

are only reduced by CYP24A1 (91) (Figure 2-2, page 8). A number of these patients have been

found to also have low levels of 24,25 dihydroxyvitamin D and an elevated 25OHD to 24,25

dihydroxyvitamin D ratio, suggesting that these parameters may be used to demonstrate reduced


19

24,25 dihydroxyvitamin D in patients with CYP24A1 mutations (92). Unfortunately though,

methods for measuring 24, 25 dihydroxyvitamin D have not been standardized (93) and as far as

we are aware, there are no Australian laboratories measuring it for clinical use.

Children with hypercalcaemia secondary to CYP24A1 mutations frequently have nephrocalcinosis.

(85, 90, 94, 95). In addition, heterozygous and homozygous CYP24A1 mutations have been

reported in adult patients with nephrocalcinosis and nephrolithiasis, some of whom never

presented with hypercalcaemia during infancy or childhood, and others who only presented with

hypercalcaemia in early childhood and adolescence (91, 95, 96).

The incidence of idiopathic infantile hypercalcaemia is estimated to be 1 in 47, 000, based on UK

data from 1960-1980 (97, 98). The prevalence of CYP24A1 mutations is not clearly known but

Nesterova et al estimated the prevalence of biallelic mutations based on data from 2012, to be

between 420-1960 cases per 100,000 people and estimated the frequency of kidney stones due

to CYP24A1 mutations to be between 4-20% of all cases of kidney stones (91). In 2017 Pronicka et

al estimated the carrier frequency of CYP24A1 mutations in the Polish population to be 1 in 90;

thus the expected incidence of infantile hypercalcaemia secondary to CYP24A1 recessive

mutations was estimated as 1 in 32 465 births (86).

There is limited information on the long term outcome of IIH and most data are from cases of IIH

prior to the discovery of CYP24A1 mutations. The hypercalcaemia is thought to resolve in most

patients by 2-3 years of age; although there have been reports of hypercalcaemia persisting past 5

years (4, 99). Hypercalciuria seems to persist longer, with one case series reporting hypercalciuria

lasting for 12 years, in the absence of hypercalcaemia (100). Similarly, nephrocalcinosis can persist

but tends to be non-progressive and usually not clinically significant (4, 99).

Most patients identified with mutations in CYP24A1 have been found to have homozygous or

compound heterozygous variants (3, 85, 86, 88, 101) . Heterozygotes have been reported and

whilst many are asymptomatic, mild clinical phenotypes have been described with features such

as mild asymptomatic hypercalcaemia, nephrocalcinosis or nephrolithiasis. In most cases, the

patients do not have the classic biochemical profile usually described in IIH (hypercalcaemia,

hypercalciuria, low or low-normal PTH and the absence of hypophosphatemia or elevated levels


20

of 25OHD). Authors have suggested modifying factors on the clinical phenotype of both

homozygous and heterozygous carriers, including vitamin D supplementation, dietary calcium and

sunlight exposure (101). In a group of 5 asymptomatic, hypercalcaemic neonates heterozygous for

CYP24A1 mutations or polymorphisms, biochemical parameters suggested a functional CYP24A1,

except that these neonates had higher 1,25(OH)2D and lower PTH levels than heterozygous

adults. The authors postulated that the immaturity of renal function in neonates or an increased

sensitivity to vitamin D that exceeds the capacity of 25 hydroxyvitamin D,24 hydroxylase activity,

may explain their relative predisposition to hypercalcaemia (89).

Twin studies indicate that serum vitamin D is influenced by genetic factors (102). Levels of serum

vitamin D have been associated with variants in vitamin D associated genes and have also been

associated with response to vitamin D supplementation (103, 104). Barry et al showed that

variants in genes involved in vitamin D metabolism, including CYP24 A1, modified adult response

to vitamin D supplementation (103). In addition, Sollid et al 2016 noted that variants in 4 genes

associated with vitamin D metabolism, including CYP24A1, were associated with baseline vitamin

D levels in a cohort of pre-diabetic adult patients randomized to receive placebo or vitamin D

supplementation. Variants were also associated with greater change in vitamin D after 12 months

of supplementation (104).


21

2.5. Familial Hypocalciuric Hypercalcaemia and Mutations in the CASR, GNA11 or AP2S1 genes Familial hypocalciuric hypercalcaemia (FHH) was first described in 1972. It is due to heterozygous

mutations impairing the function of the calcium sensing receptor (CaSR), a guanine nucleotide-

binding protein coupled receptor highly expressed in parathyroid and renal tubular cells. The

receptor is directly activated by high levels of calcium and inhibits parathyroid hormone secretion

and renal calcium reabsorption. Loss of one functional allele in the calcium sensing receptor gene

(CASR) causes reduced sensitivity of the parathyroid and renal cells leading to rightward shift in

the dose response curve for calcium, resulting in a higher ‘set point’ and persistent mild to

moderate hypercalcaemia (105). FHH is thought to be similar to primary hyperparathyroidism,

which is caused by homozygous mutations in CASR, but is considered less severe and without the

renal and skeletal manifestations, although apparent autosomal recessive transmission of FHH

has been described (106). FHH has a benign course and treatment is not generally required. For

patients with symptomatic hypercalcaemia, low calcium intake has been helpful, but diuretics and

bisphosphonates are generally not useful (16). Parathyroidectomy or calcimimetic drugs have

been considered in severe cases (107, 108).

For many years, mutations in the calcium sensing receptor were considered to be responsible for

FHH. Through gene mapping and with the discovery of several other genetic mutations, there are

now thought to be three genetically distinct but phenotypically similar forms of FHH. FHH type 1

(FHH1) is due to loss of function mutations in the calcium sensing receptor on 3q21.1 and

accounts for approximately 65% of all case; FHH type 2 (FHH2) is due to mutations in G protein

subunit alpha 11 gene (GNA11) on 19p13.3 that is involved in calcium sensing receptor signaling;

and FHH type 3 (FHH3), first described in 2013, is due to mutations in the adaptor related protein

complex 2 sigma 1 subunit gene (AP2S1) on 19q13.32, resulting in altered endocytosis of the

calcium sensing receptor (16-18, 109). There do not appear to be phenotypic features that help to

clearly differentiate the different subtypes, although FHH3 may be associated with higher serum

calcium and magnesium as well as cognitive deficits or behavioural disturbance in children (18,

110).

Classically, patients with FHH have hypercalcaemia, normal or elevated PTH, normal or low

phosphate, high magnesium and hypocalciuria (defined as calcium creatinine ratio <0.01);


22

however, hypocalciuria is not a constant feature (4, 16, 18, 111, 112). Fujisawa et al reported a

female neonate who presented with hypercalcaemia associated with hypercalciuria who was

found to have an AP2S1 mutation consistent with FHH type 3 (16). Pasieka et al reported on a

family with benign familial hypercalcaemia, in which some members had hypocalciuria and some

had hypercalciuria; however genetic studies were not available at the time (113). In addition,

there have been case reports of adults with FHH type 1 in whom calcium creatinine clearance is

above 1%, higher than expected in this condition (112, 114).

Zajickova et al also reported on a family with hypocalciuric hypercalcaemia secondary to a CASR

mutation and noted that Vitamin D deficiency in two patients, including an infant and an adult

male with elevated calcium and elevated PTH levels, made the initial diagnosis difficult (114).

Supplementation with Vitamin D resulted in normalization of PTH levels. The calcium levels of the

adult male remained steady following Vitamin D supplementation and the calcium levels in the

infant rose slightly. The authors suggested that Vitamin D deficiency and then supplementation

modulated the clinical phenotype.

FHH type 1 has been associated with over 130 different mutations affecting the calcium sensing

receptor. Most are missense mutations that tend to be clustered around the extracellular domain

near the calcium binding site and the transmembrane domain which is involved in transmission of

activation signals (109). In contrast, only a few mutations in GNA11 have so far been identified as

causing FHH2 (109). AP2S1 mutations have been reported in more than 60 patients with FHH3. All

AP2S1 mutations affect the arginine 15 residue, with three substitutions so far described (17, 18).

Variants have been reported in all three genes associated with calcium sensing (109). Twin studies

estimate the heritability of serum calcium to be between 33 and 78% and variants in the CASR

may explain some of this variance (115-117). The A986S variant has been associated with serum

and ionised calcium levels in healthy adults (118, 119). Scillitani et al (115, 120) showed that

clusters of variants in CASR were associated with variance in serum calcium and suggested that

tri-locus haplotyping of the 986S allele and two neighbouring loci may be more useful for studying

the association between CASR variants and disease. In addition, the R990G variant of the CASR

has been associated with hypercalciuria in adults (121). There are limited studies of CASR variants

in children, although the A986S variant has been shown to be associated with total serum calcium


23

in a cohort of African-American and European-American Children and total serum calcium

corrected for albumin in a group of Caucasian teenage girls in Sweden (122).


24

2.6. Vitamin D Supplementation

2.6.1. Interest in Vitamin D

Vitamin D was first introduced in the 1920s after cod liver oil was successfully used to treat

vitamin D deficient rickets, and the active hormone was isolated (123, 124). Vitamin D plays a

crucial role in calcium absorption from the gut and it is well established that deficiency of vitamin

D is associated with rickets in children (125). Nutritional rickets due to vitamin D and calcium

deficiency is most prevalent in the Middle East, Asia and Africa but increasing prevalence has

been reported in Western countries, likely related to migration from geographic areas of high risk

(126-128). Other possible causes include prolonged breast feeding, reduced sunlight exposure

and restricted diets (126). The vitamin D receptor is found in many cells within the body and

recent studies have suggested a role for vitamin D insufficiency in many chronic diseases and in

epigenetic programming (129, 130). Improved vitamin D status has been linked to reduced risk of

chronic disease including Type 1 Diabetes, Crohn’s disease, multiple sclerosis and rheumatoid

arthritis.

Based on this emerging information, and population studies suggesting widespread prevalence of

vitamin D deficiency in Australia (131), interest in vitamin D has escalated. In 2012 Bilinski et al

reviewed the Medicare Benefits Schedule and noted that Medicare billings for vitamin D testing

increased from $1.02 million in the year 2000 to $96.7 million in the year 2010, indicating a yearly

increase of 59% in vitamin D testing (7). Bilinski et al also reported on sales of vitamin D

supplements in Australia and noted a 3 fold increase between 2000 and 2010 (6).

2.6.2. Measurement of Vitamin D Reserve and Definition of Vitamin D deficiency

Serum 25 hydroxyvitamin D (25OHD) is a marker of vitamin D reserve and is used to define

vitamin D status (37). Most of the 25OHD is made up of 25 hydroxyvitamin D3 (25OHD3). In the

past measurement has been mostly by immunoassay but some laboratories have now moved to

liquid chromatography tandem mass spectrometry (LCMS), which is felt to be more accurate.

Immunoassay results may be affected by differing concentrations of vitamin D binding protein

and cross reactivity with other vitamin D metabolites. The immunoassays do not differentiate


25

between 25 hydroxyvitamin D2 (25OHD2) and 25 hydroxyvitamin D3 (25OHD3), and as they do

not bind 25OHD2 as well as 25OHD3, they can be an inaccurate representation of total vitamin D

level, particularly in countries where vitamin D2 is the main form of supplementation (93). LCMS

on the other hand does not distinguish epi-25 hydroxyvitamin D (epi-25OHD), which is not

measured by immunoassay, from 25OHD. Epi-25OHD exists in high levels in neonates and infants

and is thought to account for about 9% of 25OHD in adults, so inability to distinguish the two,

particularly in children, can lead to an overestimation of 25OHD (93). Comparisons between

different immunoassays and LCMS suggest that there is not a consistent correlation between

assays, even in Australia where there is fairly rigorous quality assurance (93, 132-134) .

The serum level of vitamin D to indicate sufficiency is a source of debate because of the difficulty

linking the serum level to an endpoint. Definitions for sufficiency of vitamin D in adults have

varied between serum 25OHD levels of 30 to 75 nmol/L, with optimal vitamin D being considered

in relation to PTH levels and/or causal association with disease (134). Atapattu et el reported an

inflection point of PTH when 25OHD levels reached 34nmol/L in children, although it was noted

that calcium intake was likely a significant influencing factor (135). The published consensus

seems to be that 25OHD levels of 50 nmol/L are adequate, although there is little evidence to

support this in children (9). In addition, it is well known that 25OHD levels vary with season,

reflecting variations in sun exposure.

2.6.3. Measurement of 1,25 Dihydroxyvitamin D

The measurement of 1,25 dihydroxyvitamin D (1,25(OH)2D) can be useful in the diagnosis of some

conditions which affect 1,25(OH)2D production, action or degradation, such as 1 alpha

hydroxylase deficiency, vitamin D resistant rickets and granulomatous disorders, in which there is

increased extra renal production of 1,25(OH)2D; however, it is not a good marker of vitamin D

status, as it has often been found to be normal in states of proven vitamin D deficiency (136).

Measurement of 1,25(OH)2D is also afflicted by similar issues that affect measurement of 25OHD

and although most laboratories use radioimmunoassay, some are using LCMS and there seems to

be a lack of good correlation across platforms (93). In addition, recent data using samples run on

Diasorin Liaison XL assay suggest that neonates and infants have higher 1,25(OH)2D levels that


26

decrease with age, although the authors were unable to conclude whether this was due to cross-

reaction with another substance (137).

2.6.4. Vitamin D Supplementation in Infancy and Antenatally

For supplementation, vitamin D is given orally either as ergocalciferol (vitamin D2) or

cholecalciferol (vitamin D3). Both undergo the same metabolism, but vitamin D2 does not seem

to raise serum 25OHD levels as high as vitamin D3. This may either be because of the inability of

the radioimmunoassay to detect vitamin D2 accurately or differential metabolism of vitamin D2

and D3 (138).

Vitamin D supplementation has been used for many years to prevent rickets in infants and

children (8, 9, 139). Breast fed infants are a particularly important group, since breast milk

contains only very small amounts of vitamin D, usually between 10-80 units per litre expressed as

antirachitic activity and correlated with maternal plasma 25 hydroxyvitamin D concentrations

(25). The recommended intake of vitamin D in all infants and children in Australia to prevent

rickets is 400 units per day (9, 125). Most infant formula in Australia contains approximately 400

units of vitamin D in every 1000 ml, but not all formula fed children are taking 1 litre of milk in the

first months of life.

Australian guidelines for vitamin D supplementation in infants and children were first published in

2006 and provided advice around supplementation requirements to treat vitamin D deficiency, as

well as doses to prevent vitamin D deficiency in children at risk. To prevent vitamin D deficiency

in infants, it was recommended that mothers be screened antenatally and if moderately to

severely deficient, treated with 3000 to 5000 units daily until a 25 hydroxyvitamin D level above

50 nmol/L was achieved (8). The guidelines were revised in 2013 and the doses were reduced,

although the authors did not indicate the reasons for this and noted that data on optimal vitamin

D dosing regimens in pregnancy are lacking. In this publication, infant and childhood doses were

recommended to be 400 to 4000 units per day, depending on age and 25OHD level, and antenatal

doses were reduced to 1000 to 2000 units daily (9) (

Table 2-6). Clinical practice guidelines in pregnancy were updated further in 2018 and a significant

change was that vitamin D testing should not be routinely performed in pregnancy in the absence

of specific risk factors; although it was recommended that vitamin D supplementation be


27

prescribed to those with 25OHD levels below 50 nmol/L. No specific recommendations regarding

vitamin D dose were provided (140). In 2016, Munns et al published a global consensus

statement on the prevention of rickets in infants and children and recommended that all infants,

irrespective of mode of feeding, be supplemented with 400 units of vitamin D from birth to 12

months, and thereafter, meet the nutritional requirements of 600 IU per day. Recommendations

for treatment of vitamin D deficient rickets in infants less than 12 months of age included 2000 IU

of vitamin D for 90 days, followed by a maintenance dose of 400 IU per day (125).

Table 2-6 Comparison of Vitamin D dosing recommendations according to Australian Guidelines in 2006 and 2013 (8, 9)

Vitamin D Level

2006 Recommendations 2013 Recommendations 2016 Recommendations

Definition 25OHD Concentration

Sufficient >50 nmol/L ≥ 50 nmol/L >50 nmol/L

Mild deficiency

25-50 nmol/L 30-49 nmol/L Insufficiency 30-50 nmol/L

Moderate deficiency

12.5-25 nmol/L 12.5-29 nmol/L Deficiency < 30 nmol/L

Severe Deficiency

< 12.5 nmol/L < 12.5 nmol/L

Age, Degree of Vitamin D Insufficiency and Vitamin D dose (IU/day)

Treatment of Vitamin D deficiency in infants and children

Age < 1 month Moderate-severe 1000 IU/day for 12 months

Preterm Mild 200 IU/day Moderate-severe 800 IU/day

Routine 25OHD screening not recommended, therefore no specific 25OHD threshold for vitamin D supplementation is targeted. 400 IU/day is recommended for all infants from birth to 12 months, independent of mode of feeding, to prevent rickets and osteomalacia. 600IU/day is recommended for children beyond 12 months of age and adults, through either diet or supplementation, to prevent rickets

Age 1-12 months Moderate-severe 3000 IU/day for 3 months or 300 000 IU over 1-7 days

Term < 3 months Mild 400 IU/day for 3 months Moderate-severe 1000 IU/day for 3 months

Age >12 months Moderate-severe 5000 IU/day for 3 months or 500 000 units over 1-7 days

3-12 months Mild 400 IU/day for 3 months Moderate-severe 1000 IU/day for 3 months or 50 000 IU stat

1-18 years Mild 1000-2000 IU/day for 3 months or 150 000 IU stat Moderate- severe 1000-2000 IU/day for 6 months or 3000-4000 IU/day for 3 months or


28

150 000 IU single dose and repeat 6 weeks later

For treatment of nutritional rickets, at least 2000 IU/day is recommended for a minimum of 3 months, in addition to at least 500 mg/day calcium either dietary or as a supplement.

Treatment of vitamin D deficiency antenatally

Mild 400 IU/day

Mild 1000 IU/day

Pregnant women should receive 600IU/day of vitamin D to prevent nutritional rickets Moderate-severe

3000-5000 IU until 25OHD 50 nmol/L then 400 IU/day

Moderate-severe 2000 IU/day until 25OHD 50 nmol/L then 600 IU/day

IU: International units. 25OHD: 25 hydroxyvitamin D Studies have assessed vitamin D sufficiency following supplementation and it has been shown

that increasing doses of vitamin D supplementation increase serum 25 hydroxyvitamin D levels in

infants (38, 141). Zeghoud et al (142) showed that supplementation with high dose cholecalciferol

led to a rise in serum calcium concentrations, albeit still within the normal range . Large doses of

vitamin D have been shown to raise serum concentrations of 25 hydroxyvitamin D above the

supposed therapeutic range, but this is not always associated with hypercalcaemia (143). In 2013

Gallo et al (144) published data from a randomized controlled trial investigating the efficacy of

different dosages of cholecalciferol to maintain serum 25OHD levels greater than 75 nmol/L. One

month old breast fed infants were randomly assigned to receive 400 IU, 800 IU, 1200 IU or 1600

IU cholecalciferol. The 1600 IU group was stopped prematurely because 93% of infants developed

25OHD concentration above 250 nmol/L at 3 months. Two patients in each group had suspected

hypercalcaemia during the study but there was limited information about these cases provided by

the study group. Vitamin D in doses of 400 units (the amount in 1 teaspoon of cod liver oil) has

not been reported to cause toxicity.

The role of vitamin D supplementation antenatally has also received significant attention.

Maternal serum 25OHD levels in the third trimester have been positively correlated with

neonatal 25OHD in cord blood and the first week of life (145, 146), with cord blood levels

reported to be approximately 62-65% of maternal serum levels at birth (147). It is well reported

that supplementing women with vitamin D during pregnancy, increases maternal serum 25OHD at


29

term and subsequently neonatal 25OHD (11, 148, 149). Higher levels of vitamin D given

antenatally have been associated with higher neonatal 25OHD levels (149). There is some

evidence that vitamin D supplementation antenatally may reduce the risk of pre-eclampsia, pre-

term birth and low birthweight, although further studies are required to confirm these findings

and until such time, the only neonatal outcome with good supportive data is an improvement in

25OHD concentration (11).

