Nucleic Acids Research, 1992, Vol. 20, No. 22 5919-5925

Evolutionarily conserved nucleotides within the E.coli 4.5SRNA are required for association with P48 in vitro and foroptimal function in vivo

Heather Wood*, Joen Luirink+ and David TollerveyEuropean Molecular Biology Laboratory, Postfach 102209, Meyerhofstrasse 1, 6900 Heidelberg,Germany

Received September 4, 1992; Revised and Accepted October 16, 1992

ABSTRACTE.coli 4.5S RNA is homologous to domain IV ofeukaryotic SRP7S RNA, the RNA component of thesignal recognition particle. The 4.5S RNA is associatedin vivo with a 48kD protein (P48), which is homologousto a protein component of the signal recognitionparticle, SRP54. In addition to secondary structuralfeatures, a number of nucleotides are conservedbetween the 4.5S RNA and domain IV of all othercharacterised SRP-like RNAs from eubacteria,archaebacteria and eukaryotes. This domain consistsof an extended stem-loop structure; conservednucleotides lie within the terminal loop and withinsingle-stranded regions bulged from the stemimmediately preceding the loop. This conserved regionis a candidate for the SRP54/P48 binding site. Todetermine the functional importance of this regionwithin the 4.5S RNA, mutations were introduced intothe 4.5S RNA coding sequence. Mutated alleles weretested for their function in vivo and for the ability ofthe corresponding RNAs to bind P48 in vitro. Singlepoint mutations in conserved nucleotides within theterminal tetranucleotide loop do not affect P48 bindingin vitro and produce only slight growth defects. Thissuggests that the sequence of the loop may beimportant for the structure of the molecule rather thanfor specific interactions with P48. On the other hand,nucleotides within the single-stranded regions bulgedfrom the stem were found to be important both for thebinding of P48 to the RNA and for optimal function ofthe RNA in vivo.

INTRODUCTION

Signal recognition particle (SRP) is a ribonucleoprotein (RNP).Mammalian SRP is composed of a 7S RNA molecule, (SRP7S),and six different protein subunits. It is required for targeting

nascent secretory proteins to the endoplasmic reticulum (reviewedin 1). Small RNA species which contain a domain homologousto domain IV of SRP7S RNA have been identified in a widevariety of organisms, including a number of eubacterial species(2, 3). The E.coli representative is the 4.5S RNA, a 114nucleotide, metabolically stable RNA, which is essential forviability (4). The 4.5S RNA is associated in vivo with the P48protein, (product of the ffh gene), which shows similarity insequence to a protein component of the signal recognition particle,SRP54 (5, 6, 7, 8). SRP54 recognises the signal sequence ofthe nascent polypeptide chain as it emerges from the ribosome(9, 10).The existence of homologues of two SRP components in E. coli

raised the possibility that the prokaryotic RNP may also beinvolved in a pathway of protein secretion. The functionalrelationship of the mammalian and bacterial components ishighlighted by the ability of the human 7S RNA to complementthe loss of 4.5S or scRNA (the B.subtilis homologue) in vivo(8, 11) and by the ability of mammalian SRP54 to bind to theE. coli 4.5S RNA in vitro (7, 8, 12). More recently it has beenshown that, like SRP54, P48 also interacts with nascent signalsequences in vitro (13).A comparison of 7S-like RNAs reveals a number of conserved

regions (14). Archaebacterial and eukaryotic 7S-like RNAs sharedomain mI, the major binding site for SRP19 (15). This domainis not present in eubacterial 7S-like RNAs. The binding site forthe SRP9/14 heterodimeric protein, domain I, which appears tobe present in all characterised eukaryotic and archaebacterial 7S-like RNAs, has so far been found in only one eubacterial 7S-like RNA, the scRNA from B.subtilis (16). The only region of7S-like RNAs that is universally conserved is domain IV (17).This domain consists of an extended stem-loop structure. Highlyconserved and invariant residues lie within the terminaltetranucleotide loop and within single-stranded regions bulgedfrom the stem immediately preceding this loop. This conservedregion is a candidate for the SRP54/P48 binding site. In orderto determine the functional importance of this region within the

* To whom correspondence should be addressed

+ Present address: Department of Molecular Microbiology, Faculty of Biology, De Boelelaan 1087, 1081 HV Amsterdam, The Netherlands

k.) 1992 Oxford University Press

5920 Nucleic Acids Research, 1992, Vol. 20, No. 22

E.coli 4.5S RNA, we changed conserved residues by site directedmutagenesis and analysed the effects of these changes on P48binding and on the function of the mutated alleles in vivo. Theresults indicate that the evolutionarily conserved residues withinthe bulged region are important both for P48 binding and functionof the RNA. Conserved residues within the tetranucleotide loop,although important for function, are not required for P48 bindingin vitro.

