Gene 527 (2013) 606–615

Contents lists available at SciVerse ScienceDirect

Gene

j ourna l homepage: www.e lsev ie r .com/ locate /gene

Novel polymorphisms in UTR and coding region of inducible heat shockprotein 70.1 gene in tropically adapted Indian zebu cattle (Bos indicus)and riverine buffalo (Bubalus bubalis)

M. Sodhi ⁎, M. Mukesh, A. Kishore, B.P. Mishra 1, R.S. Kataria, B.K. JoshiNational Bureau of Animal Genetic resources, Karnal 132001, India

Abbreviations: °C, Degree celsius; μl, Microliters; A, AAspartic acid; ATP, Adenosine triphosphate; ATP1A1, ATBase pair; C, Cytosine; cDNA, Complementary deoxyriboribonucleotide triphosphate; DTT, Dithiothreitol; E, Gluttwenty-six (ETS)-like transcription factor 1; F, Forwardcontent; GIC, Gir cattle; Glu, Glutamic acid; Gly, GlycineHSP, Heat shock protein; HSP70.1, Heat shock proteinKYC, Kangayam cattle; L, Liter; LINEs, Long interspersedevolutionary genetic analysis; Met, Methionine; MGC,ribonucleic acid; MS, Microsatellite; Mw, Molecular weicattle; NJ, Neighbor-joining; N-terminal, Amino-terminudatabase, Protein families database; Phrap, Phragment aRFX, Regulatory factor X; RNA, Ribonucleic acid; RNAseSeconds; SINEs, Short interspersed nucleotide repetitivThermus aquaticus; TESS, Transcription element searchcattle; Thr, Threonine; TRANSFAC, Transcription factor dhomolog; μM, Micromolar.⁎ Corresponding author at: National Bureau of Anima

E-mail address: monikasodhi@yahoo.com (M. Sodhi1 Present Address: Indian Veterinary Research Institu

0378-1119/$ – see front matter © 2013 Elsevier B.V. Alhttp://dx.doi.org/10.1016/j.gene.2013.05.078

a b s t r a c t

a r t i c l e i n f o

Article history:Accepted 29 May 2013Available online 19 June 2013

Keywords:BuffaloNative cattleHeat shock proteinPolymorphismMolecular characterization

Due to evolutionary divergence, cattle (taurine, and indicine) and buffalo are speculated to have differentresponses to heat stress condition. Variation in candidate genes associated with a heat-shock response mayprovide an insight into the dissimilarity and suggest targets for intervention. The present work was under-taken to characterize one of the inducible heat shock protein genes promoter and coding regions in diversebreeds of Indian zebu cattle and buffaloes. The genomic DNA from a panel of 117 unrelated animalsrepresenting 14 diversified native cattle breeds and 6 buffalo breeds were utilized to determine the completesequence and gene diversity of HSP70.1 gene. The coding region of HSP70.1 gene in Indian zebu cattle,Bos taurus and buffalo was similar in length (1926 bp) encoding a HSP70 protein of 641 amino acids witha calculated molecular weight (Mw) of 70.26 kDa. However buffalo had a longer 5′ and 3′ untranslatedregion (UTR) of 204 and 293 nucleotides respectively, in comparison to Indian zebu cattle and Bos tauruswherein length of 5′ and 3′-UTR was 172 and 286 nucleotides, respectively. The increased length of buffaloHSP70.1 gene compared to indicine and taurine gene was due to two insertions each in 5′ and 3′-UTR. Com-parative sequence analysis of cattle (taurine and indicine) and buffalo HSP70.1 gene revealed a total of 54gene variations (50 SNPs and 4 INDELs) among the three species in the HSP70.1 gene. The minor allelefrequencies of these nucleotide variations varied from 0.03 to 0.5 with an average of 0.26. Among the 14B. indicus cattle breeds studied, a total of 19 polymorphic sites were identified: 4 in the 5′-UTR and 15 inthe coding region (of these 2 were non-synonymous). Analysis among buffalo breeds revealed 15 SNPsthroughout the gene: 6 at the 5′ flanking region and 9 in the coding region. In bubaline 5′-UTR, 2 additionalputative transcription factor binding sites (Elk-1 and C-Re1) were identified, other than three common sites(CP2, HSE and Pax-4) observed across all the analyzed animals. No polymorphism was found within the3′-UTR of Indian cattle or buffalo as it was found to be monomorphic. The promoter sequences generatedin 117 individuals showed a rich array of sequence elements known to be involved in transcription regula-tion. A total of 11 nucleotide changes were observed in the promoter sequence across the analyzed species,3 of these changes were located within the potential transcription factor binding domains. We also identified

denine; AA, Amino acid; ADP, Adenosine diphosphate; Ala, Alanine; AMC, Amritmahal cattle; AP-2, Activator protein-2; Asp,Pase Na+/K+ transporting alpha 1 polypeptide; B. bubalis, Bubalus bubalis; B. indicus, Bos indicus; B. taurus, Bos taurus; bp,nucleic acid; CDS, Coding sequence; D, Aspartic acid; DNA, Deoxyribonucleic acid; DNase, Deoxyribonuclease; dNTP, Deoxy-amic acid; EDTA, Ethylene diamine tetra acetic acid; EEVD, Glutamic acids, glutamic acids, valine and aspartic acids; Elk-1, E; Fin, Forward internal; G, Guanine; GAC, Gaolao cattle; Gap4, Genome Assembly Program; GC content, Guanine–cytosine; GTP, Guanosine-5′-triphosphate; H, Histidine; HAC, Hariana cattle; HSE, heat shock element; HSF2, Heat shock factor 2;70.1; HSP70.2, Heat shock protein 70.2; INDEL, Insertion or the deletion; K, Lysine; kDa, Kilo Dalton; KJC, Kankrej cattle;nucleotide repetitive elements; M, Molar; MATCH, matrix search for transcription factor binding sites; MEGA, MolecularMalnad Gidda cattle; MgCl2, Magnesium chloride; min, Minutes; mM, Milimolar; mmol, Millimoles; mRNA, Messengerght; NCBI, National center for biotechnology information; NF-Y, Nuclear transcription factor Y; ng, Nanogram; NIC, Nimaris/terminal; ONC, Ongole cattle; ORF, Open reading frame; Pax-4, Paired box gene 4; PCR, polymerase chain reaction; Pfamssembly program; Pmol, Picomol; PrF, Promoter forward; PrR, Promoter reverse; R, Arginine; R, Reverse; RAC, Rathi cattle;, Ribonuclease; RSC, Red Sindhi cattle; RT, Reverse transcriptase; SAC, Sahiwal cattle; SBD, Substrate binding domain; sec,e elements; SMART, Simple modular architecture research tool; SNP, Single-nucleotide polymorphism; T, Thymine; Taq,system; TFBS, Transcription factor binding sites; TFSearch, Searching transcription factor binding sites; THC, Tharparkaratabase; U, Unit; UMC, Umblachery cattle; UTR, Untranslated region; v-Maf, Musculoaponeurotic fibrosarcoma oncogene

l Genetic Resources, PO Box 129, Karnal, 132001, Haryana, India. Tel.: +91 184 2267918; fax: +91 184 2267654.).te, Izatnagar, Uttar Pradesh, India.

l rights reserved.

