Chemosphere 74 (2008) 96–105

Contents lists available at ScienceDirect

Chemosphere

journal homepage: www.elsevier .com/locate /chemosphere

Molecular targets of TBBPA in zebrafish analysed through integration ofgenomic and proteomic approaches

Marijke De Wit a,*, Dorien Keil a, Noor Remmerie b, Karlijn van der Ven a, Evert-Jan van den Brandhof c,Dries Knapen a, Erwin Witters b, Wim De Coen a

a Department of Biology, Laboratory for Ecophysiology, Biochemistry and Toxicology, University of Antwerp, Building U, 7th Floor, Groenenborgerlaan 171, B-2020 Antwerp, Belgiumb Department of Chemistry, Plant Biochemistry and Physiology, University of Antwerp, Groenenborgerlaan 171, B-2020 Antwerp, Belgiumc National Institute of Public Health and the Environment (RIVM), Anthonie van Leeuwenhoeklaan 9, P.O. Box 1, 3720 BA Bilthoven, The Netherlands

a r t i c l e i n f o a b s t r a c t

Article history:Received 29 April 2008Received in revised form 14 August 2008Accepted 4 September 2008Available online 30 October 2008

Keywords:GenomicsProteomicsZebrafishBrominated flame retardants

0045-6535/$ - see front matter � 2008 Elsevier Ltd. Adoi:10.1016/j.chemosphere.2008.09.030

Abbreviations: BFR, brominated flame retardant;methyltransferase; Brd 8, bromodomain containinganalysis; DIA, differential in-gel analysis; DiGE, differGO, gene ontology; GST, glutathione-S-transferase; Hnamic acid; HSP 70, heat shock 70 kDa protein 5; IEF,locally weighed scatterplot smoothing; MAP, mitomethionine; MIAME, minimum information about a mmethionine sulfoxide reductase; PEPCK, phosphoenolprotein kinase C; PMF, peptide mass fingerprint; PMTretinol binding protein; SULT2, sulfotransferase 2;hormone receptor; TTR, transthyretine; TBBPA, tetrab

* Corresponding author. Tel.: +32 3 2653350; fax: +E-mail address: Marijke.dewit@ua.ac.be (M. De W

Tetrabromobisphenol-A (TBBPA) is nowadays one of the most frequently used brominated flame retar-dants (BFRs) and can be considered as a high production volume chemical. Over the last decade, numer-ous reports of increasing concentrations of BFRs in the environment and humans have been published.However, the toxicological knowledge on TBBPA, and more specifically its molecular mode of action, israther fragmentary. In this study two populations of adult zebrafish (Danio rerio) were exposed for 14days to 0.75 lM and 1.5 lM TBBPA. Subsequently, we employed a combined transcriptomic and proteo-mic approach to evaluate the molecular effects of TBBPA in zebrafish liver. Oligonucleotide microarrayswere used to study the effects on gene expression levels. These results were validated through real-timePCR. The proteome of the liver was analysed by means of differential in-gel electrophoresis (DiGE), aninnovative application of traditional 2D-PAGE. Combination of the extracted datasets allowed reassem-bling of individual molecular responses into a comprehensive overview of affected molecular pathways.Interpretation of the results depicted an interference of thyroid and Vitamin A homeostasis in theexposed zebrafish, TBBPA also elicited responses indicating onset of oxidative stress and general stressresponses. Additionally, numerous differentially expressed transcripts could be associated with defencemechanisms or corresponded to metabolizing enzymes. Furthermore, cellular metabolism was clearlyaffected, illustrated as disturbance of e.g. lipid, carbohydrate, and organic acid metabolic processes. Sum-marizing, these results enabled us to hypothesize several working mechanisms of TBBPA and demon-strated the potential of a combined genome and proteome approach to generate detailed mechanistictoxicological information.

� 2008 Elsevier Ltd. All rights reserved.

1. Introduction

Although many synthetic chemicals are currently being used ina commercial context without proper knowledge of their possibleenvironmental threat, society is becoming more and more awareof the need to analyse the detailed (eco)toxicological properties

ll rights reserved.

BHMT, betaine homocysteine8; BVA, biological variationential in-gel electrophoresis;CCA, a-cyano-4-hydroxycin-iso-electric focusing; Lowess,gen-activated protein; Met,icroarray experiment; MsrA,

pyruvate carboxykinase; PKC,, photo multiplier tube; RBP,T4, thyroxine; THR, thyroidromobisphenol-A.32 3 2653497.

it).

of these chemicals (Neumann and Galvez, 2002). In order to gaina more detailed toxicological comprehension, ‘-omics’ informationcan be extracted to complement data acquired at higher levels ofbiological organization. It is more and more recognized that suchmechanistic information, generated through study of gene andprotein expression, can be a valuable asset for risk assessmentprocesses (Aardema and MacGregor, 2002). Toxicogenomics repre-sents an approach to determine how the regulation and expressionof genes control the physiological responses induced by exposureto a chemical compound. However, due to the relatively low corre-lation between mRNA and protein, gene expression analysis isinadequate to predict effects on proteome level (Anderson andSeilhammer, 1997). Therefore, it is essential to also analyse theproteome in parallel. The most commonly used method for study-ing protein expression profiles is currently two-dimensional poly-acrylamide gel electrophoresis. Due to a significant advancementof this traditional approach, differential in-gel electrophoresis(DiGE), it is possible to label proteins with fluorescent dyes

M. De Wit et al. / Chemosphere 74 (2008) 96–105 97

(Cy Dyes) and multiplex them within a single gel, allowing com-parison of samples from different exposure conditions on one gel(Unlü et al., 1997). When combining transcriptomic and proteomictechnologies, one can generate a first impression of how an organ-ism responds to a given toxic stimulus at the molecular level(Snape et al., 2004).

The present study applied a combined genomics and proteo-mics approach to unravel the influence of tetrabromobisphenol A(TBBPA) on genes and proteins in the liver of zebrafish (Danio re-rio). TBBPA is the most widely used brominated flame retardant(BFR) and belongs to the group of high production volume chemi-cals (global consumption assessed: 300000 t a�1) (Alaee et al.,2003). BFRs represent a broad spectrum of organic chemicals thatare added or covalently bound to polymers which are used in elec-tronic circuitry, plastics, textiles and other materials to prevent fireor to slow down a developing fire. Although they have considerablevalue for a cost-effective reduction of fires, recent reports illus-trated environmental health issues (Alaee and Wenning, 2002).Next to effects on cell function (Canesi et al., 2005) and hepaticcytochrome P450 levels (Germer et al., 2005), TBBPA has been sug-gested to interfere with the thyroid hormonal system (Kitamuraet al., 2002, 2005). Concerning effects in fish, results from a partiallife-cycle test described a negative effect of TBBPA on reproductivesuccess in zebrafish, accompanied by a reduction of matureoocytes in the ovaries (Kuiper et al., 2007).

In order to generate a more complete mechanistic overview ofthis compound on the molecular level, in the present study adultzebrafish (D. rerio) were exposed to TBBPA for 14 days followinggene and protein expression profiling in the liver. Primary objec-tive of this study was to display a set of reactions, measured at gen-ome and proteome level, generating an overview of molecularpathways subject to TBBPA exposure.