MATERIALS AND METHODSPlasmid constructionsThe region encoding the mature portion of the 4.5S RNA (lacking4 nucleotides at the 3' end) was amplified by PCR using the 4.5SRNA clone in p801 (kindly provided by M.J.Fournier) as atemplate. Primers were designed to introduce SaIl and BamHIrestriction sites at the 5' and 3' ends respectively. The fragmentwas cloned between the SalI and BamHI sites of pT7/T3a19(purchased from Stratagene).

In order to express the 4.5S RNA in vivo, the fragment whichencodes the 4.5S RNA precursor was amplified by PCR usingprimers to introduce Sall and BamHI restriction sites at the 5'and 3' ends respectively. This fragment was cloned between theBamHI and Sall sites ofpDR720 (18), thus placing the gene underthe control of the trp promoter. The tip promoter-4.5S gene wasthen removed on a EcoRI-BamHlI fragment and cloned betweenthe EcoRI and BamHI sites of pLK9159. pLK9159 is a derivativeof pLK915 (19), which has been modified to remove the uniqueSall site; pLK915 was cut with Sall and HindlII, treated withT4 DNA-polymerase and religated. The final plasmid(pPre4.5wt), contains the 4.5S RNA precursor coding sequencecloned between the tip promoter and phage fD transcriptionalterminators.

Construction of mutant allelesMutations were constructed by successive PCR reactions usingthe 4.5S RNA coding sequence in pT7/T3a19 as a template. Amutagenic oligonucleotide was employed as a primer along witha second primer which hybridises to 5' flanking plasmidsequences. Concurrently, an independent PCR reaction wasperformed to generate the 3' end of the 4.5S RNA codingsequence. The PCR products from these two reactions overlapby 15 nucleotides. These fragments were then combined and usedas templates in a further PCR reaction. In this reaction the mutated4.5S RNA coding region was amplified using primers designedto incorporate Sall and BamHI at the 5' and 3' ends respectively.The resulting fragments were cloned between the Sall and BamHIsites of pT7/T3a 19 as described for the wild-type gene. In orderto incorporate the mutations into the pre4.5S RNA gene, eachmutant 4.5S gene in pT7/T3cd19 was used as a template in afurther PCR reaction. The primer at the 5' end of the gene wasextended so as to generate a fragment which encodes the 4.5SRNA precursor. This SalI-BamI-l fragment was then used toreplace the wild-type fragment in pPre4.5wt (described above).The nucleotide sequence of all mutant alleles was confirmed byDNA sequencing of one strand. In cases where the sequence wasambiguous the second strand was sequenced or dGTP wasreplaced by dITP in the sequencing reaction. The fraction ofnucleotides misincorporated over the double PCR reaction wasfound to be approximately 0.2%.

Bacterial strainsThe ability of the mutant alleles to support growth was testedin E. coli FF283T (F'::TnIO proA+B+ lacIQA(lacZ)Ml5/lacAx74 araD139[araABOIC-leu] A7679 galUgalK rpsL), a variant of E.coli FF283 (kindly provided byM.J.Fournier) in which the F' factor from FF283 has beenreplaced by that containing the tetracycline resistance marker fromE. coli XL1 blue. The endogenous 4.5S RNA gene (ifs) in thisstrain is under the control of the tac promoter and hence the strainis IPTG or lactose dependent. Other manipulations were carriedout in E.coli XL1 blue.

MediaGrowth of E. coli FF283T transformants was analysed onM9-glucose media containing glucose (0.4%) and casamino acids(0.2%). The chromosomal copy of the ifs gene was induced byreplacing the glucose with lactose (0.4%). Where statedtryptophan was added to 0.04mgnl--'. For other manipulationscells were routinely grown on LB (20). Ampicillin (I00igmln-)and tetracycline (12.5ygmn-1) were added to all media.

RNA preparationCells were grown in M9-glucose media for 4.5hrs (37°C), 5.5hrs(30°C), or 7.75hrs (25°C). At these time points thechromosomally expressed 4.5S RNA has fallen to a level, belowwhich it cannot support growth. The cells from the equivalentof 6 OD6Wo units of culture were resupended in I00A of a 1:1mixture of 4M guanidinium thiocyanate (GTC), (buffered withTris.HCl pH7.5) and phenol. An equal volume of glass beads(Sigma, G-1 145) was added and the mixture vortexed for 5 min.at 4°C. A further 350A1d each of4M GTC and phenol were added,followed by 4001t chloroform/isoamylalcohol and 2001il 100mMNaOAc in TE, and the mixture was heated to 65°C for 5min.After centrifugation the aqueous phase was recovered andextracted twice with phenol/chloroform. The RNA wasprecipitated with 2.5 volumes of ethanol. RNA was separatedby electrophoresis on 8% acrylamide, 8.3M urea gels. RNA wastransferred to Hybond-N membrane (Amersham). The filter wasprobed with [32P]-labelled anti-sense RNA transcribed in vitrousing T3 RNA-polymerase and the wild-type 4.5S RNA constructin pT3/T7o19 (see above) as template. To allow for variationin transfer and hybridisation efficiencies, northern blotting wasperformed in duplicate.