Follow up of infants born to mothers who received vitamin D supplementation antenatally has

not been rigorous. Cord blood 25OHD has been positively correlated with cord blood calcium

(146) and two studies have reported that vitamin D supplementation given antenatally seemed to

attenuate the physiological nadir in calcium and increase 1,25(OH)2D in the first week of life(150,

151). Delvin et al studied a group of women who received 1000 units of Vitamin D

supplementation in the last trimester of pregnancy and compared their offspring with women

who did not. Cord blood and blood taken at 4 days of age was assessed for calcium, 25

hydroxyvitamin D and 1,25 dihydroxyvitamin D levels. The study group noted that those who

were born to mothers receiving supplementation had significantly higher 25OHD levels on cord

blood, but they also had lower 1,25 dihydroxyvitamin D levels. On day 4 serum calcium levels

were higher in the supplemented group as were 25OHD and 1,25 dihydroxyvitamin D levels.

When compared with the samples taken from cord blood, calcium levels declined significantly in

the un-supplemented group. 25 hydroxyvitamin D levels dropped in both groups but the drop was

more pronounced in the supplemented group. 1,25 dihydroxyvitamin D levels increased in the

supplemented group but remained stable in the un-supplemented group. The authors concluded

that the supplemented group most likely had 25 hydroxyvitamin D more readily available to

convert to 1,25 dihydroxyvitamin D (150). Harrington et al also showed that in infants born to

mothers supplemented with high dose vitamin D (35, 000 IU per week) the drop in calcium level

over the first 3 days of life was attenuated. They estimated that for every 10 nmol/L increase in

cord blood vitamin D, there was 0.02 mmol/L attenuation in day 3 infant calcium. Hypercalcaemia

was reported in some infants but there was no significant difference in the rates of

hypercalcaemia between the two groups. Of note, all infant calcium levels were measured within

the first week of life (151).


30

2.6.5. Vitamin D and the Calcium Content of Breast Milk

Vitamin D content of breast milk is related to maternal ultraviolet B (UVB) exposure, maternal

vitamin D intake, and varies with season (147, 152, 153). The 25 OHD concentration of breast milk

is expressed as antirachitic activity (ARA) which is usually based on the biologic activity values of

vitamin D or 25OHD, and is about 10-80 IU/L in human milk (154). Vitamin D preferentially

transfers into breast milk rather than 25OHD, so levels are thought to be only approximately 1%

of the maternal 25OHD concentration (25, 154). Supplementation of breast feeding mothers with

vitamin D has been shown to directly correlate with infant vitamin D levels (155), but only

maternal doses of 6400 IU have been reported to raise infant vitamin D levels to that of infant

supplementation with 400 IU/day (156). The main sources of calcium in breast milk are thought to

be from increased maternal bone resorption and intestinal calcium absorption. There are large

inter-individual differences in the calcium content of breast milk but it is thought that the calcium

concentration of breast milk is unrelated to maternal dietary calcium or vitamin D. Rather, some

authors suggest that the calcium concentration of breast milk is dependent on the concentration

of casein and citrate (157, 158).

2.6.6. Vitamin D Conclusion

It is apparent from the data available to date, that whilst vitamin D deficiency is associated with

infantile rickets, the exact serum concentration to denote sufficiency, the role of vitamin D

supplementation in pregnancy and in prevention of diseases other than rickets, and the exact

amount of vitamin D to meet the health needs of infants, is still not clear. There are likely a

number of important modifying factors that determine each individual’s vitamin D requirement,

including their ethnic background, genetics, maternal vitamin D sufficiency and calcium intake.

Whilst current global recommendations to supplement all breast fed infants with 400 units

vitamin D will likely achieve the primary aim of preventing rickets, it is likely that such a blanket

recommendation may not be necessary for everyone.


31

2.7. Summary It is apparent that we have come a long way since the term ‘Idiopathic infantile hypercalcaemia’

was first coined by Lightwood in the 1950s. We now know that this term likely reflects a variety of

underlying diagnoses, which may or may not be related to an increased sensitivity to vitamin D,

including Williams syndrome, CYP24A1 mutations and FHH. However, there are many cases of

infantile hypercalcaemia that remain unlabeled, so whilst IIH may be a dwindling category, there

is much left to learn before it becomes a redundant term. In addition we still do not fully

understand the role of variants in genes involved in calcium and vitamin D metabolism, and how

these may affect how we interact with the environment around us, including response to

widespread increases in vitamin D supplementation.

Chapter 3 – Materials and Methods

32


3.1. Study Overview This study was conducted at the Sydney Children’s Hospital, Randwick, and was carried out in

three parts.

We observed an unusual increase in the number of referrals to the Endocrine service of the

Sydney Children’s Hospital for hypercalcaemia in infancy after 2010. To explore whether our

impression was correct, we surveyed our referral database from its establishment in March 2008

until March 2014 for referrals of infants with hypercalcaemia, and carried out a retrospective

chart review of the 14 infants identified with idiopathic hypercalcaemia.

To examine whether the apparent increased incidence might reflect variation in the genes known

to be involved in calcium sensing or vitamin D metabolism, the families of the above mentioned

14 infants with idiopathic hypercalcaemia were offered genetic testing for CYP24A1, CASR, GNA11

and AP2S1.

We asked if the increase in referral for hypercalcaemia was due to chance or reflected an

underlying increase in calcaemia in infancy, potentially exposed by increased vitamin D

supplementation in pregnancy. To explore this, we obtained de-identified data for serum calcium

and related analytes and 25OHD measured in all infants under 6 months of age from the South

Eastern Area Laboratory Service (SEALS), on the Randwick campus, between January 2002 and

December 2014. Because the laboratory method for measuring plasma calcium changed

significantly in January 2011, we obtained the same data on infants whose serum calcium was

measured at a peripheral hospital, also under the umbrella of SEALS, whose laboratory platform

changed 4 months prior to that at Randwick.

3.2. Ethics The study was approved by the Sydney Children’s Hospitals Network Human Research Ethics

Committee’s Executive HREC/14/SCHN/372. Site authorization was provided by the Sydney


33

Children’s Hospital research and governance office SSA/14/SCHN/380. Written informed consent

was provided by the parents of children who underwent genetic testing.

3.3. Definitions Hypercalcaemia was defined as a total serum calcium concentration above 2.75 mmol/l,

according to the reference ranges in place for SEALS during the study period (Table 2-1, page 9).

Hypocalcaemia was defined as total serum calcium concentration below 1.9 mmol/l in neonates

under the age of 2 weeks, and below 2.25 mmol/l for infants between 2 weeks and 6 months of

age.

Ionised calcium concentrations were used to validate trends seen in the total calcium data set,

and hypercalcaemia and hypocalcaemia were defined according to the age related reference

ranges detailed in Table 2-2, page 9.

Vitamin D sufficiency was defined as 25 hydroxyvitamin D (25OHD) concentration greater than or

equal to 50 nmol/L, as defined by the 2013 Australian and New Zealand position statement (9).

Severity of vitamin D insufficiency was defined by the same statement (

Table 2-6, page 27).

Reference ranges for other analytes were as defined by SEALS laboratory (Table 3-1) 1,25

dihydroxyvitamin D (1,25(OH)2D) levels were measured by radioimmunoassay at 2 external

laboratories, both with the same reference interval

Reference ranges for paediatric urinary calcium:creatinine ratios have not been established for

our laboratory. Urinary calcium:creatinine ratios are higher in infants than in adults and decrease

with age, likely related to the immature neonatal kidney and the rise in creatinine as muscle mass

increases with age. In infants less than 6 months of age, reference intervals with an upper limit of

normal from 1.5 to 2.4 mmol/mmol have been reported (159-161). For the purpose of this study

we chose to use the reference interval 0.4-2.2 mmol/mmol, reported by Matos et al, on the

advice of the renal physicians in our centre (159).


34

Table 3-1 SEALS reference ranges for analytes including 1,25(OH)2D, parathyroid hormone, phosphate, magnesium and alkaline phosphatase.

Test Age Reference Interval

1,25(OH)2D (pmol/L) 0 – 18 years 60-158

PTH (pmol/L) 0 – 18 years 0.5-5

Phosphate (mmol/L) 0-14 days 1.7-3

14 days-12 months 1.3-2.3

Magnesium (mmol/L) 0 – adult 0.65-1.02

ALP (U/L) 0-2 years 80-450

1,25(OH)2D: 1,25 dihydroxyvitamin D. ALP: alkaline phosphatase. PTH: parathyroid hormone.

3.4. Subjects with Idiopathic Infantile Hypercalcaemia To confirm our impression that the number of referrals had increased, infants referred to the

Endocrine Department at Sydney Children’s Hospital for the management of hypercalcaemia were

identified by searching a password protected database of electronically stored weekly inpatient

and consultation handover records available from March 2008. At the end of each on call week, a

new handover record is generated in Microsoft Word and saved by the on call registrar who has

been responsible for receiving all acute referrals for that week. The record captures all referrals

including those being managed at peripheral referring hospitals, patients who have been

discharged and those who are still being monitored and will be handed over to the new on call

team. Twenty-eight infants referred between March 2008 and March 2014 were identified using

the search terms ‘hypercalcaemia’, ‘hypercalcemia’ and ‘calcium’, and their clinical and

biochemical findings were analysed by chart review. To be included in our analysis, the infants

had to have documented hypercalcaemia for which there was no diagnosis, be aged less than 6

months at presentation and to have been assessed and treated by one of the endocrinologists in

our department (either as an inpatient, outpatient or in consultation with a general

paediatrician). Infants were excluded if they did not have sufficient medical information available

including at least 1 month of follow up biochemistry, to determine response to treatment and

outcome (Figure 3-1).

To check whether the increased number of referrals for hypercalcaemia was paralleled by an

increase in referral numbers generally, the number of patients being ‘handed over’ to the new on

call team was manually counted on each weekly list for the randomly chosen three month periods


35

of January to March and August to October each year from March 2008 to March 2014. This did

not showed a significant increase in the total number of referrals in each 12 month period (March

to March) over the 6 years (p=0.149), although there was an increase in the 2013/2014 year

(Table 3-2). To validate our method of capture, referrals during that time were scrutinized for

infants referred for hypercalcaemia We found 5 hypercalcemic patients who had not been

captured in our original analysis, however these five infants would not have met criteria to be

included in our cohort of patients with IIH because of: insufficient data; hypercalcaemia

secondary to distal RTA; hypercalcaemia following treatment for hypocalcaemia in the setting of

CHARGE syndrome; and hypercalcaemia that developed in intensive care in two infants following

major surgery for congenital diaphragmatic hernia repair or coarctation repair, respectively. We

also reviewed the rates of presentation for hypocalcaemia in the total data set, using the search

terms ‘hypocalcaemia’, ‘hypocalcemia’, ‘hypocalcaemic seizure’, ‘rickets’ and ‘vitamin D

deficiency’. There were 25 referrals for hypocalcaemia between March 2008 and March 2014. Of

these 25 referrals, only 6 patients were less than 6 months of age and all of these were referred

between March 2008 and August 2010. Four of these patients were captured in our count of the

handover lists. In summary, on review of the handover record, there was no significant increase

in referrals from March 2008 to March 2014, although there was a decrease from 2 to zero cases

of hypocalcaemia and a 7 fold increase in cases of hypercalcaemia captured within the same

record.

Table 3-2 Number of patients on handover lists for August, September and October (Aug-Oct) and January, February and March (Jan-Mar) each year from March 2008 to March 2014, including number of infants less than 6 months old identified as having hypercalcaemia and hypocalcaemia and hypercalcaemic infants not captured in the original analysis.

Year^ (Mar -Mar)

Number of patients on handover list

Number of infants with hypercalcaemia

Number of infants with hypocalcaemia

Number of hyercalcaemic infants not captured in original analysis

Aug-Oct Jan-Mar Total Aug-Oct Jan-Mar Aug-Oct Jan-Mar

08/09 276 136 412 1 0 1 1 1*

09/10 254 155 409 1 0 0 1 0

10/11 201 203 404 0 0 1 0 0

11/12 154 225 379 3 3 0 0 0

12/13 203 239 442 2 5 0 0 1*

13/14 246 280 526 2 5 0 0 3*


36

^Year was calculated from March to March, commencing March 2008 when handover records were first available *Did not meet inclusion criteria due to: insufficient data; hypercalcaemia secondary to distal RTA; hypercalcaemia following treatment for hypocalcaemia in the setting of CHARGE syndrome; hypercalcaemia developed in intensive care following major surgery for congenital diaphragmatic hernia or coarctation repair, respectively. Jan: January. Mar: March. Aug: August. Oct: October.

Figure 3-1 Decision tree used to identify infants with idiopathic infantile hypercalcaemia at Sydney Children’s Hospital March 2008 to March 2014

From the charts of the 14 infants identified with idiopathic infantile hypercalcaemia, clinical data

related to the presentation with hypercalcaemia were obtained, including symptoms leading to

the diagnosis of hypercalcaemia (specifically lethargy, poor weight gain, poor feeding or

vomiting), the presence of prior co-morbidities, and documentation of nephrocalcinosis on renal

ultrasound. The history of maternal vitamin D supplementation during pregnancy and infant

vitamin D supplementation postnatally was also obtained retrospectively. Serum calcium (total,


37

and where available, ionised), magnesium, phosphate, albumin, alkaline phosphatase, PTH,

25OHD and 1,25(OH)2D concentrations and urinary calcium:creatinine ratios were obtained from

the biochemical records of each patient.

All patients were treated with a low calcium formula (Locasol™, by Nutricia). Details of the

infants’ biochemistry during treatment and the duration of treatment were extracted from the

individual files.

3.5. Genetic Analysis The families of the 14 infants identified were approached to obtain blood for DNA for analysis of

the CYP24A1 gene, involved in vitamin D degradation (page 18) and the genes associated with

calcium sensing, namely CASR, GNA11 and AP2S1 (page 21), and nine families agreed to

participate.

Testing was performed at the Kolling Institute, a medical research facility at Royal North Shore

Hospital, which provides genetic testing for endocrine conditions that affect calcium, vitamin D

and phosphate regulation. All patients provided written informed consent for genetic testing. The

institute provided a summary of the techniques used for DNA sequencing. DNA was extracted

from peripheral blood leukocytes using the QIAamp DNA Blood Mini Kit (Qiagen). A custom gene

panel (TruSeq Custom Amplicon Assay, Illumina), including CASR, GNA11 and AP2S1 was

developed using DesignStudio (Illumina) to create libraries that are sequenced on Illumina MiSeq

platform. The protein-coding exons and flanking intronic regions of each of the genes were

encompassed. DNA (250 ng) was prepared from each sample according to the manufacturer’s

instructions (TruSeq Custom Amplicon Assay, Illumina). Sequencing data were analysed using

Illumina Miseq Reporter software (v2.3, Illumina) which assess sequencing quality, aligns

sequencing reads to the reference human genome [hg19] using a banded Smith-Waterman

algorithm and identifies variants (using the Genome Analysis Toolkit [GATK]). Annotation of

variants was performed using ANNOVAR (version 2013 Jul) (162), while visualization of data was

performed with the Integrated Genomics Viewer (IGV, v2.3, ww.broadinstitute.org) which allows

exploration of data aligned to the selected reference genome. To confirm findings, coding exons

of the gene of interest were amplified by Polymerase Chain Reaction (PCR) and the PCR products


38

were examined by Sanger sequencing which is outsourced to AGRF (Westmead, NATA ACC No.:

14332) where the samples are analysed using Big Dye Terminators (BDT) and capillary

electrophoresis on an AB3730xl DNA analyser. Each PCR product is sequenced in the forward and

reverse direction. The primer sequences used for CASR, AP2S1, GNA11 and CYP24A1 are detailed

in Table 3-3.

Table 3-3 Primer sequences for CASR, AP2S1 and GNA11 mutation analyses

Exon Name Primer

CASR

2 CaSR-2F CaSR-2R

ATCCCTTGCCCTGGAGAGACGGC AGAGAAGAGATTGGCAGATTAGGCC

3 CaSR-3F CaSR-3R

AGCTTCCCATTTTCTTCCACTTCTT CCCGTCTGAGAAGGCTTGAGTACCT

4A CaSR-4AF CaSR-4AR

ACTCATTCACCATGTTCTTGGTTCT GCTGTTGCTAAACCTGTCGC

4B CaSR-4BF CaSR-4BR

CCCAGGAAGTCTGTCCACAATG CCCAACTCTGCTTTATTATACAGCA

5 CaSR-5F CaSR-5R

GGCTTGTACTCATTCTTTGCTCCTC GACATCTGGTTTTCTGATGGACAGC

6 CaSR-6F CaSR-6R

CAAGGACCTCTGGACCTCCCTTTGC GACCAAGCCCTGCACAGTGCCCAAG


AGTCTGTGCCACACAATAACTCACTC CTTGTTGAAGATGCACGCCA


TGCTCATCTTCTTCATCGTCTGG CTCTCTGCATTCTCCCTAGCCCAGT

2 CaSR-2F CaSR-2R

ATCCCTTGCCCTGGAGAGACGGC AGAGAAGAGATTGGCAGATTAGGCC

3 CaSR-3F CaSR-3R

AGCTTCCCATTTTCTTCCACTTCTT CCCGTCTGAGAAGGCTTGAGTACCT


ACTCATTCACCATGTTCTTGGTTCT GCTGTTGCTAAACCTGTCGC


CCCAGGAAGTCTGTCCACAATG CCCAACTCTGCTTTATTATACAGCA

5 CaSR-5F CaSR-5R

GGCTTGTACTCATTCTTTGCTCCTC GACATCTGGTTTTCTGATGGACAGC

6 CaSR-6F CaSR-6R

CAAGGACCTCTGGACCTCCCTTTGC GACCAAGCCCTGCACAGTGCCCAAG

GNA11

1 GNA11 1F GNA11 1R

CCAGCCTGCTAGGTTGTCC ACTCACCGAGCAGCAGCAG

2 GNA11 2F GNA11 2R

GCAGGGTCTGGGTAAGAGG ATGGATGACCAGGGGTAGC

3 GNA11 3F CGAGCTCTCGACGTCTCC


39

GNA11 3R CCTTCCCGAAGGGTCCCA

4 GNA11 4F GNA11 4R

GTGCTGTGTCCCTGTCCTG GGGCAAATGAGCCTCTCAG

5 GNA11 5F GNA11 5R

GCCAGGTGGCTGAGTCCT CACTGCACACAGCCCAAG

6 GNA11 6F GNA11 6R

CTTGGGCTGTGTGCAGTG ATGAGCCCCTCTCCCATATC

7 GNA11 7F GNA11 7R

ACAAAGGGGCCCACGAGT GTGTCTCCATCCCGTCTC

AP2S1

1 AP2S1 1F AP2S1 1R

CTGGTTCTTCAGCATCTCG CAGAGAAGGGACTTGTCAGC

2 AP2S1 2F AP2S1 2R

AGCCCTATCTCCCCTCTGG GAAGCAAGCAAGCTCAAAGC

3 AP2S1 3F AP2S1 3R

GAGTGAAGGAGTGAATGTTTTGG AAGAAATGGAGAGGGAGAGTCC

4 AP2S1 4F AP2S1 4R

AGGCTGGTCTTGCACTCCTA AGCTGGGACACAGACCTCAG

5 AP2S1 5F AP2S1 5R

ATCAGAGCCCCAGCTTCC GAAGGACTGCTGGGTTGG

CYP24A1

1 CYP24A1 Ex1_F CYP24A1 Ex1_R

CCCTCTTTGCTTCCTTTTCC ATGTCGGGGAGGGTTTG


GAGGAAGGAGGCGGGAG CCGTCAGGCTCATCAGGTC


GCTGGAGTATTTCTGCATCTCC CCACCAATATCCCTATGTCCC


ATGCGATGTAGCAAGACCTG TGCCTGTTTACAAAAGAGTTGTC


GGCATAGAATTGAGTCTTTAATAACC TGGGAATCACTGTGAAGTTCTG


CCTCTTCCAGAACGAACATTG TGAAGCTCCAGACACGGG


TGCAAGAAGGAGTTTGGACTG TGAATCCCAGTGAAATGAATG


TTGCAGAATAAGGTGGTGGG TAATTAGCTAGGGGAAGCCG


AATCTGCATTCCCATTGACAC CAAAGTCTAGGGAGATCTGGTG

10-11 CYP24A1 Ex10-11_F CYP24A1 Ex10-11_R

CAATTTTGCCATTCAAAGGTC GCTCATCCCTCGTCATTCTC


CCGGAAAGCAAACTTCAAAC AACAAAATAATGCCCCAGTG


40

Only genetic changes, including common variants, within exons were reported. Common variants

(sometimes referred to as polymorphisms) are defined as genetic variations that occur in greater

than 1% of the population. The allele frequency (AF) from the ExAC (Exome Aggregation

Consortium) database was provided for the variants identified (http://exac.broadinstitute.org).

