Insights into the Impact of Histone Acetylation and Methylation on Sir Protein Recruitment,...

doi:10.1016/j.jmb.2008.06.059 J. Mol. Biol. (2008) 381, 826–844

Available online at www.sciencedirect.com

Insights into the Impact of Histone Acetylation andMethylation on Sir Protein Recruitment, Spreading,and Silencing in Saccharomyces cerevisiae

Bo Yang, Jeanette Britton and Ann L. Kirchmaier⁎

Department of Biochemistryand Purdue Cancer Center,Purdue University, 175 SouthUniversity Street, WestLafayette, IN 47907, USA

Received 9 April 2008;received in revised form14 June 2008;accepted 23 June 2008Available online28 June 2008

*Corresponding author. E-mail [email protected] used: Sir, silent info

ORC, origin recognition complex; Cimmunoprecipitation; PCR, polyme

0022-2836/$ - see front matter © 2008 E

Silent chromatin formation in Saccharomyces cerevisiae begins with therecruitment of silent information regulator (Sir) proteins to silencers at thesilent mating-type loci and to telomere ends. Next, Sir2/3/4 proteins pro-pagate across these loci as histones are deacetylated by the NAD+-depen-dent histone deacetylase Sir2p, ultimately resulting in the cessation oftranscription and in the loss of SET1- and DOT1-dependent methylation ofhistone H3 within silent chromatin. We analyzed the effects of modifiablelysine residues on histones H3 and H4 on experimentally defined steps insilencing: recruitment of Sir proteins to silencers, Sir protein spreading, andtranscriptional repression. Loss of acetylation, but not methylation, facili-tated both Sir recruitment and spreading, and Sir spreading across hypo-acetylated chromatin could disrupt SET1- and DOT1-dependent histonemethylation without silencing underlying genes. Our data indicate that lossof methylation of K4 and K79 on histone H3 reflects intermediate eventsduring the formation of silent chromatin, and that retention of a positivecharge at a single residue on histone H4 (K16) was both necessary andsufficient to permit Sir spreading beyond sites of their recruitment.

© 2008 Elsevier Ltd. All rights reserved.

Edited by J. Karn
Keywords: silencing; SIR2; SIR3; DOT1; SET1
Introduction

Epigenetic processes regulate heritable states ofgene expression through the combined action ofchromatin-modifying enzymes, which chemicallyalter the surface of chromatin, and structural or re-gulatory proteins, which modulate access to geneslocated within the underlying DNA. Silencing inSaccharomyces cerevisiae is arguably the best-charac-terized example of epigenetic gene regulation thatprohibits access to genetic information, yet exactlyhow silent chromatin forms, functions, and is inhe-rited remains elusive.In yeast, silent chromatin is assembled through a

series of steps initially involving targeting of silentinformation regulator (Sir) proteins to specific chro-mosomal loci, including the rDNA locus, the silent

ess:

rmation regulator;hIP, chromatinrase chain reaction.

lsevier Ltd. All rights reserve

mating-type loci HML and HMR, and telomeres,removing acetyl groups from multiple lysine resi-dues on histones H3 and H4 and spreading of Sirproteins across this deacetylated chromatin. Addi-tional necessary, yet poorly understood, steps occurduring silent chromatin formation that are, in part,cell cycle regulated. Together, these events ulti-mately result in the cessation of transcription andthe inheritance of the silenced state.1–8 When silentchromatin forms at HMR, proteins bound to DNAat the HMR-E silencer, the origin recognition com-plex (ORC), Rap1p, and Abf1p together adopt theirsecondary roles of recruiting the Sir proteins Sir1–4pto the chromosome. Upon arriving at HMR-E, theNAD+-dependent histone deacetylase Sir2p re-moves acetyl groups from multiple lysine residueson the N-terminal tails of histones H3 and H4.Deacetylation enhances Sir3p and Sir4p binding tonucleosomes, and enables Sir2p, Sir3p, and Sir4p tospread together across the HMR locus9–11 (see alsoLuo et al.12). Silencing at the rDNA locus requiresonly one Sir protein (Sir2p), and the steps of rDNAsilencing are less well characterized.13 At the HMloci and telomeres, these events alone, however, areinsufficient for silencing, and a growing body of

d.

827Histone Modification and Silencing

evidence indicates that additionalmodificationsmustbe removed from histones to establish epigeneticallysilent states.Two such modifications include SET1-dependent

methylation of K4 on histone H314 and DOT1-dependent methylation of K79 on histone H3.15

Histone H3 is hypomethylated at both of these resi-dues in silent chromatin relative to transcriptionallyactive chromatin.6,16–18 Methylation of both K4 andK79 on histone H3 is lost at the HM loci and telo-meres as silent chromatin is formed, although loss ofhistone methylation occurs at a slower rate thandoes loss of acetylation.6 Deletion ofDOT1 increasesthe rate of Sir3p accumulation at HMR and adja-cent to Telomere VIR during silent chromatin forma-tion,6 whereas overexpression of DOT1 disruptssilencing.15,19 Deletion of SET1 similarly increasesthe rate of accumulation of Sir3p at HMR.6 Theseeffects are likely related to interactions betweenSir3p and histones H3 and H4. Sir3p and Dot1pcompete for binding to the same patch of basicresidues on the N-terminal tail of H4, and interac-tions between Sir3p and peptides containing eitheramino acids 67–89 or amino acids 1–21 of H3 aredisrupted by methylation of K79 or K4, respect-ively20,21 (see also Onishi et al.22). Thus, along withloss of acetylation, loss of histone methylation islinked to the formation of silent chromatin.In addition to deacetylation of key lysine residues

on histones to permit Sir protein spreading, deace-tylation of additional lysine residues on histone H3or H4 may be critical for forming silent chromatin.Evidence for this comes from analysis of sir2-345mutants. sir2-345p contains a N345A mutationwithin the active site, rendering this protein cataly-tically inactive.23–27 sir2-345p is stably expressed,forms complexes with Sir3p and Sir4p, and localizesto silencers, but is defective in both Sir proteinspreading and silencing in an otherwise wild-typecell5,7,9,23,24 (see also Hoppe et al.10). Sir proteinspreading can be restored in sir2-345 cells bymutating known substrates of Sir2p, residues 9and 14 of histone H3, and residue 16 of histone H4from lysine to arginine to mimic their unacetylatedstate.7,23,28,29 However, these sir2-345 cells remainunable to silence the HM loci unless Sir3p is alsooverexpressed.7 In contrast, both Sir protein spread-ing and silencing occur in SIR2 cells expressing thesame H3 K9,14R H4 K16R mutants, implying thatadditional acetylated residue(s) are likely deacety-lated by Sir2p to form silent chromatin.7 Accordingto this model, either the deacetylated state of addi-tional residue(s) or the production of 2′-O-acetyl-ADP ribose during the deacetylation reactioncatalyzed by Sir2p may be critical for silencing.2′-O-Acetyl-ADP ribose induces both conforma-tional and stoichiometric changes in Sir2/3/4pcomplexes in vitro,22,30 but whether such changesare critical for silencing in vivo is not yet clear.Here, we have assessed the contribution of several

modifiable lysine residues on histones H3 and H4 toSir protein recruitment, spreading, and silencingusing SIR2 and sir2-345 cells. Our results indicate

that Sir protein spreading disrupts histone methyla-tion, but loss of both methylation and acetylation isinsufficient for epigenetically stable silent chroma-tin. In these analyses, we also considered the effectsof histone methylation and acetylation on silencingin the context of the dilution model for silencingdefects.15 This model proposes that global loss ofhistone modifications leads to silencing defects byredistributing Sir proteins to inappropriate chromo-somal loci throughout the genome. We found thatmutations causing defects in histone acetylationfacilitated Sir protein recruitment, spreading, andsilencing at test loci, whereas defects in histonemethylation did not. These findings provide evi-dence that at least two different classes of redis-tribution events can occur in cells with defects inhistone modifications.

Results

Sir protein spreading and silencing inhypoacetylation and hyperacetylation mutantsof histones H3 and H4

Like acetylation, methylation marks found on his-tones at transcriptionally active loci are absent fromhistones at silenced loci in yeast.6,16–18,31,32 Histonemethylation directly interferes with Sir3p binding20,22

and may need to be removed prior to establishingepigenetically stable silent states. Consistent withthis possibility, expression of H3 K9,14R H4 K16Rmutants rescues Sir protein spreading at the HMloci and adjacent to Telomere VIR in sir2-345 cells,but silencing is not restored unless Sir3p is alsooverexpressed.7

To analyze the relationship between SET1- andDOT1-dependent methylation, Sir spreading, andsilencing, we generated and characterized SIR2 andsir2-345 yeast expressing a new set of histone hypo-acetylation mutants and then determined the me-thylation status of histone H3 in sir2-345 cells inwhich Sir spreading had been restored. Use of H3K14R H4 K8,16R mutants ensured that histoneN-terminal tail mutations would not interfere withthe recognition of methylated K4 on histone H3 bymethylation-specific antibodies (see below). Likeacetylated K14 on histone H3 and K16 on histoneH4, acetylated K8 on histone H4 is a substrate ofSir2p in vitro,28 and H4 K8 is hypoacetylated at silentloci in vivo.33,34 In addition, mutating H4 K8 toglutamine to mimic the acetylated state adverselyaffects silencing.33 To test whether H3 K14R H4K8,16R mutants could support Sir protein spread-ing, we examined the association of Sir2p, Sir3p, andSir4p at HML, at HMR, and adjacent to TelomereVIR by chromatin immunoprecipitation (ChIP) insir2-345 versus SIR2 cells expressing wild-type ormutant histones (Figs. 1 and 2; Supplementary Figs.1–3). H3 K14R H4 K8,16R mutants that mimickedthe unacetylated state enhanced Sir3p associationthroughout HML (Fig. 2b versus a), and supported

Fig. 1. Diagrams of HML, HMR, and Telomere VIR.The positions of silencers, open reading frames, andTelomere VIR are indicated. The regions monitored for Sirprotein association (Figs. 2, 5, 7, and 9; SupplementaryFigs. 1–3) and histone modification (Fig. 4) or transcription(Figs. 5 and 9) are indicated below each locus.

