www.elsevier.com/locate/ygcen

General and Comparative Endocrinology 155 (2008) 63–69

Short Communication

Characterization of the luteinizing hormone beta (LH-b) subunit genein the Indian river buffalo (Bubalus bubalis)

Mallikarjuna Shivapura Basavarajappa 1, Sachinandan De *,1, Manish Thakur,Tirtha Kumar Datta, Gaurav Dogra, Paras Yadav, Surender Lal Goswami

Animal Biotechnology Center, National Dairy Research Institute, Karnal 132001, Haryana, India

Received 10 December 2006; revised 18 March 2007; accepted 20 March 2007Available online 31 March 2007

Abstract

The cDNA sequence of leuteinizing hormone (LH) beta subunit was determined to understand the molecular basis for silent oestrusbehavior and poor response to superovulation in buffalo. The LH-b cDNA contains an open reading frame 426 bp long. The deducedsequence of the LH-b is 141 amino acids in length. The amino acid sequences of the Indian river buffalo LH-b subunit showed overallsimilarity to those of other mammals. The nucleotide sequence variability of LH-b was studied in more than �350 Indian buffaloes cov-ering five different breeds. The results of the sequence analysis showed that the buffalo LH-b gene is not highly conserved and non-syn-onymous mutations are not rare, at least in the samples collected randomly from five different breeds and buffalo populations. A total ofseven different variants were obtained. In spite of its crucial role in reproduction, variation of the LH-b gene was found present in thisspecies. The polymorphisms found were unique in the Indian river buffalo population.� 2007 Elsevier Inc. All rights reserved.

Keywords: Buffalo; Luteinizing hormone (LH) beta; SSCP

1. Introduction

The Indian river buffalo (Bubalus bubalis) is a majordairy animal in India. India produces about two-thirds ofthe world’s buffalo milk and nearly half of the world’s buf-falo meat (FAOSTAT, 2005). However, there are certainproblems related to the species such as delayed puberty, along calving interval and silent heat. Silent reproductivebehavior is one of the major problems in understandingreproductive parameters and assisted reproduction in thisspecies. Assisted reproductive techniques including embryomanipulation techniques, such as cryopreservation ofembryos/gametes and transgenic technologies, need to beemployed to improve the usability of such an importantdairy animal, but at present these techniques do not find

0016-6480/$ - see front matter � 2007 Elsevier Inc. All rights reserved.

doi:10.1016/j.ygcen.2007.03.012

* Corresponding author. Fax: +91 184 2250042.E-mail address: sachinandan@gmail.com (S. De).

1 These authors contributed equally to this work.

maximal utility in this species. For these applications,many embryos/oocytes are required, making induction ofsuperovulation an essential requirement. In general, super-ovulation is induced by the injection of gonadotropins. Thecombination of equine chorionic gonadotropin (eCG) andhuman chorionic gonadotropin (hCG), widely used for theinduction of superovulation in many species, is sometimesfound ineffective in this species (Manik et al., 2002). There-fore, understanding the protein hormones responsible forthe reproductive process in the Indian river buffalo is anurgent requirement.

Luteinizing hormone (LH), like other members of theglycoprotein hormone family, is a heterodimer consistingof a common alpha subunit coupled to a unique beta sub-unit, each encoded by different genes. LH is produced bygonadotropes in the anterior lobe of the pituitary gland.It has 121 amino acids (MW �30 kDa), contains two dis-similar subunits, namely, common-a subunit and specific-b subunit linked by non-covalent bonds. The beta subunitconfers specificity of action by mediating interaction with

64 M.S. Basavarajappa et al. / General and Comparative Endocrinology 155 (2008) 63–69

its cognate receptor. LH functions together with the Folli-cle Stimulating Hormone (FSH) to promote the growthand development of gonads, to control gametogenesisand to regulate gonadal endocrine functions (Moyleet al., 1994). In the female, LH is responsible for follicularmaturation, ovulation, transformation of follicles into cor-pora lutea and the maintenance of luteal activity; and inmales, LH binds to its receptor on Leydig cells to increasesteroidogenesis. An intact beta subunit is required for bio-logical activity. However, heterogeneity and genetic vari-ants of LH are known to exist in humans (Petterssonet al., 1992, 1994). Some point mutations that cause hypo-gonadotropic hypogonadism (Weiss et al., 1992; Valdes-Socin et al., 2004) and infertility in both sexes of humanshave been identified in the LH-b subunit gene (Roy et al.,1996; Liao et al., 1998; Ramanujam et al., 1999, 2000).