The AF refers to the frequency with which the reported allele occurs in the population. An AF of

0.45 means that 45% of chromosomes studied will carry that allele. In some cases a reported

variant may be the more frequent allele, but has been identified as a variant because it differs

from the allele that was identified when constructing the human reference genome. Information

from ClinVar (https://www.ncbi.nlm.nih.gov/clinvar), a public database of reports of the

relationship between genetic variants and phenotypes was used to further asses the likely

pathogenicity of variants identified.

When variants occur in the coding region of the protein, they can be synonymous or non-

synonymous. Synonymous variations do not change the amino acid sequence of the protein,

whereas non-synonymous variations change the amino acid sequence of the protein.

Synonymous variants are unlikely to have functional consequences or effects on phenotype but

both synonymous and non-synonymous variants are reported for completeness.

3.6. Identification of Trends in Calcaemia in Infants To determine if there was a trend to increased calcium concentrations amongst infants and

whether the incidence of hypercalcaemia and hypocalcaemia changed over time, we requested all

episodes of biochemical data (serum total calcium, ionised calcium, albumin, phosphate, PTH, ALP

and 25OHD) collected between 1st January 2002 and 31st December 2014 for all infants aged less

than 6 months at the time of sampling. Initially, these data were requested for infants sampled at

the Randwick campus comprising Sydney Children’s Hospital, Prince of Wales Private Hospital and

the Royal Hospital for Women. Subsequently, the same data were requested from an external

hospital site under the umbrella of SEALS, to confirm their generalizability and to test the possible

contribution of a change in the laboratory assay platform, which occurred approximately 4

months earlier at the peripheral site.

http://exac.broadinstitute.org/

https://www.ncbi.nlm.nih.gov/clinvar


41

The data provided by SEALS were de-identified with each patient assigned a record number

(independent of their medical record number) and episode numbers to denote each occasion of

testing for an individual patient. The episode numbers also allowed identification of analytes run

concurrently. To be included, site of analysis, the date of birth for each infant and the date of

each episode of sampling had to be available to allow calculation of the age of the infant at each

time point.

Because of the potential for cord blood samples to positively skew analysis of the incidence of

hypercalcaemia, data from patients less than 1 day of age were excluded from all analyses. For

analysis of calcium-related analytes (phosphate, magnesium, alkaline phosphatase, albumin and

PTH), only samples associated with a total calcium concentration were used.

From the data provided, there were 26 765 measurements of total calcium concentration in 6146

infants, 83 228 measurements of ionised calcium in 9128 infants and 1581 measurements of

25OHD in 1398 infants across both sites.

Of note, whereas serum calcium or ionised calcium concentration has to be specifically requested

on a venous sample for it to be measured, ionised calcium is measured routinely in all venous or

arterial blood gas samples. The total calcium data set of 26 765 measurements, included 237

samples paired with ionised calcium. The paired total and ionised calcium measurements were

only available from 2009 to 2014. The ionised calcium data set comprising 83 228 measurements

was completely independent of the total calcium data set and was used to validate trends

suggested by the total calcium data set.

Analysis of total calcium was separated by site (Randwick or peripheral site) whereas ionised

calcium concentrations and 25OHD were combined for both sites, because the assays were the

same at each site and either did not change during the study period (ionised calcium) or changed

at the same time (25OHD).

To determine if there was an increase in total calcium concentration over the 12 year time period

of the study, serum calcium values were analysed by year, adjusted for age and multiple

observations per subject. To further examine any trend, the same analysis was performed for


42

calcium-related analytes and for the separate data set of ionised calcium. Correlations between

analytes paired with total calcium concentration were sought to confirm expected associations as

further validation of the data.

To determine if the rates of hypercalcaemia and hypocalcaemia changed over time, the

prevalence of each was reviewed by year of collection for both total calcium and ionised calcium.

Only the first serum total calcium or ionised calcium measurement was used on each infant, to

exclude multiple observations per patient and to minimize the effect of any therapeutic

intervention.

To determine if changes in calcium assay between 2010 and 2013 were associated with an

increase in calcium concentrations, we performed a comparison of the 2 year period prior to the

initial change of analyser, the approximately 2 year period that followed this prior to the

subsequent modification of the assay, and the approximately 2 year period from the assay

modification to the end of our data collection in December 2014. The comparison was performed

separately for both the Randwick and peripheral sites. The same assessment was performed for

ionised calcium values taken from a separate data set containing all ionised calcium, and also

ionised calcium paired with the first total calcium from each patient, which was available from

2009 to 2014.

Vitamin D was analysed to assess for changes in measurement frequency and concentration.

Because the method for measuring 25OHD changed in 2005 and 2014, with significant differences

reported between assays (163-166), we only assessed 25OHD values measured on the Diasorin

analyser from 14/11/05 to 14/07/2014 (n=1407 25OHD measurements in 1246 patients). The

trend for 25OHD concentrations was analysed over the study period, adjusted for the inclusion of

multiple observations per patient. To determine if there was an increase in the rate of vitamin D

sufficiency over time, 25OHD measurements above and below 50 nmol/L were reviewed by year

of collection, based on the first 25OHD level per patient.

3.7. SEALs Laboratory Platforms The analysers used for total calcium, ionised calcium and 25OHD are detailed in Table 3-4 and the

analysers used for the other analytes are detailed in Table 3-5.


43

The Diasorin Liaison chemiluminescence immunoassay (Diasorin, Saluggia, Italy) was used for

measurement of 25OHD from 2005 to 2014. The total interbatch imprecision was 10.6%. Before

2005 25OHD was measured on the Nichols Advantage chemiluminescence protein binding

immunoassay and after 2014 25OHD was measured using LCMS. Only the 25OHD measurements

on the Diasorin Liaison assay were analysed for this study. From 2002 to 2013, PTH was measured

using the Immulite chemiluminescent enzyme labelled immunoassay (Diagnostic Products

Corporation, Los Angeles), which measures intact PTH. From 2013 PTH was measured using Roche

e601 electrochemiluminescence immunoassay (Roche Diagnostics, Rotkreuz, Switzerland) which

measures intact PTH. The interbatch imprecision was less than 3.5%. 1,25 dihydroxyvitamin D was

referred to an external laboratory and measured on Diasorin radioimmunoassay (Diasorin,

Saluggia, Italy).

Serum biochemistry was measured using basic spectrophotometry assays run on a standard

chemistry analyser. For calcium analysis, the Randwick laboratory moved from Beckman to Roche

analyser (with cresolphtaleine assay) in January 2011 and, based on internal laboratory

correlations, there was a positive bias in calcium measurements of 2.2%, up to 4-5% in the higher

calcium ranges, such as in neonates. Roche later changed their assay from cresolphtaleine to the

BAPTA method, which is thought to be less likely to be inaccurate in the presence of high

concentrations of magnesium ions and contrast agents (167). This new assay was used in the

Randwick laboratory from January 2013 and based on internal correlations, was thought to

correct the previously noted upward bias in calcium concentrations.

The peripheral site moved to a Roche analyser (with cresolphtaleine assay) in August 2010, which

was being run concurrently with a Beckman Coulter analyser, until September 2010 when only

Roche analysers were used. The peripheral site changed to the Roche BAPTA method on the

same date as Randwick, in January 2013.

The ionised calcium assay did not change between 2002 and 2012 at either site.

Despite the many changes in method, there was no change in reference interval for total calcium

concentration at SEALS laboratory between 2002 and 2014 for infants less than 6 months of age.


44

Corrected calcium levels were not used due to previous data showing that they are unreliable in

infants under 12 months of age (20).

Table 3-4 Analysers used for serum calcium, urine calcium, ionised calcium and 25 hydroxyvitamin D at SEALS Randwick and peripheral site 2002-2014

Time 2002 2014

Analyte Site 14/11/05 22/09/10 14/01/11 23/1/13 14/7/14

Total calcium/Urine calcium

Randwick Beckman Coulter Roche Cobas

Roche Cobas with BAPTA method

Peripheral site

Beckman Coulter Roche Cobas Roche Cobas with BAPTA method

Ionised Calcium

Both sites Radiometer ABL blood gas analyser

25OHD Both sites Nicholls Advantage

Diasorin Liaison LCMS

LCMS: liquid chromatography tandem mass spectrometry. 25OHD: 25 hydroxyvitamin D. Table 3-5 Analysers used for biochemical analytes at SEALS Randwick and peripheral site 2002-2014

Time 2002 2014

Analyte Site 18 May 2006

22 Sept 2010

Dec 2010

14 Jan 2011

18 Oct 2013

17 Dec 2013

Mg Randwick Beckman Coulter Roche Cobas

Peripheral site

Beckman Coulter Roche Cobas

Phos Randwick Beckman Coulter Roche Cobas

Peripheral site


ALP Randwick Beckman Coulter

DXC880i Roche Cobas

Peripheral site


PTH Randwick Immulite Roche e601

Peripheral site

Sent to Randwick Roche e601

Albumin Randwick Beckman Coulter Roche Cobas

Peripheral site


Cr Randwick Beckman Coulter Roche Cobas with CREJ method

Roche Cobas with CREJ2 method

Peripheral site

Beckman Coulter Roche Cobas with CREJ method Roche Cobas with CREJ2 method

Mg: Magnesium. Phos: Phosphate. ALP: Alkaline Phosphatase. PTH: Parathyroid Hormone. Cr: Creatinine. LCMS: liquid chromatography tandem mass spectrometry.


45

3.8. Statistical Analysis

Statistical analyses were performed using IBM SPSS Statistical Software Version 25 (IBM Corp.

Released 2017. IBM SPSS Statistics for Windows, Version 25.0. Armonk, NY: IBM Corp) and

reviewed by a statistician.

For the small cohort assessment, median values were reported for non-normally distributed data,

with range reported to describe the variability in the data. Spearman’s correlations were used to

determine the relationship between continuous variables. Time series analysis was used to assess

for significant changes in handover counts over time.

For the larger data set, linear mixed models were used to assess for significant changes in

biochemical concentrations over time, adjusted for potential confounding factors and multiple

observations per patient. Multinomial logistic regressions were used to assess for significant

changes in rates of hypercalcaemia and hypocalcaemia over time. Linear regressions were used to

analyse correlations between continuous variables. Time series analysis was used to assess for

significant changes in frequency of vitamin D and calcium measurements over time. Chi Square

tests were used to compare categorical variables. An analysis of covariance (ANCOVA) with

Bonferroni post hoc test was used to assess for differences in estimated marginal mean of calcium

concentration before and after the analyser and assay changes.

For all statistical tests, p value < 0.05 was considered significant.

Chapter 4 – Results

46


4.1. Sydney Children’s Hospital Idiopathic Infantile Hypercalcaemia Case Series 2008-2014

4.1.1. Cases Series of Idiopathic Infantile Hypercalcaemia Of the 14 patients (Table 4-1) included in the study, none presented between March 2008 and

March 2011; 5 were diagnosed between March 2011 and March 2012; 6 were diagnosed between

March 2012 and March 2013; and 3 were diagnosed between March 2013 and March 2014. All

were managed for hypercalcaemia by the Department of Paediatric Endocrinology either as

inpatients or outpatients of the hospital or in consultation with general paediatricians, if managed

at remote sites. If we had used the AACB harmonized reference interval introduced in 2014 with

an upper limit of calcium of 2.8 mmol/L, two infants (Patients 3 and 12) would not have met the

criteria for hypercalcaemia based on their first elevated calcium, but would have met the criteria

based on subsequent calcium measurements (calcium 2.82 mmol/L and 2.84 mmol/L,

respectively). Eight infants had non-specific symptoms consistent with hypercalcaemia, namely

poor weight gain (n= 6), lethargy (n= 6), poor feeding (n=5), vomiting (n=1) and/or irritability (n=

1). In the remaining 6 infants, hypercalcaemia was identified incidentally. Calcium concentrations

were measured in those identified incidentally because of respectively: prolonged jaundice; scalp

nodules (later thought to be bony protuberances); thyroid function tests in an infant born to a

mother with hypothyroidism; previous hypoglycaemia; routine blood tests in an infant with

hypopituitarism; and routine follow up blood tests in an infant born with low APGAR scores and

respiratory distress. Comorbidities (in addition to symptoms attributable to hypercalcaemia) were

present in 11/14 infants and are detailed in Table 4-2. Hypercalcaemia was classified as idiopathic

in the absence of clinical and biochemical evidence for potential causes including dehydration, fat

necrosis, FHH, hyperparathyroidism and Williams syndrome. None of the patients had dysmorphic

features suggestive of Williams syndrome and it was excluded in 10/14 patients (Patients

1,2,3,4,6,7,8,10,12 and 13) by fluorescence in situ hybridization (FISH). The median gestational

age was 40 weeks [33-41] with only two infants born at less than 36 weeks gestation, and the

median age at presentation was 17 days [5-53].


47

Table 4-1 Clinical Characteristics of patients managed for idiopathic infantile hypercalcaemia at Sydney Children’s Hospital 2011-2014

Clinical Characteristic Number affected/Number in whom data available (%)

Male 4/14 (29)

Comorbidities including prematurity 11/14 (79)

Breast milk exclusively at diagnosis^ 11/12 (92)

Maternal vitamin D supplementation^ 10/11 (91)

Infant vitamin D supplementation 1/14 (7)

Symptomatic hypercalcaemia* 8/14 (57) ^Information not available in all patients * Lethargy, poor weight gain, poor feeding or vomiting


48

Table 4-2 Reason for initial calcium measurement and comorbidities in patients managed for idiopathic infantile hypercalcaemia at Sydney Children’s Hospital 2011-2014

Patient Reason for initial calcium

measurement Comorbidities

1 Presented with fever, rash, lethargy and irritability

Small patent foramen ovale on echocardiogram, not requiring treatment. Small bilateral subdural haematomas.

2 Nodules noted on head (likely bony protuberances).

Scalp nodules.

3 Routine blood tests in premature infant with comorbidities. Loss of 10% birth weight.

Gestation 35+5. Twin 2 (MCDA). Growth retardation. Hypoglycaemia. Poor feeding. Anaemia. Discordant growth.

4 Meconium aspiration. Meconium liquor and fetal distress during delivery. Respiratory distress syndrome at birth and low APGAR scores (41/65). Treated with antibiotics for meconium aspiration. On intravenous fluids initially, started breast feeds on day 2 of life. Mother on calcium supplements.

5 Hypopituitarism and diabetes insipidus.

Septo optic dysplasia and panhypopituitarism on full replacement.

6 Mother hypothyroid and on thyroxine.

No comorbidities.

7 Hypoxic ischaemia encephalopathy, vomiting and failure to thrive

Hypoxic ischaemic encephalopathy secondary to perinatal asphyxia with multi-organ failure. Renal dysfunction and hypoglycaemia. Feeding difficulties. Tremor ?basal ganglia injury and mild cerebral palsy.

8 Poor feeding, lethargy and weight loss.

Treated for possible neonatal sepsis.

9 Postnatal follow up of microdeletion.

16p13.11 microdeletion diagnosed in utero.

10 Failure to thrive. No comorbidities.

11 Prematurity and poor weight gain.

33+5 weeks gestation. IUGR. VSD/pericardial effusion. Respiratory distress at birth. Dysmorphic features. Persistent tachypnea. Pulmonary hypertension.

12 Poor weight gain. No comorbidities.

13 Prolonged jaundice. Presented with prolonged jaundice, breast buds and umbilical granuloma.

14 Lassitude and poor feeding Hypotonia.

Vitamin D supplementation was given as cholecalciferol to 10/11 mothers in whom the

information was available. Six women received vitamin D as part of their multivitamin in doses of

350 or 500 IU daily (patients 1, 2, 4, 7, 9 and 13). One of these mothers was intermittently taking

1000 IU daily in addition to the multivitamin and increased this to 2000 units daily in the last


49

trimester (patient 13). Two women were taking 1000 IU daily (patients 6 and 10) and two women

were taking 2000 IU daily (patients 3 and 8). Two women were also taking calcium

supplementation (patients 9 and 10).

Nephrocalcinosis was identified in 4/13 infants who had a renal ultrasound (patients 7, 10, 11 and

14). The baseline biochemistry in those who did and did not develop nephrocalcinosis is detailed

in Table 4-3, however no statistical analyses were done because of the small numbers.

Table 4-3 Baseline biochemistry in patients who developed nephrocalcinosis and those who did not, in a cohort of infants treated for idiopathic infantile hypercalcaemia at Sydney Children’s Hospital 2011-2014

Median Baseline Values Nephrocalcinosis (n=4) No nephrocalcinosis (n=10)

Calcium (mmol/L 2.98 [2.88-4.03] 2.90 [2.8-3.12]

Magnesium (mmol/L) 0.93 [0.69-0.93] (n=3) 0.75 [0.69-0.98]

Phosphate (mmol/L) 1.95 [1.23-2.08] (n=3) 2.13 [1.1-2.24] (n=9)

PTH (pmol/L) 0.5 [0.3-3.1] 0.75 [0.3-1.6] (n=8)

25OHD (nmol/L) 88 [44-218] 39.5 [17-73] (n=8)

1,25(OH)2D (pmol/L) 68 [64-190] (n=3) 214 [174-302] (n=3)

PTH: parathyroid hormone. 25OHD: 25 hydroxyvitamin D. 1,25(OH)2D: 1,25 dihydroxyvitamin D. n: total number.

4.1.2. Biochemistry of Patients with Idiopathic Infantile Hypercalcaemia

The biochemical characteristics for each individual patient at baseline are detailed in Table 4-4,

page 51. The baseline total calcium was the first calcium recorded at consultation with us and

associated chemistry was obtained either concurrently or within one week of the baseline

calcium. The median serum calcium concentration at presentation was 2.92 mmol/L [range 2.79-

4.03]. All paired magnesium levels fell within the reference range and are not included.

Twelve patients had a PTH concentration obtained a median of 1 day [range 0-5] after the

baseline calcium. None of these patients had an elevated PTH level. Five PTH levels were below

and seven were within the reference range (0.5-5 pmol/L) with a median PTH concentration of 0.6

pmol/L [range 0.3-3.1] at the time of hypercalcaemia (median 2.92 mmol/L [2.8-4.03]). For the

remaining two patients (patients 5 and 8) PTH levels were taken on days 13 and 17 from the

baseline calcium and were, respectively, 2.5 pmol/L with paired calcium 2.9 mmol/L, and 3 pmol/L

with paired calcium 2.67 mmol/L.


50

Twelve infants had 25OHD concentrations measured within one week of baseline and in six of

them, concentrations were below 50 nmol/L (median 56 nmol/L [range 17-218]). In ten patients

there was associated hypercalcaemia (median paired calcium concentration 2.89 mmol/L [range

2.6-3.5]). There were no 25OHD levels above 250 nmol/L. The remaining two patients (patients 5

and 6) had 25OHD levels of 52 nmol/L and 30 nmol/L respectively with paired calcium 2.9 mmol/L

and 2.46 mmol/L, 13 and 11 days from baseline.

1,25(OH)2D concentrations were available in six patients within 1 week of consultation and above

the reference range in four patients (median 182 [64-302]), despite high calcium concentrations

(median 2.98 mmol/L [2.83-3.5]), implicating vitamin D metabolism as potentially contributing to

the hypercalcaemia.

Urinary calcium:creatinine ratios paired with a serum calcium concentration were measured in 11

infants a median of 2 days [range 0-5] after the first consultation. Ten of the eleven were still

hypercalcaemic, 7 of whom were hypercalciuric. None of the remaining 4 had hypocalciuria as

defined by either the reference range or the literature (168).