607M. Sodhi et al. / Gene 527 (2013) 606–615

4 microsatellite markers within the buffalo HSP70.1 gene and 3 microsatellites within bovine HSP70.1. Thepresent study identified several distinct changes across indicine, taurine and bubaline HSP70.1 genes thatcould further be evaluated as molecular markers for thermotolerance.

© 2013 Elsevier B.V. All rights reserved.

1. Introduction

Environmental heat stress negatively impacts a variety of dairyparameters including fertility, milk production, feed intake, growth,conception rates and animal health (Sharma et al., 1988; West,2003). Concerns about the impact of environmental heat stress in-creased in recent years with the realization of global warming's influ-ence on the environment and animal production (West, 2003). Thepractice of breeding cows to increased milk yield has made themmore susceptible to the effects of high heat load (AI-Katanani et al.,1999). Currently, it is not completely understood why and how stresshas such adverse effects on dairy cows. The identification and exploi-tation of heat tolerant germplasm/gene pool might be effective strat-egies to mitigate the negative impact of heat stress (Gaughan et al.,2010). Further, understanding DNA variation within a genome couldbe fundamental to the identification and interpretation of geneticcomponents underlying complex adaptive traits (Hayes et al., 2009).As themotolerance is a quantitative trait, mutations in the gene affectthe differential thermotolerance behavior.

In this regard, Bos indicus cattle, predominantly found in tropical re-gions are considered to be more thermotolerant (Hansen, 2004) thanB. taurus breeds. These thermotolerant animals could be used to studythe variation in genes conferring the trait of thermotolerance. B. taurusand B. indicus cattle have undergone separate evolution from a commonancestor (Bradley et al., 1996) and during the course of evolution zebucattle acquired a set of certain genes due to which they are better ableto regulate body temperature in response to heat load (Gaughan et al.,1999). Consequentially, the effect of heat load on production and repro-duction traits are less for tropically adapted B. indicus than for temper-ate zone B. taurus breeds (Johnson, 1965). Some other changes likedecreased general activity, increased respiratory and heart rates,panting, increased peripheral blood flow and sweating which havealso been commonly observed in taurine cattle in response to heatload are seen to a lesser extent in indicine cattle. Buffalo are a majorcomponent of the Indian dairy industry. They have different skin char-acteristics and fewer sweat glands than cattle and are therefore highlysusceptible to high heat loadwhich affects productive and reproductiveperformances (Basu, 1985).

Living organisms respond to physiological and physical stressorsat the cellular level with a transient but rapid and strong increase inthe biosynthesis of various stress proteins like HSPs (heat schock pro-teins). HSP70, a member of the HSP family plays a critical role in cellsurvival and acquisition of thermotolerance (Parsell and Linquist,1993) by aiding in the rapid recovery of heat induced denatured pro-teins to their native state (Aufricht, 2005; Maloyan et al., 1999). TheHSP70 gene family in bovines includes HSP70.1, HSP70.2, HSP70.3,and HSP70.4 genes. HSP70.1 is the key component of HSP70 familybeing expressed under normal conditions and also substantivelystimulated after different stressful conditions (Christians et al., 1997).

Activity of the HSP70.1 protein is ATP dependent and under stressconditions,misfolding and aggregation of proteins is prevented throughits ATP-regulated association of the protein with short hydrophobicsegments in substrate polypeptides (Flynn et al., 1991; Rüdiger et al.,1997). The ATPase domain is ~400AA long (1−384AA) and is at theNH2-terminus. The other domains are a substrate binding domain(SBD: ~180AA) and a Carboxyl-terminal domain of variable length.Among the domains, the N-terminal ATPase domain binds and hydro-lyzes ATP to ADP which drives conformational changes in the othertwo domains. Interaction of peptides to the binding domain stimulatesthe ATPase activity of HSP70.1 (Lopez-Buesa et al., 1998). Sequence

variations in either of the domains are important as thesemight changethe interaction of HSP70.1 protein and hence the responses of animal toheat stress (Davis et al., 1999; Hardcastle et al., 2007).

Recently, few reports have identified SNPs within heat shock pro-tein 70.1 (HSP70.1) gene contributing to certain disease susceptibilityand stress tolerance in B. taurus (Jian-bo et al., 2009). 253 bp sequencesof the HSP70.1 3′-UTR were analyzed and novel nucleotide substitu-tions at two positions were identified (Adamowicz et al., 2005; Groszet al., 1994). Similarly, a novel SNP in the ATP1A1 gene has also been as-sociated with heat tolerance traits in dairy cows (Liu et al., 2011). Li etal. (2010) identified five novel SNPs (1 in CDS and 4 in 3′-UTR) and 11different genotypes in HSP70.1 gene of Chinese Holstein cattle. Amongthese, 3 genotypes AB, DD and FF showed higher potassium content inerythrocytes, higher milk fat and protein percentage and higher milkyield respectively and thus the authors suggested the probable associ-ations of these genotypes with thermotolerance. In addition, associa-tions between HSP70 gene polymorphisms and thermotolerance havealso been well studied in pigs, chicken and humans. Zhang et al.(2002) detected polymorphisms of the regulatory and coding regionsof the HSP70 gene associated with different heat tolerance capabilitiesin broiler chickens. Huang et al. (2002) detected SNPs in the 5′ flankingregion of theHSP70.2 gene in boars and these SNPswere found to be as-sociated with the semen quality traits including sperm motility, per-centage of normal and abnormal sperms, sperm concentration andsemen volume. In pigs, a functional promoter and 3′-UTR variants ofhighly conserved inducible HSP70.2 gene significantly affected mRNAstability and cell response to stress (Schwerin et al. 2001, 2002).Singh et al. (2006) observed associations of polymorphisms in the cod-ing region of HSP70 gene with human longevity and survival advan-tage, and increased ability to respond to thermal stress. However, nosystematic initiative has been attempted to unravel the genetic com-ponents associated with thermotolerant ability of Indian cattle andbuffalo.

Postulating thatHSP70.1might be one of the candidate genes for dif-ferential heat stress response in cattle and buffalo, the present studywas undertaken to unravel gene structure and existing variations inHSP70.1 in a large set of tropically adapted animals representing diver-sified Indian cattle and buffalo breeds.

