Caenorhabditis elegans based in vivo screening of bioactives from marine sponge associated bacteria...

ORIGINAL ARTICLE

Caenorhabditis elegans-based in vivo screening ofbioactives from marine sponge-associated bacteria againstVibrio alginolyticusS. Durai, L. Vigneshwari and K. Balamurugan

Department of Biotechnology, Alagappa University, Karaikudi, India

Keywords

Caenorhabditis elegans, in vivo screening,

quorum quenching, Sponge-associated

bacteria, Vibrio alginolyticus.

Correspondence

Krishnaswamy Balamurugan, Department of

Biotechnology, Alagappa University, Karaikudi

630 003, India.

E-mail: [email protected]

2013/1233: received 20 June 2013, revised

10 August 2013 and accepted 21 August

2013

doi:10.1111/jam.12335

Abstract

Aim: To establish Caenorhabditis elegans based in vivo method for screening

bioactives from marine sponge associated bacteria (SAB) against Vibrio species.

Methods and Results: About 256 SAB isolates were screened for their ability

to rescue C. elegans infected with Vibrio species. The chloroform extract of the

positive isolate was subjected to column fractionation and purity of the active

fraction was analysed using HPLC. Further, the components were elucidated

using GC/MS. The active fraction was tested for its in vivo rescue activity,

antibacterial and anti-QS activity. In vivo colonization reduction and biofilm

inhibition efficiency were assessed using GFP-tagged V. alginolyticus using

confocal laser scanning microscopy (CLSM). The ability of the active fraction

in modulating expression of V. alginolyticus quorum sensing (QS) regulators

luxT and lafK was measured using real-time PCR. The results indicated that

the chloroform extract of SAB4.2 displayed significant rescue activity against

V. alginolyticus by inhibiting the QS pathway. HPLC analysis of the active

fraction revealed a single major peak and GC/MS analysis suggested Pyrrolo

[1,2-a]pyrazine-1,4-dione, hexahydro-3-(2-methylpropyl) as the major

constituent. The potent bacterial isolate was identified as Alcaligenes faecalis.

Conclusions: In vivo screening using C. elegans identified a marine isolate that

inhibits the virulence of V. alginolyticus by interrupting the QS pathway.

Significance and Impact of the Study: The study provides a C. elegans based

in vivo screening method for identifying bioactives from natural resources by

overcoming the disadvantages of traditional in vitro plate assays.

Introduction

Since the discovery of antibiotics, micro-organisms have

been proven to be the source of various important life sav-

ing drugs. Innumerable terrestrial microbiomes have been

explored for their bioactive metabolites, and several com-

pounds have been identified against Gram-positive and

Gram-negative pathogens. As infectious microbes develop

resistance against several drugs, new sources for drug

discovery have become necessary to overcome multidrug-

resistance-related issues. Oceans are the source of structur-

ally diverse and novel anti-infectives. Sponges of the

phylum Porifera are the major biomass occupants of the

marine environment and only 1% of the phylum accounts

to fresh water origin (Radjasa et al. 2007). Besides being

the known source of several bioactive principles, marine

sponges also serve as the host for innumerable marine

micro-organisms (Wang 2006). In the recent years, symbi-

otic bacteria associated with sponges have been proven to

be the source of several lead molecules previously believed

as a metabolite of sponges itself (Zhang et al. 2005;

Newman and Hill 2006). Bioactive compounds isolated

from these sponges gains utmost importance due to their

similarity with compounds isolated from terrestrial

microbes of highly varied phylogeny (Perry et al. 1988).

Vibrio alginolyticus is a mesophilic marine bacterium

responsible for vibriosis, wound infections and gastroenter-

itis in humans. Infection and mortality caused by

Journal of Applied Microbiology 115, 1329--1342 © 2013 The Society for Applied Microbiology 1329

Journal of Applied Microbiology ISSN 1364-5072

V. alginolyticus in aquaculture results in significant eco-

nomic losses every year (Lee et al. 1996; Liu et al. 2011).

The increase in antibiotic resistance of V. alginolyticus iso-

lates at clinical and aquaculture environments and the

insufficient information about the mechanism of develop-

ment of antibiotic resistance have made it difficult to

control V. alginolyticus infections. Although the pathogen-

associated infections can be treated successfully with the

appropriate antibiotics, they can often lead to serious med-

ical conditions especially in immune-compromised

patients (Reilly et al. 2011). Hence, it becomes necessary to

find novel antivirulent compounds to treat V. alginolyticus

infections. The adhesive property of V. alginolyticus is

another important reason for its successive and efficient

invasion of the host system (Snoussi et al. 2008). Many

studies in recent years have proven the ability of Vibrio

spp. in developing biofilm during infection (Yildiz and

Visick 2009). The bacterium develops resistance to antibi-

otics by initial attachment and development of multilay-

ered, smeared colonies. Biofilm development in the host

and the production of extracellular products are attributes

of its virulence and pathogenicity. V. alginolyticus QS path-

ways like LuxO and LuxR were elucidated in recent reports

(Rui et al. 2008). luxT and lafK in V. alginolyticus are

found to play important roles in regulation of V. alginolyti-

cus virulence (Ye et al. 2008; Liu et al. 2012). Traditional

methods of antibiotic discovery primarily screen for com-

pounds that affect the growth and survival of bacterial

pathogens and identify compounds with almost similar

mechanism of action. The development of resistance

against these structurally similar antibiotics demands the

need for a new strategy of antimicrobial discovery (Moy

et al. 2006). Hence, identifying a potent QS-inhibitor

against V. alginolyticus will be an efficient method to

restrict the virulence by avoiding development of any

subsequent antibacterial resistance.

Marine invertebrates have developed highly specific

relationships with numerous micro-organisms, and these

associations have been recognized for ecological and bio-

logical importance (Armstrong and Van Baalen 1979;

Sponga et al. 1999; Strahl et al. 2002). It has been

reported that the ratio of micro-organisms with antimi-

crobial activity from invertebrates is higher than from

other sources (Ivanova et al. 1998; Burgess et al. 1999),

suggesting that invertebrate-associated micro-organisms

might play a chemical defence role for their hosts. Several

recent studies have proven the efficiency of marine bacte-

rial extracts to inhibit quorum sensing in Gram-positive

and Gram-negative bacteria (Bakkiyaraj and Pandian

2010; Nithya et al. 2010; Nithyanand et al. 2010).

Using live animal models as a platform for screening is

the most accurate alternative for in vitro solid assay

plates, mediating antimicrobial discovery. The main

advantage of using live models is that both efficacy and

toxicity of the screened candidate are validated simulta-

neously (Matthews and Kopczynski 2001). Current drug

discovery processes rely on popular model systems such

as yeast, worms and flies due to their high similarity with

the human system in their biological mechanisms and

protein functions (Zon and Peterson 2005; Kaletta and

Hengartner 2006). The main benefit of using these mod-

els in the drug discovery process for in vivo selection and

validation is the development of a potent technology for

the discovery of tomorrow’s small molecular medicines

(Powell and Ausubel 2008).