Alkaline phosphatase measurements were within the reference range in all 10 patients in whom it

was measured within one week of baseline.

Serum calcium concentrations were normal in 8 mothers and 3 fathers in whom it was measured.


51

Table 4-4 Biochemical data at baseline (or within 1 week of baseline) from 14 patients treated for idiopathic infantile hypercalcaemia at Sydney children’s Hospital 2011-2014

Patient

Age first consult

(days)

Ca at first

consult (mmol/

L)

PO4 (mmol/

l)

PTH (pmol/L)

(Paired Ca, days from

first consult)

ALP (Paired Ca, days

from first consult)

First 25OHD (nmol/L)

(Paired Ca, days from

first consult)

First 1,25(OH)2D (pmol/L) (Paired Ca, days from

first consult)

First Ur Ca:Cr (mmol/mmol)

(Paired Ca, days from first

consult)

RI 1.9-2.75

1.3-2.3 0.5-5 80-450

>50 60-158 0.09-2.2

1 10 3.02 1.69 0.4

(Ca 2.84; +1 day)

278 40 (Ca 2.84; +1

day)

7.9 (Ca 2.82; +3days)

2 17 2.86 2.24 1.2 124 39 174 0.4

3 17 2.8 2.19 1.6 274 68

(2.6; +2 days)

4 5 3.01 1.1 0.3 107

32 3

(Ca 2.69; +1 day)

5 19 2.93 2.13

0.4

(Ca 2.92; +2 days)

6 5 2.83

Haem (PO4 2.0;

+3days)

0.5 (Ca 2.93; +4days)

2.3

(Ca 2.93; +4days)

7* 25 3.04 1.95 0.3

(Ca 3.16; +2days)

144 (Ca 3.16: +2days)

44 68

8 17 2.82 1.87 73

(Ca 2.71; +3 days)

1.9

9 8 3.12 1.73 0.3

(Ca 3.07; +5 days)

146 69 (Ca3.07; +5

days)

302 (Ca 3.07; +5 days)

4.4 (Ca 3.07; +5

days)

10* 50 4.03 1.23 0.3 232 102

(Ca 3.5; +1 day)

64 (Ca 3.5; +1

day)

3.8 (Ca 3.5; +1

day)

11* 53 2.88 2.08 3.1

(Ca 2.8; +4 days)

218 (Ca 2.8; +4

days)

7.3 (+3 days)

12 14 2.79 2.14 1.6

(Ca 2.84; +2 days)

167 33 (Ca=2.84; +2days)

1.2

(Ca 2.8; +4 days)

13 20 3.03 2.16 1 281

17 214

(Ca 2.83; +2 days)

7

14* 10 2.92

1.93 (Ca

2.91; +1day)

0.7 (Ca 2.91; +1

day)

150 (Ca 2.91; +1

day) 74 190

3.65 (Ca 2.77; +2days)


52

Baseline biochemistry in patients treated for idiopathic infantile hypercalcaemia. The calcium concentration is the first elevated calcium recorded at consultation with our team. If associated biochemistry was not taken concurrently with baseline calcium, the value taken within 1 week of the initial consultation is reported together with the paired calcium and the number of days from consultation in brackets. PTH in patients 5 and 8 were measured 13 and 17 days, respectively, after baseline and are described in the text. *Nephrocalcinosis on renal ultrasound. PO4: phosphate. PTH: parathyroid hormone. 25OHD: 25 hydroxyvitamin D. 1,25(OH)2D: 1,25 dihydroxyvitamin D. Ur Ca:Cr: urinary calcium creatinine ratio. ALP: Alkaline phosphatase. Day: days from first consultation. RI: reference interval. Haem: haemolysed

Relationship Between Calcium Related Analytes Run Concurrently

Consistent with normal physiology, there was a significant negative correlation between PTH and

calcium concentrations (n= 12, r = -0.827, p=0.001, Spearman’s correlation), and a significant

positive correlation between phosphate concentration and PTH (n=10, r =0.919, p<0.001,

Spearman’s correlation). There was no significant correlation between calcium and phosphate

concentration (n=12, r=-0.566, p=0.055, Spearman’s correlation) and there were no significant

correlations between calcium concentration and either the first 25OHD level (n=12, r=-0.077,

p=0.812, Spearman’s correlation) or the first 1,25(OH)2D (n=6, r=-0.371, p=0.468, Spearman’s

correlation)

4.1.3. Management of Patients with Idiopathic Infantile Hypercalcaemia Of the 14 patients, 7 received IV fluids (patients 1, 2, 3, 6, 7, 10 and 13) and 2 received frusemide

(patients 2 and 7) for acute management of hypercalcaemia. All patients were treated with low

calcium formula (Locasol™). Treatment with low calcium formula was started once

hypercalcaemia was confirmed and the infant was able to tolerate oral feeds. The proportion of

Locasol™ prescribed (versus breast milk or formula feeds) was at the discretion of the treating

physician and was adjusted according to subsequent serum calcium concentrations.

Hypercalcaemia resolved in all infants in response to Locasol™. Most patients responded quickly,

with 13/14 patients having normal calcium levels recorded within 1 week of the initial

consultation. In the remaining patient (patient 12) calcium levels did not normalize until 12 days

after the initial consultation. Locasol™ treatment was continued then weaned and stopped once

calcium levels had normalized and were stable. The median time from consultation to stopping

full Locasol™ feeds was 49 days [0-183]. Three patients were never treated with full Locasol™

feeds. The median time of treatment from consultation until Locasol™ was stopped completely

was 226 days [24-1827] in 11/14 patients in whom this information was available.


53

4.1.4. High Parathyroid Hormone (PTH) During Treatment with Locasol™

For all patients, follow up was individualized and at the discretion of the treating physician, with

weaning of low calcium formula usually based on serum calcium and hormonal investigations

variably performed. Results for PTH measured subsequent to the initial values were available for

13/14 infants a median of 89 days [range 9-357] after diagnosis (Table 4-5). In 9 infants the PTH

concentration had increased to above the reference range (median 10.7 pmol/L [Range 5.9-49.3]),

associated with a serum calcium concentration in the upper half of the reference range (>2.5

mmol/L) in 7/9 infants (median for the 9 infants: 2.68 mmol/L [range 2.11-2.79]. Five of 9 patients

were receiving Locasol™ exclusively at the time of the increased PTH.

Only 2 of 9 infants with a high PTH had a 25OHD concentration above 50 nmol/L; however of the

6 with values falling within the deficient or severely deficient range, only 2 (patients 3 and 4) had

biochemistry consistent with Vitamin D deficiency (Table 4-5). Seven of 9 infants with an elevated

PTH had an ALP measured at the time of the PTH or within 1 week and in 2 patients the ALP was

elevated above the reference interval.

Relationship between analytes

There were no significant correlations between PTH and Calcium, phosphate and PTH, calcium

and phosphate or calcium and 25OHD when all patients were analysed whilst on treatment with

Locasol; however there was a significant negative correlation between 25OHD and PTH (n=10, r=-

0.796, p=0.006, Spearman’s correlation). When only those who developed a rise in their PTH were

analysed, there was a significant negative correlation between PTH and calcium (n=9, r=-0.733,

p=0.025, Spearman’s correlation) and a significant positive correlation between 25OHD and

calcium (n=8, r = 0.886, p=0.003). There was also a significant negative correlation between PTH

and 25OHD (n=8, r=-0.790, p=0.02), however there was no significant correlation between

phosphate and PTH (n=9, r =0.100, p =0.798) or calcium and phosphate (n=9, r =-0.067, p=0.865).

These data are consistent with Locasol treatment leading to vitamin D deficiency and perturbed

mineral metabolism; however the fact that many of the patients still had relatively high calcium

concentration suggests an alteration in the calcium set point.


54

Table 4-5 PTH values and associated biochemical data in infants whilst on Locasol™ treatment for idiopathic hypercalcaemia at Sydney Children’s Hospital 2011-2014

Patients in bold had elevated PTH. For patients with elevated PTH, the biochemical data is provided at the time of the first elevated PTH whilst on mostly Locasol™ or all Locasol™ feeds and with the most complete additional biochemistry. For patients without elevated PTH, the most complete biochemical data whilst on treatment with Locasol™ is provided. *Nephrocalcinosis on ultrasound. PTH: parathyroid hormone. Ca: calcium. PO4: phosphate. 25OHD: 25 hydroxyvitamin D. ALP: alkaline phosphatase. RI: reference interval

4.1.5. Outcome After Cessation of Locasol™

The median calcium concentration was 2.55 mmol/L [2.41-2.88] 1-6 months after stopping

Locasol in the 11/14 for whom the duration of Locasol treatment was known. 25OHD levels were

above 50 nmol/L in the 8 patients in whom they were measured (Table 4-6).

For the 4 patients with nephrocalcinosis, the ultrasound findings were unchanged in 3 patients

(patients 7, 10 and 11) who had follow-up ultrasounds at 3 years, 5 years and 8 months

respectively. In 1 patient (patient 4), the nephrocalcinosis was improving on follow up ultrasound

at 4 months.

Patient

Time from first

consult

(days)

Ca (mmol/

L)

PO4 (mmol/L

)

PTH (pmol

/L)

ALP (within

1 week;I

U/L)

Paired 25OHD

(within 1 week;

nmol/L)

Paired 125 OHD

(within 1 week;

pmol/L)

Time on Locasol™

exclusively (days)

Total time on Locasol (days)

RI 1.9-2.75

1.3-2.3 0.5-5 80-450

>50 60-158

1 125 2.75 2.15 12.8 23 0 708

2 35 2.57 3.22 5 35

3 150 2.29 1.87 17.8 608 16 158

4 51 2.11 2.58 49.3 452 10 51 226

5 357 2.52 1.93 2.5 182 456

6 190 2.69 1.8 4.2 43 597 183 213

7* 160 2.76 1.92 6.6 395 62 47 1827

8 17 2.67 2.04 3 324 0 24

9 216 2.46 2 1 226 71 7

10* 51 2.56 1.32 10.7 10 62 64 986

11* 53 2.93 2 5.9 394 119 720 145 145

12 136 2.57 2.39 9.5 441 38 298

13 9 2.68 2.69 8.2 247 47 179 139 139

14* 46 2.69 2.45 10.8 235 20 0


55

Table 4-6 Follow up biochemistry, taken after stopping Locasol™, in 14 patients treated for idiopathic infantile hypercalcaemia at Sydney Children’s Hospital 2002 to 2014

Patient

Biochemistry after Locasol™ stopped

Time after

Locasol™ stopped (months)

Ca (mmol/L)

Mg (mmol/L)

PO4 (mmol/L)

ALP PTH

(pmol/L)

25OHD (nmol/L

)

1,25(OH)2D

(pmol/L)

Urine Ca:Cr

(mmol/mmol)

RI 2.25-2.75 0.65-1.02 1.3-2.3 0.5-5 >50 60-158 0.4-2.2

1 1 2.56 3.9 110 190

2 3 2.5 2.59

3 ND

4 1 2.53 0.81 2.13 200 2.8 53

5 2 2.49 0.88 1.71

6 6 2.61 0.86 1.86 2.4 83 237

7* 2 2.51 0.83 1.73 5.6 72

8 0.5 2.55 0.82 2.06 368

9 ND

10* 1 2.41 0.76 1.45 0.3 74

11* 1.5 2.74^ 0.92 1.94 6.2 67 434 1

12 1 2.75^ 1.01 1.85 273 2 54

13 1 2.88^ 1.04 2.2 4.9 67 148 0.9

14* ND

Biochemistry off Locasol™ is provided as close as possible to 1 month, but at least 2 weeks, off treatment and with the most complete additional data. ^Subsequent total calcium concentrations were documented to drop well into the reference range. *Nephrocalcinosis on ultrasound. PTH: parathyroid hormone. Ca: calcium. PO4: phosphate. Mg: magnesium. 25OHD: 25OHD. 1,25(OH)2D: 1,25 dihydroxyvitamin D. Urine Ca:Cr: urine calcium creatinine ratio. ALP: alkaline phosphatase. ND: No data. RI: reference interval.

4.1.6. Genetic Results

The results of genetic testing are detailed in Table 4-7.

There was good coverage of genes, except for exon 1 GNA11 for all patients, exon 6 GNA11 for

patient 7 and exons 5 and 6 GNA11 for patients 4 and 10, due to difficulty with PCR.

No pathogenic variants were found in any patient according to ClinVar

(https://www.ncbi.nlm.nih.gov/clinvar)

Benign genetic variants were reported in 7 patients and in 5 patients 1 or more of the variants

was non synonymous. 1 patient was wild type for all 4 genes



56

No patient had non synonymous variants in CYP24A1 but 5 patients had non synonymous variants

in CASR, AP2S1 or both, although the biochemistry at baseline in these patients was not

suggestive of hypocalciuric hypercalcaemia.

Although none of the variants is reported as pathogenic, A986S has been associated with higher

serum calcium and R990G has been associated with hypercalciuria (118, 119, 121, 169).


57

Table 4-7 Genetic testing results including common variants in AP2S1, CASR, GNA11 and CYP24A1, in 9 patients treated for idiopathic infantile hypercalcaemia at Sydney children’s Hospital 2011-2014

Pt AP2S1 CASR GNA11 CYP24A1

1 WT WT WT (exons 2-7) WT

2 Non synonymous c.164T>G, p.I55S AF 0.49

Non synonymous c.3031G>C, p.E1011Q AF 0.95 c.2968A>G, p.R990G AF 0.15 Synonymous c.2244G>C p.P748P AF 0.99

Synonymous c.771C>T p.T257T AF 0.43

Synonymous c.552C>T, p.A184A (homozygous) AF 0.49

4 WT WT WT (exons 2,3,4,7) Synonymous c.552C>T, p.A184A (homozygous) AF 0.49 c.1125G>A, p.P375P AF 0.28


Non synonymous c.3031G>C, p.E1011Q AF 0.95 Synonymous c.2244G>C p.P748P AF0.99


Synonymous c.552C>T, p.A184A (homozygous) AF 0.49 c.1125G>A, p.P375P AF 0.28

6 WT Non synonymous c.3031G>C, p.E1011Q AF 0.95 c.2956G>T, p.A986S AF 0.13 Synonymous c.2244G>C p.P748P AF 0.99


WT

7 WT WT WT (exons2-5,7) Synonymous c.552C>T, p.A184A (homozygous) AF 0.49

8 WT Non Synonymous C1333A>G, p.T445A AF 0.02

WT (exons2-7) Synonymous c.552C>T, p.A184A AF 0.49

10 WT WT WT (exons 2,3,4,7) WT


Non synonymous c.3031G>C, p.E1011Q AF 0.95 Synonymous c.2244G>C p.P748P AF 0.99

WT Synonymous c.552C>T, p.A184A (homozygous) AF 0.49 c.1125G>A, p.P375P AF 0.28

WT: wild type. AF: Allele frequency from ExAC database. All variants were heterozygous unless stipulated as homozygous in brackets. Pt: patient


58

4.2. Analysis of SEALS laboratory Data 2002-2014

4.2.1. Overview of Data There were 131 372 episodes of biochemical measurements obtained from infants aged between

1 day and 6 months from all sites. The numbers and descriptive data for each analyte that was

paired with total calcium are detailed in Table 4-8. Ionised calcium data paired with total calcium

was only available from 2009. The numbers of total and ionised calcium measurements and of

25OHD according to the number of patients from whom these measurements were obtained and

the spread of calcaemia and vitamin D sufficiency are described in the cohort diagrams (Figure

4-1, Figure 4-2 and Figure 4-3). There was a significant difference in proportions of

hypocalcaemia (p<0.001, chi square) between the Randwick site and the peripheral site, which

may be explained by the volume of critically ill patients under 6 months of age being managed in

the neonatal and paediatric Intensive care units at Randwick. There was a smaller but significant

difference in proportions of hypercalcaemia (p=0.037, chi square). The age distribution of the

episodes of total calcium measurement is detailed in Figure 4-4. For all calcium values (and paired

analytes), 50% were measured in infants 30 days of age or younger. The number of calcium

measurements per year for total calcium concentration at each site and ionised calcium

incorporating both sites are shown in Figure 4-5 and Figure 4-6 respectively. There was a

significant increase in the frequency of total calcium measurements at the Randwick site

(p<0.001) but not at the peripheral site (p=0.986) from 2002 to 2014. There was no significant

increase in the frequency of ionised calcium measurements at all sites (p=0.107).


59

Table 4-8 Descriptive data for biochemical analytes paired with total calcium at SEALS Randwick and peripheral site 2002-2014

n Median [range] Mean (SD)

Calcium (mmol/L) 26765 2.33 [0.92-4.75] 2.31 (0.270

Ionised calcium (paired with total calcium and

only available from 2009) (mmol/L)

237 1.36 [0.87-1.83] 1.34 (0.10)

Magnesium (mmol/L) 25693 0.87 [0.08-3.56] 0.88 (0.16)

Phosphate (mmol/L) 25352 1.97 [0.27-6.85] 1.99 (0.51)

25 OHD (nmol/L) 429 61 [10-319] 69.85 (43.47)

PTH (pmol/L) 371 3.4 [0.1-81.2] 7.36 (10.56)

25 OHD: 25OHD, PTH: parathyroid hormone. SD: standard deviation. n: total number.

Figure 4-1 Total calcium data set: Cohort diagram of the number of total calcium measurements in infants 1 day to 6 months of age at SEALS Randwick and peripheral site 2002-2014


60

Figure 4-2 Ionised calcium data set: Cohort diagram of the number of ionised calcium measurements in infants 1 day to 6 months of age at SEALS Randwick and the peripheral site 2002-2014

Figure 4-3 25OHD data set: Cohort diagram of the number of 25 hydroxyvitamin D measurements (25OHD) in infants 1 day to 6 months of age at SEALS Randwick and the peripheral site


61

Figure 4-4 Age distribution (days) of all total calcium measurements in infants aged 1 day to 6 months at SEALS either site (Randwick and peripheral site) between 2002 and 2014

Figure 4-5 Number of infants per year aged 1 day to 6 months, who had a total calcium concentration measured at SEALS Randwick (blue) and peripheral site (red) between 2002 and 2014


62

Figure 4-6 Number of infants per year aged 1 day to 6 months who had an ionised calcium concentration measured at SEALS at either site (Randwick and peripheral site) between 2002 and 2014


63

4.2.2. Prevalence of Hypercalcaemia and Hypocalcaemia

4.2.2.1. Calcium: Prevalence of hypercalcaemia and hypocalcaemia Over time, at the Randwick site, the prevalence of hypercalcaemia increased (P<0.001, OR =1.24

95% CI = 1.18-1.31, Multinomial Logistic Regression) and of hypocalcaemia decreased (P<0.001,

OR =0.88 95% CI = 0.86-0.89, Multinomial Logistic Regression; Figure 4-7). A similar trend was

seen for hypercalcaemia at the peripheral site (P=0.003, OR =1.16 95% CI = 1.05-1.27, Multinomial

Logistic Regression) but not hypocalcaemia (P=0.549, Multinomial Logistic Regression; Figure 4-8).

These data were supported by analysis of the ionised calcium data set in which the prevalence of

hypercalcaemia increased (P<0.001, OR =1.13 95% CI = 1.07-1.19, Multinomial Logistic

Regression) and the prevalence of hypocalcaemia decreased (P<0.001, OR =0.89 95% CI = 0.87-

0.90, Multinomial Logistic Regression) over time (Figure 4-9).

Figure 4-7 Prevalence of hypercalcaemia and hypocalcaemia by year at the Randwick site 2002 to 2014 based on age related reference intervals and the first total calcium measurement per patient in infants 1 day to 6 months of age.


64

Figure 4-8 Prevalence of hypercalcaemia and hypocalcaemia by year at the peripheral site 2002 to 2014 based on age related reference intervals and the first total calcium measurement per patient in infants 1 day to 6 months of age.

Figure 4-9 Prevalence of hypercalcaemia and hypocalcaemia by year at all sites 2002 to 2014 based on age related reference intervals and the first ionised calcium measurement per patient in infants 1 day to 6 months of age.


65

4.2.3. Analysis of Calcium Concentration over time for Total Calcium and Ionised Calcium To explore whether the rise in cases of hypercalcaemia and decrease in cases of hypocalcaemia

might reflect a general rise in calcium concentration, we also assessed change in total calcium

concentration at each site and ionised calcium concentration at both sites, over time.