2. Materials and methods

2.1. Experimental exposures

2.1.1. General exposure conditionsIn this study, adult zebrafish (D. rerio) were used to evaluate the

effects of TBBPA on the genome and proteome. The exposureexperiment was performed at the National Institute of PublicHealth and the Environment (RIVM, Bilthoven, The Netherlands).Adult zebrafish were supplied by commercial importer (Ruine-mans Aquarium BV, Montfoort, The Netherlands) and were accli-matised for a minimum period of 28 days. The fish weremaintained on a photoperiod of 14 h light: 10 h dark in water witha constant temperature of 27 ± 2 �C, pH ranging from 6.9 to 7.8 andoxygen levels exceeding 5 mg L�1 at all times. The animals werefed defrosted Artemia two times a day (Landman BV, Hoevelaken,The Netherlands) in an amount that was consumed within 5 min.Seven days prior to the experiment, the fish were transferred tothe testing system with standard formulated water (van der Venet al., 2006).

2.1.2. Exposure experimentTetrabromobisphenol A (TBBPA; technical mixture, homoge-

nous with a purity of 99.17% and containing tribromoBPA ando,p0-TBBPA as impurities, verified by HPLC analysis) was obtainedas a composite mix through BSEF (Bromine Science and Environ-mental Forum) (kindly provided by Dr. Klaus Rothenbacher). Stocksolutions of TBBPA were prepared in dimethyl sulfoxide (DMSO),DMSO was also submitted to the control populations to reach iden-tical concentrations in each experimental unit (final DMSO concen-trations: 0.01% in all groups including controls). Threeexperimental groups were used, a control population and two

exposed populations administered 0.75 lM (low) and 1.5 lM(high) TBBPA, respectively. For each experimental condition 12zebrafish (in triplicate) were used, with a sex ratio 1:1 (6 male fishand 6 female fish per experimental unit). Exposure was semi-staticby medium renewal every 3–4 days and was performed in 9 L fullglass tanks (0.75 L per fish). During the experiment, temperature,pH and oxygen concentrations were measured before and afterexposure medium renewal. These conditions were kept similar asdescribed for the acclimatisation period. Residual organic matterwas removed every other day. A first experimental populationwas exposed to 0.75 lM TBBPA (corresponding to 0.408 mg L�1),representing the low exposure concentration. A concentration of1.5 lM TBBPA (corresponding to 0.816 mg L�1) was administeredto a second experimental population. After 14 days of exposureall the fish were decapitated, livers were dissected, frozen in liquidnitrogen and kept at �80 �C for later extraction of RNA and pro-teins. For every replicate, female and male fish were pooledseparately.

Prior to the presented experiment, a similar experiment underthe same exposure conditions was performed at the RIVM. The ac-tual TBBPA water concentrations were analysed during the expo-sure cycles. These measurements showed a decrease of TBBPAwater concentrations reaching a minimum after 96 hrs at5.2 ± 2.7% (SD) of the nominal values. TBBPA levels were also mea-sured on both wet and lipid weight of the exposed fish and showeda strong linear relation with the nominal water concentrationwhich was not gender-related (Kuiper et al., 2007). However, thiscomplementary experiment was carried out with a lower loadingrate (6 fish/6 L), therefore it can be possible that our experimentexperienced a higher TBBPA degradation rate.

2.2. RNA and protein extraction

Following homogenisation of the livers with mortar and pestlein liquid nitrogen, total RNA from the zebrafish populations (con-trol, 0.75 lm TBBPA and 1.5 lm TBBPA) was extracted by applica-tion of TRIzol-RNA-extraction. Afterwards RNA was purified bymeans of DNAse treatment with 1 U RNAse-free DNase and 1 URNAse inhibitor (Fermentas, St.Leon-Rot, Germany) per 30 lL sam-ple, followed by a phenol–chloroform treatment. The exact amountof RNA was quantified by spectrophotometry (NanoDrop ND-1000Spectrophotometer) and RNA quality was assessed using 260/280and 260/230 ratios. Integrity of the RNA was evaluated by denatu-rating formamide-agarose gel-electrophoresis.

2.3. Microarrays

2.3.1. ArraysAminosilane coated glass slides (Asper Biotech, Tartu, Estonia)

were spotted robotically with a commercially available library of3479 oligonucleotides which were designed as complementaryprobes to tissue a-specific zebrafish genes with known functions(Qiagen Operon� Array-ready oligo setTM, Qiagen, Venlo, the Neth-erlands). These oligos were spotted in duplicate through contactprinting using a Qarray mini (Genetix Ltd., Hampshire, UnitedKingdom) and cross-linked by UV radiation (6 � 105 lJ) (Stratalin-ker, Stratagene, La Jolla, CA, USA). Controls (Lucidea UniversalScoreCard, GE healthcare, Roosendaal, The Netherlands) were spot-ted complementary on the arrays to give an indication about thespecific character and the efficiency of the hybridization.

2.3.2. Labelling of RNA samplesThe first step of the labelling comprises a conversion from RNA

to labelled cDNA which represents the transcripts in the sample.Superscript II RNase H-Reverse Transcriptase (Gibco BRL, Life Tech-nologies, Merelbeke, Belgium) was used, which converted the

98 M. De Wit et al. / Chemosphere 74 (2008) 96–105

available RNA to the corresponding cDNA by use of the presentaminoallyl-dUTP and unlabelled dTTP. This reaction was initiatedusing Random Hexamer Primers (Gibco BRL, Life Technologies,Merelbeke, Belgium). In order to determine the sensitivity of thefollowing hybridization, RNA samples were spiked with Lucideareference and test mRNA spikes at known concentrations. Aftercreating the cDNA probes, unincorporated aminoallyl-dUTP wasremoved by use of a Qiaquick PCR purification kit (Qiagen, Crawley,UK). Cy3 and Cy5 dyes were added and incubated with the dUTP-labeled cDNA. To remove unbound dyes a second purification stepwas performed. Incorporation of the Cy3 and Cy5 dyes was evalu-ated, by means of a spectrophotometer, at 550 nm (Cy3) and650 nm (Cy5), respectively. Following quantification, 150 pmol ofCy3 dye and Cy5 dye (coupled to the cDNA) were combined andsubjected for 5 min to 95 �C, resulting in denaturation.

2.3.3. HybridizationSpotted arrays were incubated in prehybridization solution

containing 20 � SSC, 10% SDS and 20 mg mL�1 BSA for approxi-mately 1 h after which arrays were rinsed in isopropanol and waterbefore drying with compressed N2. Prior to hybridization on the ar-rays, samples were dissolved in hybridization solution consistingof 30% formamide, 5 � SSC, 0.1% SDS, 0.1 mg mL�1 BSA and0.1 mg mL�1 sheared salmon sperm. Subsequently, samples fromcontrol populations and exposed populations were combined andhybridized on the arrays during overnight incubation at 42 �C.After incubation, stringency washes were carried out to removeany unbound probes.