The genes encoding for alpha and beta subunits arelocalized on different segments in the genome. After properpost translational modification/processing they are associ-ated by non-covalent bonds to form biologically active hor-mones. The nucleotide sequences of cDNA and aminoacids of LH-b have been studied mostly in mammals, birds,amphibians, reptiles and fish. The structure, function, andregulation of LH molecules have been investigated mostextensively in the mammalian species (Nakav et al.,2005). The cDNAs and deduced peptide sequences of theLH-b subunit molecule are available for at least 15 mam-malian species (Bovine [M10077], Sheep [X52488], Goat[AM258985], Pig [P01232], Giant Panda [AF448455], Rat[NM012858], Mouse [NM008497], Dog [Y00518], Hamster[AF106915], Monkey [AJ781396], Human [NM_000894],Baboon [M14966], Marmoset [U04447], Horse [X80116]and Zebra [Y16265]). This information is useful for the iso-lation and analysis of these genes in different species, forthe identification and quantification of their mRNA andproduction of biologically active recombinant hormones(Clark et al., 2005). These data-sets also suggest a spe-cies-specific difference in structural organization and theirbiological activity. Analysis of the nucleotide and predictedamino acid sequences of the pituitary glycoproteins pro-vides further insight into the evolution of this family ofhormones (Wallis, 2001).

In this study, we cloned cDNA encoding the precursormolecules and estimated the primary structure of the betasubunit of the Luteinizing Hormone, a pituitary glycopro-tein hormone in the Indian River buffalo (Bubalis bubalis).In the Indian river buffalo, we also found the presence ofpolymorphisms in this region.

2. Materials and methods

2.1. Animals and genomic DNA

Fifty unrelated animals each from the Murrah, Nili Ravi, Surti, Meha-

sana and Nagpuri breeds were included in this study. Standard proteinase-K digestion followed by phenol–chloroform extraction was performed toisolate genomic DNA from peripheral blood leucocytes to study DNAsequence variation (Sambrook and Russell, 2001).

2.2. RNA isolation

Total RNA was isolated from the pituitary glands of three female buffa-loes. Buffalo pituitaries were collected from the skulls of slaughtered buffa-loes after the brain was removed. The pituitary was dissected using DEPCtreated scalpels and scissors and transported to the laboratory in ice at0 �C. The pituitary tissue sample was triturated in liquid nitrogen with amortar and pestle. This tissue powder was used for RNA isolation usingthe TRI reagent (Sigma, USA), following the manufacturers’ protocol.The RNA pellet was finally dissolved in 20 ll of RNase-free water. The qual-ity of RNA was checked by running 5 ll aliquots on a 1.5% formaldehydeagarose gel.

2.3. Primers

Primers for the specific amplification of LH-b Exons and cDNA weredesigned using the web-based software, PRIMER-3 (http://www-genome.-wi.mit.edu/cgi-bin/prime/primer3-www.cgi) after homology alignment(using software GeneDoc) of known luteinizing hormone beta subunitDNA sequences from other species available in GenBank (www.ncbi.nlm.-nih.gov.in) and custom synthesized from M/S Sigma Aldrich chemicalcompany, Aldrich, USA. Two sets of primers, which were used in thestudy, are as follows. One set of primers was used to amplify the entirecoding region of LH-b gene from cDNA preparation and another setwas used to amplify a 705 bp region of the LH-b gene from genomicDNA covering partially the second and third exons.

cDNA primers:

Forward-5 0GGAGGCAGGAAGGATGGAGATG3 0 = 22 bases

Reverse-5 0TGGAGGTTGAAGTGGGGCATCCTTA30 = 25 bases

Genomic primers (used for SSCP study):