4.2.3.1 Calcium concentration over time Total calcium concentrations at each site and ionised calcium concentrations at both, significantly

increased over time adjusted for age and the inclusion of multiple observations per subject

(P<0.001 using a linear mixed model; Figure 4-10, Figure 4-11 and Figure 4-12). On average, each

year, total calcium increased by 0.019 mmol/L at Randwick and 0.01mmol/l at the peripheral site

and ionised calcium by 0.015 mmol/L across all sites When the data set for ionised calcium was

restricted to only those who had a paired total calcium measurement from 2009, the trend to

increase was maintained (p=0.001 using a linear mixed model; Figure 4-13)

Figure 4-10 Total calcium concentration by date collected at the Randwick site 2002 to 2014 for infants 1 day to 6 months of age.

Red line: 2.75 mmol/L. Green line: 1.9 mmol/L. Blue line: line of fit.


66

Figure 4-11 Total calcium concentration by date collected at the peripheral site 2002 to 2014 for infants 1 day to 6 months of age.


Figure 4-12 Ionised calcium concentration by date collected at all sites 2002 to 2014 for infants 1 day to 6 months of age.

Red line: Calcium 1.5 mmol/L. Green line: Calcium 0.93 mmol/L.


67

Figure 4-13 Ionised calcium concentration (paired with calcium levels from the total calcium data set) by date collected at all sites 2009 to 2014 for infants 1 day to 6 months of age.

Red line 1.5 mmol/L. Green line 0.93 mmol/L. Blue line: line of fit.

4.2.4. Comparison of Total Calcium Concentration Between Sites According to Changes in Assay To determine if the change in assay may have contributed to the observed rise in calcaemia, we

used an ANCOVA with Bonferroni post hoc test, adjusted for age, to compare means of total

serum calcium 2 years before the analyser change (group 1), the approximately 2 years between

the analyser and assay change (group 2) and the approximately 2 years after the assay change

until the end of the study (group 3), at each site (Table 4-9). The Randwick site changed its

calcium analyser on 14/1/11 and made a further change to the assay on 23/1/13, whereas the

peripheral site changed the calcium analyser on 22/9/10 and made a further change to the assay

on 23/1/13 (Table 3-4).

At the Randwick site, the mean total calcium concentrations differed significantly between groups

(p<0.001). The mean total calcium concentration increased after the analyser change (p<0.001).

The mean total calcium concentration decreased after the subsequent assay change (p<0.001) but


68

remained above that prior to the analyser change (p=0.003). This was in keeping with the

laboratory’s own observation that the initial analyser change led to a small increase in total

calcium that was corrected with the updated assay in 2013. However, we found that although an

increase in mean calcium concentration was noted after the analyser change at the peripheral

site, this did not correct after the 2nd assay change (p<0.001 for all groups, p<0.001 group 1 and 2,

p<0.001 group 1 and 3 and p=0.314 group 2 and 3). A similar pattern was observed when

analysing the paired samples for total and ionised calcium for the Randwick site. The mean total

calcium concentration increased after the change in analyser (p<0.001) but did not fall

subsequently (p=0.304) and the mean ionised calcium concentration did not change in these

paired samples (p=0.809). These findings support a contribution from the change in analyser to

the increase in total calcium observed. On the other hand, analysis of the separate ionised

calcium data set at Randwick, using the time periods corresponding to the changes in analyser

and assay for total calcium, showed a significant increase in mean ionised calcium suggesting that

there was an increase in calcaemia independent of changes in the analyser (p<0.001 for all

groups, p<0.001 groups 1 and 2, p<0.001 groups 1 and 3 and p=0.676 groups 2 and 3)

Table 4-9 Mean calcium ± SD for total calcium and ionised calcium at the Randwick and peripheral sites approximately 2 years before and after the analyser and assay changes for infants 1 day to 6 months of age.

Total Ca (mmol/L) Ionised Ca (mmol/L) mean ±SD

Paired Sample

Total Ca (mmol/L)

Ionised Ca (mmol/L)

Site Statistic Randwick† Peripheral site†

Randwick† Randwick† Randwick

Group 1

Mean ±SD (n)

2.32±0.27 (850)^

2.42±0.19 (91)

1.19 ±0.17 (1908)

2.47 ±0.13 (23)^

1.34 ±0.08 (23)

Group 2

Mean ±SD (n)

2.41 ±0.30 (994)*

2.56±0.21 (139)*

1.24 ±0.15 (1858)*

2.64 ±0.19 (40)*

1.36 ±0.09 (40)

Group 3

Mean ±SD (n)

2.36 ±0.29 (1136)*^

2.51±0.20 (110)*

1.25 ±0.13 (1677)*

2.59 ±0.14 (76)*

1.35±0.06 (76)

*Significantly different from group 1 p<0.05 ^Significantly different from group 2 p<0.05 †Significant overall difference between 3 groups p<0.05. Group 1: 2 years prior to the analyser change. Group 2: between the analyser and assay change (approximately 2 years). Group 3: from the assay change until the end of the study (approximately 2 years). Ca: calcium. SD: standard deviation. n: total number of samples


69

4.2.5 Analysis of Vitamin D

4.2.5.1 Vitamin D sufficiency Over Time To determine whether there was an increased interest in vitamin D testing and/or sufficiency, in

association with changes in rates of hypercalcaemia, we assessed frequency of vitamin D testing

over time and changes in the number of cases that would be defined as sufficient or insufficient.

Using only the data obtained with the Diasorin analyser, there were 1407 vitamin D levels across

both sites between 14/11/05 and 14/07/2014 in 1246 patients, 90.8% of them (n= 1132) after

2009. In keeping with this, there was a significant increase in frequency of vitamin D testing over

time (p=0.015, time series analysis) but there was no significant change in the prevalence of

vitamin D sufficiency over time (p=0.662, Binary Logistic regression; Figure 4-14)

Figure 4-14 Measurements of 25 hydroxyvitamin D by year at all sites (Randwick and peripheral site) in infants 1 day to 6 months of age, and defined as sufficient (25OHD ≥50nmol/L) or insufficient (25OH D<50 nmol/L)

For the 308 paired measurements of calcium and 25OHD (Diasorin assay), the median total

calcium was 2.55 mmol/L [1.42-3.56] and the median 25OHD was 59 nmol/L [20-319]; thus, as

illustrated in Figure 4-15 many infants with a 25OHD as low as 10 nmol/L had total calcium


70

concentration well within the reference range. There was no significant correlation between

25OHD and calcium (p=0.752). There was also no significant correlation between the 144 paired

PTH and 25OHD levels (p=0.983; Figure 4-16), nor was there a significant correlation between the

295 paired ALP and 25OHD measurements (p=0.716); however, there was a significant negative

correlation between the 122 paired PTH and calcium measurements (p=0.014, ᵝ=-0.222, r =0.222)

and a significant positive correlation between the 88 paired ALP and PTH measurements

(p<0.001, ᵝ=0.385, r=0.385). Taking the calcium measurements of greater than 2.75 mmol/L

(n=35) the median paired 25OHD was 53 nmol/L [11-144] and taking the calcium measurements

below 2.25 nmol/L (n=29) the median paired 25OHD was 50 nmol/L [11-243]. These data

underline the necessity of assessing 25OHD concentrations in the context of calcaemia.

Figure 4-15 25 hydroxyvitamin D and total calcium correlation all sites (Randwick and peripheral site) in infants 1 day to 6 months of age.

Green vertical line: Vitamin D 50 nmol/L. Red horizontal line: Calcium 2.75 mmol/L. Blue line: line of fit


71

Figure 4-16 25 hydroxyvitamin D and PTH correlation all sites (Randwick and peripheral site) in infants 1 day to 6 months of age.

Green vertical line: Vitamin D 50 nmol/L. Red horizontal line: PTH 5.0 pmol/L. Blue line: line of fit.

4.2.5.2. Vitamin D Concentration over Time

Combining data from both sites, Vitamin D concentration significantly decreased over time,

excluding infants on day 1 of life and adjusted for the inclusion of multiple observations per

subject. On average vitamin D decreased by 1.59 nmol/L each year (P=0.001 using a linear mixed

model; Figure 4-17).


72

Figure 4-17 25 hydroxyvitamin D concentration (nmol/L) by date collected at all sites (Randwick and peripheral site) 2002 to 2014 in infants 1 day to 6 months of age.

Red line:50 nmol/L. Blue line: line of fit.

Although there was a significant decrease in vitamin D levels over time, there was a significant

increase in paired calcium concentration (P<0.001 using a linear mixed model). On average and

across all sites, each year, total calcium concentration increased by 0.038 mmol/L. There was no

significant change in PTH concentration (n=144; p = 0.897) nor was there any significant change in

ALP (n=295; p=0.896).


73

Figure 4-18 Calcium concentration (paired with 25 hydroxyvitamin; mmol/L) by date collected at all sites (Randwick and peripheral site) 2002 to 2014 in infants 1 day to 6 months of age.


4.2.6 Analysis of Calcium Related Analytes

4.2.6.1. Correlation of Paired Analytes Of the 26765 calcium values, 25 352 had paired phosphate concentrations, 308 had paired

vitamin D (Diasorin assay only), 371 had paired PTH and 237 had paired ionised calcium (from

2009 to 2014 only). The expected physiological relationships were found. There was a significant

relationship between calcium and ionised calcium (p=0.004, ᵝ =0.601, r=0.601). There were

significant inverse relationships between calcium and phosphate (p<0.001, ᵝ=-0.106, r=0.106),

calcium and PTH (p<0.001, ᵝ =-0.229, r=0.229) and PTH and phosphate (p=0.002, ᵝ=-0.160, r=

0.160). There was no significant relationship between 25OHD and either calcium (p=0.752) or PTH

(p=0.684).


74

4.2.6.2. Change in Concentration of Calcium Related Analytes Over Time Combining the data from both sites over the 12 years, there was an average annual increase in

the concentrations of PTH and ALP by 0.58 pmol/L and 6.68 U/L respectively (P<0.001 using a

linear mixed model). Magnesium decreased by 0.002 mmol/L and phosphate by 0.02 mmol/L per

year P<0.001 using a linear mixed model). The concentration of albumin decreased by an average

of 0.05 g/L (p<0.001 using a linear mixed model).

Chapter 5 – Discussion

75


Analysis of our referral data confirmed that we experienced a spike in referrals for idiopathic

hypercalcaemia of infancy between March 2011 and March 2014 albeit in a younger age group

than originally reported by Lightwood (1, 83). The biochemical profiles of the infants referred was

similar to other reported cases of IIH; however the CYP24A1 gene implicated in some infants with

idiopathic hypercalcaemia was normal in all those tested. All infants responded well to reduced

calcium intake; however we noted that prolonged use of a low calcium feed was associated with

an increase in PTH and low 25OHD in most infants, even if total calcium concentrations remained

in the upper part of the reference range. This might indicate an abnormality of calcium sensing;

however there was no genetic evidence for this in those tested. We suggest that prolonged

treatment with low calcium feed needs close monitoring and early weaning because of the

potentially deleterious effect of raised PTH on bone health.

Analysis of laboratory-based population data in infants under 6 months of age identified an

increase in prevalence of hypercalcaemia, a decrease in prevalence of hypocalcaemia and a

gradual increase in both total and ionised calcaemia over 12 years; however we found no direct

evidence to link vitamin D supplementation in pregnancy with the rise in calcaemia. While some

of the change in total calcaemia is likely to be explained by a change in laboratory assay around

2011, hypercalcaemia in the infants referred to us was associated in many cases with significant

morbidity and was unlikely to be explained by assay variation. Although the frequency of

measurements of 25OHD increased with time, the concentration of 25OHD did not increase and

nor did the number of values above 50 nmol/L despite the widespread practice of vitamin D

supplementation during pregnancy, evident in our own cohort of hypercalcaemic infants. The

overall lack of correlation between calcaemia and 25OHD concentration, in both our cohort of IIH

and the laboratory-based population data, and the association of concentrations of 25OHD

classified as indicating moderate to severe vitamin D deficiency with total calcium concentrations

well within or above the reference range, suggests that the 25OHD concentration in an individual

should not be interpreted in isolation, as it more likely reflects both vitamin D stores and adaptive

vitamin D metabolism.


76

The infants in our cohort had similar biochemical findings to previously described cases of IIH in

whom high calcium, low or normal PTH, high 1,25(OH)2D and normal 25OHD have been reported

(3, 4, 90, 99), a pattern also thought to implicate vitamin D in the aetiology (170). None of our

patients had elevated 25OHD (> 250 nmol/L) and in 6/12, the 25OHD concentration was below 50

nmol/L (Table 4-4, page 51); however 1,25(OH)2D measured within a week of the initial

consultation was above the reference range in 4 of 6 infants, associated with hypercalcaemia and

a PTH concentration below or in the lower part of the reference range. Several reports have

shown a similar pattern of high 1,25(OH)2D in spite of normal or in some cases, low, 25OHD (4),

suggesting that 1,25(OH)2D is driving the hypercalcaemia via increased intestinal absorption. The

underlying pathology explaining the divergent pattern of 25OHD and 1,25(OH)2D concentrations

may be either increased activity of the 1 alpha hydroxylase, resulting in increased conversion of

25OHD to 1,25(OH)2D (4) or impaired destruction of 1,25(OH)2D but normal breakdown of

25OHD, as occurs in CYP24A1 mutations (170). 1,25(OH)2D promotes intestinal and renal

phosphate absorption and therefore an excess of 1,25(OH)2D should be associated with high or

high-normal phosphate concentration (170). None of our patients had a phosphate concentration

above the reference range; however in 9/14 the phosphate concentration was in the upper half of

the reference range despite hypercalcaemia (Table 4-4, page 51).

There were two obvious differences between our cohort of IIH infants and those previously

reported: they were younger and there was a high rate of comorbidity, ranging from prematurity

and difficult deliveries to neonatal sepsis and genetic mutations (not associated with

hypercalcaemia). All patients in our cohort were diagnosed in the first 2 months of life, with 12 of

14 presenting within the first month of life, whereas IIH has been described as usually presenting

between 3 and 7 months of age (4, 99). Only one infant in our case series was receiving vitamin D

supplementation (as a low dose in an infant multivitamin), but 10 of 11 patients in whom the

information was available were born to mothers who received relatively modest antenatal

vitamin D supplementation. Five mothers were taking vitamin D in doses ranging from 1000 to

2000 units per day and 5 mothers were receiving lower dose vitamin D (350-500 units per day) in

multivitamin preparations. Antenatal vitamin D supplementation has been studied extensively.

Most studies do not report an increased incidence of infant hypercalcaemia; however there are

data to suggest that the physiological nadir usually seen in serum calcium within the first 48 hours

of life is attenuated in those exposed to antenatal vitamin D (151). A recent study by Roth et al


77

(171) found that antenatal vitamin D supplementation was associated with higher calcium

concentration in cord blood and at 3 months of age compared with the infants of placebo treated

mothers, although this effect was no longer seen at 6 months. Brooke et al also noted that serum

calcium concentrations in infants on days 3 and 6 of life were higher in those whose mothers

received 1000 units of calciferol each day during pregnancy (172). In addition, a recent systematic

review and meta-analysis of the effects of maternal vitamin D supplementation also concluded

that neonates had higher calcium concentrations (173). We did not find direct evidence to

support our original hypothesis that maternal vitamin D supplementation unmasked a

predisposition to hypercalcaemia, however; the absence of a definable aetiology, the early

presentation and the resolution in all infants after a period of support with low calcium feed

raises the possibility that the hypercalcaemia was a carry-over from the environment in utero,

and/or that post-natal events uncovered a predisposition to hypercalcaemia. If following

antenatal vitamin D supplementation neonates are more calcium replete, it is feasible that non-

pathological genetic variants affecting vitamin D metabolism or calcium sensing, or stimuli of

1,25(OH)2D production unrelated to mineral metabolism could be associated with a

predisposition to hypercalcaemia.

In critically ill adults and children, low 25OHD concentrations have been associated with greater

illness severity and mortality, but the direction of association is unclear. Some authors propose a

role for vitamin D status as a prognostic tool; however it is likely that critical illness or therapeutic

intervention in very unwell patients modifies vitamin D metabolism, and this is supported by the

finding that 25OHD levels decrease during acute illness in adult patients (174, 175). Potential

mechanisms to explain the low 25OHD levels in critically ill patients include haemodilution by

intravenous fluid, a decrease in vitamin D binding protein or conversion of 25OHD to its

metabolites (176). A dysregulated vitamin D metabolism model has also been proposed in chronic

inflammation, whereby bacterial pathogens invade cells and increase 1,25(OH)2D in an attempt to

upregulate the vitamin D receptor; 25OHD is then rapidly broken down and levels decrease (177).

25OHD may therefore be a particularly poor measure of vitamin D status in patients with critical

illness, chronic inflammation or other co-morbidities, and might explain the findings in our study,

whereby 6/14 patients had 25OHD levels below 50 nmol/L despite elevated total calcium and in

some cases, elevated 1,25(OH)2D.


78

It should be noted that 1,25(OH)2D is not measured routinely in all laboratories and the assays

are not robust. Difference between assays and poor correlation between platforms has been

reported (93). In addition, reference ranges for adults have been used for infants and children,

likely related to the accepted physiology that neonatal 1,25(OH)2D levels rise after birth and

reach adult levels within the first week of life(12, 13); however, recent data suggest that neonates

and infants may have higher 1,25 dihydroxyvitamin D levels that decline with age (137).

Nearly all of our patients were fed with breast milk exclusively at diagnosis and responded quickly

to the introduction of Locasol™, raising the possibility that the calcium concentration of the

breast milk may have contributed to the hypercalcaemia. One study comparing lactating mice

sufficient or insufficient for 1 alpha hydroxylase, suggested that 1,25 dihydroxyvitamin D and

dietary calcium had an effect on the calcium concentration of breast milk (178). However there is

no evidence to date in human studies that maternal vitamin D supplementation or even maternal

calcium intake alters the calcium content of breast milk (157, 158, 179). The calcium content of

breast milk appears to be highly variable between populations and it is likely that genetic factors,

rather than dietary calcium or vitamin D, are of more significance in determining the calcium

concentration of breast milk (180).

Alterations in intestinal calcium absorption also might explain sensitivity to the calcium content of

milk. Current evidence, mostly based on animal models, suggests that neonatal absorption of

calcium results from passive non-saturable paracellular transport, but shifts towards more active

saturable transcellular transport with increasing postnatal age. Mouse models suggest that the

greatest transition in gut absorption mechanisms is around the time of weaning and may be

related to upregulation in the expression of genes involved in transcellular transport, including

TRPV6 (transient receptor potential vallinoid 6 calcium channel) and CaBP9K (Calbindin-9K

calcium binding protein)(181). In mouse models, 1,25(OH)2D has been shown to increase

transcription of TRPV6 and CaBP9K in the intestine around the time of weaning. In vivo studies

have also shown 1,25(OH)2D to increase passive calcium absorption, although the findings have

not been replicated in studies in adult rodents (181). Given that there is some evidence to show a

greater increase in 1,25(OH)2D across the first 4 days of life in infants born to mothers

supplemented with vitamin D (150), it is possible that antenatal vitamin D supplementation


79

modifies or enhances changes in the intestinal absorption of calcium in the infant, however no

studies have looked at this in detail.

In four of twelve infants in whom it was measured within a week of the initial consultation, the

urinary calcium:creatinine ratio was inappropriately low or normal in association with

hypercalcaemia, raising the possibility of Familial Hypocalciuric Hypercalcaemia (FHH). Because of

the range of biochemical findings in FHH, this diagnosis can be hard to exclude and assessment of

parental serum and urinary calcium looking for FHH was incomplete in our cohort. Urinary

calcium:creatinine ratios within or even above the reference range have been reported in proven

FHH, particularly in neonates (16), however none of the 9 infants tested, including 2 who had

ratios < 0.5, had pathological variants of the genes known to be associated with FHH. Moreover,

the biochemistry both prior to and during Locasol™ treatment was inconsistent with an

abnormality of calcium sensing in those who had common non-synonymous genetic variants of

the CASR and/or AP2S1 genes.