2.3.4. Visualization and bioinformatic analysisArrays were scanned with a Genepix Personal 4100A confocal

scanner (Axon instruments, Union city, CA, USA) which excitedthe fluorophores at 532 and 635 nm. To balance the overall inten-sities between the two channels, the PMT voltage was adjusted foreach slide to obtain a ratio close to one. Evaluation of the Lucideacalibration series showed that the arrays were reliable to measureexpression levels across a dynamic range spanning several ordersof magnitude. The negative controls showed absence of non-specific hybridization. Spot recognition, identification and quantifi-cation of raw fore- and background intensities were automatedusing Genepix Pro 4.1 software (Axon Instruments, Union city,CA, USA). This raw data was subsequently processed in the Bioar-ray Software Environment Database (BASE 1.2.12, http://www.isla-b.ua.ac.be/base/), a free MIAME platform based microarray analysismethod customized by the Intelligent Systems Laboratory (Univer-sity of Antwerp, Antwerp, Belgium). After local background sub-traction, intensity ratios could be calculated and were log2

transformed in order to review the ratio’s of up-regulated anddown-regulated genes at the same scale (Leung and Cavalieri,2003). Intensity-dependent variations in relative Cy3 and Cy5 sig-nals were removed by Locally Weighed Scatterplot Smoothing(Lowess), which applies a smoothing correction on the collectionof log2 values. All the described analyses were performed in tripli-cate (biological replicates). Based on data from self–self hybridiza-tions, spots with an �0.75 > abs (M) > 0.75 (fold change > 1.68

Table 1aUsed primers to validate results of the microarrays

Gene ID Gene name

NM_130920 Retinol binding protein 4BM317318 Bromodomain containing 8BI705518 WD-repeat 1AW116402 Delta 1-pyrroline-5-carboxylate synthetaseNM_131397 HSP 70 kDaNM_198914 SULT2AF533661 Ribophorin II

or < 0.59) were considered differentially expressed (with M = log2

(Cy5/Cy3)). All differentially expressed genes were classified usingBlast2GO (www.blast2go.de), a comprehensive bioinformatics toolwhich enables annotating and classifying of differential genes (orproteins) according to the Gene Ontology (GO) designation.

2.4. Quantitative real-time PCR analysis

In order to validate the microarray results, real-time quantita-tive PCR was performed using a Roche Molecular BiochemicalsLightCycler 3.5 with the LightCycler FastStart DNA MasterPLUS SYBRGreen I Kit (Roche Diagnostics, Germany). Superscript First-StrandSynthesis System (Invitrogen life technologies, Merelbeke, Bel-gium) was used to construct complementary DNA strands out ofall the RNA samples. The primers were designed by means of RocheMolecular Biochemicals LightCycler Probe Design software 1.0 (Ta-ble 1a). Based on screening of previous microarray experimentsand the TBBPA experiment, a housekeeping gene Ribophorin II,which showed to be not differentially expressed, was selected fornormalization. Cycling parameters were 95 �C for 5 min, followedby 45 cycles of 10 s at 95 �C, 10 s at 58 �C and 12 s at 72 �C. For eachbiological replicate (three in total, as for the microarrays), eachgene measured by real-time PCR was measured in 3 technical rep-licates. Calculation of the expression of the transcripts was per-formed as reported by Pfaffl (2001) including efficiencycorrections for each transcript. Complementary melting curveanalysis was implemented in order to detect possible formationof non-specific PCR products.

2.5. Proteomics

2.5.1. Protein extractionParallel with the RNA extraction by TRIzol reagent, proteins

were extracted out of the homogenized liver tissues. Although TRI-zol reagent is a common RNA extraction reagent, we also used thisreagent to extract the proteins in order to perform the analyses ondifferent molecular levels, being genome and proteome, on the ex-act same samples. After removal of the RNA, DNA was precipitatedby ethanol. Subsequently, proteins were isolated using isopropa-nol. The TRIzol user manual recommends solubilizing the proteinsby adding 1% SDS; however, this approach resulted in insufficientsolubilization. Therefore, the resulting protein pellet was dissolvedin a resolubilization buffer containing 7 M urea, 2 M thiourea and4% CHAPS buffer. In order to remove salts, charged detergentsetc., the protein extract was purified by a clean-up kit (GE Health-care Europe, Diegem, Belgium). Total protein concentration wasdetermined with a RC DC Protein Assay (Bio-Rad Laboratories, Naz-areth, Belgium) in order to load the appropriate amount of proteinsamples.

2.5.2. Labelling of proteins with fluorescent dyesPrior to labelling, samples were adjusted to pH 8–9 by adding

50 mM NaOH. Liver samples of the male control population andof the population exposed to 1.5 lM were labelled with fluorescentcyanine dyes developed for differential in-gel electrophoresis (GE

Forward Reverse

ATGGAACCATGACAGCC CCAGTCTGGAGATACGCGAACAGAACACCGAGTCC CTCCATCCCTTCATCCACAGCTCTGCTTCTGGAATG CCTGTCTGATGTTCCACTCCGTGAGCTGGCATTC TGCTGTATCGAGGTGGTCATCGACGCCAACGGG CCAGGGAGTTTTTAGCAGAAATCTTAGCATCGAGCCATTCT ACATGGTCAAACCAGCTTGAGTTCAGCCAGCGT TGGCAACAAATCGGCG

M. De Wit et al. / Chemosphere 74 (2008) 96–105 99

Healthcare). These Cy Dyes are supplied as N-hydroxyl succinim-idyl ester derivatives, which react with the epsilon amino groupof lysine residues in 5% of the proteins in a sample. In order to ex-clude the potential variation in labelling efficiency or fluorescence,both samples were labelled with Cy3 as well as Cy5 to generatecolor flips. Complementary to this, a pool of both samples was cre-ated and coupled with a third fluorochrome Cy2 to generate aninternal standard for normalization. Proteins were labelled at a fi-nal concentration of 200 pmol Cy Dye per 50 lg protein.

2.5.3. Two-dimensional electrophoresisPrior to iso-electric focusing (IEF), 50 lg of the control protein

sample, 50 lg of the exposed protein sample and complementary50 lg of internal standard was combined in one sample to beloaded per gel. For first dimension separation, rehydratation load-ing was preferred as sample application method. After addingrehydratation solution (6 M urea, 2 M thiourea, 0.2% DTT, 0.5%IPG buffer, 0.5% bromophenol blue) to the combined protein sam-ples, the samples were loaded into the strip holders. Immobilinestrips (24 cm) (GE Healthcare), ranging from pH 3 to 10, wereplaced onto the samples and covered with cover fluid. IEF was per-formed on an Ettan IPGphor 3 IEF system (GE Healthcare) and fo-cused for 12 h at 30 V, 1 h at 200 V, 1 h at 500 V, 1 h at 1000 Vand finally 8000 V until 52000 V h were supplied. After IEF, stripswere incubated in equilibration buffer (6 M urea, 30% glyceroland 2% SDS) containing 10 mg mL�1 DTT for 15 min at room tem-perature, followed by alkylation in equilibration buffer containing40 mg mL�1 iodoacetamide.

Second dimension SDS–PAGE was performed with an EttanDALT six electrophoresis unit (GE Healthcare). Vertical 12.5%SDS–PAGE gel slabs (240 mm � 200 mm � 1 mm) were freshlyprepared between glass plates. The IPG strips were positioned ontop of the polyacrylamide gels and overlaid with 0.5% agarose seal-ing solution. Second dimension was prerun at 600 V, 400 mA and2.5 watt gel�1 for 30 min, followed by the definite run at 600 V,400 mA and 100 watt until bromophenol blue fronts reached thegel bottom. After electrophoresis, gels were scanned with a Ty-phoon Variable Mode Imager 9400 (GE Healthcare). This scannerallows generation of three images for each gel, corresponding tothe three different protein samples labelled with the three differ-ent Cy Dyes. The Cy3, Cy5 and Cy2 images were scanned by using532 nm, 633 nm and 488 nm lasers, respectively. All the gels werescanned at a pixel resolution of 100 lm.