Forward-5 0CCTGAGGCACTGGCCTTGTCC(C/T)A30 = 23 bases

Reverse-5 0TGGAGGTTGAAGTGGGGCATCCTTA30 = 25 bases

2.4. RT-PCR

cDNA was prepared according to the manufacturer’s instructions usingan RT-access Reverse transcription System (Promega corporation, USA).The reaction was performed in a 20 ll volume. Oligo d(T)15 primers(100 ng) and total cellular RNA (500 ng) from the pituitary gland wereheated to 65 �C for 5 min. 10 U of MMLV-RT were added to each reactionmix and the reaction mixes were incubated for 60 min at 37 �C. Five micro-liters of the cDNA-containing mixture were then used for further PCRamplification. The PCR was performed using Taq DNA polymerase (Pro-mega corporation, USA) under the following thermal conditions: one cycleat 94 �C for 2 min, then 25 cycles at 94 �C for 20 s, 60 �C for 25 s and 72 �Cfor 30 s and finally, an extension at 72 �C for 5 min in a PTC-100 thermalcycler (MJ Research). The procedure was repeated thrice for three differentpituitary samples. The yields of the resulting RT-PCR products were system-atically checked on agarose gels. The purified RT-PCR product was clonedin p-GEM T (Promega Corporation, USA) vector following the manufac-turer’s protocol.

2.5. Genomic DNA PCR

The LH-b gene has three exons and two introns. A portion of the sec-ond and third exons was amplified together with a genomic primer set. ThePCR was performed at an annealing temperature of 54 �C, which yielded a705 bp amplified product. The PCR products were either cloned in thep-GEM-T vector (Promega) for further characterization of the ampliconor processed further for SSCP analysis.

2.6. SSCP analysis and sequencing

For SSCP analysis, 5 ll (0.5 lg) of each of the genomic DNA PCRproducts were mixed with 12 ll of denaturing solution (95% formamide,

M.S. Basavarajappa et al. / General and Comparative Endocrinology 155 (2008) 63–69 65

20 mM EDTA, pH 8.0, 0.05% bromophenol blue, and 0.05% xylene cya-nol), heated for 10 min at 95 �C, and immediately cooled on ice. The DNAstrands were separated by nondenaturing 8% polyacrylamide gel electro-phoresis in Tris–borate–EDTA buffer (89 mM Tris–borate, pH 8.0,2 mM EDTA), with a constant current of 28 mA per minigel, and the tem-perature was maintained at 20–24 �C. The duration of the electrophoresisrun was 4–6 h for the 705 bp amplicon. The gels were finally stained withDNA silver staining according to Bassam et al. (1991) with slight modifi-cations: time for fixing was reduced from 20 to 5 min and time for stainingwas decreased from 30 to 20 min.

DNA samples yielding different SSCP patterns were considered to con-tain different genotypes for the LH-b gene. Follow-up sequencing of alldifferent genotypes confirmed that they indeed differed by one or moremutations; while on the other hand, sequencing of up to three samples(when available) containing identical genotypes confirmed that they dis-played strictly identical sequences.

2.7. Sequence analysis

Additional mammalian LH-b sequences were retrieved from GenBankas follows: bovine (M10077), ovine (X52488), caprine (AM258985), por-cine (P01232), giant panda (AF448455), mouse (NM008497), rat(NM012858), canine (Y00518), human (NM_000894), baboon(M14966), marmoset (U04447), equine (X80116) and zebra (Y16265).These sequences were edited and analyzed using the BLAST and Clustal

W programs. The resulting multiple-sequence alignment was correctedmanually using the program Gendoc (Nicholas et al., 1997). A phyloge-

Fig. 1. cDNA nucleotide and deduced amino acid sequences of the Indian riversequences of the 5 0 UTR are designated with negative numbers and the firstforward (partial) and the reverse primer binding regions are represented in theprotein amino acid sequence is designed as �1/+1 boundary. The proposed leato be N-glycosylated at Asn 13th position, shown in bold and underlined. Thewith alpha subunit are located in between 54 and 59 amino acid residues. The

netic tree was constructed from the data provided by the multiple-sequence alignment patterns following the Neighbour-Joining method bythe MEGA 3.0 program (Kumar et al., 2004).