ImmunoprecipitationE.coli lysates were prepared by resupending cells in 150mMNaCl, 5mM MgCl2, 20mM Tris (pH8.0), 0.05% NP40, 4mMvanadyl-ribonucleoside complex, 0.1mM PMSF. 0.5 volumesof glass beads (Sigma, G-1145) were added and the suspensionwas vortexed for 5 min at 4°C.

Protein A-Sepharose was equilibrated in 150mM NaCl, 5mMMgCl2, 20mM Tris (pH 8), 0.05% NP40 and incubated for 2hrs with the polyclonal antiserum 730. This antibody was raisedagainst a peptide derived from an evolutionarily conserved regionof SRP54 and cross-reacts with P48 (8). After antibody binding,the protein A-Sepharose was washed with the same buffer andincubated with the lysate. To specifically block the interactionof the antibody with P48 in control experiments, competitorpeptide (lag) was added to the protein A-Sepharose-antibodycomplex and incubated for 5 min before addition of the lysate.After centrifugation, the pellet was washed 3 times in the same

Nucleic Acids Research, 1992, Vol. 20, No. 22 5921

40 V C

G CIUCu 30 Ac A4G

5 10 20 UA C 4 ACCA CAGG50O4GGGGGCUCUGUUGGUU c UCCCG CAACGC UCUGUUU GGU UCC G-A

CCCACCCCCGGGACGGUCGA AGGGC UGCG AGACGGA CCG AGG A110 100 UGU go CGUG 80 CAGU 70 A ACG A

C3GUCUGU60

t A

176 GAAC cA5.' GGGGU CGGCC UCG A3. CCUCAA A CUGG GGC A

220 A ACG A A

B

Figure 1. A. Locations of the point mutations within the E.coli 4.5S RNA secondary structure. Residues which are invariant across all known 7S-like RNAs (14),are indicated in bold. The large arrows denote the endpoints of the deletion in the mutant A(49-60). B. The coffesponding region, domain IV of the human SRP7SRNA (nucleotides 176-220), (17).

buffer. RNA was recovered by heating to 65°C in a 1: 1 mixtureof 4M GTC and phenol, and extracted as described above.

In vitro binding assayThe RNAs encoded by each of the mutant 4.5S genes weretranscribed in vitro using T7 polymerase after linearisation ofthe constructs in pT7/T3ct19 with BamHI. As a negative controlthe plasmid containing the wild-type 4.5S RNA gene waslinearised with Sall and transcribed using T3 RNA-polymeraseto generate an anti-sense RNA. RNAs were ethanol precipitatedafter adjustment to 2.5M ammomium acetate.pET-8c-48 (kindly provided by A.Giner and B.Dobberstein),

was used for the in vitro transcription of the P48 protein. Thiscontains the coding region for P48 under the control of the T7promoter in pET-8c (8). RNA was ethanol precipitated andtranslated for 30 min at 25°C in a wheat germ cell free system(Promega), in the presence of [35S]methionine. EDTA wasadded to a final concentration of5mM to release nascent chainsfrom ribosomes and tRNA, and incubation was continued fora further 15 min. The translation reactions were then adjustedto 5mM MgOAc2, 450mM KOAc. 10,lO of the translationreaction were incubated with lAg RNA at 25°C for 30 min. Thevolume was adjusted to 200i1 with 450mM KOAc, 5mMMgOAc2, 50mM Tris pH7.4 (wash buffer). 20d1 was removedand TCA precipitated to monitor total protein synthesis. 30A1 ofDEAE-Sepharose CL-6B (Pharmacia) equilibrated in wash bufferwas added to the remainder and incubated at 4°C for 30 min.The supernatant fraction was removed and TCA precipitated. TheDEAE-Sepharose beads were washed twice with 800y1 washbuffer. The DEAE-Sepharose bound material was eluted byincubation at 4°C with 200/1 of wash buffer adjusted to 2M KCl.Eluted protein was TCA precipitated and samples were analysedon a 10% SDS-PAG. Failure of P48 to bind to mutant RNAswas confirmed by repetition of the assay.