Caenorhabditis elegans is a well-established and popu-

larly accepted model for studying bacterial pathogenicity

and screening for antimicrobials (Bhavsar and Brown 2006;

Kurz and Ewbank 2007). Recently, we have established

C. elegans as a model system for V. alginolyticus (Durai

et al. 2011b) and studied the changes in C. elegans at both

physiological and molecular levels against Vibrio parahae-

molyticus infection (Durai et al. 2011a). With this knowl-

edge on the interaction of C. elegans with Vibrio spp., the

present study has screened and characterized several

sponge-associated bacteria (SAB) collected from the Palk

bay region of India, for their anti-infective activity against

pathogenic Vibrio spp. infection under in vivo conditions.

Materials and methods

Bacterial strains and C. elegans

Reference bacterial strains obtained from the American

Type Culture Collection (ATCC) included V. alginolyticus

(ATCC 17749), V. parahaemolyticus (ATCC 17802) and

Vibrio vulnificus (ATCC 29307). All the cultures were

maintained in Zobell marine medium 2216 (HiMedia,

Mumbai, India). Escherichia coli OP50 was maintained in

LB medium. V. alginolyticus was GFP tagged and main-

tained according to a standardized protocol (Sawabe et al.

2006). C. elegans WT Bristol N2 obtained from Caenor-

habditis Genetics Center (CGC) was routinely maintained

at 20°C on nematode growth medium (NGM) seeded with

E. coli OP50 as per the standard methods (Brenner 1974).

In all assays, the size of bacterial inoculum was kept

constant at 6�7 9 108 cells ml�1 (0�3 OD at 600 nm).

Collection, isolation and identification of sponge-

associated bacteria

The marine sponge samples of Haliclona spp. were col-

lected at the depth of 5 m from the costal waters of

Mandapam, Palk Bay North (longitude 79° 8″ East; lati-

tude 9°17″ North). Sponge samples were washed gently

with sterile seawater to remove debris and loosely bound

1330 Journal of Applied Microbiology 115, 1329--1342 © 2013 The Society for Applied Microbiology

In vivo screening of anti-infectives S. Durai et al.

bacteria and then transported to the laboratory in sterile

condition. The sponge samples were squeezed and

swabbed using sterile cotton swabs (HiMedia, India) in

different regions. The cotton swabs were directly used to

inoculate autoclaved marine agar medium (HiMedia).

Colonies of different morphology were selected and

maintained as pure culture in the marine agar medium.

Sterile environment was maintained throughout to avoid

external bacterial contamination in pure cultures. The

positive isolate SAB4.2 was identified by 16S rRNA gene

sequence analysis according to Nithyanand et al. 2011.

The identified sequence was then submitted to the

GenBank database.

C. elegans rescue assay

For the preliminary screening, a single colony from the

pure culture of each SAB was inoculated into 2 ml marine

broth and incubated at 37°C overnight. Each culture was

centrifuged at 9391 g, and the cell-free culture supernatant

was filtered using 0�2-lm filters and extracted with an

equal volume of chloroform 1 : 1 (v/v). The solvent frac-

tion was collected and evaporated to remove solvent under

reduced pressure. The resultant crude extract was dissolved

in 100 ll of molecular grade water and tested for the ability

to rescue C. elegans from V. alginolyticus infection. Rescue

assay was performed in liquid medium with c. 50 worms

transferred into each well of a 24-well plate, and 100 ll ofthe crude extract was used to analyse the rescue efficacy

against pathogen infection. The crude extracts of SAB

isolate which showed significant rescue activity against

V. alginolyticus was also tested against other Vibrio strains.

C. elegans exposed to Vibrio spp. alone served as a negative

control and uninfected C. elegans exposed to SAB4.2 alone

served as the positive control.

Purification and identification of active compound

Silica gel column and thin-layer chromatography

To identify the component of the crude extract responsible

for the rescue activity, the SAB4.2 extract was purified

using silica column chromatography with a solvent system

that was standardized using thin-layer chromatography

(TLC). The crude extract was purified using 20 9 2 cm sil-

ica gel columns (SRL, Mumbai, India), with a mesh size of

60–120 lm packed into a total column volume of 40 ml. A

methanol/chloroform/hexane solvent system in the ratio of

0�5 : 2�5 : 7 was used as a mobile phase and the absorbed

compound was eluted using methanol/water (75 : 25)

solution at a flow rate of 2 ml min�1. The purity of the

elutant was confirmed by TLC. Individual fractions were

analysed for their in vivo rescue activity. Active fractions

were collected many times and pooled together and

evaporated. Survival assay was performed using the

column-purified fraction at different concentrations

(150–600 lg ml�1). The toxicity of the SAB extract was

tested by exposing C. elegans to the active fraction in all

test concentrations (150–600 lg ml�1). C. elegans exposed

to V. alginolyticus alone served as a negative control and

uninfected C. elegans exposed to SAB4.2 alone served as

the positive control.

HPLC and GC/MS analysis

The column fraction displaying rescue activity was analy-

sed using high-pressure liquid chromatography (HPLC),

to check the purity. Column-purified active fraction

(5 mg) was redissolved in 0�5 ml of HPLC grade metha-

nol and introduced into a SHIMADZU system (Japan)

with C18 silica gel column. Fractions were eluted using

binary gradient of methanol with water from 0�1% to

100% (v/v). The major peaks were collected and checked

for rescue activity, and the active fraction was analysed

using gas chromatography/mass spectrometry. GC/MS

analysis of the column purified active fraction was

conducted using a Shimadzu GCMS-QP 2010 plus sys-

tem comprising a manual injector. The gas chromato-

graph is interfaced to a mass spectrometer equipped with

RXi-5MS (5% diphenyl, 95% dimethyl polysiloxane)

fused to a capillary column (30 9 0�25 9 0�25 lm). For

GC/MS detection, an electron ionization system was

operated in electron impact mode with ionization energy

of 70 eV. Helium gas (99�9%) was used as a carrier gas

at a constant flow rate of 1�0 ml min�1 and an injection

volume of 2 ll (splitless). The injector temperature was

maintained at 260°C, the ion-source temperature was

250°C and the oven temperature was programmed from

140°C (for 2 min) with an increase of 10°C min�1 to

250°C as the final temperature. Mass spectra were taken

at 70 eV at a scan interval of 0�5 s and from 45

to 450 Da. The solvent delay was 4 min, and the total

GC/MS running time was 30 min. The relative percentage

amount of each component was calculated by comparing

its average peak area to the total area. Real-time analyser

(Agilent Technologies, Palo Alto, CA, USA) was used to

handle the mass detector, mass spectra and chromato-

grams. Metabolites were identified by comparison with

the NIST database and standards.