3. Results

3.1. Buffalo LH-b sequence

The cDNA primer set designed out of the available LH-b nucleic acid sequence data of bovine and other mamma-lian species could amplify a fragment of 461 bp in the buf-falo pituitary cDNA preparation. This size was expected asper the bovine LH-b sequence information. The procedurewas repeated three times (for three separate pituitary sam-ples) for consistency and positive clones were selected forsequencing. Three clones, one from each experiment weresequenced at random. Alignment of three sequences con-firmed the fact that these represented coding regionsequences, were similar, and represented the buffalo LH-bsequence. This was done to rule out any errors duringPCR amplification and further sequencing. One sequencewas submitted to GenBank, with the accession numberAY765376. A BLAST search for this sequence in NCBIconfirmed its relatedness/similarity with other mammalian

buffalo LH beta subunit (Accession Number: AY765376). The nucleotidenucleotide of the ATG translational start codon as +1. The location of

shaded box. The end of the signal peptide and the beginning of the matureder sequence is 20 amino acids in length. The LH beta subunit is presumed

cysteine residues are underlined. Conserved CAGY residues for bindingposition of asterisk (*) indicates the end of the LH-b reading frame.

66 M.S. Basavarajappa et al. / General and Comparative Endocrinology 155 (2008) 63–69

LH-b sequences. The sequencing results revealed a highsimilarity (between 68% and 100% similarity) with othermammalian species. The nucleotide sequences and thededuced amino acid sequences of the cDNA are shown inFig. 1. Comparative analysis suggests that this 426 bp frag-ment represents the entire coding region of the precursorLH-b hormone. The ORF of the buffalo LH-b subunitencodes 141 amino acids with a predicted molecular massof 15.17 kDa. Based on the high degree of conservationof the amino acid sequence in the LH-b subunit of othermammals, it is likely that the buffalo LH subunit consistsof a signal peptide 20 amino acids long and a mature sub-unit 121 amino acids long with a molecular mass of12.97 kDa. A total of 12 cysteines and one putative N-gly-cosylation sites exist in this subunit (Fig. 1).

3.2. Homology comparison

The nucleotide and deduced amino acid sequences werecompared with other mammalian sequences available inGenBank. Amino acid and nucleotide sequence alignmentwas performed using the Clustal method (Higgins andSharp, 1990). The amino acid sequence alignment withother species is presented in Fig. 2. Nucleotide sequencealignments are not presented to conserve space, but areavailable in the NCBI GenBank. Clustal W analysis ofnucleotide sequences revealed a high level of similarity with

Fig. 2. Alignment of putative amino acid sequences of the LH beta subunit.[AY765376] Bovine [M10077], Sheep [X52488], Goat [AM258985], Pig [P0123[Y00518], Hamster [AF106915], Monkey [AJ781396], Human [NM_000894[Y16265]). Potential N-linked glycosylation sites are indicated by an open boxthat agree with the buffalo sequence are indicated by a dot (.). The numbering abto the putative cleavage site. The position of asterisk (*) indicates the end of

the nucleotide sequences of other mammalian species. Thebuffalo LH-b sequence had the highest homology withother mammals ranging from 99% for bovine buffalo com-parison (highest) and 78% homology with the marmosetmonkey (lowest) at the nucleotide level. At the amino acidsequence level, the buffalo LH-b sequence had 100%homology with sheep and goat (highest) and 68% withthe marmoset monkey (lowest). The unique amino acid res-idues, CAGY (34th to 37th amino acid residues), werefound conserved across different species. These conservedresidues are responsible for binding to the common alphasubunit (Gharib et al., 1990).

3.3. Phylogenetic analysis of the LH-b hormone family

Based on the multiple sequence alignment of 121 aminoacid residues, a phylogenetic tree was constructed (Fig. 4).Closely related mammalian species were clustered in a sim-ilar group. There are distinct clades for ruminants, rodents,equids and primates.

3.4. SSCP variants

Genomic DNA PCR amplimers (705 bp), representa-tives of the partial second and third exon of the LH-b geneexhibited polymorphisms upon SSCP analysis. Under opti-mized SSCP conditions, seven types of SSCP patterns were

The sequences for alignment were from 15 species of mammals (Buffalo2], Giant Panda [AF448455], Rat [NM012858], Mouse [NM008497], Dog], Baboon [M14966], Marmoset [U04447], Horse [X80116] and Zebraand conserved cysteine residues are indicated by shaded box. Amino acidsove the sequence corresponds to the buffalo amino acid position according

LH-b reading frame.