RESULTSLocation of mutations within the 4.5S geneThe structure proposed for E.coli 4.5S RNA (2) is shown inFigure IA. The predicted structure of the terminal region and

the nucleotides shown in bold are invariant in all known SRP-like RNAs. For comparison, the corresponding domain of humanSRP7S RNA is also shown (Figure 1B). The position ofmutations introduced into the 4.5S RNA are indicated inFigure IA. These include: a deletion of 12 nucleotides, 49 to60 (the endpoints are indicated by arrows in Figure 1), whichremoves the tetranucleotide loop and terminal stem; pointmutations within the terminal tetranucleotide loop; point mutationsof the invariant and highly conserved nucleotides within thesingle-stranded regions bulged prior to the terminal loop; twopoint mutations within the previous bulge; a mutation, C52G,which disrupts predicted base pairing with G57 and a doublemutation, C52G, G57C which restores the base pairing ability.A change from C to U at position 23, which lies within a regionconserved among eubacterial 4.5S RNA homologues (3), wasfound as a PCR artifact and this mutant allele was also analysed.To test the ability of mutant RNAs to bind to P48 in vitro,

mutations were introduced into the mature 4.5S RNA codingsequence under control of the T7 promoter in the vectorpT7/T3ac19. To test the ability of mutant RNAs to provide 4.5SRNA function in vivo, mutations were cloned into the pre4.5SRNA gene under the control of a trp promoter (see Materialsand Methods).

Some mutant RNAs are unable to bind P48 in vitroThe ability of P48 to bind to each of the mutant 4.5S RNAs wasexamined by an in vitro assay (5). RNA was transcribed in vitrofrom the wild-type and each of the mutant alleles in pT7/T3c 19,using T7 polymerase. As a control the complementary strand ofthe wild-type allele was transcribed using T3 polymerase. TheRNA was incubated with [35S]methionine labelled, in vitrotranslated P48. 10% of the incubation mixture was withdrawnto monitor total protein synthesis (T). Complex formation wasdetected by incubation with DEAE-sepharose: unbound protein(U) was removed in the supernatant fraction, while protein boundto the RNA and hence to the DEAE-Sepharose (B) was elutedin 2M KCI. Samples were TCA precipitated and protein detectedby SDS-PAGE and fluorography. The results are shown inFigure 2 and summarised in Table 1.

5922 Nucleic Acids Research, 1992, Vol. 20, No. 22

Table 1. Viability of Ecoli FF283T containing mutant 4.5S alleles.

4.5S allele - tryptophan + tryptophan P48 Binding370C 300C 370C 300C 250C in vitro

nonewild-type ++++ ++++ ++++ ++++ ++++ +A(49-60)C23U ++++ ++++ ++++ ++++ ++++ +U37A n.t. n.t. n.t. n.t. n.t. +A39C ++++ ++++ ++++ ++++ +++ -C40G ++++ ++++++++++ +

A47C + -G48U ++++ ++ ++++ - - -G49C ++++ +++ +++ +C52G ++ +++ ++ + +

C52G, G57C ++++ ++++ ++++ ++++ ++++ +

G53A ++++ ++++ ++++ ++++ +++ +G53C ++++ ++++ ++++ ++++ +++ +G54A ++++ ++++ ++++ ++++ ++++ +A56U ++++ ++++ ++++ ++++ ++ +A60U ++++ ++++ +

G61U ++ + ++++ ++ + -C62GA63C +++ ++++ ++++ ++++ ++ +

+ + + + Colony size > 80% of wild-type.+ + + Colony size 30% to 80% of wild-type.+ + Colony size 10% to 30% of wild-type.+ Colony size < 10% of wild-type.- No visible colonies.n.t. Not tested.

conserved tetranucleotide loop does not, however, affect binding.On the other hand, point mutations within the opposing bulgedresidues at positions 47, 48, 49, 61 and 62 completely abolishbinding. A mutation from A to C at position 39, which lies within

'P"'" the adjacent single-stranded bulged region also abolishes theability to bind P48 in vitro. This suggests that these nucleotides,four of which are invariant and the remainder of which areconserved in 26 of 27 characterised SRP-like RNAs (14), maymake sequence-specific contacts with P48.

Figure 2. In vitro binding of the P48 protein to the mutant 4.5S RNAs. Complexformation was examined by DEAE chromatography. Samples containing no RNA(-RNA), and the 4.5S reverse transcript (Rev), were used as negative controls.An aliquot (10%) of the total incubation mixture (T), material not bound to theDEAE (U), and the material bound to the DEAE (B), were analysed by SDS-PAGE and fluorography.