Antibacterial and QSI assay

The effect of SAB4.2 column-purified active fraction

(600 lg ml�1) on cell proliferation of V. alginolyticus was

determined by a growth curve assay. The growth curve of

V. alginolyticus was determined for up to 24 h, along with

a quorum-sensing inhibition assay. The quorum-sensing

inhibition assay was performed using Chromobacterium


S. Durai et al. In vivo screening of anti-infectives

violaceum ATCC 12472 in a 24-well plate liquid medium

as mentioned previously (Nithya et al. 2010). Cinnamal-

dehyde (75 mmol l�1) was the positive standard control

as at lower concentration and it has been proven to inhi-

bit quorum sensing without inhibiting bacterial growth

(Niu et al. 2006; Brackman et al. 2008).

Bacterial colonization assay

The effect of the column-purified SAB4.2 extract on in vivo

colonization in C. elegans intestine was analysed using

GFP-tagged V. alginolyticus. C. elegans exposed to GFP-

tagged V. alginolyticus in the presence and the absence of

SAB extract were examined under confocal laser scanning

microscope (CLSM) for their intensity of GFP fluorescence

which is directly proportional to the intestinal colonization

by V. alginolyticus. Worms exposed to GFP-tagged E. coli

served as negative controls. In addition, any GFP-like

pseudo-fluorescence activity of SAB4.2 against V. parahae-

molyticus was used as another control to avoid any false-

positive results. Also, the colony forming unit (CFU) count

of the sample isolated from the infected C. elegans was per-

formed on TCBS agar plates according to standardized

procedures (Durai et al. 2011b).

Pharyngeal pumping assay

To determine the pharyngeal pumping rate, infected

worms and column-purified SAB4.2 extract treated

worms were placed on NGM plates seeded with E. coli

OP50 and V. alginolyticus respectively. Pharyngeal pump-

ing was observed manually using a stereomicroscope

continuously for a minute. Animals infected with

V. alginolyticus served as controls against treated animals.

The pumping rate in the presence of E. coli OP50 was

also monitored and compared.

In vitro biofilm inhibition and microscopic observation

For visualization by light microscopy, biofilms were

allowed to grow on glass pieces (c. 1 9 1 cm) placed in

24-well polystyrene plates supplemented with the column-

purified bacterial extract (50–300 lg ml�1) and incubated

for 24 h at 37°C. The glass pieces were removed from the

plate and stained with crystal violet. The stained glass

pieces were placed on slides with the biofilm pointing up

and inspected by light microscopy. Visible biofilms were

documented with an attached digital camera (Nikon,

Tokyo, Japan). The biofilms were also monitored under

CLSM (Carl Zeiss, Goettingen, Germany) after washing

with PBS and staining with 0�01% acridine orange. A

488 nm Ar laser and 500–640 nm band pass emission fil-

ters were used to excite and detect the stained cells. CLSM

images were obtained from 24 h control and treated bio-

films and processed using Zen 2009 image software.

Quantitative analysis of biofilm inhibition was performed

using liquid assay (Nithya et al. 2010).

In vivo biofilm inhibition and CLSM analysis

Approximately, 25 worms per well were taken in 24-well

polystyrene plates containing Zobell Marine Broth 2216

(ZMB) and the column purified SAB4.2 extract. The wells

without SAB4.2 extract acted as controls. Each well was

inoculated with 1% (0�3 OD at 600 nm) of GFP-tagged

V. alginolyticus and incubated at 25°C. After 24 h, a

worm from each well was taken washed gently with M9

buffer to remove planktonic cells and observed for

adhered bacterial cells using CLSM. The density of the

surface biofilm was measured by intensity profile analysis

using Zen software 2009. The intensity of the GFP

recorded was directly proportional to the amount of

bacterial biofilm.

RNA isolation and qPCR

To analyse the regulation of quorum-sensing genes in

V. alginolyticus, total RNA was isolated from both V. alg-

inolyticus and V. alginolyticus treated with SAB4.2

column-purified active fraction for 12 h. Total RNA was

isolated using a guanidine thiocyanate/phenol extraction

method. RT-PCR was performed using Superscript III

Kit (Invitrogen) according to the manufacturer’s instruc-

tions. RT-PCR was followed by a standard real-time PCR

method in a single-well format in which the V. alginolyti-

cus QS-specific primers and the primers for the house-

keeping gene (rpoB) (Table 1) with their PCR mix

(SYBR Green kit, Applied Biosystems) were combined

separately at a predefined ratio. The PCR cycle numbers

were always titrated according to the manufacturer’s and

previously established protocols to ensure that the reac-

tion was within the linear range of amplifications. The

steady-state levels of QS-specific gene mRNA were

assessed from the cycle threshold (Cq) values during the

real-time PCR of the candidate QS-specific gene product

relative to the Cq values of the rpoB using a relative rela-

tionship method supplied by the manufacturer (Applied

Biosystems).

Statistical analysis

All the experiments were conducted thrice, and one-way

ANOVA (using SPSS Ver. 17.00) was used to compare the

mean values of each treatment. The significant difference

between the means of the parameter was calculated by

using Dunnett’s test (P < 0�05).



Results

Alcaligenes faecalis (SAB4.2) extract rescued C. elegans

from V. alginolyticus infection

Among the screened isolates, crude chloroform extracts

(100 ll) of eight SAB isolates had rescued C. elegans

from V. alginolyticus infection during the preliminary

screening. Crude extract from the isolate SAB4.2 signifi-

cantly (P < 0�05) promoted the survival rate of C. elegans

by 60% against V. alginolyticus infection in 48 h postin-

fection. In the assay, C. elegans exposed to Vibrio spp.

displayed complete death (negative control) and

C. elegans exposed to SAB4.2 extract alone (without

Vibrio spp. infection) displayed 100% survival (positive

control). The ability of the SAB4.2 crude extract to rescue

C. elegans against other Vibrio spp. was also tested. The

activity of SAB4.2 extract against the other Vibrio strains

was not as significant as against V. alginolyticus. Hence,

bioactivity of the SAB4.2 isolate against V. alginolyticus

was explored in further studies. A full-length 16S rRNA

gene sequence of the SAB4.2 isolate was PCR amplified,

sequenced and aligned to the closest match using BLAST.

The strain SAB4.2 was identified as A. faecalis. The entire

16S rRNA gene sequence was submitted to the GenBank

database with the accession number JQ040510.