2.5.4. Processing of proteomics dataAnalysis of the 3 gels was performed using DeCyder Differential

Analysis software, version 5.0 (GE Healthcare). The correspondingimages for the 3 dyes were imported as TIFF files in the DIA (differ-ential in-gel analysis) module of the software package to detect thespots present in every image. The triple detection algorithm al-lowed detection of the spot features in the three different imagesand to incorporate all these spot features in one single image.The volumes of the detected spots were always expressed withthe background subtracted, which is calculated as the lowest10th percentile value of all the pixel values observed on the spotboundary. Subsequently, the DIA module algorithms quantifiedthe spot protein abundance for each image and presented differ-ences in expression as ratio values. After this preliminary process-ing, the obtained spot data was exported to the BVA (BiologicalVariation Analysis) module for inter-gel matching, allowing quan-titative comparisons of protein expression across numerous gels.The generated gels were linked and matched in the BVA module.Although the software was capable of performing an automaticmatching between corresponding spots across gels, this processwas verified manually. Statistical analysis was executed by apply-ing a t-test on the matched spot pairs. Finally, protein spots with a

log2 ratio larger than 1 (up-regulated) or smaller than –1 (down-regulated) and showing a p-value below 0.05 were assigned as sig-nificant differential protein spots.

2.5.5. Identification of proteins of interestAfter analysis of the gels and selection of differential proteins,

the gels were stained with colloidal Coomassie Brilliant Blue in or-der to enable spot picking. Spots with significantly altered levelswere excised manually for identification by mass spectrometry.Excised protein spots were washed three times with 95% acetoni-trile, one time with 50 mM NH4HCO3 and once again with 95% ace-tonitrile. After drying, the gel pieces were incubated with 4 lL oftrypsin solution (25 ng lL�1 trypsin in 50 mM NH4HCO3, 10%CH3CN) for 30 min at 4 �C. Prior to an incubation of 4 h at 37 �C,10 lL of substitute buffer (50 mM NH4HCO3, 10% CH3CN) wasadded. Following this in-gel proteolysis, each tryptic peptide mix-ture was desalted by using ZipTipl-C18 (Millipore, Brussels, Bel-gium), mixed with HCCA (a-cyano-4-hydroxycinnamic acid) andspotted on Opti-TOF target plates according to the dried dropletmethod. Peptide masses were acquired with a MALDI-TOF massspectrometer (Proteomics analyzer 4700, Applied Biosystems, Fos-ter City, CA, USA) at reflection mode in order to generate PeptideMass Fingerprints (PMF’s). Calibration of the mass spectrometerwas based on an internal standard Glu-Fib (600 femtomol) witha m/z ratio of 1570. Additionally, external standards were used.More specifically, a mixture of peptides specifically designed forcalibration of mass spectrometers (Calmix 2, Applied Biosystems).Sequence database searches were performed using Mascot, usingGPS-Explorer TM software. Peptide mixtures that could not beidentified unambiguously based on the corresponding PMF’s werefurther analysed by applying MS/MS mass spectrometry.

3. Results

3.1. Gene expression

The TBBPA-induced gene expression changes in male and fe-male zebrafish liver were evaluated for two concentrations ofTBBPA (0.75 lM and 1.5 lM) after one exposure interval (14 days).Analysis of the oligo microarrays depicted 52 differentially ex-pressed genes in the liver of female organisms exposed to0.75 lM TBBPA; exposure to 1.5 lM TBBPA elicited an effect on34 genes. In the male liver, exposure to 0.75 lM and 1.5 lM TBBPAprovoked a differential expression of 25 and 27 genes, respectively.A detailed list of these differentially expressed genes, accompaniedby their corresponding expression levels, can be found in the Sup-plementary material. By classifying the differentially expressedgenes using Blast2GO (www.blast2go.de), biological processesand molecular functions could be ascribed to these genes of inter-est. Fig. 1 represents a graphic overview of the biological processeswhich were highly affected after TBBPA exposure.

Although only 12 differentially expressed genes showed overlapbetween both genders, Fig. 1 illustrates a quite similar distributionof the differential genes across the biological processes. For bothgenders we could relate more than 65% of the influenced genesto metabolism, transcription or cell structure. Metabolic distur-bances (mainly of the protein metabolism) were most pronouncedin exposed females, transcription-related reactions on the otherhand were more prominent in the male organisms. In the exposedfemales, the responses related to protein metabolism reflectedstimulation of ubiquitin-dependent protein catabolic processes.Influence on the glutathione/methionine/cysteine metabolismwas also more pronounced in female organisms. Other differen-tially expressed genes were related to lipid metabolism (e.g. fattyacid binding proteins, retinol binding proteins...), carboxylic acid

0 5 10 15 20 25 30 35 40 45

cell organization and biogenesis

development and reproduction

transport

signal transduction

regulation of transcription, DNA-dependent

gametogenesis

response to stimulus

metabolic processes

femalemale

0 10 20 30 40 50 60 70

cellular protein metabolic process

glutathione/methionine/cysteine metabolism

lipid metabolic process

carboxylic acid metabolic process

phosphate metabolic process

% differential genes

% differential genes

Fig. 1. Graphical presentation of the most influenced biological processes, based on the genes (expressed as the percentage of the total number of differential genes) whichwere differentially expressed in the zebrafish livers.

100 M. De Wit et al. / Chemosphere 74 (2008) 96–105

and phosphate metabolism. Concerning phosphate metabolism, nodifferential effects were measured in the male fish exposed toTBBPA. The lipid metabolism on the other hand showed to be influ-enced in both genders. The most prominent response was theinhibitory effect on retinol binding protein mRNAs, which was de-tected in every exposed condition. Also fatty acid binding proteinmRNAs were down-regulated in both exposed males and females.Carboxylic acid metabolic processes experienced most impact inthe male organisms as clearly illustrated in Fig. 1. This categoryof differential transcripts encoded enzymes with catalytic activi-ties, which to some extent could be related to carbohydrate metab-olism (phosphoenolpyruvate carboxykinase, tryptophan-5-monooxygenase, glutamate dehydrogenase 1...). As earlier stated,transcription-related reactions were more pronounced in the malefish. Some of these transcriptomic responses could also be associ-ated with developmental processes and signal transduction. Sev-eral of the differentially expressed mRNA’s could be linked to theWnt receptor signaling pathway (casein kinases, wnt-11 relatedprotein). Another interesting response, associated with the thyroidhormonal system, could be observed in this category of transcrip-tion-related transcripts. More specifically, the transcript corre-sponding to Bromodomain containing 8 (Brd 8, also known astranscription factor SMAP, Skeletal Muscle Abundant Protein)was suppressed in both the low and high male exposed popula-tions. The gene Brd 8 encodes for a protein able to interact withthe thyroid hormone receptor (THR) in a ligand-dependent man-ner. Moreover, this protein is considered a nuclear co-activatorfor the THR, as it enhances thyroid hormone-dependent activationfrom thyroid response elements.