Table 1Allelic frequencies of the LH beta variants from five breeds of Indian riverbuffalo (total animals = 357) typed by SSCP of the 705 bp PCR productsobtained from genomic DNA

Variant Number of animals Percentage Acc. No.

Major type 326 91.31 AY765376Variant 1 4 1.12 EF113097Variant 2 7 1.96 EF113098Variant 3 3 0.84 EF113099Variant 4 8 2.24 EF113100Variant 5 6 1.68 EF113101Variant 6 1 0.28 EF113102Variant 7 2 0.56 EF113103

M.S. Basavarajappa et al. / General and Comparative Endocrinology 155 (2008) 63–69 67

observed (Table 1). All variants were found in a heterozy-gous condition. Cloning of amplimers and subsequentscreening of recombinant clones revealed seven uniqueSSCP variants. All sequences were confirmed by comparingcorresponding SSCP patterns of the cloned PCR ampli-mers with those of the genomic PCR amplimer from whichthe sequence was isolated. Additional confirmation wasprovided by identifying each sequence in more than oneanimal (when available). After removal of the intronsequences, the coding regions were translated into aminoacid sequences. The amino acid sequence alignment is pre-sented in Fig. 3. All variants revealed one or more aminoacid substitutions. These substitutions were observed in atotal of nine different amino acid positions. These positionswere found in sites other than the N-glycosylation sites and12 cysteine residues.

4. Discussion

In this study, we isolated cDNA clones encoding thepituitary glycoprotein hormone LH-b subunit-precursormolecule of the Indian River buffalo (Bubalus bubalis).

Fig. 3. Amino acid sequence alignment of different buffalo LH-b variants. IdenLH beta amino acid sequence variants in comparison to wild type LH beta seqsites of nonsynonymous mutations. The numbering above the sequence correspsite. Potential N-linked glycosylation sites are indicated by shaded box and co

The nucleotide sequence of the precursor was determinedand amino acid sequences were estimated. This is, in ourknowledge, the first study on complete nucleotide codingsequences of LH-b cDNAs and their polymorphisms inthe Indian river buffalo.

The cDNA encoding the buffalo LH-b subunit precursormolecule contained a coding region 426 bp long. The prim-ers were designed to amplify amino acid coding regionsonly. Thus the cDNA clone had incomplete 5 0and 3 0

UTR. The LH-b cDNA encoding precursor protein is426 bp long (corresponding to 141 amino acid residues)in most mammalian species. However, the size of the com-plete cDNA sequence including the 5 0end and putativepoly-A sites is quite large and shows considerable lengthvariation (Koura et al., 2004). The buffalo LH-b subunitis closer to ruminants (like cattle, sheep and goat) thanother mammalian species like rodents, equids and prima-tes. Identity values of the nucleotide sequence encodingthe precursor LH-b hormone are 99% similar with cattle.The deduced amino acid sequences showed that the buffaloLH-b precursor molecule consisted of 141 amino acid res-idues and divided into a signal peptide containing 20 resi-dues and a functional protein containing 121 residues(Fig. 1). The amino acid sequence of the buffalo LH-b mol-ecule is 100% similar with sheep and goat and 98% withcattle amino acid sequences. Therefore, this cDNA corre-sponds to the buffalo LH-b subunit.

Several characteristics of the primary amino acidsequences of this family were evident from these multiple-sequence alignments. Firstly, 12 half Cys residues of LH-b subunit molecules were conserved across all species pre-sented in their mature protein sequences. Secondly, the buf-falo LH-b subunit possessed a single potential N-linkedglycosylation site at the 13th amino acid residue, similarto that of other ruminants, rodents and equids (Fig. 2).This N-linked glycosylation at the 13th amino acid position

tity to the consensus sequence is indicated by dots (.). Polymorphic sites ofuence (top). Only polymorphic sites are shown within box, which indicatesonds to the buffalo amino acid position according to the putative cleavagenserved cysteine residues are indicated by open box.

G-Panda Dog

Pig Hamster

Rat Mouse

Goat Buffalo

Bovine Sheep

Horse Zebra

Marmoset Baboon

Monkey Human

0.05

A.