Deletion of the 12 terminal nucleotides of the stem-loopabolishes the ability of the RNA to form a complex with P48,suggesting that nucleotides within this region are important forbinding. The introduction of single point mutations within the

A plasmid expressed 4.5S RNA is functional in vivo4.5S RNA is synthesised in the cell as a larger precursor whichis cleaved by RNase P to yield the mature 4.5S RNA (21). Inorder to examine the function of the mutant alleles in vivo, theDNA which encodes the 4.5S RNA including its native 24nucleotide 5' extension (referred to below as pre4.5S), was clonedinto an expression vector between a trp promoter and phage fDterminator sequences (see Materials and Methods). This plasmidwas called pPre4.5Swt.The expression and function of this 4.5S RNA gene was

examined after transformation of E.coli FF283T. In this strainthe chromosomal copy of the 4.5S RNA gene is under the controlof the tac promoter. In the absence of an inducer (lactose orIPTG), this strain fails to grow. The presence of the plasmidencoded 4.5S RNA gene restores growth. To examine expressionlevels of the plasmid encoded 4.5S RNA, cells were grown inthe absence of lactose for the time required for the chromosomaflyexpressed RNA to fall to a level below which it is insufficientto support growth. This requires 4.5hrs at 37°C, 5.5hrs at 30°Cand 7.75hrs at 25°C. RNA was prepared and analysed byelectrophoresis and northern blotting (Figure 3). RNA in lane6 (Figure 3) was prepared from a control strain which containsthe plasmid pLK9159. This shows the residual level of

Nucleic Acids Research, 1992, Vol. 20, No. 22 5923

12 3 4 5 6 7

* - mature4.5S RNA

Figure 3. Expression of the wild-type 4.5S RNA from pPre4.5wt in E.coliFF283T. Cells were grown in M9-glucose media (in the absence or presence

of tryptophan), for 4.5hrs (37°C), 5.5hrs (30°C), or 7.75hrs (25°C). RNA was

prepared and separated on a 8% acrylamide, 8.3M Urea gel. The RNA was

transferred to Hybond-N membrane and hybridised with a[3 P]-labelled reverse

transcript of the 4.5S RNA coding region. Lanes: 1. 37°C, + tryptophan; 2.37°C, - tryptophan; 3. 30°C, + tryptophan; 4. 30°C,-tryptophan; 5. 25°C,+ tryptophan; 6. Control plasmid without the 4.5S RNA sequence, 25°C, +tryptophan. 7. wild-type control, E.coli JM109.

chromosomally expressed 4.5S RNA in cells at this time point.Figure 3, lanes 1-5 show RNA prepared from cells containingpPre4.5wt. As can be seen, greater than 90% of the plasmidencoded 4.5S RNA is processed to the size of the mature form.This indicates that sequences required for recognition andprocessing by RNaseP are contained within the pre4.5S RNAcoding sequence. Constitutive expression from the trp promoterresults in levels of 4.5S RNA two to three fold higher than thatfound in a wild-type E. coli strain, JM109 (Figure 3, compare

lane 2 with lane 7). When tryptophan is added to the growthmedium, transcription from the trp promoter is repressed(compare lane 1 with lane 2) resulting in approximately 50% ofthe level of 4.5S RNA found in the wild-type strain (comparelane 1 with 7). This amount of RNA is sufficient to supportgrowth under the conditions tested. In the presence or absenceof tryptophan, RNA levels did not vary significantly when cellswere grown at 37°C (lanes 1 and 2), 30°C (lanes 3 and 4) or

25°C (lane 5).

Function of the 4.5S mutant alleles in vivoTo analyse the effects of the mutations within the 4.5S gene, eachmutated allele was used to replace the wild-type sequence inpPre4.5Swt. The resulting plasmids were used to transform E.coliFF283T. Northern blot analysis showed that in each case themutant allele was expressed. Levels of the mutant RNA variedfrom approximately 25% to 100% of that of the plasmid bornewild-type allele (data not shown). In all cases except two, (G49Cand the deletion mutant), expression levels were similar to thosethat allowed wild-type growth in the case of other alleles.

Transformants were tested for their ability to grow on solidmedia in the absence of lactose. Cells were first grown inM9-lactose medium for 5 hours, under which conditions the

chromosomal copy of the 4.5S RNA gene is expressed. Cultureswere diluted 10-5 in M9-glucose medium, plated onM9-glucose medium in the absence and presence of tryptophanand scored for their ability to form colonies at 370C, 300C and

250C (Table 1). Relative growth supported by the mutant alleleswas found to be reproducible in independent experiments.Two of the alleles fail to support growth under any of the

conditions tested. These are the 12 nucleotide deletion and thepoint mutant C62G. Five mutant alleles show no apparentphenotype. The remaining alleles give rise to varying defects ingrowth. Generally, the defect is more pronounced when cellsare grown in the presence of tryptophan and a more severe defectis observed with decreasing growth temperature.Three alleles with mutations within the tetranucleotide loop

(G53C, G53A and A56U), confer growth defects only under themost restrictive growth conditions while a further change withinthis region (G54A), has no apparent effect on growth under anyof the conditions tested. The mutation C52G, which disrupts thepredicted base pair which closes the loop, results in a reducedgrowth rate of the cells at 30°C and 25°C. When base pairingis restored in the double mutant C52G, G57C, the colony sizeis indistinguishable from that of cells expressing the wild-typeallele. Both of these alleles are expressed at comparable levels.