Purification and characterization of SAB4.2 extract

In total, 20 fractions (2 ml each) collected from silica gel

column were tested for their rescue activity. The active

fraction (fraction number 8) was collected repeatedly,

pooled and evaporated for further assays. The survival

assay, with varying concentrations of the column purified

extract indicated 300 lg ml�1 as the minimum dose

required to display a significant rescue activity of >50%(P < 0�05) (Fig. 1). We observed that the SAB4.2 active

fraction displayed no toxic effect on C. elegans. Further,

no reduction in life span was observed in C. elegans

exposed to the active fraction alone in all the tested con-

centrations (P < 0�05). Before proceeding with further

assays, the purity of the active fraction was analysed using

HPLC. The HPLC chromatogram displayed a single

major peak at the RT of 52�52. The fraction correspond-

ing to the major peak was collected and tested for the

rescue activity. Other minor peaks with no significant

intensity were also tested for rescue activity. The results

of the rescue assay indicated activity only in the fraction

corresponding to the major peak and not in other frac-

tions. The column-purified active fraction was character-

ized using GC/MS. The results of the mass spectrometry

indicated Pyrrolo[1,2-a]pyrazine-1,4-dione,hexahydro-3-

(2-methylpropyl) as major constituent (29�29%) (Fig. 2).

The other compounds identified include L-proline

(7�72%) and uric acid (4�52%). Considering the HPLC

chromatogram and the GC/MS analysis, it is clear that

the major peak corresponds to Pyrrolo[1,2-a]pyrazine-

1,4-dione,hexahydro-3-(2-methylpropyl) which is the

only component to display rescue activity.

Growth curve and QS inhibition

The column-purified active fraction of SAB4.2 did not

inhibit cell proliferation of V. alginolyticus even at a

high test concentration of 600 lg ml�1 (Fig. 3a). This

result suggested that the SAB4.2 active fraction inhibited

only the virulence of V. alginolyticus without affecting

the bacterial cell proliferation. QS Inhibition assay

performed with the marker strain C. violaceum further

confirmed the ability of SAB4.2 to prohibit bacterial

communication by inhibiting colour formation (Viola-

cein) in vitro equal to cinnamaldehyde the positive

control (Fig. 3b).

Table 1 Gene-specific primers for qPCR

S. No Gene Primer sequence (5′–3′)

1 luxT-FP GCGTAGTAAAGAAGATACCGA

luxT-RP GGAAGTGATGGCTAATACCGG

2 lafK-FP GAATCGGGAACGGGTAAAGAA

lafK-RP GGTGAACGCGCCTTTTACAT

3 rpoB-FP TCCGTATTCCCGATTCAGAG

rpoB-RP CAGCGGTGCAGAATAAGTCA

60 7040 5020 3010

Nem

atod

e su

rviv

al in

%

800

Time in hours

120

100

80

60

40

20

0

Figure 1 Survival curve for Caenorhabditis elegans exposed to Vibrio

alginolyticus, in the presence of various concentrations (150–

600 lg ml�1) of column-purified SAB4.2 extract. C. elegans exposed

to V. alginolyticus alone displayed complete death (negative control)

and C. elegans exposed to SAB4.2 without V. alginolyticus displayed

100% survival (positive control). Data are expressed in percentage of

live C. elegans in each group (P < 0�05). (□) V. alginolyticus alone;

(M) V. alginolyticus SAB4.2 150 lg; ( ) V. alginolyticus SAB4.2

300 lg; ( ) V. alginolyticus SAB4.2 450 lg; ( ) V. alginolyticus

SAB4.2 6050 lg and ( ) SAB4.2 alone 600 lg.



Active fraction reduced in vivo colonization of

V. alginolyticus

The intensity of GFP fluorescence observed in the gut of

C. elegans was directly proportional to the density of

pathogen load in C. elegans. CLSM analysis of C. elegans

indicated reduced colonization of V. alginolyticus in the

presence of SAB4.2 extract at a significantly lower con-

centration (250 lg ml�1) (Fig. 4a). This in turn indicated

the in vivo efficacy of the SAB4.2 active fraction to pre-

vent bacterial adherence, thereby inhibiting colonization

in C. elegans intestine. Assays performed using higher

concentrations of SAB4.2 active fraction (300–500 lg ml�1) displayed similar results. It should be noted

that the in vivo colonization reduction concentration of

the SAB4.2 active fraction was lower than the optimal

concentration observed in rescue assay (300 lg ml�1)

proving the efficiency of the extract in inhibiting the

adhesion property of V. alginolyticus. The in vitro time

course CFU count of infected C. elegans calculated in the

presence of the active fraction (250 lg ml�1) further sup-

ported the CLSM data on the reduced intestinal coloniza-

tion by V. alginolyticus (Fig. 4b).

The presence of the SAB extract improved nematode

activity

In C. elegans, food intake by pharyngeal pumping is

directly correlated with the activity of animals. It is

important to note that the decrease in pharyngeal pump-

ing is a symptom of disease, illness or infection. The pha-

ryngeal pumping of C. elegans was visually scored

between control worms infected with V. alginolyticus and

worms infected in the presence of the SAB4.2 active

extract (250 lg ml�1). The results indicated a gradual

decrease in pharyngeal pumping during infection, in the

absence of the SAB4.2 extract. In contrast, worms

infected in the presence of the active extract displayed

pumping rate equal to that of worms treated with the

food source E. coli OP50 (Fig. 5).

In vitro and In vivo antibiofilm activity of SAB4.2

The effect of the SAB4.2 extract on V. alginolyticus bio-

film formation was studied on glass slides using crystal

violent staining, followed by light microscopic analysis.

The inhibition of biofilm was also studied using CLSM,

wherein the untreated biofilm always showed higher sur-

face coverage in contrast to the treated samples that dis-

played disrupted biofilm (Fig. 6a). Quantification of

in vitro biofilm inhibition indicated a gradual increase

with increase in extract concentration. At a concentration

of 250 lg ml�1, the SAB4.2 extract displayed significant

(75%) biofilm inhibition activity (Fig. 6b).

In vivo biofilm analysis from C. elegans CLSM micro-

graphs displayed a significant difference in the surface

biofilm between the control and the treated samples

(Fig. 6c). The density of adhering bacteria on C. elegans

(a)

(b)

250

200

150

100

50

0

0

100

30 50 70 90 110 130 150 170 190 210 230 250

244

201173154

153

125

126103

9170

6541

270 290 310

O

N

NH

O

330

10 20 30Retention time (RT)

PDA Multi 1

mA

U

40 50min

52·5

20

Figure 2 (a) HPLC analysis of column-purified active fraction of SAB4.2 (b) GC/MS spectra of the major compound Pyrrolo[1,2-a]pyrazine-1,4-

dione,hexahydro-3-(2-methylpropyl) in column purified active fraction of SAB4.2.



surface was imaged and analysed using the software pro-

vided with the CLSM instrument. The intensity of fluo-

rescence in the control animal without the SAB extract

treatment was much higher (250 units) than the SAB4.2

treated samples (50 units). The above results confirmed

the ability of the SAB4.2 to reduce V. alginolyticus adher-

ence both in vitro and in vivo.