An unexpected finding in our cohort of patients was the rise in PTH noted over the course of

treatment with Locasol™, despite calcium levels at the upper end of the reference interval. The

combination of low calcium and no vitamin D intake associated with prolonged, exclusive

Locasol™ feeds would predispose to vitamin D deficient rickets. Nine of 13 patients who had PTH

levels measured had elevated PTH, associated with calcium levels in the upper half of the

reference range in 7/9. Only 5/9 were exclusively on Locasol™ at the time. Of 10 infants who had

a paired 25OHD concentration, only 3 had values above 50nmol/l. Of the remaining 7/10, 5 had

values <25nmol/l, two of whom had low or low-normal calcium concentrations and increased ALP

consistent with vitamin D deficiency (Table 4-5, 54). No radiological examinations were

performed in any of the infants.

The association of increased PTH, low 25OHD and relatively high calcium concentrations seen in

four of the patients is suggestive of a calcium sensing receptor abnormality. Fujisawa et al

reported similar findings in an infant with an AP2S1 mutation, consistent with FHH type 3 (16).

Treatment of the symptomatic infant with low calcium formula resulted in resolution of

symptoms and improved growth, but PTH became elevated as serum calcium normalized. We did

not find genetic evidence for pathogenic calcium sensing receptor abnormalities in our cohort,


80

and in the 5 patients who had common non synonymous variants in at least one of the genes

involved in calcium sensing, only 2 developed a rise in PTH on treatment with low calcium

formula. The genes we tested are thought to explain only up to 70% of cases of FHH (182), so it is

possible that genes aside from those studied may be implicated. In view of our findings, we would

recommend that use of low calcium formula is monitored with frequent measurement of PTH,

calcium, phosphate and alkaline phosphatase, to guard against a potentially deleterious effect on

bone health.

No pathogenic gene mutations were identified in our cohort of patients who agreed to genetic

testing. When Schlingman and colleagues reported on CYP24A1 mutations in 2011, they

postulated that their findings may explain the molecular basis behind IIH and why these infants

seemed to have an increased sensitivity to vitamin D supplementation. Our data, however,

suggest that many cases of IIH still remain unexplained, and unlike other case series, genetic

testing did not increase our diagnostic yield. Since this study was completed, genetic mutations in

SLC34A1(183) have been identified as a potential cause of IIH, and it may be that looking at other

genes involved in calcium and vitamin D metabolism will be more fruitful. In 2017, Pronicka et al

found that out of 11 patients with idiopathic infantile hypercalcaemia, 9 patients had CYP24A1

mutations and 2 patients had SLC34A1 mutations (86). SLC34A1 encodes the renal sodium

phosphate transporter and affected patients develop hypophosphatemia due to renal phosphate

wasting leading to a decrease in FGF23. This results in increased CYP27B1 expression and activity

of 1 alpha hydroxylase and decreased CYP24A1 expression and 24 hydroxylase activity. The net

effect is an increase in 1,25(OH)2D, hypercalcaemia and hypercalciuria. Vitamin D

supplementation in these patients results in unlimited vitamin D activation due to lack of the

counter-regulatory effects of FGF23. Only 2 patients from our cohort had low phosphate levels on

presentation (Table 4-4, page 51), but analysis of this gene may prove informative, as may the

role of other genes involved in FGF23/Klotho signaling that could potentially result in decreased

FGF23 action (184, 185).

Common polymorphisms in CASR, AP2S1, GNA11 and CYP24A1 were identified in 7 of 9 patients

in our cohort who underwent genetic testing. Non-synonymous variants that alter the amino acid

sequence of the protein have greater potential to affect phenotype, although there is increasing

awareness that synonymous variants are in some cases implicated in pathogenicity (186). All five


81

of the non-synonymous variants that were identified in our patients were located in the AP2S1

and CASR genes. The biochemistry in these patients was not suggestive of hypocalciuric

hypercalcaemia and information from ClinVar (https://www.ncbi.nlm.nih.gov/clinvar), a public

database of reports of the relationship between genetic variants and phenotypes, identified these

as benign variants based on The American College of Medical Genetics and Genomics consensus

recommendation (186). However it is important to note that the concept of ‘benign’ and

‘pathogenic’ variants might not be well suited to the genes we studied whereby variants may not

lead directly to pathology but may result in changes in phenotype that predispose to pathology

under certain circumstances.

Two of the variants reported in the CASR in our patients have been associated with specific

phenotypes. One of the variants in the CASR (R990G), with an allele frequency of 0.15, occurred in

patient 2. This variant has been associated with an increased risk for urolithiasis and

hypercalciuria and increased sensitivity to the PTH lowering effects of Cinacalcet (121, 169, 187).

One study also reported that vitamin D deficient individuals (based on 25OHD level <20ng/ml [50

nm/L]) who were homozygous for the R990G allele had lower serum calcium and higher PTH

levels (188). In our study, the only patient harbouring this heterozygous variant (patient 2) had

one of the lower urine calcium excretions at the time of hypercalcaemia but did not have follow

up vitamin D and PTH levels during treatment. Another patient in our study (patient 6) had the

CASR A986S variant, which in homozygous form has been associated with variance in serum

calcium in adults and several small studies involving African American and European American

children(115, 118, 119, 122). One of these studies also analysed tri-locus haplotypes of the CASR ,

looking at A986S along with neighbouring R990G and Q1011E variants, and showed that higher

ionised blood calcium levels were associated with the SRQ/ARE genotype, compared with the

ARQ/ARQ (wild type) genotype(115). This group suggested that tri-locus haplotyping may provide

more information regarding the role of CASR variants and phenotype.

To determine if our findings of increasing presentation of IIH reflected a more widespread

phenomenon, we analysed population data from our hospital laboratory.

Review of the first total serum calcium concentration obtained from infants less than 6 months of

age, between 2002 and 2014, showed that according to laboratory age-related reference



82

intervals, the incidence of hypercalcaemia increased at both Randwick and the peripheral site

(p<0.003; Figure 4-7, page 63 and Figure 4-8, page 64). This might have been explained by

changes in the assay for total calcium or by increased sampling; however the same analysis was

performed on a separate data set of ionised calcium for which there was no change in assay

method and no significant increase in sampling and the same pattern was seen (p<0.001; Figure

4-9, page 64). We also examined these independent data sets for changes in concentration over

time as continuous variables, and the same statistically significant trend to increasing calcium

concentration over time was observed in both (p<0.001; Figure 4-10, page 65, Figure 4-11, page

66 and Figure 4-12, page 66). During the same time period, the incidence of hypocalcaemia

decreased (p<0.001). Hypocalcaemia was more common than hypercalcaemia in this hospital

laboratory based cohort (Figure 4-1, page 59; Figure 4-2, page 60); however most of the

measurements of calcium were obtained from neonates (Figure 4-4, page 61) and the

preponderance of hypocalcaemia was probably due to the contribution of sick or premature

neonates and infants from the intensive care units serviced by the laboratory. We considered

whether vitamin D deficiency may have also contributed to the proportion of hypocalcaemic

infants (with a subsequent decline in prevalence of hypocalcaemia following increased vitamin D

supplementation); however our data showed that although there was a slight decline in the

25OHD concentration over time (Figure 4-17, page 72), the proportion of sufficiency (25OHD > 50

nmol/L) did not change (Figure 4-14, page 69) and in paired samples calacaemia increased over

time (Figure 4-18, page 73). In paired samples, there was no relationship between 25OHD

concentration and the concentrations of calcium, alkaline phosphatase, or PTH. Moreover, the

median 25OHD concentrations were similar whether paired with calcium concentrations >2.75

mmol/L or <2.25 mmol/L (53 and 50nmol/l respectively). These data suggest that despite the

number of 25OHD values <50 nmol/l, the contribution of Vitamin D deficiency to the prevalence

of hypocalcaemia in the laboratory-based cohort is likely to be small.

It is notable that frequency of hypercalcaemia in the laboratory based data appeared to rise after

2011 and then decline from 2013 onwards, and so we explored whether the change to the Roche

analyser at the beginning of 2011 might have contributed to these findings. Internal correlations

performed by the laboratory suggested that there was a positive bias in calcium concentrations

associated with the change in platform, more marked at higher concentrations, that was later

corrected in 2013 when the assay changed again. To investigate this, total calcium data for the


83

Randwick and peripheral site were analysed separately, comparing the 3 approximately 2 year

blocks before and after the change in analyser and after the change in assay (Table 4-9, page

68). At both sites there was a step up in mean total calcium concentration after the change in

analyser (p<0.05) however while the subsequent change in assay resulted in a drop at Randwick,

the mean total calcium concentration after the second change in assay remained above that

observed for the 2 years prior to the initial change at both sites (p<0.05). A similar pattern was

observed in the mean ionised calcium concentrations from the independent ionised calcium

dataset analysed over the same time periods, suggesting that the progressive increase in total

calcaemia we observed over time was not attributable to the change in analyser. The

preservation of physiological relationships between analytes in the total calcium dataset and the

many patients in our small cohort who were symptomatic and/or had nephrocalcinosis also

militate against the changes observed in calcaemia being spurious. A contribution from the

change in analyser however is suggested by the analysis of paired measurements of total and

ionised calcium from the total calcium dataset, where the mean concentration of total calcium

increased following the change in analyser, but the mean for paired ionised calcium did not (Table

4-9, 68). We conclude that whilst the change in analyser may not explain all cases of

hypercalcaemia in our data, it most likely contributed to the magnitude of the change observed.

This highlights the importance of considering the role of assays in addition to the clinical picture

when assessing any child presenting with a condition such as hypercalcaemia.

The frequency of vitamin D testing increased significantly between 2005 and 2014 (p = 0.015;

Figure 4-14; page 69), consistent with the increased interest in vitamin D status reported by

others (6, 7) and following publications highlighting the importance of vitamin D supplementation

in the prevention of rickets (8, 9). In Australia, between 2000 to 2010, the cost of Medicare

subsidized tests of 25OHD concentration increased by 59% per year and sales of vitamin D

supplements tripled. Guidelines for vitamin D supplementation, including antenatally, were

published in 2006 and updated in 2013 with a reduction in the recommended vitamin D dose in

pregnant women with moderate to severe deficiency, from 3000-5000 units daily to 2000 units

daily (8, 9). Whilst it is plausible that vitamin D supplementation contributed to the reciprocal

changes observed in our data set in the rates of hypercalcaemia and hypocalcaemia over time,

including the downward trend in hypercalcaemia noted after the 2013 revised guidelines, we did

not find data to support this in our study. Direct evidence would have required a more robust


84

relationship between 25OHD concentration and calcaemia or an increase in vitamin D sufficiency

or concentration and a decrease in ALP and PTH, none of which was found. Dudenkov et al

conducted a retrospective population based study from 2002 to 2011 (189) and found that the

incidence of vitamin D values above 50 ng/ml (125 nmol/L) and associated calcaemia increased

over time, which they attributed to increased use of vitamin D supplements. There did not appear

to be an increase in vitamin D toxicity and they did not find a relationship between the

concentrations of calcium and 25OHD. Our data set of infants less than 6 months of age was

vastly different from Dudenkov’s group which included 25OHD concentrations from people of all

ages, and the number of infants who had 25OHD analysed in our cohort was relatively low (n=

1246) compared to the number who had calcium analysed (n=6146). We have no way of knowing

how many of the infants in our cohort were exposed to vitamin D supplementation pre- or

postnatally. Similarly, we cannot determine how many of the 25OHD measurements were

obtained in the setting of acute illness or in those deemed to be at risk of vitamin D deficiency. As

was reported by Dudenkov et al, we also did not demonstrate a relationship between 25OHD and

calcium concentration. In fact, we showed that very low and high concentrations of 25OHD could

be associated with hypercalcaemia and hypocalcaemia, respectively. In addition, although most of

the mothers of the infants referred to us with hypercalcaemia were known to have had antenatal

vitamin D supplementation, 6/12 infants in whom it was measured had 25OHD concentrations

less than 50 nmol/L on presentation with hypercalcaemia (Table 4-4, page 51). As has been

demonstrated in cases of vitamin D toxicity, there is not a clear relationship between the

concentrations of 25OHD and calcium, nor is there a clear relationship between oral vitamin D

supplementation dose and 25OHD concentration achieved (38, 190, 191). The only patients in

whom we were able to demonstrate a relationship between 25OHD concentration and both

calcium concentration and PTH, were those infants who developed a rise in their PTH on

treatment with Locasol. It is thus difficult to interpret a 25OHD concentration in isolation, as it is

likely that variations in 25OHD assays, calcium intake, inter-current illness and differences in

pathways governing Vitamin D metabolism all contribute to the measured 25OHD and its clinical

implications (93, 103, 104, 174, 175, 192). This has been recognised in a recent review that

suggested further investigation of the contribution of 25OHD concentration to clinical outcomes

such as rickets should include a panel of biomarkers, such as PTH, ALP and other markers of

vitamin D including 24,25 dihydroxyvitamin D and Vitamin D binding protein, and consideration of

risk factors such as calcium intake and genetic markers, to aid interpretation (192).


85

Our study has a number of limitations. Firstly, as is the nature of retrospective studies, in our

cohort of IIH, treatment and follow up was at the discretion of the treating physician, so follow up

biochemistry was not taken at defined time points and therefore was incomplete and not always

comparable between subjects. In addition, important biochemistry such as 1,25(OH)2D, was

missing from a number of patients at diagnosis. The measurement of 24,25 dihydroxyvitamin D

would have been helpful but at the time was only available as a research tool. We found no

mutations in the genes studied; however very large numbers would be needed to draw definitive

conclusions regarding the possible contribution of common genetic variants to infantile

hypercalcaemia. In our laboratory based data set, the data were pooled from all patients less than

6 months of age who had calcium levels measured, and many of these may have been sick

paediatric or neonatal intensive care patients whose gestation and potential comorbidities could

not be determined from the data requested or received, therefore the data were not

representative of a normal healthy infant population. As this was a retrospective study, we were

also unable to document the method of collection for calcium values. Although there was no

change in the laboratory’s recommendation for blood collection of calcium, we cannot guarantee

that all samples were collected in the same way, particularly given the difficulties in blood

collection from infants. However, manner of collection in bloods is unlikely to have changed over

time, thus in a large population unlikely to have altered the trends we were observing.

In spite of the numerous studies since Lightwood first described IIH in the 1950s, there is a lot

that still remains to be understood about the underlying pathogenesis. We did not increase the

diagnostic yield using a gene panel in our cohort; however the scope of potential genetic

variations continues to broaden, including the consideration of whether multiple variations in

genes involved in vitamin D and calcium metabolism might influence serum calcium

concentrations and/or the response to vitamin D supplementation. Although there are a number

of studies demonstrating safety and efficacy of antenatal vitamin D supplementation, the effect of

antenatal vitamin D supplementation on postnatal vitamin D metabolism beyond the first few

weeks of life also remains an area to be elucidated. In addition, we note that our patient cohort

had a high rate of co-morbidity, and determining the influence of acute illness on vitamin D and

calcium metabolism pathways requires further study.


86

The rise in PTH seen in a number of our patients on treatment with low calcium formula, despite

maintaining high normal serum calcium, suggests that a rise in the calcium set point may be part

of the underlying pathology; however treatment of these patients with very low calcium feed

should be monitored closely to avoid damaging bone health as a result of increased PTH. Data on

changes in calcaemia subsequent to antenatal vitamin D supplementation make such

supplementation a plausible contributor to the increase in calcaemia observed in our laboratory

population data, but we did not demonstrate a change in 25OHD, ALP or PTH concentrations to

support this and vitamin D deficiency by current definitions remains prevalent. The disparity

between serum 25OHD and calcium concentration in our cohort of IIH, the laboratory population

data and the literature suggests that in addition to being a marker of vitamin D sufficiency, 25OHD

concentrations are likely to reflect adaptions in vitamin D metabolism and should be interpreted

in the light of the clinical picture and other biochemical findings.

References

87

References

1. Stapleton T, Macdonald WB, Lightwood R. The pathogenesis of idiopathic hypercalcemia

in infancy. Am J Clin Nutr. 1957;5(5):533-42.

2. Lightwood R. Idiopathic hypercalcaemia with failure to thrive:nephrocalcinosis. Proc R Soc

Med. 1952;45:401.

3. Schlingmann KP, Kaufmann M, Weber S, Irwin A, Goos C, John U, et al. Mutations in

CYP24A1 and idiopathic infantile hypercalcemia. The New England journal of medicine.

2011;365(5):410-21.

4. Koltin D, Rachmiel M, Wong BY, Cole DE, Harvey E, Sochett E. Mild infantile

hypercalcemia: diagnostic tests and outcomes. The Journal of pediatrics. 2011;159(2):215-21 e1.

5. Tate JR, Sikaris KA, Jones GR, Yen T, Koerbin G, Ryan J, et al. Harmonising adult and

paediatric reference intervals in australia and new zealand: an evidence-based approach for

establishing a first panel of chemistry analytes. Clin Biochem Rev. 2014;35(4):213-35.

6. Bilinski K, Talbot P. Vitamin d supplementation in australia: implications for the

development of supplementation guidelines. Journal of nutrition and metabolism.

2014;2014:374208.

7. Bilinski KL, Boyages SC. The rising cost of vitamin D testing in Australia: time to establish

guidelines for testing. The Medical journal of Australia. 2012;197(2):90.

8. Munns C, Zacharin MR, Rodda CP, Batch JA, Morley R, Cranswick NE, et al. Prevention and

treatment of infant and childhood vitamin D deficiency in Australia and New Zealand: a consensus

statement. The Medical journal of Australia. 2006;185(5):268-72.

9. Paxton GA, Teale GR, Nowson CA, Mason RS, McGrath JJ, Thompson MJ, et al. Vitamin D

and health in pregnancy, infants, children and adolescents in Australia and New Zealand: a

position statement. The Medical journal of Australia. 2013;198(3):142-3.

10. Thorne-Lyman A, Fawzi WW. Vitamin D during pregnancy and maternal, neonatal and

infant health outcomes: a systematic review and meta-analysis. Paediatric and perinatal

epidemiology. 2012;26 Suppl 1:75-90.

11. De-Regil LM, Palacios C, Lombardo LK, Pena-Rosas JP. Vitamin D supplementation for

women during pregnancy. Cochrane Database Syst Rev. 2016(1):CD008873.

References

88

12. Kovacs CS. Bone metabolism in the fetus and neonate. Pediatric nephrology.

2014;29(5):793-803.

13. Kovacs C KH. Maternal-Fetal Calcium and Bone Metabolism During Pregnancy,

Puerperium and Lactation. . Endocrine Reviews. 1997;18(6):832-72.

14. Salle BL, Delvin EE, Lapillonne A, Bishop NJ, Glorieux FH. Perinatal metabolism of vitamin

D. Am J Clin Nutr. 2000;71(5 Suppl):1317S-24S.

15. Allgrove J. Physiology of calcium, phosphate and magnesium. Endocr Dev. 2009;16:8-31.

16. Fujisawa Y, Yamaguchi R, Satake E, Ohtaka K, Nakanishi T, Ozono K, et al. Identification of

AP2S1 mutation and effects of low calcium formula in an infant with hypercalcemia and

hypercalciuria. The Journal of clinical endocrinology and metabolism. 2013;98(12):E2022-7.

17. Nesbit MA, Hannan FM, Howles SA, Babinsky VN, Head RA, Cranston T, et al. Mutations

affecting G-protein subunit alpha11 in hypercalcemia and hypocalcemia. The New England journal

of medicine. 2013;368(26):2476-86.

18. Hendy GN, Canaff L, Newfield RS, Tripto-Shkolnik L, Wong BY, Lee BS, et al. Codon Arg15

mutations of the AP2S1 gene: common occurrence in familial hypocalciuric hypercalcemia cases

negative for calcium-sensing receptor (CASR) mutations. The Journal of clinical endocrinology and

metabolism. 2014;99(7):E1311-5.

19. Christakos S, Ajibade DV, Dhawan P, Fechner AJ, Mady LJ. Vitamin D: metabolism.

Endocrinol Metab Clin North Am. 2010;39(2):243-53, table of contents.

20. Jassam N, Gopaul S, McShane P, McHugh A, Coleman R, Thompson D, et al. Calcium

adjustment equations in neonates and children. Annals of clinical biochemistry. 2012;49(Pt

4):352-8.

