www.elsevier.com/locate/nucmedbio

Nuclear Medicine and

Acquisition of resistance to antitumor alkylating agent ACNU:

a possible target of positron emission tomography monitoring

Hideya Kawaia,c, Jun Toyoharab,d, Hirotsugu Kadoc, Takao Nakagawaa, Shinji Takamatsud,

Takako Furukawad, Yoshiharu Yonekurad, Toshihiko Kubotaa, Yasuhisa Fujibayashid,4aDepartment of Neurosurgery, Faculty of Medical Sciences, University of Fukui, Fukui 910-1193, Japan

bRadiopharmaceutical Chemistry Section, Department of Medical Imaging, National Institute of Radiological Sciences, Chiba 263-8555, JapancResearch Institute of Brain and Blood Vessels, Akita 010-0874, Japan

dBiomedical Imaging Research Center, University of Fukui, Fukui 910-1193, Japan

Received 2 August 2005; received in revised form 2 October 2005; accepted 4 October 2005

Abstract

Early detection of tumor response to chemotherapy is of great importance for appropriate treatment of tumors. In this study,

characteristics of two positron emission tomography (PET) tracers, [18F]2-fluoro-2-deoxy-d-glucose (FDG) and[18F]3V-fluoro-3V-deoxy-thymidine (FLT), in the early detection of tumor cell response as well as tolerance development to chemotherapy was compared using rat

C6 glioma cells and 1-(4-amino-2-methyl-5-pyrimidinyl)-methyl-3-(2-chloroethyl)-3-nitrosoureahydrochloride (ACNU). ACNU is an

alkylating agent known to induce drug resistance through expression of O6-methylguanine-deoxyribonucleic acid methyl transferase

(O6-MGMT). We established an ACNU-resistant C6 glioma cell line (C6/ACNU) and investigated the effect of ACNU on the uptake of

FLT and FDG. In C6 cells, DNA synthesis presented as [3H]thymidine ([3H]Thd) incorporation into DNA was quickly suppressed by

ACNU. In C6/ACNU cells, the suppression was recovered promptly, indicating that DNA alkylation occurs initially but highly expressed

O6-MGMT repairs DNA, leading to the recovery of DNA synthesis. The patterns of FLT uptake in C6 and C6/ACNU were difficult to

distinguish in the very early stage of the treatment, though it was reported that FLT uptake well correlated with proliferation in certain

conditions. FDG uptake showed different patterns between the resistant and control cells, with significantly decreased uptake in C6 cells

and unchanged uptake in C6/ACNU cells at 18–24 h after the treatment. Though difficult to be directly translated into clinical situation,

the present study will provide a base to develop an appropriate protocol to assess tumor response to treatment by PET and to design

effective treatment plans.

D 2006 Elsevier Inc. All rights reserved.

Keywords: Drug resistance; Glioma; Thymidine; PET; FLT; FDG

1. Introduction

Treatment of malignant tumor consists of surgical

operation, radiation therapy, chemotherapy or their combi-

nation. Among them, chemotherapy plays an important

role especially in the treatment of recurrent, metastatic or

nondissectible tumors. However, selection of antitumor

agents as well as dosage and schedule of the treatment is

still based on personal experiences of each doctor or

hospital, and establishment of an evidence-based decision

making protocol is required. At present, therapeutic effect

can only be evaluated by volumetric change in X-ray CT

0969-8051/$ – see front matter D 2006 Elsevier Inc. All rights reserved.

doi:10.1016/j.nucmedbio.2005.10.002

4 Corresponding author. Tel.: +81 776 61 8430; fax: +81 776 61 8170.

E-mail address: yfuji@fmsrsa.fukui-med.ac.jp (Y. Fujibayashi).

or MRI, which requires more than a month after

completion of the therapy. In addition, tumor cells can

develop resistance against a specific agent or a group of

agents. Thus, early detection of tumor response to

chemotherapy is of great importance for appropriate

treatment of tumors.