Regulation of QS responsible genes

The luxT gene, a strong regulator of the V. alginolyticus

QS system and lafK gene (responsible for a swarming

phenotype which is under control of luxT) were reported

for their significant role in V. alginolyticus infection (Liu

et al. 2012). As the SAB4.2 active fraction displayed

significant reduction in the QS-mediated violacein

production in the C. violaceum strain and inhibited

QS-controlled biofilm formation in V. alginolyticus, the

effect of the SAB extract on the transcription of V. algi-

nolyticus QS genes was analysed using qPCR. The results

indicated a significant down regulation of luxT and lafK

genes in V. alginolyticus exposed to the SAB4.2 active

fraction (Fig. 7). Taken together, all these results ascer-

tain the quorum-sensing inhibition mechanism of the

SAB4.2 extract against V. alginolyticus. Further studies on

understanding the complete QS pathway regulation in

the presence of SAB4.2 active fraction will provide clear

information on the mechanism of action.

Discussion

Marine sponges are an untapped source of anti-infectives

and act as shelter for diverse microbial communities

(Garson 1993). The present study screened secondary

metabolites from marine bacterial isolates associated with

the sponge Haliclona simulans for their ability to rescue

C. elegans against Vibrio spp. infection. C. elegans provide

a strong platform for screening bioactives from medicinal

plants, natural product libraries and synthetic chemical

libraries against bacterial pathogens (Bhavsar and Brown

2006; Moy et al. 2006, 2009; Adonizio et al. 2008).

Hence, the primary objective of the study was to exploit

the amenability of the model organism for in vivo screen-

ing of anti-infectives from sponge-associated bacteria. In

contrast to traditional plate assay methods, the activity

and toxicity of the extracts under examination were vali-

dated in a single step while using in vivo screening (Moy

et al. 2006). The simplicity of C. elegans system allowed

2·5

1·5

0·5

2

2 4 6 8 10 12 14 16 18 20

1

00

Time (h)

O.D

@ 6

00 n

m

CV control Positive standard control Test Medium control

(a)

(b)

Figure 3 (a) Growth curve analysis: Influence of column-purified active fraction (600 lg ml�1) on growth of Vibrio alginolyticus. The data repre-

sent the mean value of experiments performed in triplicates. (b) QS Inhibition: Liquid assay in a multiwell plate for QS inhibition displaying CV

control; Cinnamaldehyde (75 mmol l�1) as a positive standard control; CV treated with SAB4.2 active fraction (250 lg ml�1) as test and sterile

medium with active fraction alone (250 lg ml�1) as medium control. The SAB4.2-treated sample showed no colour formation in comparison with

untreated CV control. No contamination from SAB4.2 active fraction is seen in medium control. ( ) V. alginolyticus control and ( ) V. algino-

lyticus + SAB4.2.



for the screening of a large number of samples in a short

time period (Bhavsar and Brown 2006). Although C. ele-

gans have been previously used as a screening model in

the identification of anti-infectives, this is the first study

to validate the bioactivity of marine bacterial extract

using C. elegans based screening against V. alginolyticus.

Previously, C. elegans has been established as a model for

Vibrio spp. infection and the infection related phenotypic

0·90

0·80

0·70

0·60

0·50

0·40

0·30

0·20

0·10

0·004 8 12 24 36

Time in hours

Log

CF

U p

er w

orm

50 µm

50 µm 50 µm

50 µm

(B)

(A)a b

c d

Figure 4 (a) In vivo colonization reduction: Confocal laser scanning microscopic images of Caenorhabditis elegans infected with GFP tagged

Vibrio alginolyticus displaying reduced in vivo colonization upon treatment with the SAB4.2 chloroform extract; (a,b) Infection in the absence of

SAB extract; (c,d) Infection in the presence of the SAB4.2 extract (250 lg ml�1). (b) CFU assay: Kinetic analysis of bacterial colonization in

C. elegans in untreated and SAB4.2 extract (250 lg ml�1) treated samples. ( ) Untreated and ( ) treated.



changes, including bacterial colonization, pharyngeal

activity and transcriptional regulation of immune respon-

sible genes, have been reported (Durai et al. 2011a,b).

With the knowledge about infection from our previous

studies, preliminary screening using chloroform extract of

SAB isolates was performed against V. alginolyticus to

observe various phenotypic parameters. The observed

parameters included (i) rescue of the nematode against

V. alginolyticus infection; (ii) negligent toxicity of the

extract to C. elegans and (iii) developmental changes in

C. elegans due to extract treatment (egg laying). Results

of the preliminary screening identified 8 SAB isolates that

promoted C. elegans survival against V. alginolyticus

infection without displaying toxicity and developmental

changes. Toxicity assays in C. elegans are well established

and have been reported to be comparable with higher

animal models (Williams and Dusenbery 1990) and

mammalian cell lines (Moy et al. 2006). Hence, the active

compound identified by the current C. elegans-based

screening assay can be easily taken to drug trials. The

results suggested that the SAB4.2 extract displayed signifi-

cant rescue activity (60%) only against V. alginolyticus

infection.

HPLC analysis of the column-purified active fraction

showed a single major peak that exhibited the rescue

activity. GC/MS analysis of the major fraction revealed the

presence of Pyrrolo[1,2-a]pyrazine-1,4-dione,hexahydro-

3-(2-methylpropyl) as the major constituent (29�29%).

The compound identified in the present study was

previously isolated from sponge-associated bacteria and

reported for its bioactivity including antibiofilm and anti-

larval settlement activity against Vibrio halioticoli (Dash

et al. 2009).

Identification of natural anti-infectives that target the

virulence of bacteria rather than the survival is considered

to be highly important (Clatworthy et al. 2007). To

understand the mechanism of action of SAB4.2 extract in

promoting survival of C. elegans, in vitro assays were per-

formed. From comparing the in vitro growth assay and

the in vivo rescue assay, it became clear that SAB4.2

rescues C. elegans from V. alginolyticus infection by a dif-

ferent mechanism without affecting the growth of the

bacteria. Also, it is observed that low concentration of

SAB4.2 is efficient under in vivo conditions compared

with in vitro. The reason behind this could be SAB4.2

mainly inhibits the bacterial cell to cell communications

that could reduce the quorum-sensing-mediated virulence

phenotypes like adhesion. Due to reduced adhesive prop-

erty of the pathogen the level of colonization in C. ele-

gans intestine might be reduced, and hence, there was a

reduction in pathogenesis. The other possible reason for

this could be the efficiency of SAB4.2 to support the

innate immune system of C. elegans and act efficiently to

digest the pathogen and cure the infection paving way for

survival in the presence of SAB4.2. Similar results regard-

ing efficient in vivo activity of screening compound was

also observed by Moy et al. 2006. The efficiency of high

throughput screen to identify compounds targeting the

virulence of V. cholera has been previously reported

(Hung et al. 2005). The ability of cinnamaldehyde deriva-

tives to interfere with the AI-2-dependent QS system of

Vibrio spp. and its ability to rescue Artimia shrimp

against Vibrio harveyi infection has been documented in

earlier studies (Brackman et al. 2009; Musthafa et al.