21. Goldstein Clinical Methods: The History, Physical, and Laboratory Examinations. 3rd

edition. Boston: Butterworths; 1990.

22. Rodd C, Goodyer P. Hypercalcemia of the newborn: etiology, evaluation, and

management. Pediatric nephrology. 1999;13(6):542-7.

23. Khositseth S, Charngkaew K, Boonkrai C, Somparn P, Uawithya P, Chomanee N, et al.

Hypercalcemia induces targeted autophagic degradation of aquaporin-2 at the onset of

nephrogenic diabetes insipidus. Kidney Int. 2017;91(5):1070-87.

24. Hosking DJ, Cowley A, Bucknall CA. Rehydration in the treatment of severe

hypercalcaemia. Q J Med. 1981;50(200):473-81.

References

89

25. Kasalova E, Aufartova J, Krcmova LK, Solichova D, Solich P. Recent trends in the analysis of

vitamin D and its metabolites in milk--a review. Food Chem. 2015;171:177-90.

26. Nutrition JFIoP. The Feeding Guide. Sydney, Australia: James Fairfax Institute of Paediatric

Nutrition; 2010.

27. Gidrewicz DA, Fenton TR. A systematic review and meta-analysis of the nutrient content

of preterm and term breast milk. BMC Pediatr. 2014;14:216.

28. Davies JH, Shaw NJ. Investigation and management of hypercalcaemia in children.

Archives of disease in childhood. 2012;97(6):533-8.

29. Fisher MM, Cabrera SM, Imel EA. Successful treatment of neonatal severe

hyperparathyroidism with cinacalcet in two patients. Endocrinol Diabetes Metab Case Rep.

2015;2015:150040.

30. Gannon AW, Monk HM, Levine MA. Cinacalcet monotherapy in neonatal severe

hyperparathyroidism: a case study and review. The Journal of clinical endocrinology and

metabolism. 2014;99(1):7-11.

31. Gunn IR, Gaffney D. Clinical and laboratory features of calcium-sensing receptor

disorders: a systematic review. Annals of clinical biochemistry. 2004;41(Pt 6):441-58.

32. Eftekhari F, Yousefzadeh DK. Primary infantile hyperparathyroidism: clinical, laboratory,

and radiographic features in 21 cases. Skeletal Radiol. 1982;8(3):201-8.

33. Wilhelm-Bals A, Parvex P, Magdelaine C, Girardin E. Successful use of bisphosphonate and

calcimimetic in neonatal severe primary hyperparathyroidism. Pediatrics. 2012;129(3):e812-6.

34. Reh CM, Hendy GN, Cole DE, Jeandron DD. Neonatal hyperparathyroidism with a

heterozygous calcium-sensing receptor (CASR) R185Q mutation: clinical benefit from cinacalcet.

The Journal of clinical endocrinology and metabolism. 2011;96(4):E707-12.

35. Demirel N, Aydin M, Zenciroglu A, Okumus N, Cetinkaya S, Yildiz YT, et al.

Hyperparathyroidism secondary to maternal hypoparathyroidism and vitamin D deficiency: an

uncommon cause of neonatal respiratory distress. Ann Trop Paediatr. 2009;29(2):149-54.

36. Alikasifoglu A, Gonc EN, Yalcin E, Dogru D, Yordam N. Neonatal hyperparathyroidism due

to maternal hypoparathyroidism and vitamin D deficiency: a cause of multiple bone fractures. Clin

Pediatr (Phila). 2005;44(3):267-9.

37. Ketha H, Wadams H, Lteif A, Singh RJ. Iatrogenic vitamin D toxicity in an infant--a case

report and review of literature. The Journal of steroid biochemistry and molecular biology.

2015;148:14-8.

References

90

38. Vogiatzi MG, Jacobson-Dickman E, DeBoer MD, Drugs, Therapeutics Committee of The

Pediatric Endocrine S. Vitamin D supplementation and risk of toxicity in pediatrics: a review of

current literature. The Journal of clinical endocrinology and metabolism. 2014;99(4):1132-41.

39. Anik A, Catli G, Abaci A, Dizdarer C, Bober E. Acute vitamin D intoxication possibly due to

faulty production of a multivitamin preparation. J Clin Res Pediatr Endocrinol. 2013;5(2):136-9.

40. Blank S, Scanlon KS, Sinks TH, Lett S, Falk H. An outbreak of hypervitaminosis D associated

with the overfortification of milk from a home-delivery dairy. Am J Public Health. 1995;85(5):656-

9.

41. Vanstone MB, Oberfield SE, Shader L, Ardeshirpour L, Carpenter TO. Hypercalcemia in

children receiving pharmacologic doses of vitamin D. Pediatrics. 2012;129(4):e1060-3.

42. Ozkan B, Hatun S, Bereket A. Vitamin D intoxication. Turk J Pediatr. 2012;54(2):93-8.

43. Smollin C, Srisansanee W. Vitamin D toxicity in an infant: case files of the University of

California, San Francisco medical toxicology fellowship. J Med Toxicol. 2014;10(2):190-3.

44. Hatun S, Cizmecioglu F. Use of alendronate in the treatment of vitamin D intoxication in

infants. Turk J Pediatr. 2005;47(4):373-5.

45. Donnai D, Karmiloff-Smith A. Williams syndrome: from genotype through to the cognitive

phenotype. Am J Med Genet. 2000;97(2):164-71.

46. Lashkari A, Smith AK, Graham JM, Jr. Williams-Beuren syndrome: an update and review

for the primary physician. Clin Pediatr (Phila). 1999;38(4):189-208.

47. Taylor AB, Stern PH, Bell NH. Abnormal regulation of circulating 25-hydroxyvitamin D in

the Williams syndrome. The New England journal of medicine. 1982;306(16):972-5.

48. Kruse K, Pankau R, Gosch A, Wohlfahrt K. Calcium metabolism in Williams-Beuren

syndrome. The Journal of pediatrics. 1992;121(6):902-7.

49. Culler FL, Jones KL, Deftos LJ. Imparied calcitonin secretion in patients with Williams

syndrome. The Journal of pediatrics. 1985;107(5):720-3.

50. Cagle AP, Waguespack SG, Buckingham BA, Shankar RR, Dimeglio LA. Severe infantile

hypercalcemia associated with Williams syndrome successfully treated with intravenously

administered pamidronate. Pediatrics. 2004;114(4):1091-5.

51. Ismail J. Pamidronate for long-term control of hypercalcemia associated with Williams

syndrome. Indian Pediatr. 2015;52(2):163-4.

References

91

52. B O, Sr M, C M, Jc G, Argerich LP. Long-term control of hypercalcaemia in an infant with

Williams-Beuren syndrome after a single infusion of biphosphonate (Pamidronate). Acta

Paediatrica. 2004;93(7):1002-3.

53. Burden AD, Krafchik BR. Subcutaneous fat necrosis of the newborn: a review of 11 cases.

Pediatr Dermatol. 1999;16(5):384-7.

54. Strohm B, Hobson A, Brocklehurst P, Edwards AD, Azzopardi D, Register UTC.

Subcutaneous fat necrosis after moderate therapeutic hypothermia in neonates. Pediatrics.

2011;128(2):e450-2.

55. Tuddenham E, Kumar A, Tarn A. Subcutaneous fat necrosis causing neonatal

hypercalcaemia. BMJ Case Rep. 2015;2015.

56. Mahe E, Girszyn N, Hadj-Rabia S, Bodemer C, Hamel-Teillac D, De Prost Y. Subcutaneous

fat necrosis of the newborn: a systematic evaluation of risk factors, clinical manifestations,

complications and outcome of 16 children. Br J Dermatol. 2007;156(4):709-15.

57. Kruse K, Irle U, Uhlig R. Elevated 1,25-dihydroxyvitamin D serum concentrations in infants

with subcutaneous fat necrosis. The Journal of pediatrics. 1993;122(3):460-3.

58. Cook JS, Stone MS, Hansen JR. Hypercalcemia in association with subcutaneous fat

necrosis of the newborn: studies of calcium-regulating hormones. Pediatrics. 1992;90(1 Pt 1):93-

6.

59. Akin MA, Akin L, Sarici D, Yilmaz I, Balkanli S, Kurtoglu S. Follow-up during early infancy of

newborns diagnosed with subcutaneous fat necrosis. J Clin Res Pediatr Endocrinol. 2011;3(4):216-

8.

60. Alos N, Eugene D, Fillion M, Powell J, Kokta V, Chabot G. Pamidronate: Treatment for

severe hypercalcemia in neonatal subcutaneous fat necrosis. Horm Res. 2006;65(6):289-94.

61. Lyon AJ, McIntosh N, Wheeler K, Brooke OG. Hypercalcaemia in extremely low

birthweight infants. Archives of disease in childhood. 1984;59(12):1141-4.

62. Miller RR, Menke JA, Mentser MI. Hypercalcemia associated with phosphate depletion in

the neonate. The Journal of pediatrics. 1984;105(5):814-7.

63. Sagy M, Birenbaum E, Balin A, Orda S, Barzilay Z, Brish M. Phosphate-depletion syndrome

in a premature infant fed human milk. The Journal of pediatrics. 1980;96(4):683-5.

64. Juppner H. Jansen's metaphyseal chondrodysplasia: a disorder due to a PTH/PTHrP

receptor gene mutation. Trends Endocrinol Metab. 1996;7(5):157-62.

References

92

65. Schipani E, Langman CB, Parfitt AM, Jensen GS, Kikuchi S, Kooh SW, et al. Constitutively

activated receptors for parathyroid hormone and parathyroid hormone-related peptide in

Jansen's metaphyseal chondrodysplasia. The New England journal of medicine. 1996;335(10):708-

14.

66. Kozlowski K, Campbell JB, Azouz ME, Sprague P. Metaphyseal chondrodysplasia, type

Jansen. Australas Radiol. 1999;43(4):544-7.

67. Kruse K, Schutz C. Calcium metabolism in the Jansen type of metaphyseal dysplasia.

European journal of pediatrics. 1993;152(11):912-5.

68. Bianchi ML. Hypophosphatasia: an overview of the disease and its treatment.

Osteoporosis international : a journal established as result of cooperation between the European

Foundation for Osteoporosis and the National Osteoporosis Foundation of the USA.

2015;26(12):2743-57.

69. Demirbilek H, Alanay Y, Alikasifoglu A, Topcu M, Mornet E, Gonc N, et al.

Hypophosphatasia presenting with pyridoxine-responsive seizures, hypercalcemia, and

pseudotumor cerebri: case report. J Clin Res Pediatr Endocrinol. 2012;4(1):34-8.

70. Barcia JP, Strife CF, Langman CB. Infantile hypophosphatasia: treatment options to control

hypercalcemia, hypercalciuria, and chronic bone demineralization. The Journal of pediatrics.

1997;130(5):825-8.

71. Drummond KN, Michael AF, Ulstrom RA, Good RA. The Blue Diaper Syndrome: Familial

Hypercalcemia with Nephrocalcinosis and Indicanuria; a New Familial Disease, with Definition of

the Metabolic Abnormality. Am J Med. 1964;37:928-48.

72. Fazeli W, Kaczmarek S, Kirschstein M, Santer R. A novel mutation within the lactase gene

(LCT): the first report of congenital lactase deficiency diagnosed in Central Europe. BMC

Gastroenterol. 2015;15:90.

73. Saarela T, Simila S, Koivisto M. Hypercalcemia and nephrocalcinosis in patients with

congenital lactase deficiency. The Journal of pediatrics. 1995;127(6):920-3.

74. Manickavasagar B, McArdle AJ, Yadav P, Shaw V, Dixon M, Blomhoff R, et al.

Hypervitaminosis A is prevalent in children with CKD and contributes to hypercalcemia. Pediatric

nephrology. 2015;30(2):317-25.

75. Adashek J, Mu W, Francis J, Cohen B, Pruette C, Grossberg A, et al. Incontinentia Pigmenti

with Persistent Hypercalcemia: Case Report. Pediatr Dermatol. 2016;33(5):e315-7.

References

93

76. Jacobs TP, Bilezikian JP. Clinical review: Rare causes of hypercalcemia. The Journal of

clinical endocrinology and metabolism. 2005;90(11):6316-22.

77. Tau C, Garabedian M, Farriaux JP, Czernichow P, Pomarede R, Balsan S. Hypercalcemia in

infants with congenital hypothyroidism and its relation to vitamin D and thyroid hormones. The

Journal of pediatrics. 1986;109(5):808-14.

78. Carey DE, Jones KL. Hypothyroidism and hypercalcemia. The Journal of pediatrics.

1987;111(1):155-6.

79. Schoelwer MJ, Viswanathan V, Wilson A, Nailescu C, Imel EA. Infants With Congenital

Adrenal Hyperplasia Are at Risk for Hypercalcemia, Hypercalciuria, and Nephrocalcinosis. J Endocr

Soc. 2017;1(9):1160-7.

80. Ramage IJ, Durkan A, Walker K, Beattie TJ. Hypercalcaemia in association with trisomy 21

(Down's syndrome). J Clin Pathol. 2002;55(7):543-4.

81. Pela I, Seracini D, Lavoratti G, Materassi M. Hypercalcemia and distal renal tubular

acidosis: an association not only in the newborn. Pediatric nephrology. 2003;18(8):850.

82. Igarashi T, Sekine Y, Kawato H, Kamoshita S, Saigusa Y. Transient neonatal distal renal

tubular acidosis with secondary hyperparathyroidism. Pediatric nephrology. 1992;6(3):267-9.

83. Lightwood R ST. Idiopathic hypercalcaemia in infants. Lancet. 1953(265):255-6.

84. N D T MARTIN GJAIS, AND R D COHEN. Idiopathic infantile hypercalcaemia: a continuing

enigma. Archives of disease in childhood. 1984(59):605-13.

85. Dauber A NT, Sochett E, Cole D, Horst R, Abrams S, Carpenter T, Hirschhorn J. Genetic

Defect in CYP24A1, the Vitamin D 24-Hydroxylase Gene, in a Patient with Severe Infantile

Hypercalcemia. Journal of Clinical Endocrinology and Metabolism. 2012;97(2):268-74.

86. Pronicka E, Ciara E, Halat P, Janiec A, Wojcik M, Rowinska E, et al. Biallelic mutations in

CYP24A1 or SLC34A1 as a cause of infantile idiopathic hypercalcemia (IIH) with vitamin D

hypersensitivity: molecular study of 11 historical IIH cases. J Appl Genet. 2017;58(3):349-53.

87. Marks BE, Doyle DA. Idiopathic infantile hypercalcemia: case report and review of the

literature. J Pediatr Endocrinol Metab. 2016;29(2):127-32.

88. Fencl F, Blahova K, Schlingmann KP, Konrad M, Seeman T. Severe hypercalcemic crisis in

an infant with idiopathic infantile hypercalcemia caused by mutation in CYP24A1 gene. European

journal of pediatrics. 2013;172(1):45-9.

References

94

89. Molin A, Baudoin R, Kaufmann M, Souberbielle JC, Ryckewaert A, Vantyghem MC, et al.

CYP24A1 Mutations in a Cohort of Hypercalcemic Patients: Evidence for a Recessive Trait. The

Journal of clinical endocrinology and metabolism. 2015;100(10):E1343-52.

90. Castanet M, Mallet E, Kottler ML. Lightwood syndrome revisited with a novel mutation in

CYP24 and vitamin D supplement recommendations. The Journal of pediatrics. 2013;163(4):1208-

10.

91. Nesterova G, Malicdan MC, Yasuda K, Sakaki T, Vilboux T, Ciccone C, et al. 1,25-(OH)2D-24

Hydroxylase (CYP24A1) Deficiency as a Cause of Nephrolithiasis. Clinical journal of the American

Society of Nephrology : CJASN. 2013;8(4):649-57.

92. Kaufmann M, Gallagher JC, Peacock M, Schlingmann KP, Konrad M, DeLuca HF, et al.

Clinical utility of simultaneous quantitation of 25-hydroxyvitamin D and 24,25-dihydroxyvitamin D

by LC-MS/MS involving derivatization with DMEQ-TAD. The Journal of clinical endocrinology and

metabolism. 2014;99(7):2567-74.

93. Dirks NF, Ackermans MT, Lips P, de Jongh RT, Vervloet MG, de Jonge R, et al. The When,

What & How of Measuring Vitamin D Metabolism in Clinical Medicine. Nutrients. 2018;10(4).

94. Nguyen M, Boutignon H, Mallet E, Linglart A, Guillozo H, Jehan F, et al. Infantile

hypercalcemia and hypercalciuria: new insights into a vitamin D-dependent mechanism and

response to ketoconazole treatment. The Journal of pediatrics. 2010;157(2):296-302.

95. Dinaur D BP, Ganon L, Tordjman K, Eisenstein Z, Holtzman E. Loss of Function Mutations

of CYP24A1, the Vitamin D 24 Hydroxylase Gene, Cause Long-standing Hypercalciuric

Nephrolithiasis and Nephrocalcinosis. The Journal of urology. 2013(190):552-7.

96. Wolf P, Muller-Sacherer T, Baumgartner-Parzer S, Winhofer Y, Kroo J, Gessl A, et al. A

Case of "Late-Onset" Idiopathic Infantile Hypercalcemia Secondary to Mutations in the CYP24A1

Gene. Endocr Pract. 2014;20(5):e91-5.

97. Martin ND, Snodgrass GJ, Cohen RD. Idiopathic infantile hypercalcaemia--a continuing

enigma. Archives of disease in childhood. 1984;59(7):605-13.

98. Mugg A, Legeza B, Tee MK, Damm I, Long RK, Miller WL. Quantitation of CYP24A1

enzymatic activity with a simple two-hybrid system. The Journal of clinical endocrinology and

metabolism. 2015;100(2):684-8.

99. Huang J, Coman D, McTaggart SJ, Burke JR. Long-term follow-up of patients with

idiopathic infantile hypercalcaemia. Pediatric nephrology. 2006;21(11):1676-80.

References

95

100. Pronicka E, Rowinska E, Kulczycka H, Lukaszkiewicz J, Lorenc R, Janas R. Persistent

hypercalciuria and elevated 25-hydroxyvitamin D3 in children with infantile hypercalcaemia.

Pediatric nephrology. 1997;11(1):2-6.

101. Carpenter TO. CYP24A1 loss of function: Clinical phenotype of monoallelic and biallelic

mutations. The Journal of steroid biochemistry and molecular biology. 2017;173:337-40.

102. Snellman G, Melhus H, Gedeborg R, Olofsson S, Wolk A, Pedersen NL, et al. Seasonal

genetic influence on serum 25-hydroxyvitamin D levels: a twin study. PLoS One.

2009;4(11):e7747.

103. Barry EL, Rees JR, Peacock JL, Mott LA, Amos CI, Bostick RM, et al. Genetic variants in

CYP2R1, CYP24A1, and VDR modify the efficacy of vitamin D3 supplementation for increasing

serum 25-hydroxyvitamin D levels in a randomized controlled trial. The Journal of clinical

endocrinology and metabolism. 2014;99(10):E2133-7.

104. Sollid ST, Hutchinson MY, Fuskevag OM, Joakimsen RM, Jorde R. Large Individual

Differences in Serum 25-Hydroxyvitamin D Response to Vitamin D Supplementation: Effects of

Genetic Factors, Body Mass Index, and Baseline Concentration. Results from a Randomized

Controlled Trial. Horm Metab Res. 2016;48(1):27-34.

105. Mayr B, Schnabel D, Dorr HG, Schofl C. GENETICS IN ENDOCRINOLOGY: Gain and loss of

function mutations of the calcium-sensing receptor and associated proteins: current treatment

concepts. Eur J Endocrinol. 2016;174(5):R189-208.

106. Lietman SA, Tenenbaum-Rakover Y, Jap TS, Yi-Chi W, De-Ming Y, Ding C, et al. A novel

loss-of-function mutation, Gln459Arg, of the calcium-sensing receptor gene associated with

apparent autosomal recessive inheritance of familial hypocalciuric hypercalcemia. The Journal of


107. Varghese J, Rich T, Jimenez C. Benign familial hypocalciuric hypercalcemia. Endocr Pract.

2011;17 Suppl 1:13-7.