2. Materials and methods

2.1. Selection of animals

To generate a holistic depiction ofHSP70.1 genediversity in buffaloesand Indian zebu cattle, blood samples were collected from geneticallyunrelated animals by visiting different villages/talukas of respectivebreeding tract (natural habitat of the breed) (Fig. 1). Care was takento collect the unrelated samples up to three generations. Fresh bloodsamples (8–9 ml) were collected in EDTA vacutainer tubes by jugularvein puncture. The samples were transported to the laboratory in iceand were subsequently stored at −20 °C till DNA extraction. The sam-ples included four riverine buffalo (B. bubalis) breeds (Murrah, Banni,Mehsana and Toda) and swamp buffalo (Bubalus carabanesis). Amongthe riverine, Murrah, Mehsana and, Banni are dairy breeds whereasToda is semiwild. Assamesse swamp is a dual-purpose breed rearedformilk aswell as draft purpose. For B. indicus cattle, 14 analyzed breedsincluded Amritmahal (AMC), Kangayam (KYC), Malnad Gidda (MGC),Ongole (ONC) and Umblachery (UMC), Gaolao (GAC), Nimari (NIC),Gir (GIC), Hariana (HAC), Kankrej (KJC), Rathi (RAC), Sahiwal (SAC),Tharparkar (THC) and Red Sindhi (RSC). As the animals of RSC are not

Fig. 1. Geographical distribution across India of buffalo breeds (A−E) and cattle breeds (1–14) used in this study. Three letter abbreviations and number of individuals are found inparentheses.

Table 1Details of the breeds (Buffalo and cattle) undertaken in the present study.

Breed N Agroclimatic region Utility Color

BuffaloMurrah 8 Semiarid Milch BlackMehsana 8 Semiarid Milch BlackBanni 9 Semiarid Milch BlackToda 5 Tropical wet and dry Semi wild BlackAssamese swamp 8 Undifferentiated highlands Dual Black

CattleAmritmahal (AMC) 6 Tropical wet and dry Draft Gray/WhiteGaolao (GAC) 7 Humid subtropical Dual Gray/WhiteGir (GIC) 8 Semiarid Milch RedHariana (HAC) 7 Semiarid Dual Gray/WhiteKangayam (KYC) 5 Semiarid Draft Gray/WhiteKankrej (KJC) 5 Semiarid Dual Gray/WhiteMalnad Gidda (MGC) 5 Humid subtropical Draft Red/BrownNimari (NMC) 6 Tropical wet and dry Draft RedOngole (ONC) 7 Tropical wet and dry Dual Gray/WhiteRathi (RAC) 7 Arid Milch Red/BrownRed Sindhi (RSC) 7 Arid Milch RedSahiwal (SAC) 6 Semiarid Milch RedTharparkar (THC) 4 Arid Milch Gray/WhiteUmblacherry (UMC) 5 Tropical wet and dry Draft Gray/White

N: Number of individual.

608 M. Sodhi et al. / Gene 527 (2013) 606–615

available with the farmers in the field, the blood samples of this breedwere collected by visiting cattle breeding farms located in the southernand central regions of India. In terms of their utility, 5 breeds (GIC, RAC,SAC, THC and RSC) are popular dairy breeds, whereas 4 breeds (GAC,HAC, KJC and ONC) are known as dual-purpose breeds. The remaining5 breeds (AMC, KYC,MGC, NIC and UMC) have been developed as puredraft breeds primarily utilized for agricultural operations (Table 1).The various details for the breeds related to agroclimatic region, coatcolor and utility are provided in Table 1. Genomic DNA was isolatedby enzymatic digestion using proteinase K (Sigma Chemical Co.St. Louis, USA) followed by standard phenol−chloroform extractionmethod (Sambrook et al., 1989).

2.2. Bubaline RNA isolation, cDNA synthesis and full-length cDNA cloning

Mammary gland tissue samples from adult riverine buffaloes werecollected from an abattoir. The tissue samples were immediately snapfrozen and transferred to a laboratory in liquid nitrogen. Subsequent-ly the tissue samples were kept at −80 °C until RNA extraction. TotalRNA was isolated from 50 to 100 mg of bubaline mammary tissue,using TRIzol® method (Invitrogen, USA) as per recommended proto-col. To remove the traces of genomic DNA, RNeasy Mini Kit columns(Qiagen, Germany) along with on column digestion by RNAse freeDNase enzyme (Qiagen, Germany) were used. Total RNA concentra-tion and purity were measured using a NanoDrop ND-1000 spectro-photometer (NanoDrop Technologies). The extracted RNA sampleswere stored at −80 °C and utilized within one month. cDNA wassynthesized using 100 ng RNA, 1 μl dT12–18 (Invitrogen Corp. CA), 1 μl10 mmol/L dNTP mix (Invitrogen Corp., CA), 1 μl random primers(Invitrogen Corp., CA), and 10 μl DNase/RNase free water. The mixture

was incubated at 65 °C for 5 min and kept on ice for 3 min. A total of6 μl of master mix composed of 4.5 μl 5× First-Strand Buffer, 1 μl0.1 M DTT, 0.25 μl (50 U) of SuperScript™ III RT (Invitrogen Corp.,CA), and 0.25 μl of RNase Inhibitor (10 U, Promega, WI) was added.The reaction was performed in an Eppendorf Gradient cycler using theprogram: 25 °C for 5 min, 50 °C for 60 min and 70 °C for 15 min.

609M. Sodhi et al. / Gene 527 (2013) 606–615

Suitable primers (HSP70.1 1F and HSP70.1 1R) were designedusing B. taurus reference sequence (Accession number AY149618)to amplify 2561 bp of HSP70.1 gene in buffalo including 5′- and3′-untranslated regions (5′- and 3′-UTRs) as well as the coding re-gion. The PCR fragments were cloned into pCR2.1-TOPO (Invitrogen,Carlsbad, CA) and sequenced. Analysis of cDNA sequences and pre-dicted protein sequences were carried out using Biology Workbench(http://workbench.sdsc.edu/).

2.3. SNP genotyping in buffalo and cattle breeds

2.3.1. PCR amplification and SNP identificationSNPs in the bovine (indicine) and bubaline HSP70 gene were

detected by a direct sequencing approach throughout the HSP70.1coding regions as well as the 5′ and 3′ flanking regions with DNAsfrom unrelated individuals. Primers HSP70.1 1F and HSP70.1 1Rwere used to amplify complete HSP70.1 gene. For sequencing, 3 inter-nal primers (P2Fin, P3Fin and P4Fin) were used and primers PrF andPrR were used to amplify the predicted promoter region (Table 2).Amplifications were performed in 25 μl reactions containing 150−200 ng of genomic DNA, 5 pmol of each primer, 200 μM dNTPs,1.5 mM MgCl2, and 1 U of Taq DNA polymerase (Invitrogen, Brazil).The thermal cycle profile was 95 °C for 2 min, followed by 30 cyclesat 95 °C for 60 s, 59 °C for 60 s and 72 °C for 2.30 min with a final ex-tension at 72 °C for 10 min. The PCR products were purified and se-quenced using the three forward primers and ABI Prism® Big Dye™Terminator Cycle Sequencing kit (Applied Biosystem, Foster City,CA). Contigs produced by the overlapping primers were joined inconsensus with B. taurus reference sequence to generate the completesequence of the HSP70.1 gene. Sequence comparison for SNP identifi-cation across species was done by Phrap and Gap4 integration (http://staden.sourceforge.net/phrap.html) and further confirmed by manualinspection. The molecular weight and isoelectric point of the predictedamino acid sequences were calculated using Protparam tool (http://ca.expasy.org). The repeat elements were detected using repeatmaskersoftware (http://repeatmasker.org/cgi-bin/ WEBRepeatMasker). Mi-crosatellite repeats were identified using Gramene software (http://www.gramene.org/db/markers/ssrtool). The promoter region was pre-dicted using Proscan software (http://www-bimas.cit.nih.gov/molbio/proscan/) and TSSG software (http://www.softberry.ru/berry.phtml).The transcriptional binding sites were identified using TESS (http://www.cbil.upenn.edu/cgi-bin/tess/tess), MATCH (Kel et al., 2003),TRANSFAC (Matys et al., 1993) and TFSearch engine (http://www.cbrc.jp/research/db/ TFSEARCH.html). SMART (http://smart.embl-heidelberg.de/), Scanprosite (http://expasy.org/tools/ scanprosite/)and Pfam (http://pfam.janelia.org/search.) programs were used to pre-dict the domain andmotifs of HSP70.1. Further, amino acid sequences ofthe HSP70 gene family for the different species were retrieved from thepublic database (NCBI) for identification of signature patterns usingPROSITE and Wolf Psort online tools.