Positron emission tomography (PET) is a noninvasive

technique that can expose molecular processes in cells and

biological characteristics of tumors [1]. In general, changes

in such molecular processes during therapy precede

anatomical changes in tumor tissue so that PET can be a

useful tool to detect the very early response of tumor cells to

chemotherapy [1,2]. Tumor cells are known to have

accelerated energy requirement and high growth rate.

Among the available molecular probes for PET, [18F]2-

Biology 33 (2006) 29–35

H. Kawai et al. / Nuclear Medicine and Biology 33 (2006) 29–3530

fluoro-2-deoxy-d-glucose (FDG) [3] and [18F]3V-fluoro-3V-deoxy-thymidine (FLT) [4] have been proposed as markers

of glycolysis representing energy consumption and DNA

synthesis representing cell growth, respectively. There have

been several reports comparing these two tracers for

qualitative diagnosis of tumors [5–8].

In this study, characteristics of these two PET tracers in

the early detection of tumor cell response as well as

tolerance development to chemotherapy were compared

using rat C6 glioma cells as a tumor cell line and 1-(4-

amino-2-methyl-5-pyrimidinyl)-methyl-3-(2-chloroethyl)-3-

nitrosoureahydrochloride (ACNU) (nimustine hydrochlo-

ride) as a chemotherapy agent. ACNU is commonly used

for glioma patients [9], but acquisition of drug resistance

by the tumor cells causes serious problems in cancer

chemotherapy using ACNU [10]. ACNU is a non-P-

glycoprotein-mediated drug, and resistance to ACNU is

independent of P-glycoprotein (P-gp) expression. Thus,

noninvasive detection of P-gp expression using monoca-

tionic radiopharmaceuticals such as [99mTc]MIBI is not

useful for monitoring ACNU treatment. We established an

ACNU-resistant C6 glioma cell line (C6/ACNU) for this

study and investigated the effect of ACNU on the uptake

of FLT and FDG by the cells with or without the tolerance

to provide a basis for the detection of cellular response to

ACNU treatment as well as detection of tolerance

development by PET.

2. Materials and methods

2.1. Radiochemicals and chemotherapeutic agent

[Methyl-3H(N)]3V-fluoro-3V-deoxy-thymidine ([3H]FLT,

229.4 GBq/mmol; 37 MBq/ml) and [5,6-3H]deoxy-2-

fluoro-d-glucose ([3H]FDG, 2.22 TBq/mmol; 37 MBq/ml)

were purchased from American Radiolabeled Chem-

icals, St. Louis, MO. [Methyl-3H]thymidine ([3H]Thd,

2.92 TBq/mmol, 37 MBq/ml) was purchased from Amer-

sham Biosciences, Amersham, UK. A chemotherapeutic

agent, 1-(4-amino-2-methyl-5-pyrimidinyl)-methyl-3-(2-

chloroethyl)-3-nitrosoureahydrochloride (nimustine hydro-

chloride), was supplied by Sankyo (Tokyo, Japan). ACNU

was dissolved at 1.0 mg/ml in distilled water and stored as a

stock solution in the dark at �208C.

2.2. Cell line and cell culture

The C6 rat glioma cell line was obtained from the

American Type Culture Collection, Manassas, VA. The cells

were grown at 378C in a humidified atmosphere containing

5% CO2 in F-10 nutrient mixture medium (GIBCO, Grand

Island, NY) supplemented with 15% horse serum (GIBCO)

and 5% fetal bovine serum (Hyclone Laboratories, Logan,

UT). A C6 subline resistant to ACNU was established anew

by continuously exposing the C6 cell line to gradually

increasing concentration of ACNU, according to the

previously reported method [11].

2.3. Growth inhibitory effect of ACNU on C6 and C6/ACNU

glioma cells in vitro

The cytotoxicity of ACNU on C6 and C6/ACNU glioma

cells were examined by trypan blue dye exclusion method.