828 Histone Modification and Silencing

Sir protein spreading at HMR (Fig. 2d versus c) andadjacent to Telomere VIR (Fig. 2f versus e) in bothsir2-345 and SIR2 cells. Similar results wereobserved for Sir2p and Sir4p at HML, HMR, andTelomere VIR (Supplementary Figs. 1, 2, and 3,respectively). These results demonstrated that mul-tiple forms of hypoacetylated histones could sup-port Sir protein spreading (see also Yang andKirchmaier7).To assess the impact of the charge state of these

residues on histone H3 and H4 on Sir protein re-cruitment, spreading, and silencing, we generatedSIR2 cells expressing histone mutants in which H3K14 and H4 K8 and K16 had been mutated to gluta-mine to mimic their acetylated states. We comparedthe association of Sir2p, Sir3p, and Sir4p throughoutHMR in SIR2 cells expressing H3 K14Q H4 K8,16Qmutants relative to SIR2 and sir2-345 cells expres-sing wild-type histones or H3 K14R H4 K8,16Rmutants (Fig. 2c and d; Supplementary Fig. 2a andb). Sir3p was recruited to theHMR-E silencer in SIR2cells expressing H3 K14Q H4 K8,16Q mutants(Fig. 2d). However, Sir3p spreading was disrupted,consistent with the charge states of the N-terminaltail of histones H3 and H4 being critical deter-minants for silencing.12,35–39 Similar results wereobserved for Sir2p and Sir4p (Supplementary Fig.2b). Thus, mutations that mimic the acetylated stateof these residues were sufficient to disrupt Sir pro-tein spreading, but the deacetylated state of theseresidues was not required for Sir protein recruitmentto the HMR-E silencer.To determine the effects of H3 K14R H4 K8,16R

mutants and Sir spreading on transcription, we mo-nitored α1mRNA fromHML, a1mRNA fromHMR,and yFR057w mRNA from Telomere VIR (Fig. 3a

and b). α1, a1, and yFR057w were each silenced inSIR2 cells expressing wild-type histones or H3 K14RH4 K8,16R mutants. Consistent with the ChIP andtranscription analyses, SIR2 cells expressing H3K14R H4 K8,16R mutants also mated efficiently inpatch mating assays, indicating that the HM lociwere silenced (Fig. 3c). In sir2-345 cells expressingH3 K14R H4 K8,16R mutants, α1, a1, and yFR057wmRNA levels were significantly reduced relative tosir2-345 cells expressing wild-type histones (p=0.018for each locus; n=3), but not to the levels observed inSIR2 cells expressing wild-type or mutant histones(p=0.025 for α1 and a1; p=0.023 for yFR057w; n=3)(Fig. 3a). Control experiments indicated that thisreduction in transcription was Sir protein-depen-dent, not histone-mutant-dependent, as transcriptlevels in the histone mutant strains were restored incells lacking SIR4 (Fig. 3b) (Sir proteins are notrecruited to the HMR in the absence of Sir4p9–11).However, in contrast to SIR2 cells, the sir2-345mutants were unable to mate, indicating that theHM loci were not silenced (Fig. 3c; SupplementaryTable 3). Interestingly, the weak mating of MATαSIR2 cells expressing H3 K14Q H4 K8,16Q mutants(Fig. 3c) in which Sir protein spreading was notdetected (Fig. 2d; Supplementary Fig. 2b) was moreefficient than mating in sir2-345 cells expressing H3K14R H4 K8,16R mutants in which spreadingoccurred. These rare mating events likely reflect aminor fraction of the population in which Sirspreading and silencing occurred and which wasnot detected by ChIP analyses.In summary, the above experiments demonstrated

that H3 K14R H4 K8,16R mutants could enhance Sirprotein association throughout HML (Fig. 2b; Sup-plementary Fig. 1b) and could rescue Sir proteinspreading at HMR (Fig. 2d; Supplementary Fig. 2b)and adjacent to Telomere VIR (Fig. 2f; Supplemen-tary Fig. 3b) in sir2-345 cells, and that Sir proteinspreading interfered with transcription (Fig. 3a) in aSIR-dependent manner (Fig. 3b) but could not re-store silencing (Fig. 3c).

Sir protein spreading disrupts methylation ofhistone H3 on lysines 4 and 79

Dimethylated K4 and K79 on histone H3 are lostfrom the HM loci and telomeres upon the establish-ment of silencing.6,16,18 This hypomethylated state atsilent loci could be silencing-dependent. Alterna-tively, Sir spreading might be sufficient to interferewith transcription-coupled modifications by Set1pand Dot1p. To determine the impact of Sir spreadingon histone methylation, we examined the level ofdimethylated K4 and K79 on histone H3 at HMR-E,a1, or HMR-I in sir2-345 versus SIR2 cells by ChIP(Fig. 4a and b, respectively). In SIR2 cells expressingeither wild-type histones or H3 K14R H4 K8,16Rmutants, the level of dimethylated K4 on histone H3was reduced relative to sir2-345 cells expressingwild-type histones (p=0.018; n=3), confirming pre-vious reports that K4 on histone H3 is hypomethy-lated in silent chromatin.6,16,17 Dimethylated K4 on

Fig. 2. Histone hypoacetylation mutants rescue Sir spreading in sir2-345 cells. (a and b) Sir protein association atHML.Sir3p association at HML in SIR2 or sir2-345 yeast expressing wild-type histones (a) or H3 K14R H4 K8,16R mutants (b)was examined by ChIP using primers that amplified HML-E, HMLα1, HML-I, orMAT. (c and d) Sir protein association atHMR. Sir3p association atHMR in SIR2 or sir2-345 yeast expressing wild-type histones (c) or H3 K14R H4 K8,16R and H3K14Q H4 K8,16Q mutants (d) was examined by ChIP using primers that amplified HMR-E, HMR a1, HMR-I, or MAT.(e and f) Sir protein association at Telomere VIR. Sir3p association adjacent to Telomere VIR in SIR2 or sir2-345 yeastexpressing wild-type histones (e) or H3 K14R H4 K8,16R mutants (f) was examined by ChIP using primers that amplifiedDNA at 0.6 kb, 1.2 kb, and 7.5 kb from the end of Telomere VIR. ChIP experiments were conducted with anti-Sir3pantibodies or unimmunized rabbit serum (IgG), and coprecipitating DNAwas monitored by quantitative real-time PCR.The efficiency of coprecipitation of each locus was compared to MAT and was calculated as follows: Locus IP/MATIP=2(MAT CT−Locus CT). Data represent the average±SD (n=3) from the analysis of two independent clones for eachgenotype (see Fig. 1 and Materials and Methods).


histone H3 was also significantly reduced in sir2-345cells expressing H3 K14R H4 K8,16R mutantscompared to wild-type histones (HMR-E, 50±14%;a1, 56±0.77%; HMR-I, 55±13%; p=0.018; n=3 for

each comparison). Similar results were observed fordimethylated K79 on histone H3; K79 was hypo-methylated in silent chromatin in SIR2 cells expres-sing wild-type histones or H3 K14R H4 K8,16R

Fig. 3. Effects of Sir protein spreading on transcription from HM loci and yFR057w at Telomere VIR. Transcription ofα1 from HML, of a1 from HMR, and of yFR057w from Telomere VIR in H3 K14R H4 K8,16R or H3 K79R mutants (a) inSIR2 and sir2-345 cells. (b) Transcription of a1 from HMR in sir4Δ cells expressing the indicated histone mutants.Transcription was monitored by quantitative real-time PCR (see Materials andMethods). The levels of α1, a1, or yFR057wmRNA (see Fig. 1) relative to an internal control (SCR1) were determined for each yeast strain and compared to thatobserved in the sir2-345 yeast expressing wild-type histones H3 and H4, which has been set to 100%. Data were calculatedas follows: 2[(locus CT−SCR1 CT) sir2-345 H3/H4 and SIR4 or sir4Δ− (locus CT−SCR1 CT) a] ×100, where a is the indicated genotype. Data representthe average±SD (n=3) from the analysis of two independent clones for each genotype. (c) Patch mating analyses of SIR2or sir2-345 cells expressing the indicated histone mutants. Haploid MATα or MATa cells with the indicated genotypeswere grown for 1 day at 30 °C on rich medium (YPD), then tested for silencing at HML and HMR by replica plating to α(JRY2728) or a (JRY2726) mating-type tester lawns on minimal medium and incubated for 2 days at 30 °C. The growth ofdiploids on minimal medium indicates that HML or HMR was silenced. (d) Transcription of a1 from HMR in H3 K4Rmutants. Transcripts were analyzed as in (a) and (b).


Fig. 4. Sir spreading blocks dimethylation of K4 and K79 on histone H3 at HMR in sir2-345 cells. ChIP experimentswere performed using anti-H3 di-Me K4 (a) and anti-H3 di-Me K79 (b) antibodies. Coprecipitating HMR-E, a1, orHMR-I DNA (see Fig. 1 and Materials and Methods) relative to input DNA was determined for each yeast strain andcompared to that observed in sir2-345 yeast expressing wild-type histones H3 and H4, which has been set to 100%.Data were calculated as follows: 2[(locus CT− Input CT) sir2-345 H3/H4− (locus CT− Input CT) a] ×100, where a is the indicated genotype.Data represent the average±SD (n=3) from the analysis of two independent clones for each genotype. (c)Dimethylation of K4 and K79 on histone H3 in H3 K14R/H4 K8,16R mutants. Whole-cell lysates from SIR2 or sir2-345yeast expressing wild-type histones H3 and H4 or H3 K14R/H4 K8,16R mutants were analyzed by immunoblots withantibodies against H3 dimethylated K4 (top panel), H3 dimethylated K79 (middle panel), or the loading controlproliferating cell nuclear antigen (bottom panel).


mutants relative to sir2-345 cells expressing wild-typehistones (p=0.018; n=3) (Fig. 4b; see also Katan-Khaykovich and Struhl6 and Ng et al.18). Dimethy-lation of K79 on histone H3 was also reduced in sir2-345 cells expressing H3 K14R H4 K8,16R mutants.(In sir2-345 cells expressing H3 K14R H4 K8,16Rmutants compared towild-type histones, the levels ofdimethylated K79 on histone H3 were as follows:HMR-E, 61±9.2%; a1, 62±9.3%; HMR-I, 69±5.2%;p=0.018; n=3 for each comparison.) However, thelevels of dimethylated K4 or K79 at HMR-E, a1, andHMR-I remained higher in sir2-345 cells expressingH3 K14R H4 K8,16R mutants than in SIR2 cellsexpressing either wild-type histones or H3 K14R H4K8,16R mutants (p=0.025; n=3 for each comparisonfor either dimethylated K4 or K79).