Table 2Primers used for amplification and sequencing of HSP70.1 promoter and gene in buffaloand B. indicus.

Primer Sequence (5′–3′) Amplicon size (bp)

(a) Promoter regionHSP PrF GTTAGCCTCCGATCACTCTC 560 bpHSP PrR GAAGCTGCTCTCACGGACTA

(b) UTRs and coding regionHSP70.1 1F ACTGAACTCGGTCATTGGCT 2561 bpHSP70.1 P2Fin ACCAAGATGAAGGAGATCGCHSP70.1 P3Fin CTACAC GTCCATCACCAGGGHSP70.1 P4Fin AGGTGACCTTCGACATCGACHSP70.1 1R AGAGGCCAATTGCAGTTCAT

Molecular Evolutionary Genetic Analysis (MEGA) Software Version4.0 (Tamura et al., 2011) was used for the phylogenetic sequence anal-yses employing the neighbor-joining (NJ) method. This method doesnot require the assumption of a constant rate of evolution. Distanceswere estimated by the p-distance model (Kimura and Crow, 1964)and the standard errors of the estimates were obtained through 1000bootstrap replicates.

3. Results and discussion

3.1. Characterization of HSP70.1 gene

Sequence data of ~3.6 kb with respect to complete HSP70.1 geneincluding 5′ flanking region was generated in riverine, swamp buffaloand Indian zebu cattle. The complete ORF of the HSP70.1 gene in buf-falo and cattle was found to be 1926 bp long. Similar to bovines, thecDNA sequence in buffalo revealed HSP70.1 to be intron less. Thesequences of the HSP70.1 gene in the two species were submitted toNCBI-GenBank and are available at accession numbers GU183098.1,GU183099.1 (Buffalo) and GU183094.1, GU183095.1, GU183096.1,and GU183097.1 (Indian zebu cattle). Sequence comparison indicateda highly conserved structural organization of HSP70.1 (intron less)gene among the analyzed species (B. indicus, B. taurus and B. bubalis).Similar structural conservation has also been observed by Pelham(1982). No LINEs and SINEs were observed across the bubaline andindicine HSP70.1 gene.

3.2. SNP identification within buffalo breeds

Diversity analysis across riverine (Murrah, Mehsana, Banni andToda) and swamp type (Assamesse swamp) buffalo revealed a totalof 9 SNPs in the coding region (Fig. 2A). Among bubalines, only 1 nu-cleotide change (T14C) was observed in the coding region of swamptypes. Across the 42 buffaloes, the minor allele showed maximumfrequency (0.219) at the transition G1662A whereas, the least fre-quent (0.031) minor allele was observed at A-71T, T-65C, T-64G andG-53A. Overall, the highest degree of variation was found withinAssamese swamp breed (0.467), whereas the lowest frequency(0.067) was observed in Toda (data not shown).

3.3. SNP identification within indigenous cattle (Bos indicus) breeds

Across the 14 cattle breeds (85 animals), a total of 16 polymorphicsites were identified in the coding region (Fig. 2B; Table 3). Out of the16 SNPs in the coding region 13 were synonymous whereas 3 werenon-synonymous mutations (C1770G and G1877C; Fig. 2B; Table 3).Across the 85 individuals, nucleotide substitution at G1632A wasthe most frequent (0.471) minor allele followed by G573C andG942A (0.424). Variation A963G with a frequency of 0.039 was theleast frequent minor allele among all the analyzed cattle. Breed wisedistribution of variations indicated GIC and RSC, with 13 SNPs to bemost polymorphic (0.867); whereas, UMC with 6 SNPs showed thelowest degree of diversity (0.400) (data not shown).

3.4. SNP identification across bubaline and bovine HSP70.1

To assess the differences in the HSP70.1 gene across the differentspecies [bovine (indicine and taurine) and bubaline], the sequencedata generated (85 Indian zebu cattle and 32 buffalo) were comparedto the B. taurus reference genome. A total of 30, 18, and 17 SNPs wereobserved in bubaline vs indicine (Fig. 4), bubaline vs taurine andindicine vs taurine HSP70.1 CDS (Table 3). At the protein level, buffaloHSP70.1 showed 2 amino acid changes in comparison to taurine and 1change with respect to indicine cattle while 3 amino acid changeswere observed between indicine and taurine HSP70.1 (Table 3). Fur-ther, 4 microsatellite (MS)markers were identified within the bubaline

Fig. 2. A. Schematic representation of the variations within HSP70-1 gene of Indian buffalo breeds. The first allele listed is the more frequent. Nucleotide position is based on se-quence alignment with the Bos taurus reference sequence (AY149618). The coding sequence (1926 bp) is represented in green. (The 5′-UTR region in the buffalo is 32 bp longerthan that found in the cattle, due to two insertions within the buffalo sequence). B. Schematic representation of the variations within HSP70-1 gene of Indian zebu cattle breeds. Thefirst allele listed is the more frequent. Nucleotide position is based on sequence alignment with the Bos taurus reference sequence. The coding sequence (1926 bp) is represented ingreen.

610 M. Sodhi et al. / Gene 527 (2013) 606–615

HSP70.1 gene, whereas 3 identical MS markers were found in indicineand taurine HSP70.1 because of 1 variation in microsatellite repeats(Table 4), the variation at position 1177 in CDS of cattle (B. indicusand B. taurus) in comparison to buffalo sequence abolish the secondrepeat.

3.5. Characterization of the predicted amino acids sequence of buffaloHSP70.1 protein

To better understand the impact of the identified polymorphisms,we examined the putative animo acid sequence of the buffalo as pre-dicted by our RNA sequences. In silico translation of the predictedcoding DNA sequence of the HSP70.1 gene in buffalo and cattle re-vealed a sequence of 641 amino acids. The comparison of bubalineHSP70.1 amino acid sequence to different species revealed that itshared 98.7%, 99.7%, 99.8%, 96.8% and 95.9% amino acid identitywith human, cattle (taurine, indicine), rat and mouse HSP70.1 gene,respectively. Thus, HSP70.1 protein is more conserved than the DNAsequence in mammals. The charge of HSP70.1 protein was found tobe constant in buffalo and cattle with 91 positively charged aminoacids (K, H, and R) and 92 negatively charged amino acids (D, E). Ofthe 641 amino acids; 329 were polar whereas 312 were nonpolar;326 amino acids were hydrophobic while 315 were hydrophilic inbuffalo and cattle. Theoretical isoelectric point of HSP70.1 protein inboth buffalo and cattle was 5.611 and with a charge of −8.829 atpH 7.0 while estimated molecular weight of predicted HSP70.1 pro-teins was 70.26 kDa.