2011). Antipathogenic activity of marine bacterial isolates

in inhibiting the virulence of Gram-negative bacterium

200

180

160

140

120

100

80

60

40

20

04 8 12 24

Time in hours

Num

ber

of fl

ings

/min

ute

Figure 5 Pharyngeal pumping: Treatment with SAB4.2 extract (250 lg ml�1) promotes the activity of Caenorhabditis elegans against Vibrio

alginolyticus infection. (&) Control; (h) untreated and ( ) treated



(A)

(B)

a

b

c

240180120

600

0

100

100

200

200

300

300

400400

500

500

600

600

700

700

800

800Intensity

Y (µm) x (µm)

240180120

600

0

100

100

200

200

300

300400

400

500

500

600

600

700

700

800

800

Intensity

Y (µm)

x (µm)

240180120

600

0

100

100

200

200

300

300400

400

500

500

600

600

700

700

800

800Intensity

Y (µm)x (µm)

Bright field Confocal

99·70 µm

99·70 µm

99·70 µm

100

90

80

70

60

50

40

30

20

10

050 100 150 200 250 300

Concentration of SAB 4·2 extract in µg ml–1

% o

f bio

film

inhi

bitio

n

*

*

*

Figure 6 (A) In vitro biofilm inhibition: Effects of SAB4.2 chloroform extract at different concentrations on biofilm formation by Vibrio alginolyti-

cus on glass slides observed under light and Confocal microscopes, (a) Control untreated; (b) SAB4.2 100 lg ml�1and (c) SAB4.2 250 lg ml�1.

(B) Dose-dependent biofilm inhibition by SAB4.2 active fraction (100–250 lg ml�1). Statistically significant (P < 0�05) values are indicated by *.

(C) In vivo biofilm inhibition: Representative confocal laser scanning microscopic images of biofilm disruption with SAB4.2 chloroform extract at

different concentrations on glass slides and on Caenorhabditis elegans outer surface after 24 h, (a) Control untreated; (b) SAB4.2 treated

(100 lg ml�1); (c) SAB4.2 treated (250 lg ml�1).



(C)a

b

c

DistanceIntensity Ch1

Intensity Ch1

Intensity Ch1

Intensity Ch1

Intensity

Marker 1143·335 µm

99


68

Difference142·904 µm

–31

Distance

Distance (µm)

Intensity Ch1


65


15


–50

DistanceIntensity Ch1


10


23


13

250

200

150

100

50

0

Intensity

250

200

150

100

50

0

Intensity

250

200

150

100

50

0

0 50 100 150 200 250 300 350 400

Distance (µm)

0 100 200 300 400 500 600 700 800 900

Distance (µm)

0 50 100 150 200 250 300 350 400 450 500

Figure 6 (Continued)



Pseudomonas aeruginosa by targeting the AHL-mediated

virulence factor has also been reported (Musthafa et al.

2011). In many cases, the marker strain C. violaceum was

used to identify the QS inhibition activity of marine

metabolites (Adonizio et al. 2008; McLean et al. 2008;

Bakkiyaraj and Pandian 2010; Nithya et al. 2010;

Annapoorani et al. 2012). Hence, the ability of SAB4.2 to

inhibit QS was studied initially using the marker strain

C. violaceum. The assay suggested that SAB4.2 signifi-

cantly quenched the QS-mediated pigment production in

C. violaceum.

Intestinal colonization and persistence are claimed as

the major routes by which V. alginolyticus establishes

infection in C. elegans (Durai et al. 2011b). The persis-

tence and integrity of the bacterium in C. elegans intes-

tine has a crucial role in infection manifestation. In vivo

integrity of bacteria leads to the enhanced accumulation

of bacterial cells resulting in the formation of an extracel-

lular matrix and provides the environment necessary for

biofilm formation (Sousa et al. 2009). It was observed

that adhesive property and biofilm formation play major

roles in V. alginolyticus infection in human and marine

hosts (Snoussi et al. 2008). In the current study, CLSM

analysis of SAB4.2 treated C. elegans revealed reduced

pathogen colonization in the intestine. In vitro bacterial

colonization assay proved the ability of SAB4.2 extract in

reducing pathogen CFU in the infected worm intestine.

Biofilm assay performed in vitro proved the ability of

SAB4.2 to reduce the adherence of V. alginolyticus on a

glass slide. The in vivo biofilm assay on C. elegans also

confirmed reduced adhesion of V. alginolyticus in the

presence of SAB4.2 extract. Previously, many marine and

nonmarine micro-organisms have been proven to reduce

virulence by inhibiting biofilm formation against patho-

genic bacteria (Valle et al. 2006; Jiang et al. 2011).

Recently, SAB belonging to Bacillus spp. was reported to

inhibit biofilm formation in E. coli (Sayem et al. 2011).

Extracts from coral associated bacteria and coral associ-

ated actinomycetes were also reported to have antibiofilm

activity against Streptococcus pyogenes (Nithyanand et al.

2010) and clinical isolates of S. aureus (Bakkiyaraj and

Pandian 2010). Inhibiting virulence without affecting the

growth of bacteria is a better way of screening to avoid

emergence of antibacterial resistance behaviour against

antibiotic compounds. Hence, natural compounds inhib-

iting the conserved virulence pathway of many patho-

genic bacteria can become a potent lead to combat future

bacterial infections. The quorum-sensing system among

the bacterial community is a primary target of recent

screening studies to reduce virulence without cell lethal-

ity. The V. alginolyticus QS system was identified to be

similar to that of V. harveyi, involving the LuxO and

LuxR system controlling the major virulent factors (Liu

et al. 2012; Rui et al. 2008; Ye et al. 2008). Recently, a

new regulator, LuxT, was identified to control LuxO at

the transcriptional level and LuxR at post-transcriptional

level (Liu et al. 2012). The effect of SAB4.2 extract on

V. alginolyticus luxT regulation was proven for the first

time using real-time PCR. Down regulation of luxT and

lafK upon SAB4.2 treatment might have prevented

V. alginolyticus from adherence and in vivo colonization,

thereby preventing infection in the nematode. The effi-

ciency of C. elegans-based screening for the validation of

QS regulators from South Florida medicinal plant has

been previously reported against P. aeruginosa (Adonizio

et al. 2008). With the results of the present study and

previous validation, it is evident that C. elegans-based

screening can identify not only antimicrobials and

immune modulators (Moy et al. 2006) but also new leads

attenuating bacterial virulence.