In the above experiments, loss of SET1- and DOT1-dependent methylation at HMR in sir2-345 cellsexpressing H3 K14R H4 K8,16R mutants couldhave been due to the inability of Set1p or Dot1p torecognize their substrates in the context of the histonemutations. To address this potential caveat, wemoni-tored H3 methylation in the H3 K14R H4 K8,16Rmutants by protein blot analyses. These control expe-riments indicated that the levels of dimethylated K4and K79 on histone H3 in the mutants were similarto those observed in SIR2 and sir2-345 cells expres-sing wild-type histones (Fig. 4c). These controls alsodemonstrated that the anti-H3 di-Me K4 and anti-H3di-Me K79 antibodies readily recognized their epi-topes in the context of the H3 K14R, H4 K8,16Rmutations, and that acetylation of these residues

Fig. 5. Histone H3 K79R mutants do not restore Sir protein spreading in sir2-345 cells. Sir protein association at HML(a),HMR (b), and TelomereVIR (c) in SIR2 or sir2-345 yeast expressing wild-type histones H3 andH4 or H3 K79Rmutantswas examined by ChIP with anti-Sir2p, anti-Sir3p, and anti-Sir4p antibodies or unimmunized rabbit serum (IgG), asdescribed in Figs. 1 and 2. Data represent the average±SD (n=3).


was not required for methylation of H3 K4 or K79.Together, these results indicated that Sir proteinspreading in sir2-345 cells interfered with Set1p-dependent methylation of K4 and Dot1p-dependentmethylation of K79 on histone H3 throughout HMR,but hypomethylation was insufficient to supportsilencing.

Effects of the loss of methylation of histoneH3 on Sir protein recruitment, spreading,and silencing

Loss of DOT1 results in defects in silencing re-porter genes at the HM loci and telomeres. Thesefindings have contributed to a model in whichmethylated H3 K79 normally prevents Sir proteinsfrom binding nucleosomes throughout the ge-nome, and in which, in the absence of methylatedH3 K79, Sir proteins bind promiscuously across thegenome.15,19 To test whether loss of methylationdisrupts silencing by causing defects in Sir proteinrecruitment or spreading, we first compared Sir

association at silenced loci in SIR2 cells expressingH3 K79R mutants (Fig. 5a–c) to cells expressingwild-type histones (Fig. 2a, c, and e; SupplementaryFigs. 1a, 2a, and 3a). Spreading of Sir2p, Sir3p, andSir4p (Fig. 5), and silencing (Fig. 3a and c; Table 1)occurred efficiently at HML, at HMR, and adjacentto Telomere VIR in SIR2 cells expressing H3 K79Rmutants. Thus, the maintenance of a positive chargeat this residue was compatible with efficientlysilencing endogenous genes at these loci (see below).Because methylation of K79 on histone H3 inter-

feres with Sir3p binding20 and because Sir3p isrequired for Sir protein spreading,9 it was possiblethat the unmethylated state of H3 K79 could faci-litate Sir protein spreading adjacent to sites of Sirprotein recruitment. Sir proteins are recruited tosilencers in sir2-345 cells, but cannot spread alongthe chromosome in otherwise wild-type cells.5,7,9 Wedetermined the extent to which H3 K79R mutantscould restore Sir protein spreading in sir2-345 cells(Fig. 5) by ChIP. In sir2-345 cells expressing H3 K79Rmutants, Sir proteins were recruited to the HMR-E

Table 1. Loss of methylation of K4 or K79 on H3 does notenhance silencing at HMRae**

Histones

Relative efficiency of matinga

MATa MATα HMR MATα HMRae**

H3/H4 1 1 1H3 K79R/H4 1.1±0.52 0.64±0.094 0.011±0.0079H3 K4R/H4 n.d. n.d. 0.21±0.094

n.d., not determined.a The efficiency of mating of the indicatedMATa,MATα HMR,

and MATα HMRae** cells expressing wild-type histones H3 andH4 to tester strains JRY2728 (MATα) or JRY2726 (MATa),respectively, was determined relative to their plating efficiencyon minimal medium (MATa, 8.1±3.6%, n=3; MATα HMR, 93±42%; MATα HMRae**, 1.2±0.70%, n=3) and was set to 1. Themating efficiencies of H3 K79R and H3 K4R mutant strains weredetermined similarly and are expressed relative to the indicatedstrains expressing wild-type histones H3 and H4. Data representthe average±SD (n=3).


and HML-E silencers. However, H3 K79R mutantsdid not restore association of any of the Sir proteinsacross the HM loci or adjacent to Telomere VIR, incontrast to the hypoacetylation mutants of histonesH3 and H4 (compare sir2-345 cells in Fig. 5 to sir2-345 cells expressing wild-type or mutant histones inFig. 2 and Supplementary Figs. 1–3). Histone H3K79R mutants were also unable to restore matingin sir2-345 cells, indicating that silencing at the HMloci had not been rescued (Fig. 3c; SupplementaryTable 3). In addition, transcription fromHML,HMR,or yFR057w adjacent to Telomere VIR was notadversely affected in sir2-345 cells expressing H3K79Rmutants (Fig. 3a) (or H3 K4Rmutants; Fig. 3d),in contrast to H3 K14R H4 K8,16R mutants thatrestored Sir protein spreading, thereby inhibitingtranscription.Histone mutations that disrupt posttranslational

modifications may facilitate Sir protein recruitmentto certain loci by creating high-affinity Sir bindingsites on nucleosomes next to binding sites for Sir-protein-interacting factors. Alternatively, suchmutations might instead hinder Sir protein recruit-ment to certain loci if those mutations enabled othergenomic sites to compete successfully for a limitedpool of Sir proteins. In contrast to H3 K14R H4 K8R,K16R mutants, H3 K79R mutants did not enhanceSir protein recruitment to wild-typeHMR-E,HMR-I,HML-E, and HML-I silencers in the above experi-ments (Fig. 5a or b versus Fig. 2b or d, respectively,and Fig. 5a or b versus Supplementary Fig. 1b or 2b,respectively).We next asked whether hypomethylated H3 K79

created Sir binding sites on nucleosomes that couldfacilitate Sir protein recruitment to loci that arebound by Sir-protein-interacting factors but do notnormally recruit Sir proteins. For this analysis,strains containing a crippled HMR locus, HMRae**,were used. HMRae** retains the ORC binding site atthe E silencer, but contains point mutations in theRap1p and Abf1p binding sites at the E silencer andretains a wild-type I silencer. HMRae** has pre-viously been used to identify second-site suppres-sors of silencing defects, and loss of histone

acetylation can restore silencing at this locus.40–46

The crippled E silencer at HMRae** is defective inrecruiting Sir proteins,46 and the I silencer, whichcontains binding sites for ORC+Abf1p, also doesnot normally serve as the site of initial Sir proteinassembly.9 Thus, the mating defect in MATαHMRae** cells is linked to defects in Sir protein re-cruitment to this locus.To test whether loss of methylation at K79 on

histone H3 enhanced silencing at HMRae**, wegenerated MATα HMRae** yeast expressing H3K79R or H3 K79A mutants. Both mutations disruptmethylation of residue 79, but mutation to argininepreserves a positive charge at this residue, whereasmutation to alanine eliminates the positive charge.Thus, each mutation may affect silencing differently(see Discussion). In both quantitative and patchmating assays, H3 K79R and H3 K79A mutants didnot enhance silencing at HMRae** relative to cellsexpressing wild-type histones (Fig. 6a; Table 1),whereas both H3 K79R andH3 K79Amutants readilysupported silencing at a wild-type HMR (Figs. 3a and6b and g; Table 1). Similarly, silencing was notrestored at HMRae** in MATα dot1Δ cells (Fig. 6c).Thus, loss of methylation, combined with ORC orORC+Abf1 binding sites, was not sufficient to rescuesilencing. In contrast, H3 K14R H4 K8,16R mutants,which permitted Sir protein spreading (Fig. 2;Supplementary Figs. 1–3) but did not disrupt DOT1-or SET1-dependent methylation (Fig. 4c), partiallysuppressed the silencing defect at HMRae** (Fig. 6a).Similarly, deletion of SAS2, which encodes an H4K16-specific acetyltransferase, also restored silencingat HMRae** (Fig. 6c; see also Ehrenhofer-Murray etal.,41 Reifsnyder et al.,44 and Meijsing and Ehrenhofer-Murray47). Similar analyses with H3 K4R mutantsindicated that loss of methylation at K4 on histone H3also did not disrupt silencing at the endogenousHMRlocus (Figs. 6h and 8b) and could not enhance silencingat HMRae** in MATα cells (Table 1).It was possible that loss of DOT1-dependent

methylation had restored Sir association withoutrestoring silencing in the above experiments. There-fore, we compared the impact of the hypoacetyla-tion and hypomethylation of histones on Sir proteinlocalization to HMRae** by ChIP using dot1Δ orsas2Δ mutants or cells expressing wild-type his-tones, H3 K79R, or histone hypoacetylation mutants(Fig. 7). Consistent with the above mating analyses(see also Miller, Endo, Kaufman, and Kirchmaier,unpublished), deletion of SAS2 and expression ofhistone hypoacetylation mutants restored Sir locali-zation throughout HMRae** relative to wild-typecells, dot1Δ, and H3 K79R mutants. In contrast, Sirlocalization toHMRae** remained defective in dot1Δand H3 K79R mutants (Fig. 7), albeit Sir3p wasdetectably associated with the e** silencer in thesemutants relative to wild-type cells (p=0.024; n=3).Loss of methylation in dot1Δ mutants also could

not enhance silencing relative to wild-type cells atseveral other modified HMR loci that contained syn-thetic silencers at E lacking binding sites for ORCRap1p or Abf1p and lacking or retaining the I silencer

Fig. 6. Effects of loss of methylation of lysine 4 or lysine 79 on histone H3 on silencing. (a–d) Silencing of mating-typegenes at HM loci. Patch mating analyses of silencing at chromosomal HMRae** (a and c), HMR, or HML (b) loci inthe indicated strains. (d) Patch mating analyses of silencing at modified HMR loci in DOT1 and dot1Δ cells. HMRa-ss ΔIcontains a synthetic silencer with ORC, Rap1p, and Abf1p binding sites at the E silencer, and lacks the I silencer.HMRa-ssrap1− ΔI contains a synthetic silencer that lacks a Rap1p binding site at E and lacks I. HMRa-G4EB ΔI contains asynthetic silencer, with four Gal4p binding sites replacing the ORC binding site plus Rap1p and Abf1p binding sites at E,and lacks I. HMRa-ss contains a synthetic silencer with ORC, Rap1p, and Abf1p binding sites at E. HMRa-ssabf1−containsa synthetic silencer with ORC and Rap1p binding sites, and a mutated Abf1p binding site at E. (e) Colony color assays ofsilencing HMR∷ADE2. Silencing of ADE2 integrated between the E and I silencers at HMR was monitored in DOT1 anddot1Δ cells expressing wild-type histones H3 and H4 or the indicated histone mutants (see Materials and Methods). (f)Colony color assays of silencing HMR∷ADE2 in wild-type or H3 K4R mutants. (g and h) Patch mating analyses ofMATα and MATa SIR2, and sir2-345 cells expressing wild-type histones or the indicated mutants. Patch mating assayswere conducted on yeast grown on rich medium (YPD) prior to replica plating to mating lawns, as described in Fig. 3.