The last four amino acids comprising two residues of glutamicacids, one residue each of valine and aspartic acid form a motif‘EEVD’ (ATPase/SBD) essential for peptide binding that is requiredfor the prevention of apoptosis. EEVD and other domains, such as bi-partite nuclear targeting sequence and ATP/GTP-binding site motif A(P-loop) were found to be conserved in buffalo, cattle as well asacross other ruminants, porcines, murines and primates (data notshown).

An analysis of orthologous amino acid sequences of HSP70 genegenerated in the present study for Indian zebu cattle and buffalo re-vealed three distinct signature patterns: Heat shock HSP70 proteinfamily signature 1 (HSP70.1), Heat shock HSP70 protein family

signature 2 (HSP70.2) and Heat shock HSP70 protein family signature3 (HSP70.3). The HSP70.1 centered on a conserved pentapeptidefound in N-terminal section of the proteins and the other two patterns,HSP70.2 and HSP70.3, were positioned on conserved regions located inthe central part of the sequence. Detection of classical signaturepatterns in buffalo and cattle HSP70.1 gene was in accordance withthe highly conserved nature of the HSP70 gene family from bacteria toman (Bukau and Horwich, 1998; Yang et al., 2006). All the amino acidresidues having an important role in ATPase hydrolytic cycle and auxilinbinding were conserved in bubaline and bovine HSP70.1 protein. Therewere only 3 non-synonymous changes (Met5Thr, Asp590Glu andGly626Ala) when bubaline amino acid sequences were comparedwith that of indicine and taurine (Table 3).

3.6. Characterization and SNP analysis of UTRs of HSP70.1 gene

Untranslated regions (UTRs) are known to stabilize RNA and mayalso regulate the expression of the transcript. Variations within the5′-UTR and 3′-UTRs are known to affect the rate of transcriptionand the stability of the RNA, respectively. The bubaline HSP70.1gene sequences differed from taurine and indicine mainly in theUTR regions (5′- and 3′-UTR). Bubaline 5′- and 3′-UTR were 204and 293 nucleotides respectively (Fig. 2A), (accession numbersGU183098.1, GU183099.1) in comparison to taurine (Accession num-ber NM_174550) and indicine UTRs which are 172 and 286 nucleo-tides long for 5′ and 3′-UTR, respectively (Fig. 2B). The longer5′-UTR in buffalo as compared to cattle was due to 2 INDELS of 31and 1 nucleotide at positions −108 to −78 and −17, respectively(Table 3). Additionally, the 3′-UTR of buffalo had 2 INDELS of threenucleotides (TTC) from +2168 to +2170 and four nucleotides(CACT) at positions +2182 to +2185 (Table 3).

Diversity analysis within swamp and riverine (Murrah, Mehsana,Banni and Toda) buffalo detected 6 SNPs at the 5′ flanking region(Fig. 2A), however, no polymorphism was found within the 3′-UTRof buffalo HSP70.1 (Table 3). Within the diverse cattle breeds a totalof 4 polymorphic sites were identified in 5′-UTR and similar tobuffalo, 3′-UTR was monomorphic (Fig. 2B). This is in contrast tothe findings of Adamowicz et al. (2005), who reported polymorphicalleles at 3′-UTR of Holstein Polish population. When compared

Table 3Nucleotide and amino acid changes detected in HSP70.1 gene in Indian native cattle and buffalo in comparison to Bos taurus (AY149618). The first nucleotide indicates B. taurus(reference) allele and second as depicted in Indian zebu cattle and buffalo.*: Variation observed only in swamp buffalo. The values given in parenthesis indicate the frequencyof variation within swamp buffalo.

Bos taurus vs Indian native cattle Bos taurus vs buffalo

Nucleotide Amino acid Frequency Nucleotide Amino acid Frequency

Position Change Position Change Position Change Position Change

5′-UTR−168 G/C – – 0.047 −191 A/G – – 1.000−159 A/G – – 1.000 −125 G/A – – 1.000−133 C/T – – 0.459 −117 G/C –

−91 C/T – – 0.024 −108* A/C – – 0.063 (0.250)−32 T/G – – 0.165 −108 to −78 INDELs – – 1.000

−71* A/T – – 0.031 (0.125)−65* T/C – – 0.031 (0.125)−64* T/G – – 0.031 (0.125)−57 G/C – – 1.000−55 G/C – – 1.000−53* G/A – – 0.031 (0.125)−49 T/A – – 0.094−32 T/C – – 1.000−17 INDEL – – 1.000

CDS14 T/C 5 M/T 0.012 14* T/C 5 M/T 0.063 (0.25)24 C/T 8 G/G 1.000 237 A/C 79 G/G 1.000156 C/G 52 G/G 0.329 282 C/G 94 V/V 1.000249 G/A 83 V/V 0.059 324 A/G 108 K/K 1.000324 A/G 108 K/K 0.118 393 C/G 131 A/A 1.000453 C/T 151 N/N 0.059 603 A/C 201 G/G 1.000522 C/T 174 N/N 0.176 795 C/T 265 T/T 1.000573 G/C 191 G/G 0.424 798 A/G 266 A/A 1.000942 G/A 314 L/L 0.424 816 A/G 272 R/R 1.000963 A/G 321 L/L 0.035 930 C/T 310 F/F 0.0631074 C/T 358 D/D 0.071 960 G/T 320 A/A 1.0001569 A/G 523 E/E 0.118 1177 T/C 393 L/L 1.0001632 G/A 544 S/S 0.471 1581 G/A 527 A/A 1.0001746 C/T 582 D/D 0.071 1632 G/T 544 S/S 1.0001761 G/T 587 A/A 0.082 1662 G/A 554 E/E 0.2191770 C/G 590 D/E 0.059 1746 C/T 582 D/D 1.0001877 G/C 626 G/A 0.153 1866 T/C 622 F/F 1.000

1877 G/C 626 G/A 1.000

3′-UTR2002 T/G – – 1.000 2002 T/G – – 1.000

2035 T/A – – 1.0002058 A/G – – 1.0002127 G/A – – 1.0002168 to 2170 INDELs – – 1.0002182 to 2185 INDELs – – 1.000

611M. Sodhi et al. / Gene 527 (2013) 606–615

across species, a total of 17, 14, and 5 polymorphic sites were ob-served in bubaline vs indicine, bubaline vs taurine and indicine vs tau-rine HSP70.1 5′-UTR respectively (Fig. 3, Table 3). At 3′-UTR a total of5, 6 and 1 variations were found in bubaline vs indicine, bubaline vstaurine and indicine vs taurine HSP70.1 3′-UTR.