Effects related to disturbance of cell organization and biogene-sis were detected in every experimental condition. Female fish ex-posed to 0.75 lM TBBPA displayed an inhibition of actininteracting protein 1, which was also observed in male organisms(1.5 lM). Effects on motor proteins (myosins) were observed inonly one female condition (0.75 lM).

TBBPA also provoked differential expression of genesknown to react on various stimuli and oxidative stress. Themost obvious signal of a present stress response was anup-regulation of Heat shock protein 70 kDa protein 5; how-ever this effect was only measured in one male condition(0.75 lM). The male fish exposed to 1.5 lM TBBPA displayedan upregulation of methionine sulfoxide reductase. Indicationsof oxidative stress in the female fish were observed asdown-regulations of stress-associated endoplasmic reticulumprotein 1, myosin VIIa and retinol binding protein 4. Fig. 2presents a summary of the affected GO based biological cat-egories, together with their corresponding differentially ex-pressed genes. The illustration of the gene expression levelsis color-based.

3.2. Real-time quantitative PCR

Real-time PCR was used to confirm the differential expressionlevels of some selected genes. The suppressive effect on retinolbinding protein 4 (RBP4) could be verified by RT-PCR, as both thefemale conditions and the males exposed to 0.75 lM displayed asignificant down-regulation of RBP4. For the male fish exposed to1.5 lM TBBPA, we could not observe a significant inhibition ofRBP4 on the microarray. However, RT-PCR showed a significantdown-regulation of this transcript. RT-PCR showed a suppressionof Bromodomain containing 8 in all the experimental conditions,and the repression of WD-repeat protein 1 could also be validated.Concerning upregulated genes, we wanted to validate the stimula-tion of delta 1-pyrroline-5-carboxylate synthetase in the males ex-posed to the low concentration of TBBPA, and additionally wediscovered an upregulation of this transcript in both the femalesand males exposed to 1.5 lM TBBPA. Furthermore the upregula-tion of HSP 70 in the males, exposed to 0.75 lM TBBPA, could beconfirmed. Again we measured, also for other conditions, a stron-ger response with RT-PCR compared to the results from the micro-

Fig. 2. Gene expression profiles of the four experimental conditions. Every row corresponds to one gene and expression levels are represented according to a color scale.Shades of red correspond with an up-regulation of the transcript, shades of green with an inhibition.

M. De Wit et al. / Chemosphere 74 (2008) 96–105 101

arrays. Apart from confirmation of genes that showed to be differ-entially expressed using microarray analysis, the expression of onespecific gene of interest was additionally measured by means ofRT-PCR. Because of the fact that sulfotransferases were not repre-sented in the used oligo library, we chose to evaluate the expres-sion of sulfotransferase 2 (SULT2) with RT-PCR. Sulfotransferasesare enzymes involved in estrogen metabolism, by means of recep-tor-independent mechanisms, and have been reported to be af-fected by several xenobiotics (Kirk et al., 2003; Harris andWaring, 2008). Results showed a significant up-regulation of SULT2in the female conditions. However the male fish exposed to 1.5 lMTBBPA displayed a down-regulation, suggesting a gender-specificresponse of this enzyme. Results of the RT-PCR analyses are sum-marized in Table 1b.

3.3. Differential protein expression

Proteome analysis was only performed on male liver exposed to1.5 lM TBBPA vs. male control liver. These liver protein sampleswere analysed by two-dimensional difference in-gel electrophore-sis, originally described by Unlü et al. (1997). This innovative tech-nique allowed to separate protein samples from a controlpopulation and a TBBPA exposed population on the same gel andto compartmentalize the different protein samples, by virtue ofthe distinctive spectral characteristics of the fluorescent Cy Dyes.In our study, each gel contained two individual mixtures of liverextracts and an internal standard, composed of the two liver sam-ples. Analysis showed that only 12 protein spots out of the 562 de-tected spots could be considered as significant differential

Table 1bResults of the Quantitative RT-PCR

Gene ID Gene name Eff Log2 ratios

0.75 lm F 1.5 lm F 0.75 lm M 1.5 lm M

Q A Q A Q A Q A

NM_130920 Retinol binding protein 4 1.94 �1.42*** �1.05 �3.99*** �0.98 �1.14*** �1.13 �1.01*** �0.6BM317318 Bromodomain containing 8 1.87 �1.66*** �0.28 �1.29*** �1.74 �1.02*** �0.91 �1.69*** �0.78BI705518 WD-repeat protein 1 1.76 �3.48*** �2.19 �1.56*** �0.52 �0.56*** nd �1.9*** �2.74AW116402 Delta 1-pyrroline-5-carboxylate synthetase 1.75 0.09** 0.44 0.99** 0.57 2.09** 1.06 1.04** 0.71NM_131397 HSP 70 kDa 1.78 �0.79*** �0.21 0.56*** 0.41 2.62*** 0.99 0.89*** 0.52NM_198914 SULT2 1.82 1.36* nd 1.23* nd �0.22* nd �1.01* ndAF533661 Ribophorin II 1.98 0.02 0.01 0.05 0.02 0.16 0.09 0.07 0.02

Expression levels of every gene transcript were determined in triplicate and presented by the mean log2 ratio. Eff: calculated efficiency of the primer pair. Q: gene expressiondata resulting from RT-PCR. M: gene expression data resulting from microarrays. nd: no data available. Statistically significant differences, of the RT-PCR results, in geneexpression between control and TBBPA-treated fish are denoted as follows: * p < 0.05, ** p < 0.01, *** p < 0.001 (Student’s t-test).

Table 2Listing of differential proteins

NCBInr Acc Protein name Theor./exp.a

MW(kDa)Theor./exp. pI Prot. Sc. C.I. %b Peptide countc Log2 ratio

gi|82076975 Betaine homocysteine methyltransferase [Danio rerio] 44.0/44.6 6.75/6.61 99.6 16 �1.39Unknown �1.32Unknown 2.37

gi|82187997 Phosphoglycerate mutase 1 28.8/29.1 6.46/6.19 95.4 16 1.4Unknown �1.18

gi|82237487 Heat shock 70kDa protein 5 [Danio rerio] 71.9/72.1 5.05/5.04 100 18 2.23Unknown 1.63

gi|82202219 Bactin2 [Danio rerio] 41.7/42.0 5.33/5.30 100 18 �1.42Unknown �1.35

gi|82076975 Betaine homocysteine methyltransferase [Danio rerio] 44.0/44.6 6.75/6.61 100 19 �1.26

gi|82240537 Similar to chaperone protein GP96 isoform 10 [Daniorerio]

91.4/91.3 4.78/4.77 98.2 14 1.72

gi|82076975 Betaine homocysteine methyltransferase [Danio rerio] 44.0/44.6 6.75/6.61 99.9 10 �1.19

a Theor.: theoretical, data-based annotation; exp.: experimental value, from two-dimensional gels.b Prot. Sc. C.I: protein score confidence interval, proteins with a confidence interval of 95% or higher were considered as significant identifications.c Number of peptides in the spectra of the tryptic digests, identified for a given protein.