(Fig. 6d). Together, these findings indicated that lossof methylation at K79 on histone H3 did not enhancethe ability of ORC+Rap1+Abf1, ORC, ORC+Abf1,or Rap1+Abf1 binding sites to act as nucleation sitesfor silent chromatin formation. Future genomicstudies are needed to identify the nature of thechromosomal sites targeted by Sir proteins upon theloss of histone methylation.48

Methylation-dependent gene-specific silencingdefects

Although the above experiments indicated that lossof methylation of K4 and K79 on histone H3 did notcause severe silencing defects at native HM loci,previous studies have linked defects in methylationto defects in silencing reporter genes, includingADE2

Fig. 7. Histone hypoacetylationrestores Sir localization to HMRae**.Sir2p (top panel) and Sir3p (bottompanel) association at HMR-e**, a1,and HMR-I in the indicated strainswas examined by ChIP using anti-Sir2p and anti-Sir3p antibodies orunimmunized rabbit serum (IgG), asdescribed in Figs. 1 and 2. Data re-present the average±SD (n=3).


orURA3 integrated at telomeres, or URA3 integratedat HMR.15,17,19,49–51 These silencing defects in cellslacking methylation of K4 or K79 could not beattributed to loss of Sir2-4 protein expression. Sirproteins are expressed at wild-type levels in theabsence of K4 or K79 methylation.15,17,32,50–52 Thesesilencing defects were also not due to disruptionof Sir protein binding sites on histone H3, asSir3p preferentially binds the unmethylated form ofH3 peptides and nucleosomes.20,22 Therefore, weconsidered the possibility that the sensitivity ofsilencing to the methylation status of K4 or K79 isgene-specific.We examined silencing at an HMR in which ADE2

replaced the a1 and a2 genes between the E and Isilencers in cells expressing wild-type histones, H3K79R mutants, or H3 K79A mutants, using a colonycolor assay (Fig. 6e). In this assay, red coloniesindicate thatADE2 atHMR is silenced, whereas pinkor white colonies reflect a silencing defect. Coloniesof H3 K79R mutants were in very light pink, andcolonies of H3 K79A mutants were in white, indi-cating defects in silencing HMR∷ADE2. In contrast,ade2-1 strains containing a wild-type HMR pluswild-type or mutant histones all grew as redcolonies on rich medium (data not shown). Thiscontrol indicated that histone hypomethylation didnot disrupt a step in the adenine biosynthesispathway prior to ADE2, which would have pre-vented the accumulation of a red pigment in asilencing-independent manner. On further analyses,loss of DOT1 similarly resulted in derepression ofHMR∷ADE2, and, surprisingly, H3 K79R mutantsweakly suppressed this silencing defect (Fig. 6e).Loss of methylation in H3 K4R mutants also led to

weak defects in silencing HMR∷ADE2 (Fig. 6f).These results implied that loss of methylation of K4or K79 on histone H3 and the absence ofDOT1 led toreporter-dependent defects in silencing at HMR (seealso Mueller et al.53). Similar reporter-dependentdefects in silencing have been observed in cells withdefects in histone acetylation (Miller and Kirchma-ier, unpublished; e.g., Xu et al.54). It is possible thatevolutionary pressure to maintain silencing at theHM loci has shaped not only the structuralcomponents of silent chromatin but also the regula-tion of endogenous mating-type genes. Futurestudies examining how transcriptional machineryat certain promoters overcomes silencing in theabsence of histone methylation should clarify howthis occurs.

Loss of acetylation and methylation is notsufficient to restore silencing in sir2-345mutants

In the above experiments, incomplete removal ofmethylation from K4 or K79 of histone H3 at theHMloci and TelomereVIR in sir2-345 cells expressing H3K14R, H4 K8,16R mutants (Fig. 4) might have con-tributed to incomplete inactivation of transcription(Fig. 3a) and to the inability to silence (Fig. 3c;Supplementary Table 3). To test this possibility, H3K79R or K4R mutations were combined with H3K9,14R H4 K16R mutations that supported Sirprotein spreading.7 Silencing in sir2-345 and SIR2cells expressing these histone mutants was mon-itored in patch mating assays (Fig. 6g and h).Neither H3 K9,14,79R H4 K16R nor H3 K4,9,14RH4 K16R mutants rescued mating in sir2-345 cells.


Thus, loss of methylation of K79 or K4 on histone H3in the context of the hypoacetylation mutationswas not sufficient to restore silencing (see alsoFig. 8). In contrast, H3 K4,9,14R H4 K16R mutantssupported silencing of both HML and HMR in SIR2cells (Fig. 6h). Similarly, HMR was silenced in SIR2cells expressing H3 K9,14,79R H4 K16R mutants(Fig. 6g). However, MATa SIR2 cells expressing H3K9,14,79R H4 K16R mutants were no longer able tomate (Fig. 6g), indicating that silencing at HML hadbeen disrupted. Similarly, silencing at HML, butnot atHMR, was disrupted inMATa cells expressingH3 K79R H4 K16R mutants (Fig. 6g). To confirmindependently that loss of methylation at K79, inconjunction with loss of acetylation, disruptedsilencing at HML, we monitored mating in dot1Δcells expressing histone hypoacetylation mutants(Fig. 8a). MATa dot1Δ cells expressing H4 K16Rmutants did not mate. This indicated that loss ofacetylation of K16 on histone H4, plus loss of me-thylation of K79 on histone H3, was sufficient todisrupt silencing at HML. In addition, loss ofmethylation from both H3 K4 and K79 supported

silencing in SIR2 cells, but did not restore silencingto sir2-345 mutants (Fig. 8b).

Loss of acetylation of K16 on histone H4 isnecessary and sufficient for Sir proteinspreading

Many mutations within the N termini of histonesH3 and H4 are well tolerated in silencing as long as apositive charge is retained on residue 16 of histoneH4.33,35,37 These observations imply that the chargestate of residue 16 on histone H4 may be uniquelyresponsible for important structural changes tochromatin that must occur to form silent chromatin.To determine whether a positive charge at residue 16on histone H4 could support Sir protein spreading,we monitored the association of Sir2p, Sir3p, andSir4p throughout HML, throughout HMR, andadjacent to Telomere VIR in sir2-345 and SIR2 cellsexpressing H4 K16R mutants by ChIP (Fig. 9).Histone H4 K16R mutants supported Sir proteinassociation throughoutHML (Fig. 9a), and supportedSir protein spreading at HMR (Fig. 9b) and adjacent

Fig. 8. Effects of histone mu-tants on mating in dot1Δ cells. (aand b) Patch mating analyses of theindicated strains expressing wild-type histones H3 and H4 or thelisted histone mutants were con-ducted on yeast grown on rich me-dium (YPD) prior to replica platingto a or αmating lawns, as describedin Fig. 3.

Fig. 9. Histone H4 K16 is necessary and sufficient for Sir protein spreading in sir2-345 cells. Sir protein association atHML (a), HMR (b), and Telomere VIR (c) in SIR2 or sir2-345 yeast expressing H4 K16R or Q mutants was examined byChIP with anti-Sir2p, anti-Sir3p, and anti-Sir4p antibodies or unimmunized rabbit serum (IgG), as described in Figs. 1 and2. (d) Transcription of α1 from HML, of a1 from HMR, and of yFR057w from Telomere VIR in SIR2 and sir2-345 yeastexpressing wild-type histones or H4 K16Rmutants. Transcription wasmonitored as described in Fig. 3. Data represent theaverage±SD (n=3).


to Telomere VIR (Fig. 9c) in both sir2-345 and SIR2cells. Therefore, a positive charge at residue 16 ofhistone H4 was sufficient for Sir protein spreading.To determine the effect of H4 K16R mutants onsilencing, we monitored transcription of α1 mRNAfromHML, of a1mRNA fromHMR, and of yFR057wmRNA from TelomereVIR (Fig. 9d), andmating (Fig.8a) in SIR2 and sir2-345 cells. Transcription of α1, a1,and yFR057w mRNA was inhibited in SIR2 cellsexpressing either wild-type histones or H4 K16R

mutants, and these mutants mated efficiently, indi-cating that the HM loci were silenced (Figs. 8a and9d). sir2-345 cells expressing H4 K16R mutants alsoexhibited reduced levels of transcripts from HML,HMR, and yFR057w relative to sir2-345 cells expres-sing wild-type histones (p=0.018; n=3) (Fig. 9d) in aSir-dependent manner (Fig. 3b). However, mutationof H4 K16 to R did not restore mating in sir2-345 cells,indicating that silencing had not occurred (Fig. 8a;Supplementary Table 3).


Although a positive charge at residue 16 on his-tone H4 clearly supported Sir protein spreading, itremained possible that Sir proteins could interactwith nucleosomes with a single positive charge atresidue 16 on histone H4 in vivo. Although acetyla-tion of K16 in the context of a peptide containingamino acids 1–20 of histone H4 disrupts interactionswith full-length Sir3p or Sir2p/Sir4p complexes,30

Sir3p interacts efficiently with both N-terminalamino acids 1–34 of histone H4 and amino acids 1–34 of histone H4 containing K16Q fused to glu-tathione S-transferase in coprecipitation assays.20,35Similarly, amino acids 503–970 of Sir3p can interactwith a peptide containing amino acids 1–34 of histoneH4 acetylated at K16 in vitro.55 Thus, the formerpeptide may have disrupted a contact site for Sir3pbetween amino acids 15 and 34 on histone H4 in theabove analysis.20–22,35 Therefore, we investigated theimpact of neutralizing the positive charge at residue16 on histone H4 on Sir protein recruitment andspreading at HMR by ChIP using SIR2 cells expres-sing H4 K16Qmutants. Sir proteins were recruited totheHMR-E silencer in SIR2 cells expressing H4 K16Qmutants (Fig. 9b), indicating that a positive charge onthis residue 16 was not necessary for the associationof Sir proteins with the E silencer. However, incontrast to wild-type histones (Fig. 2c; Supplemen-tary Fig. 2a) or H4 K16R mutants, H4 K16Q mutantsdisrupted Sir protein spreading in SIR2 cells (Fig. 9b).Thus, the positive charge on K16 of histone H4 wascritical for Sir protein spreading at HMR in vivo (seealso Luo et al.12 and Altaf et al.20).