Table 4Microsatellites in CDS of HSP70.1 gene.

Species/breed Start End Unit Repeat

B. indicus 532 540 GCC 31699 1707 AAG 31804 1809 GT 3

B. taurus 532 540 GCC 31699 1707 AAG 31804 1809 GT 3

B. bubalis 532 540 GCC 31171 1182 CTG 41699 1707 AAG 31804 1809 GT 3

Nucleotide sequence analysis of the CDS region revealed three VNTRs: (GT)3, (GCC)3and (AAG)3 in native cattle and Bos taurus while in buffalo, (CTG)4 was observed inaddition to those detected in cattle.

A search for putative transcription factor binding sites (TFBS) withinthe 5′-UTR from TRANSFAC database revealed three potential TFBS(CP2, HSE and Pax-4) across buffalo and cattle (Fig. 4, Table 5). Of the3 TFBS, heat shock element (HSE) was conserved across bubaline andbovine 5′-UTR whereas variation G-125A was observed in CP2 (buffalovs B. taurus) and Pax-4 (C-32T buffalo vs cattle) (Fig. 4). Two additionalTFBS viz., Elk-1 and C-Re1 were also observed in bubaline 5′-UTR.Further studies need to be carried out to ascertain the special functionof these TFBS related to the heat response.

3.7. Characterization and SNP identification in the promoter of HSP70.1

Considering the fact that a SNP in gene regulatory regions, bothproximal promoters and distal regulatory elements, might havemore profound effects by causing changes in gene regulation, about1 kb region upstream of the HSP70.1 gene which includes the basalpromoter was sequenced in the present study. For the indicine andbubaline HSP70 gene, a predicted promoter region (419 bases) wasfound between −616 and −198 relative to the translational startsite. Both the promoters were compact and there was a rich array ofsequence elements known to be involved in transcription regulationwithin the first 200 bp of promoter sequences. Following a search

Fig. 3. Variations in HSP70.1 gene among Indian buffalo breeds in comparison to Indian cattle breeds (upper lane; first allele is for B. indicus) and with B. taurus (lower lane; firstallele is for B. taurus). Non-synonymous variations are bold and italicized. INDELs mark for site of insertion/s in buffalo. Inset: Polymorphism marked for 5′-UTR of HSP70.1 amongIndian Buffalo breeds in comparison to Indian cattle breeds (upper bar) and with Bos taurus (lower bar).

612 M. Sodhi et al. / Gene 527 (2013) 606–615

for possible transcription factor binding domains, a total of 13 differ-ent putative sites were identified (Table 5). Of these, 5 identified siteshad greater than 90% matrix similarity match (matrix similarityscore = 0.9). Out of 6 sites, 5 had 100% core similarity match (coresimilarity score = 1.0) (Table 5). The TATA box was found between−24 and −29 bp upstream to start codon while CCAAT box wasobserved between −59 and −68 bp for indicine and at −141 to−152 bp for bubaline HSP70.1 gene (Fig. 5).

A total of 11 nucleotide changes were observed in this regionamong cattle, river buffalo and swamp buffalo (Fig. 5). Of them, 3 var-iations were found to be located within the potential transcriptionfactor binding domains. Variation at −449 (G/A) was found to belocated in the RFX1 binding sites, while variations at −153 (C/T)and −145 (C/T) were found to be located within the CCAAT box andNF-Y binding sites. The deletion at−57 bpwas not in any of the poten-tial TFBS while the deletion of 3 nucleotides at−50 bp was found to belocated in the potential binding site for v-Maf transcription factor, a

Fig. 4. Comparative sequence of 5′-UTR of HSP70.1 gene in Indian zebu cattle, buffalo and Bare shown as dots and dashes, respectively.

known transcriptional activator. Other transcription factor bindingsites, such as HSF2, AP-2, HSE and TATA boxwere found to remain con-served. The sequence similarity between Indian zebu cattle and buffalowas 99.0% (8 variations with frequency of 1.0; 2 variations with a fre-quency of 0.4) whereas the sequence similarity between exotic cattleand buffalo was 97.6% (4 INDELS). There was 100% sequence homologybetween twowater buffalo sub-species while it was 96.7% between cat-tle and buffalo. CpG island of 539 bp with 57.5% GC content was alsodetected in the bubaline and bovine HSP70.1 gene. The CpG islandstarted 100 bp upstream of the translational start site. These islandsmay represent elements of epigenetic (methylation) control on thetranscription of HSP70.1. Themechanism by which the polymorphismsobserved in the present study are associated with higher abundance ofmRNAand synthesis of HSP70.1was not studied. Probably, the presenceof promoter variants improved binding of corresponding transcriptionfactors or activated the cellular protectivemechanism thatmay be asso-ciated with increases in cell viability.

os taurus. Sequenced variations are boxed and colored, identical sequences and INDELs

Table 5Putative transcription factors binding sites in the promoter and 5′ untranslated regionof HSP70.1 gene and their respective core match and matrix match scores.

Factor name Position Strand Corematch

Matrixmatch

Sequencea

Promoter regionRFX1 48 (+) 0.982 0.938 gagaaactcgGGAACttNF-Y 345 (−) 1.000 0.993 gcgctgATTGGttccaCCAAT box 349 (−) 1.000 0.978 tgATTGGttccaNF-Y 428 (−) 1.000 0.974 tcggtcATTGGctgacCCAAT box 432 (−) 1.000 0.982 tcATTGGctgacv-Maf 434 (+) 1.000 0.856 attgGCTGAcgagggaaaa

5′-Untranslated regionCP2 7 (−) 0.961 0.897 CTGGAgagagcElk-1 110 (−) 1.000 0.922 cgggTTCCGaaaagc-Rel 118 (−) 0.813 0.868 GAAAAgcccgPax-4 154 (+) 0.979 0.779 cgtttTCAGGtttgaagctca

a Nucleotides in capital letters are core sequences for TFBS.

613M. Sodhi et al. / Gene 527 (2013) 606–615

3.8. Phylogenetic analysis

Comparative sequence analysis for bubaline HSP70.1 coding re-gion revealed homology of 99.2%, 99.1%, 98.1%, 94.7%, 91.5%, 92.4%and 79.3% with indicine cattle, taurine cattle, goat, human, mouse,rat and pig, respectively, indicating the high similarity of geneamong the mammalian species. Phylogenetic analysis of bovine andbubaline HSP70.1 gene with different species following NJ algorithmrevealed murine, porcine and ruminants forming distinct clustereach (Fig. 6). Within the ruminants Indian zebu cattle grouped closeto B. taurus followed by buffalo and goat.

The present study is the first evidence of unique genetic variationin Indian zebu cattle and buffalo HSP70.1 gene that might be associat-ed with regulating gene expression or protein function in response tothermal stress. The 3′-UTR contains regulatory elements and controlspost-transcriptional gene regulation and stability of mRNA (Schwerinet al., 2002). Thus, the observed sequence variations in 3′-UTR of theHSP70.1 gene might be responsible for differential response of buffaloand cattle to heat stress. Additionally, INDELs observed in 5′-UTR ofHSP70.1 gene might have vital role in heat stress response as it regu-lates preferential expression of mRNA (Lindquist and Petersen, 1990).