To our knowledge, this is the first study employing an

in vivo screening system to identify sponge associated

bacteria which produce bioactive compounds with rescue

activity against V. alginolyticus infection in C. elegans. The

present study confirmed that using such efficient screening

systems with stringent criteria for identification of novel

anti-infective producers will lead to new perspectives of

screening methods.

Acknowledgements

This study was supported in part by the Grants from

University Grants Commission (UGC), Department of

Biotechnology (DBT), Council of Scientific & Industrial

Research (CSIR), and Department of Science and Tech-

nology (DST), Ministry of Science and Technology, India

to Dr. K. Balamurugan. Financial support to S. Durai

provided by Lady Tata Memorial Trust in the form of

10

9

8

7

6

5

4

3

2

1

0luxT lafK

Fol

d ch

ange

in m

RN

A le

vel

Figure 7 Regulation of Vibrio alginolyticus QS regulator genes, luxT

and lafK in control and SAB4.2 extract (250 lg ml�1) treated

samples. (&) Control and (h) treated.



Senior Scholarship is thankfully acknowledged. The

authors acknowledge the computational and Bioinformat-

ics facility provided by Alagappa University Bioinformat-

ics Infrastructure Facility (funded by DBT, GOI; Grant

No. BT/BI/25/001/2006). Also, the authors thankfully

acknowledge Miss. S. Krishnaveni for her timely help in

manuscript preparation.

Conflict of Interest

No conflict of interest declared.

References

Adonizio, A., Leal, S.M. Jr, Ausubel, F.M. and Mathee, K.

(2008) Attenuation of Pseudomonas aeruginosa virulence

by medicinal plants in a Caenorhabditis elegans model

system. J Med Microbiol 57, 809–813.

Annapoorani, A., Jabbar, A.K.K.A., Musthafa, S.K.S., Pandian,

S.K. and Ravi, A.V. (2012) Inhibition of quorum sensing

mediated virulence factors production in urinary pathogen

Serratia marcescens PS1 by marine sponges. Indian J

Microbiol 52, 160–166.

Armstrong, J.E. and Van Baalen, C. (1979) Iron transport in

microalgae: the isolation and biological activity of a

hydroxamate siderophore from the blue-green alga

Agmenellum quadruplicatum. J Gen Microbiol 111, 253–262.

Bakkiyaraj, D. and Pandian, S.K. (2010) In vitro and in vivo

antibiofilm activity of a coral associated actinomycete

against drug resistant Staphylococcus aureus biofilms.

Biofouling 26, 711–717.

Bhavsar, A.P. and Brown, E.D. (2006) The worm turns for

antimicrobial discovery. Nat Biotechnol 24, 1098–1100.

Brackman, G., Celen, S., Baruah, K., Bossier, P., Van

Calenbergh, S., Nelis, H.J. and Coenye, T. (2009) AI-2

quorum-sensing inhibitors affect the starvation response

and reduce virulence in several Vibrio species, most likely

by interfering with LuxPQ. Microbiology 155, 4114–4122.

Brackman, G., Defoirdt, T., Miyamoto, C., Bossier, P., Van

Calenbergh, S., Nelis, H. and Coenye, T. (2008)

Cinnamaldehyde and cinnamaldehyde derivatives reduce

virulence in Vibrio spp. by decreasing the DNA-binding

activity of the quorum sensing response regulator LuxR.

BMC Microbiol 8, 149.

Brenner, S. (1974) The genetics of Caenorhabditis elegans.

Genetics 77, 71–94.

Burgess, J.G., Jordan, E.M., Bregu, M., Mearns-Spragg, A. and

Boyd, K.G. (1999) Microbial antagonism: a neglected avenue

of natural products research. Prog Ind Microbiol 35, 27–32.

Clatworthy, A.E., Pierson, E. and Hung, D.T. (2007) Targeting

virulence: a new paradigm for antimicrobial therapy. Nat

Chem Biol 3, 541–548.

Dash, S., Jin, C., Lee, O.O., Xu, Y. and Qian, P.Y. (2009)

Antibacterial and antilarval-settlement potential and

metabolite profiles of novel sponge-associated marine

bacteria. J Ind Microbiol Biotechnol 36, 1047–1056.

Durai, S., Karutha Pandian, S. and Balamurugan, K. (2011a)

Changes in Caenorhabditis elegans exposed to Vibrio

parahaemolyticus. J Microbiol Biotechnol 21, 1026–1035.

Durai, S., Pandian, S.K. and Balamurugan, K. (2011b)

Establishment of a Caenorhabditis elegans infection model

for Vibrio alginolyticus. J Basic Microbiol 51, 243–252.

Garson, M.J. (1993) The biosynthesis of marine natural

products. Chem Rev 93, 1699–1733.

Hung, D.T., Shakhnovich, E.A., Pierson, E. and Mekalanos, J.J.

(2005) Small-molecule inhibitor of Vibrio cholerae

virulence and intestinal colonization. Science 310, 670–674.

Ivanova, E.P., Nicolau, D.V., Yumoto, N., Taguchi, T.,

Okamoto, K., Tatsu, Y. and Yoshikawa, S. (1998) Impact

of conditions of cultivation and adsorption on

antimicrobial activity of marine bacteria. Mar Biol 130,

545–551.

Jiang, P., Li, J., Han, F., Duan, G., Lu, X., Gu, Y. and Yu, W.

(2011) Antibiofilm activity of an exopolysaccharide from

marine bacterium Vibrio sp. QY101. PLoS ONE 6, e18514.

Kaletta, T. and Hengartner, M.O. (2006) Finding function in

novel targets: C. elegans as a model organism. Nat Rev

Drug Discovery 5, 387–399.

Kurz, C.L. and Ewbank, J.J. (2007) Infection in a dish: high-

throughput analyses of bacterial pathogenesis. Curr Opin


Lee, K.K., Yu, S.R., Yang, T.I., Liu, P.C. and Chen, F.R. (1996)

Isolation and characterization of Vibrio alginolyticus

isolated from diseased kuruma prawn, Penaeus japonicus.

Lett Appl Microbiol 22, 111–114.

Liu, H., Wang, Q., Liu, Q., Cao, X., Shi, C. and Zhang, Y.

(2011) Roles of Hfq in the stress adaptation and virulence

in fish pathogen Vibrio alginolyticus and its potential

application as a target for live attenuated vaccine. Appl

Microbiol Biotechnol 91, 353–364.

Liu, H., Gu, D., Cao, X., Liu, Q., Wang, Q. and Zhang,

Y. (2012) Characterization of a new quorum sensing

regulator luxT and its roles in the extracellular protease

production, motility, and virulence in fish pathogen Vibrio

alginolyticus. Arch Microbiol 194, 439–452.