Discussion

Nucleosomes serve as the foundation upon whichsilent chromatin is built. The characteristics of thehistones within these nucleosomes dictate thequality of this foundation and influence both thelikelihood that construction of silent chromatin willoccur at a given chromosomal site and the stability ofthe structure that is formed. Through the use of acatalytically inactivemutant of SIR2 to separate stepsrequired for the construction of silent chromatin, thisstudy established that a positive charge on residue 16of histone H4 was necessary and sufficient for Sirproteins to spread across the chromosome awayfrom sites where they had been recruited. Sir proteinspreading along hypoacetylated chromatin reducedtranscription of underlying genes and disruptedmethylation of K4 and K79 on histone H3 to a similardegree. However, loss of methylation, together withloss of acetylation, was insufficient to restore matingin the absence of the catalytic activity of Sir2p, im-plying that additional steps are required to formsilent chromatin. Although Sir proteins preferen-tially bind unmodified sites on histones overacetylated or methylated sites in vitro, defects inacetylation facilitated Sir protein recruitment andspreading in vivo, whereas defects inmethylation didnot. These differencesmay reflect a unique role of H4K16 in determining chromatin structure.

Histone methylation and establishment ofsilencing

During silent chromatin formation, histone acet-ylation is lost rapidly, but methylation of both K4and K79 of histone H3 is lost gradually overmultiple cell cycles, as the levels of Sir3p at silencedloci continue to increase and the levels of transcrip-tion continue to decrease.6 During this process, therate of loss of methylation at K79 correlates with thelength of the cell cycle and may reflect a twofolddilution of K79-methylated chromosomal histoneH3 with unmethylated histone H3 upon DNA repli-cation at every cell cycle. In contrast, methylated K4on histone H3 is lost more rapidly than is methy-lated K79. The rate of loss of methylated K4 fromsilent loci is too rapid to be accounted for solelythrough replication-coupled chromatin assembly.This implies that an additional mechanism for re-moving methyl groups from K4 on histone H3 or forexchanging methylated histone H3 for H3 lackingmethylated K4 during silent chromatin formationmay exist. In this study, we found that Sir proteinspreading in sir2-345 cells expressing H3 K14R H4K8,16R mutants resulted in partial hypomethylationof both K4 and K79 on histone H3 at HMR (Fig. 4),indicating that Sir protein spreading without stablesilent chromatin formation was sufficient to disruptmethylation at HMR. These experiments did notdistinguish whether Sir protein spreading disruptedmethylation at only one or both residues simulta-neously in any given cell in the population. Methy-lation of K4 on histone H3 does not require methy-lation of K79, nor does methylation of K79 requiremethylation of K4.51 However, as silencing was notrestored at HMR in sir2-345 dot1Δ cells expressinghistone H3 mutants that could not be methylated atK4 (Fig. 8b), other events, in addition to loss ofmethylation at both residues, are required forsilencing.Several scenarios could have contributed to the

observed Sir-protein-dependent hypomethylation ofhistone H3 at HMR in sir2-345 mutants. In onescenario, Sir protein spreading may have directlyblocked methylation of histone H3 at HMR byhistone methyltransferases. Consistent with thispossibility, Sir proteins block the access of severalproteins to silent loci, including DNA methytrans-ferase and restriction enzymes, as well as DNArepair and transcription machinery.56–61 As Sir3ppreferentially binds the unmethylated N-terminaltail of histone H3 in vitro,17,20,35 binding of Sir3pupon Sir protein spreading may have blocked theaccess of Set1p to its substrate, H3 K4, at silent loci invivo. Sir protein spreading may have also preventedaccess of Dot1p to nucleosomes at silent loci, therebypreventing methylation of K79 on histone H3.Several studies provide both genetic and physicalevidence that Sir proteins interact with a region onhistone H3 surrounding K79. Multiple mutationswithin this region lead to silencing defects,62–64 andbinding of Sir3p to this region is methylation-sensitive.20,22 In addition, overexpression of DOT1


disrupts silencing at HM loci and telomeres in amethyltransferase-activity-dependent manner.15,19

Sir3p may prevent Dot1p from accessing a secondregion on nucleosomes in silent chromatin as well.Sir3p binds to a region of the N-terminal tail ofhistone H4 between amino acids 15 and 34 in vitro35

that is critical for silencing.37,38 This region of H4contains a patch of basic residues that is also boundby Dot1p and is required for Dot1p-dependent me-thylation of K79 on histone H3 in nucleosomes.20,21

Thus, Dot1p may compete with Sir3p for thiscommon binding site on histone H4 at silencedloci. However, even though overexpression of Sir3ppartially restores silencing in sir2-345 mutantsexpressing hypoacetylated histone mutants,7 silen-cing was not restored in analogous strains lackingDOT1 (Fig. 8a and b). Thus, competition by Dot1pper se was not responsible for preventing the form-ation of silent chromatin in the sir2-345 mutants.In another scenario, the reduction in Set1p- or

Dot1p-dependent methylation of histone H3 atHMR in sir2-345 mutants upon restoration of Sirprotein spreading (Fig. 4) may simply reflect that thereduction in transcription from the a1 promoteritself had led to hypomethylation. Consistent withthis model, methylation levels of K4 and K79 onhistone H3 correlate with transcription activity inboth yeast and mammals.65,66 We do not favor thealternative possibility in which reduced methylationdue to Sir interference caused the reduction intranscription from the HM loci. Although Set1p-dependent methylation is clearly linked to transcrip-tion (e.g., Santos-Rosa et al.,17 Steger et al.,65 andPokholok et al.66), there is mounting evidence thatneither preinitiation complex formation nor tran-scription elongation is generally regulated by SET1-dependent methylation.67–69 Consistent with thesereports, methylation of K4 on histone H3 was notrequired for wild-type levels of transcripts from theHM loci in the absence of Sir protein spreading insir4Δ cells expressing H3 K4R mutants (Fig. 3d).Moreover, loss of methylation of K79 on histone H3did not alter transcript levels in sir2-345 cellsexpressing H3 K79R mutants (Fig. 3a). In addition,sir2-345 mutants expressing histone mutants hypo-methylated at either residue 4 or residue 79 onhistone H3 were unable to mate, indicating thatmating-type information from theHM loci was beingexpressed efficiently (Figs. 3, 6, and 8; SupplementaryTable 3). Thus, loss of histone methylation upon Sirprotein spreading may have been, in part, an effect ofa Sir-dependent reduction in transcription, ratherthan simply its cause. Together, these findingssupport loss of methylation as an intermediate stepduring the establishment of silencing.

The “dilution effect” and silencing

An intriguing “dilution effect” model used toexplain the silencing defects caused by eitherdeletion or overexpression of DOT1 suggests thatmethylation of K79 on histone H3 prevents Sirproteins from binding throughout the genome.15

According to this model, whenmethylation of K79 islost, Sir proteins bind across the genome andbecome effectively “diluted,” resulting in insuffi-cient amounts of Sir proteins being available forsilencing. This model also predicts that overexpres-sion of DOT1 would lead to hypermethylation ofK79 within silent loci and would disrupt importantinteractions between Sir proteins and histone H3.Consistent with this model, Sir3p is partiallydelocalized from telomeres in dot1Δ cells;48 multipleresidues clustering around K79 on histone H3 definea patch on nucleosomes that is clearly important forsilencing;20,62–64 loss of methylation enhances Sirprotein association with subtelomeric Y′ regions;15

and Dot1p and Sir3p can compete for an over-lapping binding site within the N-terminal tail ofhistone H4.20,21 Many aspects of the dilution modelproposed for mutants that disrupt methylation ofK79 on histone H3 have also been suggested formutants that disrupt methylation of K4 on histoneH3 or acetylation of K16 on histone H4.70

The formation of constitutive Sir binding sites onhistones could have several possible effects on si-lencing. First, constitutive Sir binding sites onhistones could reduce the rate at which silencing isestablished if insufficient amounts of Sir proteins areavailable due to their relocalization to other regionsof the genome. Alternatively, such sites on histonescould increase the rate of establishment by facilitat-ing a critical or rate-limiting step in silent chromatinformation. Second, constitutive Sir binding sites onhistones could enhance Sir recruitment to certaingenomic regions by providing additional Sir bind-ing surfaces on neighboring nucleosomes. Alter-natively, such sites on histones could decrease Sirbinding to other loci by creating competitive Sirbinding sites elsewhere throughout the genome.Third, constitutive Sir binding sites on histones couldenhance Sir protein spreading to areas surroundingsites of Sir recruitment. Alternatively, such sites onhistones could cause defects in Sir protein spreadingand silencing at native silenced loci by reducing thepool of available Sir proteins due to their relocaliza-tion to other regions. Several observations reportedhere or reported previously indicate that hypomethy-lation mutants display a different class of “dilutioneffect” phenotypes than do hypoacetylation mutants.The following phenotypes have been observed in

methylation mutants. First, loss of methylation incells lacking DOT1 increases, rather than decreases,the rate of Sir3p binding throughout HMR duringsilent chromatin formation.6 This increased rate ofSir association could reflect: (i) better binding sitesfor Sir proteins on nucleosomes due to their hypo-methylated state or due to the absence of Dot1p; (ii)an increase in the pool of Sir proteins available forsilencing the HM loci due to their delocalizationfrom telomeres; or (iii) a change in how the trans-cription machinery functions in the absence of me-thylation, which in turn enhances the stability of Sirprotein interactions with HMR. Second, loss ofmethylation did not facilitate silencing at HMR locicontaining crippled silencers (Fig. 6), implying that


loss of methylation may have created competitiveSir3p binding sites elsewhere in the genome.48

Third, loss of methylation did not enhance Sirspreading to surrounding regions. Others havenoted that Sir protein silencing does not spreadbeyond a normally silenced region in cells lackingDOT1,71 and that hypomethylation of K79 onhistone H3 did not restore Sir protein spreadingbeyond the site of Sir protein recruitment in sir2-345cells in this study (Fig. 5). This latter finding impliedthat loss of methylation may require concurrent lossof acetylation to stabilize interactions between theSir proteins and nucleosomes. Fourth, the pool ofSir proteins available in mutants lacking DOT1-dependent methylation was sufficient to form silentchromatin at native silent loci. Mutation of K79 toR on histone H3, which eliminated methylationand maintained a positive charge at this residue,supported Sir protein association and silencing atHMR,HML, or yFR057w adjacent to TelomereVIR inSIR2 cells (Figs. 3, 5, and 6b and g; see also Fig. 8 andvan Leeuwen et al.,15 Fry et al.,62 and van Welsemet al.72). In contrast to H3 K79R mutants (Fig. 5), H3K79A mutants disrupt Sir protein spreading attelomeres15,51 (see also Fry et al.62). This differenceimplies that a positive charge at residue 79 onhistone H3 plays an important role in retaining Sirproteins at telomeres.The effects of SET1- and DOT1-dependent methy-

lation on silencing have many similarities. Silentchromatin is also hypomethylated at K4 on histoneH3 (Fig. 4a; see also Katan-Khaykovich and Struhl,6