Fig. 5. Promoter sequence of HSP 70.1 in Indian Buffalo in comparison to Bos indicus and Brepresented as under marked (Bos indicus/Bos taurus). †: variation within Indian buffalo; dB. tarurus (AY149618). Nucleotides are marked from transcriptional start site +1.

Also, the non-synonymous amino acid changes in the coding regionmight affect the function of HSP protein and influence thermotolerantability of the species during periods of high ambient temperature.

Dairy producers are well aware that stress on the cows must beminimized in order to maintain animal health and optimize milkyield and quality and hence reduce the overall economic losses(Wolfenson et al., 2000). Maintaining cow performance in hot condi-tions requires improved management and the need for genetic ad-vancement. Selection for animals with improved thermotoleranceability is now considered to be a desirable proposition. In order to ac-complish this goal, the present work is a step towards understandingand mining genetic variants across species that show differential ad-aptation to heat stress.

The unique thermotolerant ability of Indian zebu cattle in compari-son to B. taurus breeds has long been recognized. Zebu cattle can survivein arid agroclimatic region and are known for their adaptability to hightemperature and harsh climatic conditions. The differential response ofa species to heat stress (Maraia and Haeebb, 2010; Pegorer et al., 2007;Rocha et al., 1998) has been documented on the basis of anatomical dif-ferences and physiological parameters (Basu, 1985;Hansen, 2004). Sev-eral factors alluded to offer this unique character include higher densityand larger sweat glands and the ability to sweatmore freely through thepores of the skin (Hansen, 2004; Veerasamy et al., 2012). The short,thick, densely present glossy hair coat reflects much of the sun rays, en-hancing conductive and convective heat loss. An abundance of looseskin is thought to contribute to the ability to withstand warm weatherby increasing the body surface area to dissipate heat. All these traitsmake zebu cattlemore thermotolerant as compared to the B. taurus cat-tle (Cartwright, 1955; Johnson, 1965; Pegorer et al., 2007; Rocha et al.,1998; Seif et al., 1979; Skinner and Louw, 1966). Buffalo are naturalinhabitants of tropical regions and there is general agreement thatriverine buffalo (B. bubalis) are not sufficiently heat tolerant. Reportsindicate that productive and reproductive performances are reducedduring periods of high ambient temperature in buffaloes (Das et al.,1999; Maraia and Haeebb, 2010). The relative susceptibility of buffaloto heat stress is speculated to be due to dark colored skin and fewerhair follicles and sweat glands in comparison to cattle (Basu, 1985).However, the genetic components responsible for the thermotolerantability and physiological mechanisms of heat stress response are notfully established.

. taurus. Boxed nucleotides represent site of variations in comparison to cattle and areots represent site of deletion/s in Indian buffalo and cattle sequence in comparison to

Fig. 6. Evolutionary relationship of HSP70.1 gene across different species based on coding region nucleotide sequence data using a neighbor-joining algorithm as calculated by boot-strap value of 1000 replicates. Accession number of sequences from NCBI-Genbank is mentioned in parentheses. Species listed include C. hircus (goat), B. bubalis (buffalo), B. indicus(indicine cattle), B. taurus (taurine cattle), S. scrofa (pig), R. norvegicus (rat), M. musculus (mouse).

614 M. Sodhi et al. / Gene 527 (2013) 606–615

4. Conclusions

The detection of distinct nucleotide changes in the bovine andbubaline HSP70.1 gene and its promoter provides context for functionalcharacterization of the variants in order to define cellular componentsand physiological mechanisms of the species to heat stress. The identi-fied genetic variantsmight be exploited for the identification of animalstolerant/resistant to heat stress through genotype–phenotype associa-tion studies so as to drift herds toward superior thermotolerant ability.The identified genetic variants would be important for developing andmanaging livestock in the face of climate change and more efficientresource utilization. This information should also facilitate transcrip-tional genomics related to marker for heat stress response and wholegenome-assisted methods of animal selection to develop populationswith increase resistance to heat stress. This work is preliminary andfurther research on larger populations needs to be conducted.

Acknowledgements

This work was supported by the Indian Council of AgriculturalResearch, New Delhi, under the National Fellow scheme. Authorsduly acknowledge Ms Parvesh Kumari for providing the technicalhelp.

References

Adamowicz, T., Pers, E., Lechniak, D., 2005. A new SNP in the 3′-UTR of the hsp 70-1gene in Bos taurus and Bos indicus. Biochem. Genet. 43, 623–627.

AI-Katanani, Y.M., Webb, D.W., Hansen, P.L., 1999. Factors affecting seasonal variationin 90 day non-return rate to first service in lactating Holstein cows in a hot climate.J. Dairy Sci. 82, 2611–2615.

Aufricht, C., 2005. Heat-shock protein 70: molecular supertool. Pediatr. Nephrol. 20,707–713.

Basu, S.K., 1985. Genetic Improvement in Buffaloes. Kalyani Publishers, Ludhiana.Bradley, D.G., MacHugh, D.E., Cunningham, P., Loftus, R.T., 1996. Mitochondrial diversity and

the origins of African and European cattle. Proc. Natl. Acad. Sci. U. S. A. 93, 5131–5135.Bukau, B., Horwich, A.L., 1998. TheHsp70 andHsp60 chaperonemachine. Cell 92, 351–366.Cartwright, T.C., 1955. Responses of beef cattle to high ambient temperatures. J. Anim.

Sci. 14, 350–362.Christians, E., et al., 1997. Evidence for the involvement of mouse heat shock factor 1 in

the atypical expression of the HSP70.1 Heat shock gene during mouse zygoticgenome activation. Mol. Cell. Biol. 17, 778–788.

Das, S.K., Upadhyay, R.C., Madan, M.L., 1999. Heat stress in Murrah buffalo calves.Livest. Prod. Sci. 61, 71–78.

Davis, J.E., Voisine, C., Craig, E.A., 1999. Intragenic suppressors of Hsp70mutants: interplaybetween the ATPase- and peptide-binding domains. Proc. Natl. Acad. Sci. U. S. A. 96(16), 9269–9276.

Flynn, G.C., Pohl, J., Flocco, M.T., Rothman, J.E., 1991. Peptide binding specificity of themolecular chaperone BiP. Nature 353, 726–730.

Gaughan, J.B., Mader, T.L., Holt, S.M., Josey, M.J., Rowan, K.J., 1999. Heat tolerance ofBoran and Tuli crossbred steers. J. Anim. Sci. 77, 2398–2405.

Gaughan, J.B., Mader, T.L., Holt, S.M., Sullivan, M.L., Hahn, G.L., 2010. Assessing the heattolerance of 17 beef cattle genotypes. Int. J. Biometeorol. 54, 617–627.

Grosz, M.D., Skow, L.C., Stone, R.T., 1994. An AluI polymorphism at the bovine 70 KDheat shock protein-1 (HSP-1) locus. Anim. Genet. 25, 196.