108. Nakamura A, Hotsubo T, Kobayashi K, Mochizuki H, Ishizu K, Tajima T. Loss-of-function

and gain-of-function mutations of calcium-sensing receptor: functional analysis and the effect of

allosteric modulators NPS R-568 and NPS 2143. The Journal of clinical endocrinology and

metabolism. 2013;98(10):E1692-701.

109. Hannan FM, Babinsky VN, Thakker RV. Disorders of the calcium-sensing receptor and

partner proteins: insights into the molecular basis of calcium homeostasis. J Mol Endocrinol.

2016;57(3):R127-42.

References

96

110. Fadil M Hannan VNBaRVT. <Disorders of the calcium sensing receptor and partner

proteins.pdf>. 2016.

111. Christensen SE, Nissen PH, Vestergaard P, Mosekilde L. Familial hypocalciuric

hypercalcaemia: a review. Curr Opin Endocrinol Diabetes Obes. 2011;18(6):359-70.

112. Christensen SE, Nissen PH, Vestergaard P, Heickendorff L, Brixen K, Mosekilde L.

Discriminative power of three indices of renal calcium excretion for the distinction between

familial hypocalciuric hypercalcaemia and primary hyperparathyroidism: a follow-up study on

methods. Clinical endocrinology. 2008;69(5):713-20.

113. Pasieka JL, Andersen MA, Hanley DA. Familial benign hypercalcaemia: hypercalciuria and

hypocalciuria in affected members of a small kindred. Clinical endocrinology. 1990;33(4):429-33.

114. Zajickova K, Vrbikova J, Canaff L, Pawelek PD, Goltzman D, Hendy GN. Identification and

functional characterization of a novel mutation in the calcium-sensing receptor gene in familial

hypocalciuric hypercalcemia: modulation of clinical severity by vitamin D status. The Journal of


115. Scillitani A, Guarnieri V, De Geronimo S, Muscarella LA, Battista C, D'Agruma L, et al. Blood

ionized calcium is associated with clustered polymorphisms in the carboxyl-terminal tail of the

calcium-sensing receptor. The Journal of clinical endocrinology and metabolism.

2004;89(11):5634-8.

116. O'Seaghdha CM, Wu H, Yang Q, Kapur K, Guessous I, Zuber AM, et al. Meta-analysis of

genome-wide association studies identifies six new Loci for serum calcium concentrations. PLoS

genetics. 2013;9(9):e1003796.

117. O'Seaghdha CM, Yang Q, Glazer NL, Leak TS, Dehghan A, Smith AV, et al. Common

variants in the calcium-sensing receptor gene are associated with total serum calcium levels. Hum

Mol Genet. 2010;19(21):4296-303.

118. He Y, Han L, Li W, Shu X, Zhao C, He Y, et al. Effects of the calcium-sensing receptor A986S

polymorphism on serum calcium and parathyroid hormone levels in healthy individuals: a meta-

analysis. Gene. 2012;491(2):110-5.

119. Cole DE, Vieth R, Trang HM, Wong BY, Hendy GN, Rubin LA. Association between total

serum calcium and the A986S polymorphism of the calcium-sensing receptor gene. Mol Genet

Metab. 2001;72(2):168-74.

120. Scillitani. <Blood ionised calcium is associated with clustered polymorphisms of

CASR.pdf>. 2004.

References

97

121. Vezzoli G, Terranegra A, Arcidiacono T, Biasion R, Coviello D, Syren ML, et al. R990G

polymorphism of calcium-sensing receptor does produce a gain-of-function and predispose to

primary hypercalciuria. Kidney Int. 2007;71(11):1155-62.

122. Chang X, Li J, Guo Y, Wei Z, Mentch FD, Hou C, et al. Genome-wide association study of

serum minerals levels in children of different ethnic background. PLoS One. 2015;10(4):e0123499.

123. Holick MF. Resurrection of vitamin D deficiency and rickets. J Clin Invest.

2006;116(8):2062-72.

124. Rajakumar K, Reis EC, Holick MF. Dosing error with over-the-counter vitamin D

supplement: a risk for vitamin D toxicity in infants. Clin Pediatr (Phila). 2013;52(1):82-5.

125. Munns CF, Shaw N, Kiely M, Specker BL, Thacher TD, Ozono K, et al. Global Consensus

Recommendations on Prevention and Management of Nutritional Rickets. The Journal of clinical

endocrinology and metabolism. 2016;101(2):394-415.

126. Wharton B, Bishop N. Rickets. The Lancet. 2003;362(9393):1389-400.

127. Creo AL, Thacher TD, Pettifor JM, Strand MA, Fischer PR. Nutritional rickets around the

world: an update. Paediatr Int Child Health. 2017;37(2):84-98.

128. Elder CJ, Bishop NJ. Rickets. The Lancet. 2014;383(9929):1665-76.

129. Saggese G, Vierucci F, Boot AM, Czech-Kowalska J, Weber G, Camargo CA, Jr., et al.

Vitamin D in childhood and adolescence: an expert position statement. European journal of

pediatrics. 2015;174(5):565-76.

130. Hossein-nezhad A, Holick MF. Vitamin D for health: a global perspective. Mayo Clin Proc.

2013;88(7):720-55.

131. Nowson CA, Margerison C. Vitamin D intake and vitamin D status of Australians. The

Medical journal of Australia. 2002;177(3):149-52.

132. Hsu SA, Soldo J, Gupta M. Evaluation of two automated immunoassays for 25-OH vitamin

D: comparison against LC-MS/MS. The Journal of steroid biochemistry and molecular biology.

2013;136:139-45.

133. Farrell CJ, Martin S, McWhinney B, Straub I, Williams P, Herrmann M. State-of-the-art

vitamin D assays: a comparison of automated immunoassays with liquid chromatography-tandem

mass spectrometry methods. Clin Chem. 2012;58(3):531-42.

134. Lucas R, Neale R. What is the optimal level of vitamin D? - separating the evidence from

the rhetoric. Aust Fam Physician. 2014;43(3):119-22.

References

98

135. Atapattu N, Shaw N, Hogler W. Relationship between serum 25-hydroxyvitamin D and

parathyroid hormone in the search for a biochemical definition of vitamin D deficiency in children.

Pediatric research. 2013;74(5):552-6.

136. Couchman L, Moniz CF. Analytical considerations for the biochemical assessment of

vitamin D status. Ther Adv Musculoskelet Dis. 2017;9(4):97-104.

137. Higgins V, Truong D, White-Al Habeeb NMA, Fung AWS, Hoffman B, Adeli K. Pediatric

reference intervals for 1,25-dihydroxyvitamin D using the DiaSorin LIAISON XL assay in the healthy

CALIPER cohort. Clin Chem Lab Med. 2018;56(6):964-72.

138. Jones G. Extrarenal vitamin D activation and interactions between vitamin D(2), vitamin

D(3), and vitamin D analogs. Annu Rev Nutr. 2013;33:23-44.

139. Wagner CL, Greer FR, American Academy of Pediatrics Section on B, American Academy

of Pediatrics Committee on N. Prevention of rickets and vitamin D deficiency in infants, children,

and adolescents. Pediatrics. 2008;122(5):1142-52.

140. Homer CS, Oats J, Middleton P, Ramson J, Diplock S. Updated clinical practice guidelines

on pregnancy care. The Medical journal of Australia. 2018;209(9):409-12.

141. Holmlund-Suila E, Viljakainen H, Hytinantti T, Lamberg-Allardt C, Andersson S, Makitie O.

High-dose vitamin d intervention in infants--effects on vitamin d status, calcium homeostasis, and

bone strength. The Journal of clinical endocrinology and metabolism. 2012;97(11):4139-47.

142. Zeghoud F, Ben-Mekhbi H, Djeghri N, Garabedian M. Vitamin D prophylaxis during

infancy: comparison of the long-term effects of three intermittent doses (15, 5, or 2.5 mg) on 25-

hydroxyvitamin D concentrations. Am J Clin Nutr. 1994;60(3):393-6.

143. Huynh J, Lu T, Liew D, Doery JC, Tudball R, Jona M, et al. Vitamin D in newborns. A

randomised controlled trial comparing daily and single oral bolus vitamin D in infants. J Paediatr

Child Health. 2017;53(2):163-9.

144. Gallo S, Comeau K, Vanstone C, Agellon S, Sharma A, Jones G, et al. Effect of different

dosages of oral vitamin D supplementation on vitamin D status in healthy, breastfed infants: a

randomized trial. JAMA. 2013;309(17):1785-92.

145. Thomas SD, Fudge AN, Whiting M, Coates PS. The correlation between third-trimester

maternal and newborn-serum 25-hydroxy-vitamin D in a selected South Australian group of

newborn samples. BMJ open. 2011;1(2):e000236.

146. El Koumi MA, Ali YF, Abd El Rahman RN. Impact of maternal vitamin D status during

pregnancy on neonatal vitamin D status. Turk J Pediatr. 2013;55(4):371-7.

References

99

147. Vieth Streym S, Kristine Moller U, Rejnmark L, Heickendorff L, Mosekilde L, Vestergaard P.

Maternal and infant vitamin D status during the first 9 months of infant life-a cohort study. Eur J

Clin Nutr. 2013;67(10):1022-8.

148. Roth DE, Gernand AD, Al Mahmud A. Vitamin D Supplementation in Pregnancy and

Lactation and Infant Growth. The New England journal of medicine. 2018;379(19):1881.

149. Wagner CL, McNeil RB, Johnson DD, Hulsey TC, Ebeling M, Robinson C, et al. Health

characteristics and outcomes of two randomized vitamin D supplementation trials during

pregnancy: a combined analysis. The Journal of steroid biochemistry and molecular biology.

2013;136:313-20.

150. Delvin EE, Salle BL, Glorieux FH, Adeleine P, David LS. Vitamin D supplementation during

pregnancy: effect on neonatal calcium homeostasis. The Journal of pediatrics. 1986;109(2):328-

34.

151. Harrington J, Perumal N, Al Mahmud A, Baqui A, Roth DE. Vitamin D and fetal-neonatal

calcium homeostasis: findings from a randomized controlled trial of high-dose antenatal vitamin D

supplementation. Pediatric research. 2014;76(3):302-9.

152. Greer FR, Hollis BW, Cripps DJ, Tsang RC. Effects of maternal ultraviolet B irradiation on

vitamin D content of human milk. The Journal of pediatrics. 1984;105(3):431-3.

153. Dawodu A, Tsang RC. Maternal vitamin D status: effect on milk vitamin D content and

vitamin D status of breastfeeding infants. Advances in nutrition. 2012;3(3):353-61.

154. Bae YJ, Kratzsch J. Vitamin D and calcium in the human breast milk. Best Pract Res Clin

Endocrinol Metab. 2018;32(1):39-45.

155. Rothberg AD, Pettifor JM, Cohen DF, Sonnendecker EW, Ross FP. Maternal-infant vitamin

D relationships during breast-feeding. The Journal of pediatrics. 1982;101(4):500-3.

156. Hollis BW, Wagner CL, Howard CR, Ebeling M, Shary JR, Smith PG, et al. Maternal Versus

Infant Vitamin D Supplementation During Lactation: A Randomized Controlled Trial. Pediatrics.

2015;136(4):625-34.

157. Kent JC, Arthur PG, Mitoulas LR, Hartmann PE. Why calcium in breastmilk is independent

of maternal dietary calcium and vitamin D. Breastfeed Rev. 2009;17(2):5-11.

158. Prentice A, Yan L, Jarjou LM, Dibba B, Laskey MA, Stirling DM, et al. Vitamin D status does

not influence the breast-milk calcium concentration of lactating mothers accustomed to a low

calcium intake. Acta Paediatr. 1997;86(9):1006-8.

References

100

159. Matos V, van Melle G, Boulat O, Markert M, Bachmann C, Guignard JP. Urinary

phosphate/creatinine, calcium/creatinine, and magnesium/creatinine ratios in a healthy pediatric

population. The Journal of pediatrics. 1997;131(2):252-7.

160. Metz MP. Determining urinary calcium/creatinine cut-offs for the paediatric population

using published data. Annals of clinical biochemistry. 2006;43(Pt 5):398-401.

161. Sargent JD, Stukel TA, Kresel J, Klein RZ. Normal values for random urinary calcium to

creatinine ratios in infancy. The Journal of pediatrics. 1993;123(3):393-7.

162. Wang K, Li M, Hakonarson H. ANNOVAR: functional annotation of genetic variants from

high-throughput sequencing data. Nucleic Acids Res. 2010;38(16):e164.

163. Binkley N, Krueger D, Cowgill CS, Plum L, Lake E, Hansen KE, et al. Assay variation

confounds the diagnosis of hypovitaminosis D: a call for standardization. The Journal of clinical

endocrinology and metabolism. 2004;89(7):3152-7.

164. Carter GD, Carter R, Jones J, Berry J. How accurate are assays for 25-hydroxyvitamin D?

Data from the international vitamin D external quality assessment scheme. Clin Chem.

2004;50(11):2195-7.

165. Leventis P, Garrison L, Sibley M, Peterson P, Egerton M, Levin G, et al. Underestimation of

serum 25-hydroxyvitamin D by the Nichols Advantage Assay in patients receiving vitamin D

replacement therapy. Clin Chem. 2005;51(6):1072-4; author reply 4.

166. Terry AH, Sandrock T, Meikle AW. Measurement of 25-hydroxyvitamin D by the Nichols

ADVANTAGE, DiaSorin LIAISON, DiaSorin RIA, and liquid chromatography-tandem mass

spectrometry. Clin Chem. 2005;51(8):1565-6.

167. Bourguignon C, Dupuy AM, Coste T, Michel F, Cristol JP. Evaluation of NM-BAPTA method

for plasma total calcium measurement on Cobas 8000(R). Clin Biochem. 2014;47(7-8):636-9.

168. Matos V, Melle GV, Markert M, Guignard JP. [Urinary excretion of calcium, magnesium,

phosphates, oxalates and urates in normal children en Switzerland]. Rev Med Suisse Romande.

1996;116(10):839-43.

169. Liu K, Wang X, Ye J, Qin C, Shao P, Zhang W, et al. The G allele of CaSR R990G

polymorphism increases susceptibility to urolithiasis and hypercalciuria: evidences from a

comprehensive meta-analysis. Biomed Res Int. 2015;2015:958207.

170. Tebben PJ, Singh RJ, Kumar R. Vitamin D-Mediated Hypercalcemia: Mechanisms,

Diagnosis, and Treatment. Endocr Rev. 2016;37(5):521-47.

References

101

171. Roth DE, Morris SK, Zlotkin S, Gernand AD, Ahmed T, Shanta SS, et al. Vitamin D

Supplementation in Pregnancy and Lactation and Infant Growth. The New England journal of

medicine. 2018;379(6):535-46.

172. Brooke OG, Brown IR, Bone CD, Carter ND, Cleeve HJ, Maxwell JD, et al. Vitamin D

supplements in pregnant Asian women: effects on calcium status and fetal growth. Br Med J.

1980;280(6216):751-4.

173. Bi WG, Nuyt AM, Weiler H, Leduc L, Santamaria C, Wei SQ. Association Between Vitamin D

Supplementation During Pregnancy and Offspring Growth, Morbidity, and Mortality: A Systematic

Review and Meta-analysis. JAMA Pediatr. 2018;172(7):635-45.

174. McNally JD, Nama N, O'Hearn K, Sampson M, Amrein K, Iliriani K, et al. Vitamin D

deficiency in critically ill children: a systematic review and meta-analysis. Crit Care.

2017;21(1):287.

175. Silva MC, Furlanetto TW. Does serum 25-hydroxyvitamin D decrease during acute-phase

response? A systematic review. Nutr Res. 2015;35(2):91-6.

176. Amrein K, Papinutti A, Mathew E, Vila G, Parekh D. Vitamin D and critical illness: what

endocrinology can learn from intensive care and vice versa. Endocr Connect. 2018;7(12):R304-

R15.

177. Mangin M, Sinha R, Fincher K. Inflammation and vitamin D: the infection connection.

Inflamm Res. 2014;63(10):803-19.

178. Ji J, Lu R, Zhou X, Xue Y, Shi C, Goltzman D, et al. 1,25-Dihydroxyvitamin D(3) contributes

to regulating mammary calcium transport and modulates neonatal skeletal growth and turnover

cooperatively with calcium. Am J Physiol Endocrinol Metab. 2011;301(5):E889-900.

179. Jarjou LM, Prentice A, Sawo Y, Laskey MA, Bennett J, Goldberg GR, et al. Randomized,

placebo-controlled, calcium supplementation study in pregnant Gambian women: effects on

breast-milk calcium concentrations and infant birth weight, growth, and bone mineral accretion in

the first year of life. Am J Clin Nutr. 2006;83(3):657-66.

180. Prentice A, Dibba B, Jarjou LM, Laskey MA, Paul AA. In breast milk calcium concentration

influenced by calcium intake during pregnancy. Lancet. 1994;344(8919):411-2.

181. Beggs MR, Alexander RT. Intestinal absorption and renal reabsorption of calcium

throughout postnatal development. Exp Biol Med (Maywood). 2017;242(8):840-9.

182. Stratta P, Merlotti G, Musetti C, Quaglia M, Pagani A, Izzo C, et al. Calcium-sensing-related

gene mutations in hypercalcaemic hypocalciuric patients as differential diagnosis from primary

References

102

hyperparathyroidism: detection of two novel inactivating mutations in an Italian population.

Nephrol Dial Transplant. 2014;29(10):1902-9.

183. Schlingmann KP, Ruminska J, Kaufmann M, Dursun I, Patti M, Kranz B, et al. Autosomal-

Recessive Mutations in SLC34A1 Encoding Sodium-Phosphate Cotransporter 2A Cause Idiopathic

Infantile Hypercalcemia. J Am Soc Nephrol. 2016;27(2):604-14.

184. Ichikawa S, Imel EA, Kreiter ML, Yu X, Mackenzie DS, Sorenson AH, et al. A homozygous

missense mutation in human KLOTHO causes severe tumoral calcinosis. J Musculoskelet Neuronal

Interact. 2007;7(4):318-9.

185. Murali SK, Roschger P, Zeitz U, Klaushofer K, Andrukhova O, Erben RG. FGF23 Regulates

Bone Mineralization in a 1,25(OH)2 D3 and Klotho-Independent Manner. J Bone Miner Res.

2016;31(1):129-42.

186. Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, et al. Standards and guidelines

for the interpretation of sequence variants: a joint consensus recommendation of the American

College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet

Med. 2015;17(5):405-24.

187. Rothe HM, Shapiro WB, Sun WY, Chou SY. Calcium-sensing receptor gene polymorphism

Arg990Gly and its possible effect on response to cinacalcet HCl. Pharmacogenet Genomics.

2005;15(1):29-34.

188. Majid H, Khan AH, Moatter T. R990G polymorphism of calcium sensing receptor gene is

associated with high parathyroid hormone levels in subjects with vitamin D deficiency: a cross-

sectional study. Biomed Res Int. 2015;2015:407159.

189. Dudenkov DV, Yawn BP, Oberhelman SS, Fischer PR, Singh RJ, Cha SS, et al. Changing

Incidence of Serum 25-Hydroxyvitamin D Values Above 50 ng/mL: A 10-Year Population-Based

Study. Mayo Clin Proc. 2015;90(5):577-86.

190. Zittermann A, Ernst JB, Gummert JF, Borgermann J. Vitamin D supplementation, body

weight and human serum 25-hydroxyvitamin D response: a systematic review. Eur J Nutr.

2014;53(2):367-74.

191. Lopez-Molina M, Santillan C, Murillo M, Valls A, Bosch L, Bel J, et al. Measured free 25-

hydroxyvitamin D in healthy children and relationship to total 25-hydroxyvitamin D, calculated

free 25-hydroxyvitamin D and vitamin D binding protein. Clin Biochem. 2018;61:23-7.

References

103

192. Sempos CT, Heijboer AC, Bikle DD, Bollerslev J, Bouillon R, Brannon PM, et al. Vitamin D

assays and the definition of hypovitaminosis D: results from the First International Conference on

Controversies in Vitamin D. Br J Clin Pharmacol. 2018;84(10):2194-207.

An investigation into increased cases of idiopathic infantile ...

Documents

Transcript of An investigation into increased cases of idiopathic infantile ...