Li et al.,16 and Santos-Rosa et al.17), and like loss ofDOT1-dependent methylation, loss of SET1-depen-dent methylation also results in cellular mislocaliza-tion of Sir3p and enhances the association of Sir3pwith subtelomeric regions.17 Like loss of DOT1-dependent methylation, loss of SET1-dependentmethylation also increases the rate of Sir3p bindingthroughout HMR, indicating that methylation of K4on histone H3 may interfere with Sir–histoneinteractions in vivo.6 Supporting this notion, methy-lation of K4 reduces the binding of Sir3p to peptidesderived from the N-terminus of histone H3 invitro.17,20,35 Furthermore, like loss of methylation ofK79, loss of methylation of K4 on histone H3 did notrestore silencing to an HMR locus containing acrippled silencer (Table 1).Mutants with defects in acetylation of K16 on

histone H4 display a different class of phenotypes.First, loss of the H4-K16-specific acetyltransferaseSas2p enhances Sir3p association with chromatin insubtelomeric regions,73,74 as does loss of Dot1pfunction.15 However, as DOT1 is not required foracetylation of K16 on histone H4,75 hypoacetylationof histones is not likely the indirect cause of silencingphenotypes linked to DOT1. Second, in contrast tocells lacking DOT1 or SET1, loss of SAS2 decreasesthe rate of Sir3p binding during silent chromatinformation.6 This observation implies that the pool ofSir proteins available for relocalizing to HMR isreduced in sas2Δ mutants. Third, loss of acetylationof K16 on histone H4 through the deletion of indi-

vidual components of the Sas2/4/5p complex ormutation of K16 on histone H4 suppresses thesilencing defect at HMRae** and enhances Sirprotein recruitment to weak nucleation sites thatcontain binding sites for Sir-protein-interactingfactors40,41,44,45,47,76 (Fig. 6a and c, Fig. 7, and ourunpublished data). Fourth, in contrast to hypome-thylation of K79 on histone H3, hypoacetylation ofK16 on histone H4 also facilitated Sir protein bindingto nucleosomes adjacent to sites of Sir protein re-cruitment in sir2-345 cells (Figs. 2, 5, and 9; Supple-mentary Figs. 1–3), as well as enhances Sir proteinspreading and silencing beyond normally silencedregions in SIR2 cells.73,74,77Together, these findings are consistent with

hypoacetylation of K16 on histone H4, reorganizingchromatin into a structure recognized by Sir pro-teins that is similar to an early step in silent chro-matin formation that promotes Sir protein spreading(see below). Hypomethylation of K4 and K79 onhistone H3, in contrast, may create Sir bindingsurfaces on nucleosomes that normally form duringa later step in silent chromatin formation. However,additional unknown changes to chromatin arerequired to silence gene expression.

Chromatin structure, histone H4 lysine 16deacetylation, and silencing

This study demonstrated that histone H4 mutantswith a positive charge at residue 16 restored Sirprotein spreading, whereas histone H4 mutantswith no charge at residue 16 disrupted Sir proteinspreading (Fig. 9). Loss of acetylation at this residuemay have enhanced Sir protein spreading bydirectly influencing the structure of chromatin atthe HM loci and Telomere VIR in vivo, in addition torecreating binding sites for Sir proteins on the N-terminal tail of histone H4. Recent studies haveelegantly demonstrated that the N-terminal tail ofhistone H4 and the acetylation status of K16 onhistone H4 play key roles in forming 30 nm-likecompact chromatin fibers.78,79 Acetylation of K16disrupts chromatin compaction and the formation ofa higher-order fiber–fiber chromatin structure invitro. In contrast, compaction is retained in chroma-tin with unacetylated histone H4. Acetylation ofhistone H4, including K16, is also associated withrelaxed chromatin structures in vivo that correlatewith transcriptionally active chromatin78 (see alsoDavie and Candido80 and Tse et al.81). Consistentwith a role of chromatin compaction in silencing, N-terminal deletions of H4 that support silencing aresimilar to those that support chromatin compac-tion.37,82 However, the actual structure of chromatinin silenced regions, which consists of positionednucleosome arrays,83,84 may or may not reflect a 30-nm fiber. Sir3p is capable of inducing novel oligo-meric suprastructures from nucleosomal arrays,85

and although Sir2/3/4 oligonucleosome fila-ment formation in vitro is also disrupted by H4K16Q, such Sir-oligonucleosome filaments are onlyapproximately 20 nm in diameter.22 Other chro-


matin architectural proteins, including HP1,MeCP2, and MENT, can also promote uniquehigher-order assemblies of chromatin.86 Futurecomparisons of the effects of histone tail mutantson chromatin compaction in vitro to Sir proteinspreading in vivo should help to clarify whetherdeacetylation of K16 on histone H4 by Sir2p enablesSir protein spreading and silent chromatin forma-tion by directly altering the higher-order structureof chromatin.

Perspective

Organisms across phyla have repeatedly evolvedepigenetic strategies for regulating gene expressionto enable genetically identical cells to displaydistinct heritable phenotypes during growth anddifferentiation. These strategies lead to dramaticheritable changes in histone modifications and chro-matin structure. Understanding how multiplechanges to chromatin influence the formation ofsilent chromatin in yeast will help illuminate whyanalogous changes occur in epigenetic processes inother forms of life.

†http://mcardle.oncology.wisc.edu/mstat

Materials and Methods

Plasmids and strains

Strains used in this study are listed in SupplementaryTable 1. Plasmids used in this study are listed in Supple-mentary Table 2. Plasmids containing histonemutants weregenerated by site-directed mutagenesis using the QuickChange Site-DirectedMutagenesis Kit protocol (Stratagene,La Jolla, CA) and confirmed by sequencing. PlasmidAK967(H3 K4,9,14R H4 K16R) was generated from AK9237 usingoligonucleotides oALK660 5′ AACACTCCACAATGGC-CAGAACTAGACAAACAGC 3′ and oALK661 5′ GCTG-TTTGTCTAGTTCTGGCCATTGTGGAGTGTT 3′; plasmidAK969 (H3 K9,14,79R H4 K16R) was generated fromAK923 using oligonucleotides oALK663 5′ ATCGCTCAA-GATTTCAGGACCGACTTGAGATTTC 3′ and oALK664 5′GAAATCTCAAGTCGGTTCTGAAATCTTGAGCGAT 3′;plasmid AK97246 (H4 K16R) was generated from pMP387

using oligonucleotides oALK593 5′ GGTGGTGCCA-GACGTCACAGAAAGATTCTAAGAG 3′ and oALK5945′ CTCTTAGAATCTTTCTGTGACGTCTGGCACCACC3′; and plasmid AK1001 (H3 K79R H4 K16R) was gene-rated from pAK875 using oligonucleotides oALK593 andoALK594.

Chromatin immunoprecipitation

ChIP experiments were performed in triplicate usingtwo isogenic strains for each genotype that had beengrown logarithmically in rich medium (YPD), andsamples were analyzed by real-time polymerase chainreaction (PCR) using an ABI Prism 7700, as describedpreviously.5,7,9 Anti-Sir protein antibodies used for ChIPhave been described previously,5,7,9 and anti-histone H3di-Me K4 and di-Me K79 antibodies (cat. nos. 07-030 and07-366, respectively) were obtained from Upstate. Oli-gonucleotides used for real-time PCR have been des-cribed previously, and amplified regions are indicated in

Fig. 1.5,7 Statistical analyses were conducted using Wil-coxon rank sum test and MSTAT v. 2.6†.

RNA analyses

Total RNAwas isolated and used to generate cDNA forthe analysis of the transcription of α1 from HML, of a1from HMR, or of yFR057w adjacent to Telomere VIR (seeFig. 1) and of SCR1 (control locus) by quantitative real-time PCR, as described previously.7,88 Transcriptionanalyses were performed using two independent strainsfor each genotype.

Protein blots

Whole-cell lysates (0.33 OD600 equivalents) from loga-rithmic cultures were separated by electrophoresis on 15%SDS-PAGE gels and transferred to polyvinylidene fluoridemembranes (cat. no. 162-0177; Bio-Rad). Protein blotswere incubated with antibodies against histone H3 di-MeK4 (1:10,000, cat. no. 07-030; Upstate), H3 di-Me K79(1:10,000, cat. no. 07-366; Upstate), or proliferating cellnuclear antigen (1:10,00089,90) as loading control, plushorseradish-peroxidase-linked donkey anti-rabbit Ig, F(ab)′2fragment (1:20,000, cat. no. NA9340V; Amersham). Pro-teins were detected with the ECL-Plus kit (Amersham)using Hyperfilm ECL (Amersham).

Mating assays

Quantitative and patch mating assays of yeast growninitially on either rich medium (YPD) or minimal medium(YM) were performed as outlined in the text and asdescribed previously.7,91

Colony color assay

Colony color assays were conducted using two inde-pendent yeast strains for each genotype, as describedpreviously.91 Briefly, yeast containing ADE2 integratedbetween the E and I silencers at HMR were streaked ontoYPD plates, incubated at 30 °C for 2 days, and stored at4 °C for approximately 3 days prior to acquisition ofimages using a Leica MZ125 microscope and SPOT 4.1.1imaging software. Red colonies indicate that ADE2 atHMR is silenced, white colonies indicate that ADE2 isexpressed, and pink colonies indicate a defect in main-taining silencing of ADE2 at HMR.

Acknowledgements

This work was supported by US Department ofAgriculture Hatch grant IND053072 (A.L.K.); Pur-due Department of Biochemistry, Kimmel ScholarAward SKF-03-010 (A.L.K.); and the NationalScience Foundation (A.L.K.). This research was alsosupported by an American Cancer Society Institu-tional Research Grant to the Purdue Cancer Center.We thank Scott Briggs for helpful discussions and


comments on this manuscript. We thank ScottBriggs, Ann Ehrenhofer-Murray, Paul Kaufman,Mark Parthun, Jasper Rine, and Sharon Roth forreagents, strains, and plasmids, and Andrew Millerfor technical assistance. This is paper number 2008-18365 from the Purdue University AgriculturalExperiment Station.

Supplementary Data

Supplementary data associated with this articlecan be found, in the online version, at doi:10.1016/j.jmb.2008.06.059

References

1. Fox, C. A., Ehrenhofer-Murray, A. E., Loo, S. & Rine, J.(1997). The origin recognition complex, SIR1, and the Sphase requirement for silencing. Science, 276,1547–1551.

2. Kirchmaier, A. L. & Rine, J. (2001). DNA replication-independent silencing in S. cerevisiae. Science, 291,646–650.

3. Lau, A., Blitzblau, H. & Bell, S. P. (2002). Cell-cyclecontrol of the establishment of mating-type silencingin S. cerevisiae. Genes Dev. 16, 2935–2945.

4. Li, Y. C., Cheng, T. H. & Gartenberg, M. (2001).Establishment of transcriptional silencing in theabsence of DNA replication. Science, 291, 650–653.