Hansen, P.J., 2004. Physiological and cellular adaptations of zebu cattle to thermalstress. Anim. Reprod. Sci. 82–83, 349–360.

Hardcastle, A., Tomlin, P., Norris, C., Richards, J., Cordwell, M., Boxall, K., Rowlands, M.,Jones, K., Collins, I., McDonald, E., Workman, P., Aherne, W., 2007. A duplexedphenotypic screen for the simultaneous detection of inhibitors of the molecularchaperone heat shock protein 90 and modulators of cellular acetylation. MolCancer Ther. 6 (3), 1112–1122.

Hayes, B.J., et al., 2009. A validated genome wide association study to breed cattleadapted to an environment altered by climate change. PLoS One 4 (8), e6676.http://dx.doi.org/10.1371/journal.pone.0006676.

Huang, S.Y., et al., 2002. Effects of single nucleotide polymorphisms in the 5′-flankingregion of heat shock protein 70.2 gene on semen quality in boars. Anim. Reprod.Sci. 70, 99–109.

Jian-bo, H., et al., 2009. A new SNP in coding region of HSP70 gene and the associationof polymorphism with heat stress traits in Chinese Holstein cattle. J. Agric. Sci.Technol. 11, 56–63.

Johnson, H.D., 1965. Environmental temperature and lactation (with special referenceto cattle). Int. J. Biometeorol. 9, 103–116.

Kel, A.E., Gössling, E., Reuter, I., Cheremushkin, E., Kel-Margoulis, O.V., Wingender, E.,2003. MATCH™: a tool for searching transcription factor binding sites in DNAsequences. Nucleic Acids Res. 31, 3576–3579.

Kimura, M., Crow, J.F., 1964. The number of alleles that can be maintained in a finitepopulation. Genetics. 49, 725–738.

Li, Q., et al., 2010. Novel SNPs in HSP70A1A gene and the association of polymorphismswith thermo tolerance traits and tissue specific expression in Chinese Holsteincattle. Mol. Biol. Rep. http://dx.doi.org/10.1007/s11033-010-0407-5.

Lindquist, S., Petersen, R., 1990. Selective translation and degradation of heat-shockmessenger RNAs in Drosophila. Enzyme 44, 147–166.

Liu, Y., Li, D., Li, H., Zhou, X., Wang, G., 2011. A novel SNP of the ATP1A1 gene is associ-ated with heat tolerance traits in dairy cows. Mol. Biol. Rep. 38, 83–88.

Lopez-Buesa, P., Pfund, C., Craig, E.A., 1998. The biochemical properties of the ATPaseactivity of a 70-kDa heat shock protein (Hsp70) are governed by the C-terminaldomains. Proc. Natl. Acad. Sci. U. S. A. 95 (26), 15253–15258.

Maloyan, A., Palmon, A., Horowitz, M., 1999. Heat acclimation increases the basalHSP72 level and alters its production dynamics during heat stress. Am. J. Physiol.Regul. Integr. Comp. Physiol. 276, R1506–R1515.

Maraia, I.F.M., Haeebb, A.A.M., 2010. Buffalo's biological functions asaffected by heatstress — a review. Livest. Sci. 127, 89–109.

Matys, V., et al., 1993. The function of heat shock proteins in stress tolerance: degrada-tion and reactivation of damaged proteins. Annu. Rev. Genet. 27, 437–496.

Parsell, D.A., Linquist, S., 1993. The function of heat shock proteins in stress tolerance: deg-radation and reactivation of damagedproteins. Annual ReviewofGenetics 27, 437–496.

Pegorer, M.F., Vasconcelos, J.L., Trinca, L.A., Hansen, P.J., Barros, C.M., 2007. Influence of sireand sire breed (Gyr versus Holstein) on establishment of pregnancy and embryonicloss in lactating Holstein cows during summer heat stress. Theriogenology 67, 692–697.

Pelham, H.R., 1982. A regulatory upstream promoter element in the Drosophila HSP 70heat-shock gene. Cell 30 (2), 517–528.

Rocha, A., et al., 1998. High environmental temperature and humidity decrease oocytequality in Bos taurus but not in Bos indicus cows. Theriogenology 49, 657–665.

Rüdiger, S., Buchberger, A., Bukau, B., 1997. Interaction of HSP70 chaperones withsubstrates. Nat. Struct. Biol. 5, 342–349.

Sambrook, J., Fritsh, E.F., Maniatis, T., 1989. Molecular Cloning: a Laboratory Manual,2nd edn. Cold Spring Harbor Laboratory Press, New York.

Schwerin, M., Maak, S., Kalbe, C., Fuerbass, R., 2001. Functional promoter variants ofhighly conserved inducible hsp70 genes significantly affect stress response.Biochim. Biophys. Acta. 1522, 108–111.

Schwerin, M., Maak, S., Hagendorf, A., Lengerken, G., Seyfert, H.M., 2002. A 3'UTRvariant of the inducible porcine HSP70.2 gene affects mRNA stability. Biochem.Biophys. Acta 1578, 90–94.

615M. Sodhi et al. / Gene 527 (2013) 606–615

Seif, S.M., Johnson, H.D., Lippincott, A.C., 1979. The effects of heat exposure (31 °C) onZebu and Scottish Highland cattle. Int. J. Biometeorol. 23, 9–14.

Sharma, A.K., Rodriquez, L.A., Wilcox, C.J., Collier, R.J., Bachman, K.C., Martin, F.G., 1988.Interactions of climatic factors affecting milk yield and composition. J. Dairy Sci. 71,819–825.

Singh, R., Kolvraa, S., Bross, P., Jensen, U.B., Gregersen, N., Tan, Q., Knudsen, C., Rattan,S.I.S., 2006. Reduced heat shock response in human mononuclear cells duringaging and its association with polymorphisms in HSP70 genes. Cell Stress Chaper-ones 11, 208–215.

Skinner, J.D., Louw, G.N., 1966. Heat stress and spermatogenesis in Bos indicus and Bostaurus cattle. J. Appl. Physiol. 21, 1784–1790.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5:Molecular Evolutionary Genetics Analysis usingMaximum Likelihood, Evolutionary

Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution 28,2731–2739.

Veerasamy, S., Naqvi, S.M.K., Ezeji, T., lakritz, J., Lal, R., 2012. Environmental Stress andAmelioration in Livestock Production. Springer heildeberg, New York, Dordrecht,London978-3-642-29204-0.

West, J.W., 2003. Effects of heat stress in dairy cattle. J. Dairy Sci. 86, 2131–2144.Wolfenson, D., Roth, Z., Meidan, R., 2000. Impaired reproduction in heat-stressed

cattle: basic and applied aspects. Anim. Reprod. Sci. 60–61, 535–547.Yang, M., et al., 2006. Association of HSP70 polymorphisms with risk of noise-induced

hearing loss in Chinese automobile workers. Cell Stress Chaperones 11, 233–239.Zhang, X., Du, H., Li, J., 2002. Single nucleotide polymorphism of chicken heat shock

protein (HSP70) gene. 7thWorld congress on genetics applied to livestock production,France, Montpellier.