102 M. De Wit et al. / Chemosphere 74 (2008) 96–105

(p < 0.05, t-test). Five of these spots showed an increase in inten-sity, whereas 7 spots displayed a decrease. Of these selected differ-ential proteins, 8 proteins could be identified unambiguouslythrough generation of a PMF; these are listed in Table 2. Analysisof the differentially expressed proteins elucidated a stress re-sponse, as two significantly up-regulated proteins were identifiedas Heat shock protein 70 kDa protein 5 and Chaperone proteinGP96. Next to this stress response, stimulation of the protein phos-phoglycerate mutase 1 was observed, implying an interferencewith the glycolysis pathway. Concerning the suppressive effectsof TBBPA, two down-regulated proteins could be identified. Oneof these proteins concerned a structural constituent of the cyto-skeleton, corresponding to b-Actin. Betaine homocysteine methyl-transferase (BHMT) also showed to be down-regulated due toTBBPA exposure; this protein plays an important role in thehomeostasis of homocysteine metabolism. Unfortunately, the pro-tein spot with the most significant differential expression level, alog2 ratio of 2.37, could not be identified through PMF or throughsubsequent MS/MS.

4. Discussion

The demand to explain effects of chemicals by unravelling theirtoxicological mechanisms of action has drawn ecotoxicologists intothe ‘‘omics” arena, leading to the integration of genomics and pro-teomics information in ecological risk assessment of chemicals(Snape et al., 2004). Present literature illustrates that there is anextensive interest for the application of these techniques. However

studies integrating both transcriptome and proteome analyses arerather rare (Wetmore and Merrick, 2004). The present study’s pri-mary objective consisted of the investigation of hepatic geneexpression responses in adult zebrafish exposed to TBBPA. Classifi-cation of the altered genes, according to their corresponding bio-logical processes, allows hypothesizing TBBPA’s possiblemechanism of action. Complementary, we also performed prote-ome analyses on livers of one experimental condition, being themale fish exposed to 1.5 lM TBBPA. This approach was appliedin order to explore the potential of proteomics as a tool to assesstoxic insult and to evaluate the value of a combined –omicsapproach.

4.1. Gene expression responses related to cellular metabolism

Gene expression analysis revealed a response on the gluconeo-genic pathway as phosphoenolpyruvate carboxykinase (PEPCK)was inhibited in both the female and the males exposed to0.75 lM TBBPA. PEPCK is the rate-limiting enzyme in gluconeogen-esis and plays a central role in the synthesis of glucose in the liver.Inhibition of this enzyme can provoke a blocking of the gluconeo-genic pathway (Lelli et al., 2007). Fructose-1, 6-biphosphatase iso-zyme 2, another key enzyme related to the gluconeogenesispathway, showed to be up-regulated in the male fish exposed to1.5 lM TBBPA. Toxic threats often show to be accompanied by ef-fects on carbohydrate metabolism. (Tonon et al., 1998; Lelli et al.,2007). Next to interference with carbohydrate metabolism, activi-ties of several transcripts related to lipid/fatty acid metabolism and

M. De Wit et al. / Chemosphere 74 (2008) 96–105 103

transport showed to be restrained, i.e. cytosolic phospholipase a2and fatty acid binding protein 7 were suppressed in the femaleorganisms exposed to 1.5 lM TBBPA. Gene expression analysis ofthe male livers (0.75 lM) depicted an inhibition of lipoprotein li-pase. In the male fish, exposed to the highest concentration, we ob-served a repression of fatty acid binding protein 2 and 10. Themetabolism of fatty acid binding proteins can be regulated accord-ing to the acute demands for fatty acid oxidation (McClelland,2004). Disruption of lipid and fatty acid metabolism has beennumerously associated with exposure to xenobiotics (Sanchoet al., 1998; Moens et al., 2007).

4.2. Gene expression responses related to hormonal and developmentaleffects

All four experimental conditions showed a down-regulation in theliver of either retinol-binding protein (RBP) 2 or 4, a 21 kDa proteinwith a single binding site for retinol. RBPs form complexes withtransthyretine (TTR), a transporter molecule for T4 (thyroxin), in or-der to prevent glomerular filtration (Newcomer and Ong, 2000). Apossible explanation for the observed suppression of RBPs could bethe fact that TBBPA competes with T4 for the binding site on TTR.The capability of TBBPA to compete with the T4-TTR binding has al-ready been described in literature (Meerts et al., 2000). Such interfer-ence can inhibit the complex formation of RBP with TTR, and lead toan excess of unbound T4 and retinol being susceptible for hepaticcatabolism, resulting in a decrease of circulating concentrations (Fer-nie et al., 2005). This hypothesis can be reinforced by the fact that adown-regulation of the transcription factor Bromodomain contain-ing 8 (Brd 8), a nuclear co-activator for the Thyroid hormone receptor(THR), was detected in both male conditions. Earlier studies have al-ready described TBBPA as being capable of binding with TTR, suggest-ing an anti-thyroid hormonal activity (Kitamura et al., 2005). A recentstudy also reported a decrease of plasma T4 in Wistar rats, exposed toTBBPA (van der Ven et al., 2005).

Interference with thyroid hormone and vitamin A homeostasiscan lead to alteration of development, growth, immune function,reproductive success and metabolism (Fernie et al., 2005). The im-pact of TBBPA on reproductive health in zebrafish has already beenstudied and showed reduced egg production and hatching. Histol-ogy analyses illustrated an overrepresentation of immature oocytesand oocyte atresia in zebrafish exposed to 1.5 lM TBBPA (Kuiperet al., 2007). Interference with reproductive health is often ascribedto estrogenic activities; however this study could not detect anymolecular responses indicative of a receptor-mediated estrogeniceffect. The generated molecular data was not conclusive enoughto explain a reproductive interference; nevertheless the suggestioncan be made that the obstruction of the thyroid hormone and vita-min A homeostasis could be underlying these observations.

Next to the hormone-related effects, we identified responses asso-ciated with developmental processes. Both genders exposed to0.75 lM TBBPA displayed interference with the Wnt receptor signal-ing pathway. In adult fish, the Wnt signalling pathway is related tostem cell function. Activation of present stem cells in adult fish ingeneral is associated with epimorphic regeneration, i.e. regenerationof damaged organs (Stoick-Cooper et al., 2007). Additionally, femalesexposed to 1.5 lM TBBPA demonstrated a down-regulation of a tran-script similar to stress-associated endoplasmic reticulum protein 1.Disruption of this gene, also known to respond to stress, has previ-ously been associated with growth retardation, increased mortalityand impaired glucose tolerance (Hori et al., 2006).