5. Kirchmaier, A. L. & Rine, J. (2006). Cell-cycle require-ments in assembling silent chromatin in Saccharomycescerevisiae. Mol. Cell. Biol. 26, 852–862.

6. Katan-Khaykovich, Y. & Struhl, K. (2005). Hetero-chromatin formation involves changes in histonemodifications over multiple cell generations. EMBOJ. 24, 2138–2149.

7. Yang, B. & Kirchmaier, A. L. (2006). Bypassing thecatalytic activity of SIR2 for SIR protein spreading inS. cerevisiae. Mol. Biol. Cell, 17, 5287–5297.

8. Matecic, M., Martins-Taylor, K., Hickman, M., Tanny,J., Moazed, D. & Holmes, S. G. (2006). New alleles ofSIR2 define cell cycle specific silencing functions.Genetics, 173, 1939–1950.

9. Rusché, L. N., Kirchmaier, A. L. & Rine, J. (2002).Ordered nucleation and spreading of silenced chro-matin in Saccharomyces cerevisiae. Mol. Biol. Cell, 13,2207–2222.

10. Hoppe, G., Tanny, J., Rudner, A., Gerber, S., Danaie, S.,Gygi, S. & Moazed, D. (2002). Steps in assembly ofsilent chromatin in yeast: Sir3-independent binding of aSir2/Sir4 complex to silencers and role for Sir2-dependent deacetylation. Mol. Cell. Biol. 22, 4167–4180.

11. Rudner, A. D., Hall, B. E., Ellenberger, T. &Moazed, D.(2005). A nonhistone protein–protein interactionrequired for assembly of the SIR complex and silentchromatin. Mol. Cell. Biol. 25, 4514–4528.

12. Luo, K., Vega-Palas, M. A. & Grunstein, M. (2002).Rap1–Sir4 binding independent of other Sir, yKu orhistone interactions initiates the assembly of telomericheterochromatin in yeast. Genes Dev. 16, 1528–1539.

13. Rusché, L. N., Kirchmaier, A. L. & Rine, J. (2003). Theestablishment, inheritance, and function of silencedchromatin in Saccharomyces cerevisiae. Annu. Rev.Biochem. 72, 481–516.

14. Briggs, S. D., Bryk, M., Strahl, B. D., Cheung, W. L.,Davie, J. K., Dent, S. Y. et al. (2001). Histone H3 lysine 4

methylation is mediated by Set1 and required for cellgrowth and rDNA silencing in Saccharomyces cerevi-siae. Genes Dev. 15, 3286–3295.

15. van Leeuwen, F., Gafken, P. R. & Gottschling, D. E.(2002). Dot1p modulates silencing in yeast by methy-lation of the nucleosome core. Cell, 109, 745–756.

16. Li, C., Mueller, J. E. & Bryk, M. (2006). Sir2 repressesendogenous polymerase II transcription units in theribosomal DNA nontranscribed spacer. Mol. Biol. Cell,17, 3848–3859.

17. Santos-Rosa, H., Bannister, A. J., Dehe, P. M., Geli, V. &Kouzarides, T. (2004). Methylation of H3 lysine 4 ateuchromatin promotes Sir3p association with hetero-chromatin. J. Biol. Chem. 279, 47506–47512.

18. Ng, H. H., Ciccone, D. N., Morshead, K. B., Oettinger,M. A. & Struhl, K. (2003). Lysine-79 of histone H3 ishypomethylated at silenced loci in yeast andmammalian cells: a potential mechanism for posi-tion-effect variegation. Proc. Natl Acad. Sci. USA, 100,1820–1825.

19. Singer, M. S., Kahana, A., Wolf, A. J., Meisinger, L. L.,Peterson, S. E., Goggin, C. et al. (1998). Identification ofhigh-copy disrupters of telomeric silencing in Sacchar-omyces cerevisiae. Genetics, 150, 613–632.

20. Altaf, M., Utley, R. T., Lacoste, N., Tan, S., Briggs, S. D.& Cote, J. (2007). Interplay of chromatin modifiers ona short basic patch of histone H4 tail defines theboundary of telomeric heterochromatin. Mol. Cell, 28,1002–1014.

21. Fingerman, I. M., Li, H. C. & Briggs, S. D. (2007). Acharge-based interaction between histone H4 andDot1 is required for H3K79 methylation and telomeresilencing: identification of a new trans-histone path-way. Genes Dev. 21, 2018–2029.

22. Onishi, M., Liou, G. G., Buchberger, J. R., Walz, T. &Moazed, D. (2007). Role of the conserved Sir3-BAHdomain in nucleosome binding and silent chromatinassembly. Mol. Cell, 28, 1015–1028.

23. Imai, S., Armstrong, C. M., Kaeberlein, M. &Guarente, L. (2000). Transcriptional silencing andlongevity protein Sir2 is an NAD-dependent histonedeacetylase. Nature, 403, 795–800.

24. Min, J., Landry, J., Sternglanz, R. & Xu, R. M. (2001).Crystal structure of a SIR2 homolog–NAD complex.Cell, 105, 269–279.

25. Chang, J. H., Kim, H. C., Hwang, K. Y., Lee, J. W.,Jackson, S. P., Bell, S. D. & Cho, Y. (2002). Structuralbasis for the NAD-dependent deacetylase mechanismof Sir2. J. Biol. Chem. 277, 34489–34498.

26. Zhao, K., Chai, X. & Marmorstein, R. (2003). Structureof the yeast Hst2 protein deacetylase in ternarycomplex with 2′-O-acetyl ADP ribose and histonepeptide. Structure, 11, 1403–1411.

27. Zhao, K., Harshaw, R., Chai, X. & Marmorstein, R.(2004). Structural basis for nicotinamide cleavage andADP-ribose transfer by NAD(+)-dependent Sir2 his-tone/protein deacetylases. Proc. Natl Acad. Sci. USA,101, 8563–8568.

28. Borra, M. T., Langer, M. R., Slama, J. T. & Denu, J. M.(2004). Substrate specificity and kinetic mechanism ofthe Sir2 family of NAD+-dependent histone/proteindeacetylases. Biochemistry, 43, 9877–9887.

29. Tanny, J. C., Kirkpatrick, D. S., Gerber, S. A., Gygi, S. P.& Moazed, D. (2004). Budding yeast silencing com-plexes and regulation of Sir2 activity by protein–protein interactions. Mol. Cell. Biol. 24, 6931–6946.

30. Liou, G. G., Tanny, J. C., Kruger, R. G., Walz, T. &Moazed, D. (2005). Assembly of the SIR complex andits regulation by O-acetyl-ADP-ribose, a product of


NAD-dependent histone deacetylation. Cell, 121,515–527.

31. Bernstein, B. E., Humphrey, E. L., Erlich, R. L.,Schneider, R., Bouman, P., Liu, J. S. et al. (2002).Methylation of histone H3 Lys 4 in coding regions ofactive genes. Proc. Natl Acad. Sci. USA, 99, 8695–8700.

32. Bryk, M., Briggs, S. D., Strahl, B. D., Curcio, M. J.,Allis, C. D. & Winston, F. (2002). Evidence that Set1, afactor required for methylation of histone H3,regulates rDNA silencing in S. cerevisiae by a Sir2-independent mechanism. Curr. Biol. 12, 165–170.

33. Braunstein, M., Sobel, R. E., Allis, C. D., Turner, B. M.& Broach, J. R. (1996). Efficient transcriptional silen-cing in Saccharomyces cerevisiae requires a heterochro-matin histone acetylation pattern. Mol. Cell. Biol. 16,4349–4356.

34. Suka, N., Suka, Y., Carmen, A. A., Wu, J. & Grunstein,M. (2001). Highly specific antibodies determinehistone acetylation site usage in yeast heterochroma-tin and euchromatin. Mol. Cell, 8, 473–479.

35. Hecht, A., Laroche, T., Strahl-Bolsinger, S., Gasser,S. M. & Grunstein, M. (1995). Histone H3 and H4 N-termini interact with SIR3 and SIR4 proteins: amolecular model for the formation of heterochromatinin yeast. Cell, 80, 583–592.

36. Hecht, A., Strahl-Bolsinger, S. & Grunstein, M. (1996).Spreading of transcriptional repressor SIR3 fromtelomeric heterochromatin. Nature, 383, 92–96.

37. Johnson, L. M., Kayne, P. S., Kahn, E. S. & Grunstein,M. (1990). Genetic evidence for an interaction betweenSIR3 and histone H4 in the repression of the silentmating loci in Saccharomyces cerevisiae. Proc. Natl Acad.Sci. USA, 87, 6286–6290.

38. Johnson, L. M., Fisher-Adams, G. & Grunstein, M.(1992). Identification of a non-basic domain in thehistone H4 N-terminus required for repression of theyeast silent mating loci. EMBO J. 11, 2201–2209.

39. Park, E.-C. & Szostak, J. W. (1990). Point mutationsin the yeast histone H4 gene prevent silencing ofthe silent mating type locus HML. Mol. Cell. Biol. 10,4932–4934.

40. Axelrod, A. & Rine, J. (1991). A role for CDC7 inrepression of transcription at the silent mating-typelocus HMR in Saccharomyces cerevisiae. Mol. Cell. Biol.11, 1080–1091.

41. Ehrenhofer-Murray, A. E., Rivier, D. H. & Rine, J.(1997). The role of Sas2, an acetyltransferase homo-logue of Saccharomyces cerevisiae, in silencing and ORCfunction. Genetics, 145, 923–934.

42. Ehrenhofer-Murray, A. E., Kamakaka, R. T. & Rine, J.(1999). A role for the replication proteins PCNA, RF-C,polymerase e and Cdc45 in transcriptional silencing inSaccharomyces cerevisiae. Genetics, 153, 1171–1182.

43. Kimmerly, W., Buchman, A., Kornberg, R. & Rine, J.(1988). Roles of two DNA-binding factors in replica-tion, segregation and transcriptional repression me-diated by a yeast silencer. EMBO J. 7, 2241–2253.

44. Reifsnyder, C., Lowell, J., Clarke, A. & Pillus, L. (1996).Yeast SAS silencing genes and human genes associatedwith AML and HIV-1 Tat interactions are homologouswith acetyltransferases. Nat. Genet. 14, 42–49.

45. Xu, E. Y., Kim, S., Replogle, K., Rine, J. & Rivier, D. H.(1999). Identification of SAS4 and SAS5, two genesthat regulate silencing in Saccharomyces cerevisiae.Genetics, 153, 13–23.

46. Miller, A., Yang, B., Foster, T. & Kirchmaier, A. L.(2008). Proliferating cell nuclear antigen and ASF1modulate silent chromatin in Saccharomyces cerevisiaevia lysine 56 on histone H3. Genetics, 179, 793–809.