Matthews, D.J. and Kopczynski, J. (2001) Using model-system

genetics for drug-based target discovery. Drug Discov

Today 6, 141–149.

McLean, R.J.C., Bryant, S.A., Vattem, D.A., Givskov, M.,

Rasmussen, T.B. and Balaban, N. (2008) Detection in vitro

of quorum-sensing molecules and their inhibitors. In

Control of Biofilm Infections by Signal Manipulation ed.

Balaban, N. pp. 39–50. Berlin: Springer.

Moy, T.I., Ball, A.R., Anklesaria, Z., Casadei, G, Lewis, K and

Ausubel, FM (2006) Identification of novel antimicrobials

using a live-animal infection model. Proc Natl Acad Sci

USA 103, 10414–10419.

Moy, T.I., Conery, A.L., Larkins-Ford, J., Wu, G.,

Mazitschek, R., Casadei, G., Lewis, K., Carpenter, A.E.



et al. (2009) High-throughput screen for novel

antimicrobials using a whole animal infection model.

ACS Chem Biol 4, 527–533.

Musthafa, K.S., Saroja, V., Pandian, S.K. and Ravi, A.V. (2011)

Antipathogenic potential of marine Bacillus sp. SS4 on

N-acyl-homoserine-lactone-mediated virulence factors

production in Pseudomonas aeruginosa (PAO1). J Biosci

36, 55–67.

Newman, D.J. and Hill, R.T. (2006) New drugs from marine

microbes: the tide is turning. J Ind Microbiol Biotechnol

33, 539–544.

Nithya, C., Aravindraja, C. and Pandian, S.K. (2010) Bacillus

pumilus of Palk Bay origin inhibits quorum-sensing-

mediated virulence factors in Gram-negative bacteria. Res

Microbiol 161, 293–304.

Nithyanand, P., Thenmozhi, R., Rathna, J. and Pandian,

S.K. (2010) Inhibition of Streptococcus pyogenes biofilm

formation by coral-associated actinomycetes. Curr


Nithyanand, P., Manju, S. and Pandian, S.K. (2011)

Phylogenetic characterization of culturable actinomycetes

associated with the mucus of the coral Acropora digitifera

from Gulf of Mannar. FEMS Microbiol Lett 314, 112–118.

Niu, C., Afre, S. and Gilbert, E.S. (2006) Subinhibitory

concentrations of Cinnamaldehyde interfere with quorum

sensing. Lett Appl Microbiol 43, 489–494.

Perry, N.B.B., Blunt, J.W. and Munro, M.H.G. (1988)

Mycalamide A, an antiviral compound from a New

Zealand sponge of the genus Mycale. J Am Chem Soc 110,

4850–4851.

Powell, J.R. and Ausubel, F.M. (2008) Models of

Caenorhabditis elegans infection by bacterial and fungal

pathogens. Methods Mol Biol 415, 403–427.

Radjasa, O.K.S., Junaidi A and Zocchi E (2007) Richness of

secondary metabolite producing marine bacteria associated

with sponge Haliclona sp. Int J Pharm 3, 275–279.

Reilly, G.D., Reilly, C.A., Smith, E.G. and Baker-Austin, C.

(2011) Vibrio alginolyticus-associated wound infection

acquired in British waters, Guernsey, July 2011. Euro

Surveill 22, 42.

Rui, H., Liu, Q., Ma, Y., Wang, Q. and Zhang, Y. (2008) Roles

of LuxR in regulating extracellular alkaline serine protease

A, extracellular polysaccharide and mobility of Vibrio

alginolyticus. FEMS Microbiol Lett 285, 155–162.

Sawabe, T., Fukui, Y. and Stabb, E.V. (2006) Simple

conjugation and outgrowth procedures for tagging vibrios

with GFP, and factors affecting the stable expression of

the gfp tag. Lett Appl Microbiol 43, 514–522.

Sayem, S.M., Manzo, E., Ciavatta, L., Tramice, A., Cordone,

A., Zanfardino, A., De Felice, M. and Varcamonti, M.

(2011) Anti-biofilm activity of an exopolysaccharide from

a sponge-associated strain of Bacillus licheniformis. Microb

Cell Fact 10, 74.

Snoussi, M., Noumi, E., Cheriaa, J., Usai, D., Sechi, L.A.,

Zanetti, S. and Bakhrouf, A. (2008) Adhesive properties of

environmental Vibrio alginolyticus strains to biotic and

abiotic surfaces. New Microbiol 31, 489–500.

Sousa, C., Teixeira, P. and Oliveira, R. (2009) The role of

extracellular polymers on Staphylococcus epidermidis

biofilm biomass and metabolic activity. J Basic Microbiol

49, 363–370.

Sponga, F., Cavaletti, L., Lazzarini, A., Borghi, A., Ciciliato, I.,

Losi, D. and Marinelli, F. (1999) Biodiversity and

potentials of marine-derived microorganisms. J Biotechnol

70, 65–69.

Strahl, E.D., Dobson, W.E. and Lundie, L.L. Jr (2002)

Isolation and screening of brittlestar-associated bacteria

for antibacterial activity. Curr Microbiol 44, 450–459.

Valle, J., Da Re, S., Henry, N., Fontaine, T., Balestrino, D.,

Latour-Lambert, P. and Ghigo, J.M. (2006) Broad-

spectrum biofilm inhibition by a secreted bacterial

polysaccharide. Proc Natl Acad Sci USA 103, 12558–12563.

Wang, G. (2006) Diversity and biotechnological potential of

the sponge-associated microbial consortia. J Ind Microbiol

Biotechnol 33, 545–551.

Williams, P.L. and Dusenbery, D.B. (1990) Aquatic toxicity

testing using the nematode, Caenorhabditis elegans.

Environ Toxicol Chem 9, 1285–1290.

Ye, J., Ma, Y., Liu, Q., Zhao, D.L., Wang, Q.Y. and Zhang,

Y.X. (2008) Regulation of Vibrio alginolyticus virulence by

the LuxS quorum-sensing system. J Fish Dis 31, 161–169.

Yildiz, F.H. and Visick, K.L. (2009) Vibrio biofilms: so much

the same yet so different. Trends Microbiol 17, 109–118.

Zhang, L., An, R., Wang, J., Sun, N., Zhang, S., Hu, J. and

Kuai, J. (2005) Exploring novel bioactive compounds from

marine microbes. Curr Opin Microbiol 8, 276–281.

Zon, L.I. and Peterson, R.T. (2005) In vivo drug discovery in

the Zebrafish. Nat Rev Drug Discovery 4, 35–44.



Caenorhabditis elegans based in vivo screening of bioactives from marine sponge associated bacteria...

Documents

Transcript of Caenorhabditis elegans based in vivo screening of bioactives from marine sponge associated bacteria...