Fig. 4. An un-rooted phylogenetic tree of LH-b subunits from differentmammalian species. The tree was constructed by the Neighbour-Joiningmethod from similar sized (141 amino acid residues) LH beta sequencesshown in Fig. 2. Molecular Evolutionary Genetics Analysis version 3.0(MEGA 3.0) software was used to draw this phylogenetic tree.

68 M.S. Basavarajappa et al. / General and Comparative Endocrinology 155 (2008) 63–69

is a common feature in all mammalian species. In the caseof primates, an additional N-glycosylation site is availableat 30th amino acid residue. These substantial similaritiessuggest a common ancestral origin (Nakav et al., 2005).It was earlier proposed that all members of the glycopro-tein gene family (common-a, LH-b, FSH-b and TSH-b)evolved from a single ancestor through gene duplications.The first duplication produced an a-subunit and a b-sub-unit and was followed by a second duplication of the ances-tral b-subunit to yield the LH-b subunit gene and theancestor of the TSH-b and FSH-b subunits which eventu-ally gave rise to the genes for these two latter b-subunits (Liand Ford, 1998). LH-b, with an extended carboxyl terminalwas observed only in equids and primates (Fig. 2). Thisextended region is rich in mucin type O-glycans and confersadditional properties like prolonged circulatory survival(Pierce and Parsons, 1981).

While searching polymorphisms amongst �350 differentanimals, we primarily used the PCR-SSCP and directsequencing methods to detect mutation. A total of sevenLH-b variants were found in the studied buffalo popula-tion. In all variants, amino acid substitutions were noted.Such amino acid substitutions were noted in nine differentamino acid positions out of 128 amino acid residues. Thesubstitutions are located at positions other than the 12 con-served cystein residues and the potential N-glycosylationsite. In one very rare variant, a serine amino acid (at posi-tion 40th) was found replaced by cysteine (Fig. 3). Such ahigh non-synonymous substitution rate is very rare inany coding DNA. Experiments were repeated more thanthree times in each variant to rule out any misincorpora-tion during PCR and any reading errors during sequencing.This was found to be a mere chance factor. SSCP was usedto screen the samples before sequencing the PCR products.

SSCP detected almost all changes in the amplified region ofthe genomic DNA. This method could be employed forcDNA fragments to detect mutations. However, the avail-ability of pituitary tissue in large numbers was a limitingfactor. Direct sequencing detects every base-pair mutationand any polymorphism in the sequence. But, it is relativelyexpensive, since many small fragments have to besequenced. For a cost effective, large-scale screeningmethod of choice for a given gene, SSCP was found tobe beneficial.

It will be interesting to study the LH-b gene expressionin the Indian river buffalo. The Indian river buffalo is welladapted to a hot, humid and tropical climate. The mainaim of this work was to generate basic information onthe structure of the LH-b gene and to develop a roadmapto understand seasonal and silent reproductive events inthe Indian river buffalo. The present study was based ongenomic DNA isolated from peripheral blood leukocytesfrom a large number of buffaloes with a hypothesis thatvariations could exist in the coding region of the LH betasubunit gene. A more controlled study would furtherresolve important issues like the expression status of theseLH beta variants in different tissues including the pituitarygland in live animals and the regulation pattern of the LHbeta variants in response to the hypothalamic GnRH.Although, there are no reports of LH beta variations inother mammalian species, however, the nucleotidesequences of the LH beta subunit are found to be less con-served when compared to the FSH beta subunit during theevolution of amniotic vertebrates (Chien et al., 2005).Moreover, there are reports of variations in the biologicalactivity of LH beta to stimulate testicular androgen secre-tion in vitro (Yu et al., 1995, 1996; Yu and Wang, 1987).

Reports on LH-b variants in animals are very limited.However, few LH-b variants were reported in humans. Inone study, seven point mutations were identified in theLH-b-subunit gene by PCR-mediated SSCP, and furthersequencing. One mutation was found to be non-synony-mous, while six remaining mutations were silent (Ramanu-jam et al., 1998). The allelic variant Trp8Arg/Ile15Thr ofthe LH-b subunit was claimed to be a common polymor-phism in several populations including Brazilians (Bergeret al., 2005). In the Japanese population, Takahashi et al.(2003) reported an association between variants of luteiniz-ing hormone and ovulatory disorders including infertility.The 1036C-A transition allele was most frequent (0.945)in patients with polycystic ovary syndrome, endometriosis,premature ovarian failure, and luteal insufficiency. Threeother novel alleles (894C-T, 1098C-T, and 1423C-T) werealso found in women with ovulatory disorders. Takahashiet al. (2003) concluded that the silent polymorphisms couldinfluence the LH-b variant association with ovulatory dis-orders in the Japanese population.