The C6 or C6/ACNU glioma cells (1�104) were plated in a

24-well plate (Falcon, Becton Dickinson, Lincoln Park, NJ)

with 1.0 ml of F-10 nutrient mixture medium (GIBCO)

supplemented with 15% horse serum (GIBCO) and 5% fetal

bovine serum (Hyclone Laboratories), and cultured at 378Cfor 24 h in a 5% CO2 humidified atmosphere. Then, the

cells were treated with indicated concentrations of ACNU

for 72 h. The cells in each well were trypsinized, and viable

cell number was analyzed by the trypan blue dye exclusion

method. The drug concentration required for the 50%

inhibition of cell growth (IC50) at 72 h ACNU treatment

was determined by plotting the logarithm of the drug

concentration vs. the growth rate of the treated cells.

2.4. RT-PCR analysis of O6-methylguanine-

deoxyribonucleic acid methyl transferase

The expression of O6-methylguanine-deoxyribonucleic

acid methyl transferase (O6-MGMT), a key enzyme for the

establishment of resistance to ACNU [12–14], was analyzed

by the RT-PCR method, as previously reported [15], with

some modification using cyclophilin as housekeeping gene

expression control. In brief, total RNA was extracted from

cultured glioma cells according to the manufacturer’s

instructions for TRIZOL Reagent (Invitrogen, Carlsbad,

CA). Two micrograms of total RNA was converted to

single-strand cDNA using the first-strand cDNA synthesis

kit (Amersham Biosciences). The resulting cDNA was

subjected to PCR analysis. The PCR amplification mixture,

in a final volume of 25 AL, consisted of 1� Taq DNA

polymerase buffer, 0.2 mM dNTPs, 1.5 mM MgCl2, 0.5 AMof each specific primer and 2.5 U of Taq DNA polymerase

(Invitrogen), according to the manufacturer’s instructions.

The cycle number was chosen such that amplification of the

products was in the liner range with respect to the amount of

input cDNA. Each cycle consisted of 30 s at 948C for

denaturation, 30 s at 608C for annealing and 60 s at 728C for

extension. The PCR products were stained with ethidium

bromide after agarose gel electrophoresis and photographed

using Polaroid film type 667. The sequences of specific

primers were as follows:

O6-MGMT

(sense): ATTAGCAGCCCTGGCAGGCAACCC

(antisense): GAAGACTCGAAGGATGGCTTGAGCC

Cyclophilin

(sense): GGGGAGAAAGGATTTGGCTA

(antisense): AGAGATTACAGGGTATTGCGAG

2.5. Cell uptake studies

The C6 or C6/ACNU cells (1.0�104) were plated in a

24-well plate with 1.0 ml of the culture medium described

Fig. 1. RT-PCR analysis of O6-MGMT in C6 and C6/ACNU cells.

H. Kawai et al. / Nuclear Medicine and Biology 33 (2006) 29–35 31

above for 48 h. Then, the cells were treated with the medium

containing ACNU (0, 1, 5 and 10 Ag/ml) for 1, 3, 6, 12,

18 and 24 h. After the treatment, the cells were washed

twice with cold fresh medium, then the medium was changed

to the uptake medium containing [3H]FLT or [3H]FDG and

incubated for 1 h. Thymidine-free minimum essential

medium (GIBCO) was used for [3H]-FLT studies, and

glucose-free RPMI1640 (GIBCO) was used for [3H]-FDG

studies to avoid the influence from carrier Thd or glucose.

The cells were washed with cold phosphate-buffered saline

(PBS) three times, lysed by 0.5 ml of 0.2 N NaOH, mixed

with liquid scintillation cocktail (ACS II, Amersham

Biosciences) and the radioactivity was measured with a

liquid scintillation counter (LSC-5100, Aloka, Tokyo,

Japan). Protein concentration was determined by DCP

protein assay kit (Bio-rad Laboratories, Hercules, CA).

Relative uptake of the tracer was expressed as disintegra-

tions per minute per milligram protein and compared to

those of untreated controls.