Mutations which result in the strongest phenotype are locatedwithin the bulged nucleotides immediately preceding the loop.The transversion C62G results in lethality. A47C allowsformation of visible colonies only under the least restrictiveconditions i.e. at 37°C in the absence of tryptophan. G48U andG61U result in either no or reduced growth respectively at 25°C,but allow normal growth at 370C. The G49C allele also has astrong effect on growth at 25°C. This allele is however expressedat low levels (approximately 25% of the wild-type), which maycontribute to the phenotype. Notably these five mutant RNAsfail to bind P48 in vitro. Two further mutations within this regionA60U and A63C, have no or little effect on growth andcorrespondingly the RNAs retain the ability to bind P48 in vitro,although in the case of A60U the efficiency of binding may bereduced.The two alleles tested which have mutations within the

neighbouring bulged region, A39C and C40G, have little or noeffect on colony size. This is surprising in the former case, asthis mutant RNA fails to bind P48 in vitro. The C23U mutation,which lies within a region conserved across eubacterial 7S-likeRNAs, likewise has no detectable effect on growth.

Association of mutant RNAs with P48 in vivoMutant RNAs which fail to bind P48 in vitro show a gradationof phenotypic effects, ranging from the C62G allele, which failsto support growth under any conditions, to the A39C allele which,even under the most restrictive conditions, confers only a slightgrowth defect. An explanation may be that the in vitro bindingassay does not accurately reflect binding under physiologicalconditions. To address this question, the amount of wild-typeor mutant 4.5S RNA associated with P48 in vivo was examined.Lysates were prepared from strains expressing the wild-type 4.5SRNA, the deletion mutant (A49-60), the A39C mutant RNA,which gives rise to only a slight growth defect, and the A47Cmutant RNA which results in a severe growth defect. Antibodies,which were raised against a peptide found in the SRP54 proteinbut which cross-react with P48 (8), were used toimmunoprecipitate P48 from the lysates. In control experimentsthe interaction between the antiserum and P48 was specificallyblocked by addition of the peptide against which the antiserumwas raised. The amount of 4.5S RNA co-precipitated with P48in each case was examined by northern blot hybridisation. The

5924 Nucleic Acids Research, 1992, Vol. 20, No. 22

*

Figure 4. Association of wild-type and mutant 4.5S RNAs with P48 in vivo.Lysates were prepared from strains after 4.5hrs growth at 37°C in the absenceof lactose. P48 was immunoprecipitated using antiserum 730 (8), and levels ofco-precipitating 4.5S RNAs were analysed by gel electrophoresis andautoradiography. Lanes 1-4 contain aliquots of total RNA from the lysates; 1.

wild type; 2. A(49-60); 3. A47C; 4. A39C; lanes 5-12, the immunoprecipitatedRNA: 5 and 6. wild-type; 7 and 8. A(49-60); 9 and 10. A47C; and 12.A39C. For the samples in lanes 5, 7, 9 and competitor peptide (Iitg) wasadded prior to incubation of the lysate with antibody.

results are shown in Figure 4. The RNA with the 12 nucleotidedeletion is poorly precipitated (Figure 4, lane 8). Both alleleswith point mutations also show reduced co-precipitation of the4.5S RNA (Figure 4, lanes 10 and 12) when compared to thewild-type control (Figure 4, lane 6). No clear difference can bedetected between these two mutant strains in the level of 4.5SRNA which is associated with P48. Thus at least in the case ofthe alleles tested, the in vitro binding assay would appear to reflectthe in vivo situation.

DISCUSSION

A stem-loop structure resembling the terminal loop region of E.coli 4.5S RNA is present in eukaryotes as a domain of SRP7SRNA. In addition to conservation of the secondary structure, anumber of nucleotides are highly conserved. These lie within theterminal tetranucleotide loop and adjacent single stranded bulgedregions. No other regions have been found to be universallyconserved in primary sequence in 7S-like RNAs. MammalianSRP54 is homologous to E. coli P48, and is able to bind to 4.5SRNA, suggesting that these conserved nucleotides within theterminal loop region may be important for binding. The resultspresented here show that this region is indeed at least part ofthe P48 binding site. Moreover, four of the six invariantnucleotides are required for P48 binding in vitro. This suggeststhat a requirement for P48/SRP54 binding is the selective pressuremaintaining the identity of these nucleotides across all kingdoms.The only known exception is the RNA component of theSaccharomyces cerevisiae SRP, scRl (22), which shows littleresemblance to other SRP RNAs (23).The sequence of the terminal tetranucleotide loop conforms