The cDNA encoding the b-subunit of the luteinizinghormone (LH) was amplified and sequenced from the pitu-itary gland of the Indian river buffalo (Bubalus bubalis) andthe LH-b cDNA encodes a 141-amino acid protein with a

M.S. Basavarajappa et al. / General and Comparative Endocrinology 155 (2008) 63–69 69

signal peptide 20 amino acids long and a mature protein121 amino acids long. Like other mammalian species all12 cysteine residues are conserved in the buffalo LH-b gene.However, in this study, a total of seven variants in the LH-b gene were encountered, indicating a possible impact onobserved reproductive patterns not hitherto explained.

Acknowledgment

This study was supported by a research grant from TheDepartment of Biotechnology, Govt. of India.

References

Bassam, B.J., Caetano-Anolles, G., Gresshoff, P.M., 1991. Fast andsensitive silver staining of DNA in polyacrylamide gels. Anal.Biochem. 196, 80–83.

Berger, K., Billerbeck, A.E.C., Costa, E.M.F., Carvalho, L.S., Arnhold,I.J.P., Mendonca, B.B., 2005. Frequency of the allelic variant(Trp8Arg/Ile15Thr) of the luteinizing hormone gene in a Braziliancohort of healthy subjects and in patients with hypogonadotropichypogonadism. Clinics 60, 461–464.

Chien, J.T., Shen, S.T., Lin, Y.S., Yu, J.Y., 2005. Molecular cloning of thecDNA encoding follicle-stimulating hormone beta subunit of theChinese soft-shell turtle Pelodiscus sinensis, and its gene expression.Gen. Comp. Endocrinol. 141, 190–200.

Clark, R., Furlan, M.A., Chedrese, P.J., 2005. Cloning and expression ofthe Elk FSH and LH genes. J. Reprod. Dev. 51, 385–392.

FAOSTAT, 2005. FAOSTAT Agriculture Data. Food and AgricultureOrganization Statistics, Rome, Italy. Available from: <http://fao-stat.fao.org/default.aspx>.

Gharib, S.D., Wierman, M.E., Shupnik, M.A., Chin, W.W., 1990. Molec-ular biology of the pituitary gonadotropins. Endocr. Rev. 11, 177–199.

Higgins, D.G., Sharp, P.M., 1990. Fast and sensitive multiple sequencealignments on a microcomputer. Comput. Appl. Biosci. 5, 151–153.

Koura, M., Handa, H., Noguchi, Y., Takano, K., Yamamoto, Y.,Matsuda, J., Suzuki, O., 2004. Sequence analysis of cDNA encodingfollicle-stimulating hormone and luteinizing hormone beta-subunits inthe Mongolian gerbil (Meriones unguiculatus). Gen. Comp. Endocri-nol. 136, 406–410.

Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: integrated software formolecular evolutionary genetics analysis and sequence alignment. BriefBioinform. 5, 150–163.

Li, M.D., Ford, J.J., 1998. A comprehensive evolutionary analysis basedon nucleotide and amino acid sequences of the alpha and beta subunitsof glycoprotein hormone gene family. J. Endocrinol. 156, 529–542.

Liao, W.X., Roy, A.C., Chan, C., Arulkumaran, S., Ratnam, S.S., 1998. Anew molecular variant of luteinizing hormone associated with femaleinfertility. Fertil. Steril. 69, 102–106.

Manik, R.S., Palta, P., Singla, S.K., Sharma, V., 2002. Folliculogenesis inbuffalo (Bubalus bubalis): a review. Reprod. Fertil. Dev. 14, 315–325.

Moyle, W.R., Campbell, R.K., Myers, R.V., Bernard, M.P., Han, Y.,Wang, X., 1994. Co-evolution of ligand–receptor pairs. Nature 368,251–255.