2.6. DNA synthesis analysis

[3H]Thd incorporation into DNA after ACNU treatment

was measured to analyze the primary response to ACNU

treatment. Protocol for [3H]Thd uptake studies followed the

protocol for [3H]FLT uptake studies. After incubation,

[3H]Thd incorporation into DNA was measured following

the method described by Ayusawa et al. [16]. Briefly, the

Fig. 2. The effect of ACNU treatment (1–10 AM) on the cell number in C6 (A) and

studies, 1 S.D.) at each time point.

cells were washed with cold PBS for three times and treated

with 5% trichloroacetic acid, then the residue was washed

with cold 70% ethanol. Acid-insoluble fraction was

collected by centrifugation, dissolved in 0.5 ml 0.2 N

NaOH, then mixed with liquid scintillation cocktail (ACS II,

Amersham Biosciences). The radioactivity was measured

with a liquid scintillation counter (LSC-5100, Aloka).

The cell viability and protein concentration were

determined by trypan blue dye exclusion method and DCP

protein assay kit (Bio-rad Laboratories), respectively.

Relative uptake of the tracer was expressed as disintegra-

tions per minute per milligram protein.

3. Results

3.1. Establishment of C6/ACNU

C6 glioma cells were cultured under the presence of

ACNU to establish ACNU-resistant cell line. When the

treatment was started, the majority of the cultured cells

died, but some survived and started to proliferate

gradually. ACNU concentration was increased stepwise un-

til the IC50 value of the surviving cells reached 26.8 Ag/ml,

approximately 10 times higher than that of the parent

C6 cells (3.68 Ag/ml), and used as C6/ACNU. The

doubling times of C6 and C6/ACNU cells were 18.5 and

20.6 h, respectively. RT-PCR analysis revealed that the

expression of O6-MGMT, a key enzyme for ACNU-

resistance, was higher in C6/ACNU cells compared to

that in C6 cells (Fig. 1).

3.2. The effect of ACNU on cell viability

The effect of ACNU on cell viability in C6 and C6/

ACNU cells is shown in Fig. 2A and B. In all ACNU

dose conditions studied, viable cell numbers of both C6

and C6/ACNU cells were unchanged up to 12 h after

C6/ACNU (B) cell lines. Data are expresses as % of control (average of five

Fig. 3. The effect of ACNU treatment (1–10 AM) on the [3H]Thd incorporation into DNA in C6 (A) and C6/ACNU (B) cell lines. Data are expressed as % of

control (average of five studies, 1 S.D.) at each time point.

H. Kawai et al. / Nuclear Medicine and Biology 33 (2006) 29–3532

treatment when compared to untreated controls. Then, only

C6 cells showed decrease in cell number when treated with

5–10 Ag/ml ACNU.

3.3. The effect of ACNU on DNA synthesis

In the present study, [3H]Thd incorporation into DNA

was used as a marker of DNA synthesis. Fig. 3A shows the

% of [3H]Thd incorporation into acid-insoluble fraction after

various duration (1, 3, 6, 12, 18 and 24 h) and concentration

(1, 5 and 10 Ag/ml) of ACNU treatment in C6 cells

compared to untreated controls. DNA synthesis under

10 Ag/ml of ACNU was suppressed to 50%, 30% and

20% of the control at 1, 18 and 24 h of treatment,

respectively. Suppression was dose-dependent in the range

of 1–10 Ag/ml of ACNU.

In C6/ACNU cells, time course of [3H]Thd incorporation

into DNA showed completely different patterns from those

in control C6 cells (Fig. 3B). In C6/ACNU cells, [3H]Thd

Fig. 4. The effect of ACNU treatment (1–10 AM) on the [3H]FLT uptake in C6 (A)

five studies, 1 S.D.) at each time point.

incorporation into DNA was suppressed to 80% and 58%

after 1 and 3 h of treatment with 10 Ag/ml of ACNU,

respectively. Similar suppression was found also in lower

ACNU concentration groups. However, in longer incubation

periods, [3H]Thd incorporation into DNA was gradually

recovered to the control level.