4.3. Gene expression responses related to other functions

Review of present literature describes BFRs as inducers of oxi-dative stress in cells and living organisms (Fonnum et al., 2006;

Reistad et al., 2007). TBBPA has also been linked explicitly withthe initiation of free radical formation, more specifically throughactivation of NADPH oxidase. This response was suggested to bedependent on elevation of intracellular calcium and triggering ofPKC and MAP kinase pathways (Reistad et al., 2005). Our micro-array analyses confirmed a possible response on the MAP kinasepathway and the calcium metabolism as we observed an up-regu-lation of mitogen-activated protein kinase 3 (Mapk3) and Ca 2+-ATPase in female zebrafish exposed to 0.75 lM TBBPA. The malefish exposed to 1.5 lM TBBPA displayed an inhibition of the tran-script corresponding to betaine homocysteine methyltransferase(BHMT), an enzyme responsible for remethylation of homocysteineto form methionine. Suppression of this enzyme can provoke an in-creased generation of the potentially toxic agent, homocysteine,which is released from the liver (Kharbanda et al., 2005). Elevatedlevels of homocysteine are often an indication of present oxidativestress and result in an increasing activity of antioxidant enzymes(Moat et al., 2000). In these male fish exposed to 1.5 lM TBBPAwe could only find one indication that might be supportive of thispossible introduction of oxidative stress, the stimulation of methi-onine sulfoxide reductase (MsrA). MsrA exhibits its action byreducing methionine sulfoxide residues in proteins and free methi-onine sulfoxide to Methionine (Met). Oxidation of methionine res-idues in essential proteins can be a lethal event without a repairmechanism. Therefore MsrA is considered as a ‘‘repair enzyme”(Weissbach et al., 2004). In the female organisms we detected anincrease of antioxidant enzymes related with glutathione conjuga-tion and sulfonation pathways. The female fish exposed to 0.75 lMTBPBA displayed an up-regulation of glutathione-S-transferase(GST). GST presents a detoxifying enzyme as it is responsible forconjugating numerous exogenous and endogenous compoundswith glutathione, and therefore limits oxidative damage (Sheweita,2000). In both female conditions RT-PCR revealed an effect on an-other drug metabolizing enzyme, being the stimulation of sulfo-transferase 2. Sulfotransferases are phase II metabolizingenzymes responsible for the sulfonation of phenolic metabolites,generating readily excretable sulfate esters (Sheweita, 2000). How-ever, these responses were only observed in female fish. Overall,these antioxidant-related responses were suggestive of oxidativestress damage inflicted by TBBPA exposure in zebrafish.

4.4. Correlation of the gene expression responses with effects measuredon proteins

To certain extend, the observed responses at protein levelshowed to be confirmative of the microarray results. As for geneexpression analysis, proteome analysis also revealed a down-regu-lation of betaine homocysteine methyltransferase and a stimula-tion of Heat shock 70 kDa protein 5 (HSP 70) in the liver of malefish exposed to 1.5 lM TBBPA. Additionally to the effect on HSP70, analysis of differentially expressed proteins elucidated theup-regulation of chaperone protein GP96, an ER-resident stressprotein belonging to the HSP 90 family. This chaperone displaysa dual functionality by directing peptides into the immune re-sponse pathway and assisting in protein folding (Linderoth et al.,2000). Proteome analysis also depicted an effect on gluconeogene-sis which was measured as an increased translation of phospho-glycerate mutase 1. These findings imply that responsesmeasured on genome level can actually give indications about ef-fects on the proteome. Next to affirmation, proteome analyses alsodelivered data complementary to the transcriptome data. Reviewof the extent of these –omics results suggested, at first sight, thatanalysis of the expression of transcripts appeared to be more sen-sitive as a measuring tool for toxic insult. However, this could onlybe based on the quantity of detected responses. The more stringentregulation of proteins can explain the rather limited number of

104 M. De Wit et al. / Chemosphere 74 (2008) 96–105

reactions, but also implies that the actual detected responses are ofa higher biological relevance (Wetmore and Merrick, 2004; Gygiet al., 1999). The fact that proteins represent the biological activemolecules in an organism, and therefore carry an essential amountof information in their responses makes them conceptually attrac-tive. Generating fingerprints of these responses has therefore thepotential to become a valuable tool for unravelling mechanismsof xenobiotics in an ecotoxicological context.

5. Conclusion

Regarding the toxicological properties of TBBPA, we depicted ef-fects on several molecular pathways. Results indicated a possibleinterference of TBBPA with the thyroid and vitamin A homeostasisin adult zebrafish. Such interference can elicit effects on develop-mental and reproductive level. A considerable amount of measuredeffects could be linked to the presence of oxidative stress, as therewere indications of elevated homocysteine levels and increasedtranscription of detoxifying enzymes. TBBPA also showed to be acompetent interrupter of the energy balance in zebrafish, morespecifically, organic acid-, carbohydrate- and lipid metabolism suf-fered obstruction due to TBBPA exposure. All observed molecularevents were in line with the present knowledge on TBBPA. In addi-tion, this study illustrated that the power of –omic approaches liesin the possibility to extract an extensive network of differentialexpression data, reflecting a molecular signature representativefor a particular toxic insult. In conclusion, this study demonstratedthe potential of a combined genomics and proteomics approach toelucidate molecular effects in an (eco)toxicological context. The ex-tracted proteome data showed to be confirmative and complemen-tary to the microarray results, consequently facilitating theunderstanding of potential molecular mechanisms of toxicity ofxenobiotics.

Acknowledgement

This research was funded by the Institute for the Promotion ofInnovation by Science and Technology in Flanders (IWT Flanders).

Appendix A. Supplementary material

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.chemosphere.2008.09.030.

References

Aardema, M.J., MacGregor, J.T., 2002. Toxicology and genetic toxicology in the newera of ‘‘toxicogenomics”: impact of ‘‘-omics” technologies. Mutat. Res. 499, 13–25.

Alaee, M., Arias, P., Sjodin, A., Bergman, A., 2003. An overview of commercially usedbrominated flame retardants, their applications, their use patterns in differentcountries/regions and possible modes of release. Environ. Int. 29,683–689.

Alaee, M., Wenning, RJ., 2002. The significance of brominated flame retardants inthe environment: current understanding, issues and challenges. Chemosphere46, 579–582.

Anderson, Seilhammer, 1997. A comparison of selected mRNA and proteinabundances in human liver. Electrophoresis 18, 533–537.

Canesi, L., Lorusso, L.C., Ciacci, C., Betti, M., Gallo, G., 2005. Effects of the brominatedflame retardant tetrabromobisphenol-A (TBBPA) on cell signaling and functionof Mytilus hemocytes: involvement of MAP kinases and protein kinase C. Aquat.Toxicol. 75, 277–287.

Fernie, K.J., Shutt, J.L., Mayne, G., Hoffman, D., Letcher, R.J., Drouillard, K.G., Ritchie,I.J., 2005. Exposure to polybrominated diphenyl ethers (PBDEs): changes inthyroid, vitamin A, glutathione homeostasis, and oxidative stress in Americankestrels (Falco sparverius). Toxicol. Sci. 88, 375–383.

Fonnum, F., Mariussen, E., Reistad, T., 2006. Molecular mechanisms involved in thetoxic effects of polychlorinated biphenyls (PCBs) and brominated flameretardants (BFRs). J. Toxicol. Environ. Health A 69, 21–35.

Germer, S., Piersma, A.H., van der Ven, L., Kamyschnikow, A., Fery, Y., Schmitz, H.-J.,Schrenk, D., 2005. Subacute effects of the brominated flame retardants

hexabromocyclododecane and tetrabromobisphenol A on hepatic cytochromeP450 levels in rats. Toxicology 218, 229–236.

Gygi, S., Rochon, Y., Franza, R., Aebersold, R., 1999. Correlation between protein andmRNA in yeast. Mol Cell Biol. 19 (3), 1720–1730.

Harris, R., Waring, R., 2008. Sulfotransferase inhibition: potential impact of diet andenvironmental chemicals on steroid metabolism and drug detoxification. Curr.Drug Metab. 9 (4), 269–275.