Nakav, S., Jablonka-Shariff, A., Kaner, S., Chadna-Mohanty, P., Grot-jan, H.E., Ben-Menahem, D., 2005. The LHb gene of several mammalsembeds a carboxyl-terminal peptide-like sequence revealing a criticalrole for mucin oligosaccharides in the evolution of lutropin tochorionic gonadotropin in the animal phyla. J. Biol. Chem. 280,16676–16684.

Nicholas, K.B., Nicholas Jr., H.B., Deerfield, D.W., 1997. GeneDoc:analysis and visualization of genetic variation. EMBNEW News 4, 14.

Pettersson, K., Ding, Y.-Q., Huhtaniemi, I., 1992. An immunologicallyanomalous luteinizing hormone variant in a healthy woman. J. Clin.Endocrinol. Metab. 74, 164–171.

Pettersson, K., Makela, M.M., Dahlen, P., Lamminen, T., Huoponen, K.,Huhtaniemi, I., 1994. Genetic polymorphism found in the LHb gene ofan immunologically anomalous variant of human luteinizing hormone.Eur. J. Endocrinol. 130, 65.

Pierce, J., Parsons, T., 1981. Glycoprotein hormones: structure andfunction. Annu. Rev. Biochem. 50, 465–495.

Ramanujam, L.N., Liao, W.X., Roy, A.C., Ng, S.C., Ratnam, S.S., 1998.Molecular variants of luteinizing hormone in three populations ofSoutheast Asia. Hum. Hered. 48, 232–234.

Ramanujam, L.N., Liao, W.X., Roy, A.C., Loganath, A., Goh, H.H., Ng,S.C., 1999. Association of molecular variants of luteinizing hormonewith menstrual disorders. Clin. Endocrinol. 51, 243–246.

Ramanujam, L.N., Liao, W.X., Roy, A.C., Ng, S.C., 2000. Association ofmolecular variants of luteinizing hormone with male infertility. Hum.Reprod. 15, 925–928.

Roy, A.C., Liao, W.X., Chen, Y., Arulkumaran, S., Ratnam, S.S., 1996.Identification of seven novel mutations in LHb-subunit gene by SSCP.Mol. Cell. Biochem. 165, 151–153.

Sambrook, J., Russell, D.W., 2001. In: Molecular Cloning: A LaboratoryManual, Third Ed. Cold Spring Harbor Press, Cold Spring Harbor,New York, pp. 6.4–6.11.

Takahashi, K., Karino, K., Kanasaki, H., Kurioka, H., Ozaki, T.,Yonehara, T., Miyazaki, K., 2003. Influence of missense mutation andsilent mutation of LH-b-subunit gene in Japanese patients withovulatory disorders. Eur. J. Hum. Genet. 11, 402–408.

Valdes-Socin, H., Salvi, R., Daly, A.F., Gaillard, R.C., Quatresooz, P.,Tebeu, P.M., Pralong, F.P., Beckers, A., 2004. Hypogonadism in apatient with a mutation in the luteinizing hormone beta-subunit gene.N. Engl. J. Med. 351, 2619–2625.

Wallis, M., 2001. Episodic evolution of protein hormones in mammals. J.Mol. Evol. 53, 10–18.

Weiss, J., Axelrod, L., Whitcomb, R.W., Crowley, W.F., Jameson, J.L.,1992. Hypogonadism caused by a single amino acid substitution in thebeta subunit of luteinizing hormone. N. Engl. J. Med. 326, 179–183.

Yu, J.Y.L., Wang, L.M., 1987. Comparative effects of diverse vertebrategonadotropins on androgen formation in vitro from testes of roosterand mice. Biol. Reprod. 36, 816–824.

Yu, J.Y.L., Shen, S.T., Liu, C.T., Weng, C.F., Peng, H.K., Liu, F.K.,1995. Comparative effects of avian and picine gonadotropins ongonadal steroidogenesis, and of avian and picine pituitaries oninduction of spermiation and ovulation in the loach and white silvercarp. Aquaculture 135, 59–72.

Yu, J.Y.L., Shen, S.T., Yang, W.H., Papkoff, H., Ishii, S., 1996.Comparative effects of diverse vertebrate gonadotropins on estradiol-17 beta formation in vitro in an immature rat Sertoli cell bioassay.Gen. Comp. Endocrinol. 104, 253–261.