to the consensus GNRA, a sequence which is overrepresentedin 16S rRNA tetranucleotide loops (24) and which confers unusualthermodynamic stability to the hairpin structure (25). Thissuggests that the sequence of the loop may be important for thestructure of the molecule rather than for specific interactions withP48. Consistent with this is the observation that mutations withinthe 4.5S RNA loop do not block P48 binding. Mutations withinthe loop do, however, have some effect on growth as does themutation affecting the loop-closing base-pair, C52-G57. A

compensatory change in this base-pair restores wild-type growth,again consistent with the idea that the structure of this region,rather than its primary sequence, is important. Nucleotides whichare required for P48 binding in vitro, and hence postulated tomake sequence specific contacts with P48, lie within two single-stranded regions bulged from the stem.The effects on growth of some mutations in the homologous

domain of SRP7S RNA from Schizosaccharomyces pombe havealso been analysed (26, 27). A number of these have similareffects to mutations in equivalent sites within the 4.5S RNA. Forexample, a change at position 54 (4.5S RNA numbering) hasno phenotype in either case. Similarly, a change from A to Uat position 56 produces, in both cases, a mild conditional growthdefect. A mutation in S.pombe SRP7S RNA at the sitecorresponding to A63 has no phenotype, and the equivalentmutation in the 4.5S RNA also has little effect. Other mutations,however, produce quite different effects. A double mutation inSRP7S RNA at the sites corresponding to A56 and C62 producedonly mild conditional impairment of growth, whereas the C62mutation alone is lethal in 4.5S RNA. Conversely, the G to Ctransversion at position 53 of the 4.5S RNA results in only amild conditional growth defect, whereas the equivalent mutationin the SRP7S RNA is lethal. Thus it is evident that not allmutations in this region of S.pombe SRP7S RNA and 4.5S RNAhave identical effects. The situation for the eukaryotic RNA iscomplicated because this region also contains a binding site forthe SRP19 protein (28) and SRP54 binding to the mammalianSRP7S RNA is enhanced by SRP19 (5, 29). Thus protein-proteininteraction may stabilise SRP54 binding to the S.pombe SRPRNA.The growth defects conferred by mutant alleles were observed

to be more pronounced in the presence of tryptophan and a moresevere defect was observed with decreasing growth temperature.The former effect is likely to be due to the decreased levels ofexpression of the 4.5S RNA in the presence of tryptophan (seeFigure 3) i.e. the deleterious effect of a mutant allele is revealedonly at low expression levels. The latter effect may depend onthe higher basal level of heat-shock proteins present in cells grownat increased temperature (30). Induction of the heat shockresponse is observed in cells depleted of 4.5S RNA (31); thismay be due to an accumulation of mis-folded polypeptides (32),resulting from lack of targeting function in the absence of 4.5SRNA. The increased basal levels of the heat shock proteins at37°C compared to 25°C may suppress the phenotypic effectsof a defective 4.5S RNA by the chaperone function of some ofthe heat shock proteins. Heat shock proteins have recently beenfound to substitute for SecB function during protein export inEcoli (33, 34).P48 has been shown to interact with the signal sequence of

nascent polypeptide chains in vitro (13). The efficiency of thisinteraction is greatly reduced in the absence of 4.5S RNA,suggesting that the interaction of 4.5S RNA and P48 is requiredfor the signal recognition function of P48. Of the alleles whichfail to bind P48 in vitro, only the deletion mutant (A49 -60) andthe C62G allele fail to support growth under any conditions. Theothers show varying growth defects with one of these, the A39Callele, giving rise to only slight growth retardation even underthe most restrictive conditions. This would suggest that thesemutant RNAs are associated to some extent with P48 in vivo.Levels of RNA co-precipitated with P48 were, however, foundto be comparable for the A39C and A47C alleles; the formerresults in only a slight growth defect whereas the latter gives rise

Nucleic Acids Research, 1992, Vol. 20, No. 22 5925

to a severe growth defect. In both cases co-precipitation of 4.5SRNA with P48 was similarly reduced in comparison to the wild-type control. It is possible that the immunoprecipitation was notsensitive enough to detect subtle differences in binding efficiencywhich may differentiate between functional and non-functionalRNAs, or that the conditions used for immunoprecipitationdisrupted the already weakened association between the RNAand protein. We cannot, however, exclude the possibility thatin addition to a P48-associated function in signal-sequencerecognition, 4.5S RNA plays an additional role which is essential,but which does not depend on binding to P48.