3.4. The effect of ACNU on [3H]FLT uptake

Fig. 4A and B shows the % control of [3H]FLT uptake

after various duration (1, 3, 6, 12, 18 and 24 h) and

concentration (1, 5 and 10 Ag/ml) of ACNU treatment in C6

and C6/ACNU cells, respectively. In C6 cells, [3H]FLT

uptake was transiently increased to 120–140% of control

after ACNU treatment for 3–6 h, then decreased to 60–40%

after 24 h of treatment. The increase and decrease seemed to

be dose dependent. In C6/ACNU cells, on the other hand,

the increase was found only in the very early stage, namely,

1 h of treatment, then gradually decreased to 80–60% of the

and C6/ACNU (B) cell lines. Data are expressed as % of control (average of

Fig. 5. The effect of ACNU treatment (1–10 AM) on the [3H]FDG uptake in C6 (A) and C6/ACNU (B) cell lines. Data are expressed as % of control (average

of five studies, 1 S.D.) at each time point.

H. Kawai et al. / Nuclear Medicine and Biology 33 (2006) 29–35 33

controls. Nevertheless, both C6 and C6/ACNU cells showed

similar response pattern to ACNU after 18 h of treatment.

3.5. The effect of ACNU on [3H]FDG uptake

Fig. 5A and B shows the % control of [3H]FDG uptake

after various duration (1, 3, 6, 12, 18 and 24 h) and

concentration (1, 5 and 10 Ag/ml) of ACNU treatment in C6

and C6/ACNU cells, respectively. In C6 cells, ACNU

treatment brought complicated response in the early stage

of the treatment but significant suppression in the late stage.

In C6/ACNU cells, on the contrary, high-dose ACNU

treatment induced transient increase of [3H]FDG uptake (5,

10 Ag/ml ACNU, 3 h of treatment), then the uptake went

back to the control level.

4. Discussion

Human glioma usually shows intrinsic multidrug resis-

tance through the expression of membrane-associated P-gp

MDR-1 on stromal vessels [17]. Thus, a non-P-gp-mediated

drug such as ACNU (nimustine hydrochloride) is commonly

used for glioma treatment. ACNU is a cell-cycle-indepen-

dent alkylating agent, which adds a methyl group to DNA

and causes point mutations, mismatch repair or DNA

interstrand cross-links [18], as a result, causing impairment

of DNA synthesis. It is reported that cellular resistance to

antitumor nitrosoureas, such as ACNU, links with the

expression level of O6-methylguanine-deoxyribonucleic

acid methyl transferase (O6-MGMT), which transfers a

methyl group from O6-methylguanine-deoxyribonucleic

acid to repair damaged DNA [12]. Experimentally,

ACNU-resistant glioma cell line can be established by

continuous exposure to ACNU, and the resultant resistant

cells express high level of O6-MGMT [10]. O6-MGMT

expression is also found in nontumor cells and works for

repair of damaged DNA formed by N-nitroso carcinogens

[19]. In tumor patients, expression levels of O6-MGMT in

glioblastoma were inversely correlated with their survival

[20]. Thus, detection of resistance to ACNU in the early

stage of the treatment, in relation to O6-MGMT expression

and DNA synthesis, is of great importance. In the present

study, the C6/ACNU we established (C6/ACNU) was

confirmed to express O6-MGMT mRNA at a high level as

expected, indicating that the resistance to ACNU was

induced through DNA repair by O6-MGMT and provided

a suitable model to study the biochemical changes found in

the resistant cells treated with ACNU.

The effect of ACNU on viable cell number was found

only in C6 cells and only after 18 h of treatment.

Biochemical changes steering cellular responses to ACNU

should occur preceding or accompanying cell death, and

they will make crucial information for prognosis and further

therapy design if properly captured. In the present study, we

focused on the biochemical changes in viable cells by

careful washing of the treated cells after incubation to

remove the contamination of dead cells and expressing the

data as bradioactivity (disintegrations per minute) per

milligram protein.QIn C6 cells, DNA synthesis presented as [3H]Thd

incorporation into DNA was quickly suppressed by ACNU

treatment. This finding agreed well with the proposed

anticancer mechanism of ACNU. In C6/ACNU cells, on the

other hand, DNA synthesis was transiently suppressed after

ACNU treatment but recovered promptly. This finding

indicated that DNA alkylation occurs by ACNU treatment

initially, but highly expressed O6-MGMT repairs DNA,

leading to the recovery of DNA synthesis to the control

level. Thus, monitoring DNA synthesis after acute ANCU

treatment is considered to be useful to identify whether

tumor cells are responders or not.