Hori, O., Miyazaki, M., Tamatani, T., Ozawa, K., Takano, K., Okabe, M., Ikawa, M.,Hartmann, E., Mai, P., Stern, D.M., Kitao, Y., Ogawa, S., 2006. Deletion of SERP1/RAMP4, a component of the endoplasmic reticulum (ER) translocation sites,leads to ER stress. Mol. Cell Biol. 26, 4257–4267.

Kharbanda, K.K., Rogers, D.D., Mailliard, M.E., Siford, G.L., Barak, A.J., Beckenhauer,H.C., Sorrell, M.F., Tuma, D.J., 2005. Role of elevated S-adenosylhomocysteine inrat hepatocyte apoptosis: protection by betaine. Biochem. Pharmacol. 70, 1883–1890.

Kirk, C., Bottomley, L., Minican, N., Carpenter, H., Shaw, S., Kohli, N., Winter, M.,Taylor, E., Waring, R., Michelangeli, F., Harris, R., 2003. Environmental endocrinedisruptors dysregulate estrogen metabolism and Ca2+ homeostasis in fish andmammals via receptor-independent mechanisms. Comp. Biochem. Physiol. A135, 1–8.

Kitamura, S., Jinno, N., Ohta, S., Kuroki, H., Fujimoto, N., 2002. Thyroid hormonalactivity of the flame retardants tetrabromobisphenol A andtetrachlorobisphenol A. Biochem. Biophys. Res. Commun. 293 (1), 554–559.

Kitamura, S., Kato, T., Iida, M., Jinno, N., Suzuki, T., Ohta, S., Fujimoto, N., Hanada, H.,Kashiwagi, K., Kashiwagi, A., 2005. Anti-thyroid hormonal activity oftetrabromobisphenol A, a flame retardant, and related compounds: affinity tothe mammalian thyroid hormone receptor, and effect on tadpolemetamorphosis. Life Sci. 76, 1589–1601.

Kuiper, R.V., van den Brandhof, E.J., Leonards, P.E., van der Ven, L.T., Wester, P.W.,Vos, J.G., 2007. Toxicity of tetrabromobisphenol A (TBBPA) in zebrafish (Daniorerio) in a partial life-cycle test. Arch. Toxicol. 81, 1–9.

Lelli, S.M., Ceballos, N.R., Mazetti, M.B., Aldonatti, C.A., Martín, San, de Viale, L.C.,2007. Hexachlorobenzene as hormonal disruptor-studies about glucocorticoids:their hepatic receptors, adrenal synthesis and plasma levels in relation toimpaired gluconeogenesis. Biochem. Pharmacol. 73, 873–879.

Leung, Y.F., Cavalieri, D., 2003. Fundamentals of cDNA microarray data analysis.Trends Genet. 19, 649–659.

Linderoth, N.A., Popowicz, A., Sastry, S., 2000. Identification of the peptide-bindingsite in the Heat Shock Chaperone/Tumor Rejection Antigen gp96 (Grp94). J. Biol.Chem. 8, 5472–5477.

McClelland, G., 2004. Fat to the fire: the regulation of lipid oxidation with exerciseand environmental stress. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 139(3), 443–460.

Meerts, I., van Zanden, J., Luijks, E., van Leeuwen-Bol, I., Marsch, G., Jakobsson, E.,Bergman, A., Brouwer, A., 2000. Potent competitive interactions of somebrominated flame retardants and related compounds with humantransthyretin in vitro. Toxicol. Sci. 56, 95–104.

Moat, S.J., Bonham, J.R., Cragg, R.A., Powers, H.J., 2000. Elevated plasmahomocysteine elicits an increase in antioxidant enzyme acitivity. Free Radic.Res. 32, 171–179.

Moens, L.N., Smolders, R., van der Ven, K., van Remortel, P., Del-Favero, J., De Coen,W.M., 2007. Effluent impact assessment using microarray-based analysis incommon carp: a systems toxicology approach. Chemosphere 672, 293–304.

Neumann, N., Galvez, F., 2002. DNA microarrays and toxicogenomics: applicationsfor ecotoxicology? Biotechnol. Adv. 20, 391–419.

Newcomer, M.E., Ong, D.E., 2000. Plasma retinol binding protein: structure andfunction of the prototypic lipocalin. Biochim. Biophys. Acta 1482, 57–64.

Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, 2002–2007.

Reistad, T., Mariussen, E., Ring, A., Fonnum, F., 2007. In vitro toxicity oftetrabromobisphenol-A on cerebellar granule cells: cell death, free radicalformation, calcium influx and extracellular glutamate. Toxicol. Sci. 96, 268–278.

Reistad, T., Mariussen, E., Fonnum, F., 2005. The effect of a brominated flameretardant, tetrabromobisphenol-A, on free radical formation in humanneutrophil granulocytes: the involvement of the MAP kinase pathway andprotein kinase C. Toxicol. Sci. 83, 89–100.

Sancho, E., Ferrando, M.D., Andreu, E., 1998. Effects of sublethal exposure to apesticide on levels of energetic compounds in Anguilla anguilla. J. Environ. Sci.Health 33B, 411–424.

Snape, J.R., Maund, S.J., Pickford, D.B., Hutchinson, T.H., 2004. Ecotoxicogenomics:the challenge of integrating genomics into aquatic and terrestrial ecotoxicology.Aquat. Toxicol. 67, 143–154.

Sheweita, S.A., 2000. Drug-metabolizing enzymes: mechanisms and functions. Curr.Drug Metab. 1, 107–132.

Stoick-Cooper, C.L., Weidinger, G., Riehle, K.J., Hubbert, C., Major, M.B., Fausto, N.,Moon, R.T., 2007. Distinct Wnt signaling pathways have opposing roles inappendage regeneration. Development 134, 479–489.

Tonon, F.A., Kemmelmeier, F.S., Bracht, A., Ishii-Iwamoto, E.L., Nascimento, E.A.,1998. Metabolic effects of oxalate in the perfused rat liver. Comp. Biochem.Physiol. B Biochem. Mol. Biol. 121, 91–97.

Unlü, M., Morgan, M.E., Minden, J.S., 1997. Difference Gel Electrophoresis: a singlegel method for detecting changes in protein extracts. Electrophoresis 18, 2071–2077.

van der Ven, K., De Wit, M., Keil, D., Moens, L., Van Leemput, K., Naudts, B., De Coen,W., 2005. Development and application of a brain-specific cDNA microarray for

M. De Wit et al. / Chemosphere 74 (2008) 96–105 105

effect evaluation of neuro-active pharmaceuticals in zebrafish (Danio rerio).Comp. Biochem. Physiol. B Biochem. Mol. Biol. 141, 408–417.

van der Ven, L., van den Brandhof, E., Vos, J., Power, D., Wester, P., 2006. Effects ofthe antithyroid agent propylthiouracil in a partial life cycle assay withzebrafish. Environ. Sci. Technol. 40, 74–81.

Weissbach, H., Resnick, L., Brot, N., 2004. Methionine sulfoxide reductases: historyand cellular role in protecting against oxidative damage. Biochim. Biophys. Acta1703, 203–212.

Wetmore, B.A., Merrick, B.A., 2004. Toxicoproteomics: proteomics applied totoxicology and pathology. Toxicol. Pathol. 32, 619–642.