47. Meijsing, S. H. & Ehrenhofer-Murray, A. E. (2001). Thesilencing complex SAS-I links histone acetylationto the assembly of repressed chromatin by CAF-Iand Asf1 in Saccharomyces cerevisiae. Genes Dev. 15,3169–3182.

48. San-Segundo, P. A. & Roeder, G. S. (2000). Role for thesilencing protein Dot1 in meiotic checkpoint control.Mol. Biol. Cell, 11, 3601–3615.

49. Fingerman, I. M., Wu, C. L., Wilson, B. D. & Briggs,S. D. (2005). Global loss of Set1-mediated H3 Lys4trimethylation is associated with silencing defects inSaccharomyces cerevisiae. J. Biol. Chem. 280, 28761–28765.

50. Nislow, C., Ray, E. & Pillus, L. (1997). SET1, a yeastmember of the trithorax family, functions in transcrip-tional silencing and diverse cellular processes. Mol.Biol. Cell, 8, 2421–2436.

51. Ng, H. H., Feng, Q., Wang, H., Erdjument-Bromage,H., Tempst, P., Zhang, Y. & Struhl, K. (2002). Lysinemethylation within the globular domain of histone H3by Dot1 is important for telomeric silencing and Sirprotein association. Genes Dev. 16, 1518–1527.

52. Ng, H. H., Dole, S. & Struhl, K. (2003). The Rtf1 com-ponent of the Paf1 transcriptional elongation complexis required for ubiquitination of histone H2B. J. Biol.Chem. 278, 33625–33628.

53. Mueller, J. E., Canze, M. & Bryk, M. (2006). The re-quirements for COMPASS and Paf1 in transcriptionalsilencing and methylation of histone H3 in Sacchar-omyces cerevisiae. Genetics, 173, 557–567.

54. Xu, E. Y., Zawadzki, K. A. & Broach, J. R. (2006).Single-cell observations reveal intermediate transcrip-tional silencing states. Mol. Cell, 23, 219–229.

55. Carmen, A. A., Milne, L. & Grunstein, M. (2002). Ace-tylation of the yeast histone H4 N terminus regulatesits binding to heterochromatin protein SIR3. J. Biol.Chem. 277, 4778–4781.

56. Loo, S. & Rine, J. (1994). Silencers and domains ofgeneralized repression. Science, 264, 1768–1771.

57. Gottschling, D. E. (1992). Telomere-proximal DNA inSaccharomyces cerevisiae is refractory to methyltrans-ferase activity in vivo. Proc. Natl Acad. Sci. USA, 89,4062–4065.

58. Singh, J. & Klar, A. J. (1992). Active genes in buddingyeast display enhanced in vivo accessibility to foreignDNA methylases: a novel in vivo probe for chromatinstructure of yeast. Genes Dev. 6, 186–196.

59. Chen, L. & Widom, J. (2005). Mechanism of transcrip-tional silencing in yeast. Cell, 120, 37–48.

60. Sekinger, E. A. & Gross, D. S. (2001). Silenced chro-matin is permissive to activator binding and PICrecruitment. Cell, 105, 403–414.

61. Terleth, C., van Sluis, C. A. & van de Putte, P. (1989).Differential repair of UV damage in Saccharomycescerevisiae. Nucleic Acids Res. 17, 4433–4439.

62. Fry, C. J., Norris, A., Cosgrove, M., Boeke, J. D. &Peterson, C. L. (2006). The LRS and SIN domains: twostructurally equivalent but functionally distinct nu-cleosomal surfaces required for transcriptional silen-cing. Mol. Cell. Biol. 26, 9045–9059.

63. Park, J. H., Cosgrove, M. S., Youngman, E., Wolberger,C. & Boeke, J. D. (2002). A core nucleosome surface cru-cial for transcriptional silencing. Nat. Genet. 32, 273–279.

64. Thompson, J. S., Snow, M. L., Giles, S., McPherson,L. E. & Grunstein, M. (2003). Identification of afunctional domain within the essential core of histoneH3 that is required for telomeric and HM silencing inSaccharomyces cerevisiae. Genetics, 163, 447–452.

65. Steger, D. J., Lefterova, M. I., Ying, L., Stonestrom,A. J., Schupp, M., Zhuo, D. et al. (2008). DOT1L/


KMT4 recruitment and H3K79 methylation are ubi-quitously coupled with gene transcription in mam-malian cells. Mol. Cell. Biol. 28, 2825–2839.

66. Pokholok, D. K., Harbison, C. T., Levine, S., Cole, M.,Hannett, N. M., Lee, T. I. et al. (2005). Genome-widemap of nucleosome acetylation and methylation inyeast. Cell, 122, 517–527.

67. Shukla, A. & Bhaumik, S. R. (2007). H2B-K123ubiquitination stimulates RNAPII elongation inde-pendent of H3-K4 methylation. Biochem. Biophys. Res.Commun. 359, 214–220.

68. Pavri, R., Zhu, B., Li, G., Trojer, P., Mandal, S.,Shilatifard, A. & Reinberg, D. (2006). Histone H2Bmonoubiquitination functions cooperatively withFACT to regulate elongation by RNA polymerase II.Cell, 125, 703–717.

69. Tanny, J. C., Erdjument-Bromage, H., Tempst, P. &Allis, C. D. (2007). Ubiquitylation of histone H2Bcontrols RNA polymerase II transcription elongationindependently of histone H3 methylation. Genes Dev.21, 835–847.

70. van Leeuwen, F. & Gottschling, D. E. (2002). Genome-wide histone modifications: gaining specificity bypreventing promiscuity. Curr. Opin. Cell. Biol. 14,756–762.

71. Tompa, R. &Madhani, H. D. (2007). Histone H3 lysine36 methylation antagonizes silencing in Saccharomycescerevisiae independently of the Rpd3S histone deace-tylase complex. Genetics, 175, 585–593.

72. van Welsem, T., Frederiks, F., Verzijlbergen, K. F.,Faber, A. W., Nelson, Z. W., Egan, D. A. et al. (2008).Synthetic lethal screens identify gene silencing pro-cesses in yeast and implicate the acetylated aminoterminus of Sir3 in recognition of the nucleosome core.Mol. Cell. Biol. 28, 3861–3872.

73. Kimura, A., Umehara, T. & Horikoshi, M. (2002).Chromosomal gradient of histone acetylation estab-lished by Sas2p and Sir2p functions as a shield againstgene silencing. Nat. Genet. 32, 370–377.

74. Suka, N., Luo, K. & Grunstein, M. (2002). Sir2p andSas2p opposingly regulate acetylation of yeast histoneH4 lysine 16 and spreading of heterochromatin. Nat.Genet. 32, 378–383.

75. Lacoste, N., Utley, R. T., Hunter, J. M., Poirier, G. G. &Cote, J. (2002). Disruptor of telomeric silencing-1 is achromatin-specific histone H3 methyltransferase.J. Biol. Chem. 277, 30421–30424.

76. Xu, E. Y., Kim, S. & Rivier, D. H. (1999). SAS4 andSAS5 are locus-specific regulators of silencing inSaccharomyces cerevisiae. Genetics, 153, 25–33.

77. Donze, D. & Kamakaka, R. T. (2001). RNA polymeraseIII and RNA polymerase II promoter complexes areheterochromatin barriers in Saccharomyces cerevisiae.EMBO J. 20, 520–531.

78. Shogren-Knaak, M., Ishii, H., Sun, J. M., Pazin, M. J.,Davie, J. R. & Peterson, C. L. (2006). Histone H4-K16acetylation controls chromatin structure and proteininteractions. Science, 311, 844–847.

79. Dorigo, B., Schalch, T., Bystricky, K. & Richmond, T. J.(2003). Chromatin fiber folding: requirement for thehistone H4 N-terminal tail. J. Mol. Biol. 327, 85–96.

80. Davie, J. R. & Candido, E. P. (1978). Acetylated histoneH4 is preferentially associated with template-activechromatin. Proc. Natl Acad. Sci. USA, 75, 3574–3577.

81. Tse, C., Sera, T., Wolffe, A. P. & Hansen, J. C. (1998).Disruption of higher-order folding by core histoneacetylation dramatically enhances transcription ofnucleosomal arrays by RNA polymerase III. Mol.Cell. Biol. 18, 4629–4638.

82. Kayne, P. S., Kim, U.-J., Han, M., Mullen, J. R.,Yoshizaki, F. & Grunstein, M. (1988). Extremelyconserved histone H4 N terminus is dispensable forgrowth but essential for repressing the silent matingloci in yeast. Cell, 55, 27–39.

83. Ravindra, A., Weiss, K. & Simpson, R. T. (1999). High-resolution structural analysis of chromatin at specificloci: Saccharomyces cerevisiae silent mating-type locusHMRa. Mol. Cell. Biol. 19, 7944–7950.

84. Weiss, K. & Simpson, R. T. (1998). High-resolutionstructural analysis of chromatin at specific loci:Saccharomyces cerevisiae silent mating type locusHMLalpha. Mol. Cell. Biol. 18, 5392–5403.

85. McBryant, S. J., Krause, C., Woodcock, C. L. &Hansen, J. C. (2008). The silent information regulator 3protein, SIR3p, binds to chromatin fibers and assem-bles a hypercondensed chromatin architecture in thepresence of salt. Mol. Cell. Biol. 28, 3563–3572.

86. McBryant, S. J., Adams, V. H. & Hansen, J. C. (2006).Chromatin architectural proteins. Chromosome Res. 14,39–51.

87. Kelly, T. J., Qin, S., Gottschling, D. E. & Parthun, M. R.(2000). Type B histone acetyltransferase Hat1p parti-cipates in telomeric silencing. Mol. Cell. Biol. 20,7051–7058.

88. Schmitt, M. E., Brown, T. A. & Trumpower, B. L.(1990). A rapid and simple method for preparation ofRNA from Saccharomyces cerevisiae. Nucleic Acids Res.18, 3091–3092.

89. Daganzo, S. M., Erzberger, J. P., Lam, W. M.,Skordalakes, E., Zhang, R., Franco, A. A. et al. (2003).Structure and function of the conserved core of histonedeposition protein Asf1. Curr. Biol. 13, 2148–2158.

90. Franco, A. A., Lam, W. M., Burgers, P. M. & Kaufman,P. D. (2005). Histone deposition protein Asf1 main-tains DNA replisome integrity and interacts withreplication factor C. Genes Dev. 19, 1365–1375.

91. van Leeuwen, F. & Gottschling, D. E. (2002). Assays forgene silencing in yeast. Methods Enzymol. 350, 165–186.

Insights into the Impact of Histone Acetylation and Methylation on Sir Protein Recruitment,...

Documents

Transcript of Insights into the Impact of Histone Acetylation and Methylation on Sir Protein Recruitment,...