30. Yamamori, T. and Yura, T. (1982) Proc. Natl. Acad. Sci. USA. 79,860-864.

31. Bourgaize, D. B., Phillips, T. A., Van Bogelen, R. A., Jones, P. G.Neidhardt, F. C. and Fournier, M. J. (1990) J. Bacteriol. 172, 1151-1154.

32. Goff, S. A. and Goldberg, A. L. (1985) Cell 41, 587-595.33. Altman, E., Kumamoto, C. A. and Emr, S. D. (1991) EMBO J. 10,

239-245.34. Wild, J., Altman, E., Yura, T. and Gross, C. A. (1992) Genes Dev. 6,

1165-1172.

ACKNOWLEDGEMENTS

We thank Bernhard Dobberstein and Angelika Giner for plasmidpET-8c-48 and for anti-SRP54/P48 serum and Maurille Fournierfor the strain FF283. We also thank Bernhard Dobberstein, lainMattaj, Yves Henry and John Morrissey for critical review ofthe manuscript. Heather Wood was the recipient of an EMBOfellowship.

REFERENCES1. Siegel, V. and Walter, P. (1988) Trends Biochem. Sci. 13, 314-315.2. Brown, S., Thon, G. and Tolentino, E. (1989) J. Bacteriol. 171,

6517-6520.3. Struck, J. C. R., Lempicki, R. A., Toschka, H. Y., Erdmann, V. A. and

Fournier, M. J. (1990) J. Bacteriol. 172, 1284-1288.4. Brown, S. and Fournier, M. J. (1984) J. Mol. Biol. 178, 533-550.5. R6misch, K., Webb, J., Herz, J., Prehn, S., Frank, R., Vingron, M. and

Dobberstein, B. (1989) Nature 340, 478-482.6. Bernstein, H. D., Poritz, M. A., Strub, K., Hoben, P. J., Brenner, S. and

Walter, P. (1989) Nature 340, 482-486.7. Poritz, M. A., Bernstein, H. D., Strub, K., Zopf, D., Wilhelm, H. and

Walter, P. (1990) Science 250, 1111-1117.8. Ribes, V., Romisch, K., Giner, A., Dobberstein, B. and Tollervey, D. (1990)

Cell, 63, 591-600.9. Kreig, U. C., Walter, P. and Johnson, A. E. (1986) Proc. Natl. Acad. Sci.

USA. 83, 8604-8608.10. Wiedmann, M., Kurzchalia, T. V., Bielka, H. and Rapoport, T. A. (1987)

J. Cell Biol., 104, 201-208.11. Nakamura, K., Imai, Y., Nakamura, A. and Yamane, K. (1992) J. Bacteriol.

174, 2185-2192.12. Zopf, D., Berstein, H. D., Johnson, A. E. and Walter, P. (1990) EMBO

J. 9, 4511-4517.13. Luirink, J., High, S., Wood, H., Giner, A., Tollervey, D. and Dobberstein,

B. Nature, in press.14. Larson, N. and Zwieb, C. (1991) Nuc. Acids Res. 19, 209-215.15. Zwieb, C. (1991) Nuc. Acids Res. 19, 2955-2960.16. Strub, K., Moss, J. and Walter, P. (1991) Mol. Cell. Biol. 11, 3949-3959.17. Poritz, M. A., Strub, K. and Walter, P. (1988) Cell 55, 4-6.18. Russell, D. R. and Bennett, G. N. (1982) Gene 20, 231-243.19. Stanley, K. K. and Luzio, J. P. (1984) EMBO J. 3, 1429-1434.20. Miller, J. H. (1972) Experiments in Molecular Genetics (Cold Spring Harbor,

New York: Cold Spring Harbor Laboratory).21. Bothwell, A. L. M., Garber, R. L. and Altman, S. (1976) J. Biol. Chem.

251, 7709-7716.22. Hann, B. C. and Walter, P. (1991) Cell 67, 131-144.23. Felici, F., Cesareni, G. and Hughes, J. M. X. (1989) Mol. Cell. Biol. 9,

3260-3268.24. Woese, C. R., Winker, S. and Gutell, R. R. (1990) Proc. Natl. Acad. Sci.

USA. 87, 8467-8471.25. Heus, H. A. and Pardi, A. (1991) Science 253, 191-194.26. Laio, X., Brennwald, P. and Wise, J. A. (1989) Proc. Natl. Acad. Sci. USA

86, 4137-4141.27. Laio, X., Selinger, D., Althoff, S., Chaing, A., Hamilton, D., Ma, M. and

Wise, J. A. (1992) Nuc. Acids Res. 20, 1607-1615.28. Zwieb, C. (1992) J. Biol. Chem. 267, 15650-15656.29. Walter, P., and Blobel, G. (1983) Cell 34, 525-533.