Fluorine-18-FLT has been developed as a PET tracer for

imaging cell proliferation [4,21]. FLT is believed to be

retained in cells because of specific phosphorylation by the

cell-cycle-regulated enzyme, cytosolic TK1 [22]. TK1

H. Kawai et al. / Nuclear Medicine and Biology 33 (2006) 29–3534

normally functions in the nucleoside salvage pathway to

convert thymidine to thymidine monophosphate, an essen-

tial step before its incorporation into DNA, and the

metabolic trapping of FLT by phosphorylation is considered

to be an indicator of DNA synthesis activity, even though

only a small amount of FLT is actually incorporated into

DNA [22]. On this point, FLT as a DNA synthesis marker

has been proposed to be analogous to FDG as a glycolysis

marker. At least, it has been demonstrated that TK1 activity

is an important determinant of FLT uptake and retention in

cells [23,24].

In the present study, the changes in FLT uptake after

acute ACNU treatment showed complicated patterns in

response to ACNU treatment, which were completely

different from those in [3H]Thd incorporation into DNA.

The transient increase in FLT uptake, possible reflection of

transient induction of TK1 activity, might be a compensation

reaction of the cells to the suppressed DNA synthesis.

Interestingly, both C6 and C6/ACNU cells showed transient

increase, though with slightly different time course; then at

24 h after treatment, both cell lines resulted in suppressed

FLT uptake in a dose-dependent manner. There have been

several reports indicating that FLT uptake well correlated

with proliferation in steady state or spontaneous growth

condition [25,26]. This can be attributed to close correlation

between TK1 activity and cell proliferation under those

conditions. However, in acute suppression of DNA synthe-

sis by DNA alkylation, it is possible or likely that a

compensation system steps in to induce TK1 activity

transiently and, as a result, increase FLT uptake, bringing

in a discrepancy between FLT uptake and proliferation. In

this condition, [3H]Thd uptake itself should be enhanced

also, but amount of [3H]Thd incorporated into DNA should

be decreased because DNA synthesis itself is suppressed.

Dittman et al. [27] reported that cellular FLT uptake in the

early stage of chemotherapy may not reflect the extent of

proliferation inhibition. Our present finding also supports

their conclusion. Decreased uptake of FLT at 24 h found in

resistant C6/ACNU as well as C6 cells was also interesting,

but the mechanism awaits further investigation.

FDG is the most popular PET imaging agent in oncology

as a general marker of energy metabolism. In the present

study, FDG also did not show a well-ordered response

pattern to ACNU in the very early stage of treatment,

namely, bbefore cell-deathQ period (1–12 h). After that, FDG

uptake in C6 cells treated with 5–10 Ag/ml ACNU decreased

significantly at 18–24 h of treatment. This decrease was

comparable to that found in FLT uptake under the same

treatment. On the other hand, C6/ACNU cells showed no

change in FDG uptake, whereas significantly decreased

uptake of FLT was observed under the same condition.

In conclusion, DNA synthetic rate seems to be a good

marker of acquired drug resistance to alkylating agent in

viable cells as Thd uptake showed clearly different patterns

between the resistant and control cells under the treatment.

However, selection of PET tracers for the detection of DNA

synthesis after acute ACNU treatment requires detailed

evaluation. In addition, several factors other than the uptake

by viable tumor cells, such as presence of necrosis and

inflammatory cells in tumor mass, crucially affect the uptake

of radiotracers by tumor mass in in vivo imaging, so our

result cannot be directly applied to clinical situation.

However, present study will provide a base to develop an

appropriate protocol to assess tumor response to treatment

by PET and to design effective treatment plans.

Acknowledgments

This study was partly supported by the 21st Century

COE program bBiomedical Imaging Technology Integration

ProgramQ from Japan Society of the Promotion of Science

(JSPS), grants-in-aid for scientific research (no. 17209041)

from JSPS and research and development project aimed at

economic Revitalization (Leading Project) bResearch and

Development of Technology for Measuring Vital Functions

Merged with Optical TechnologyQ from the Ministry of

Education, Culture, Sports, Science and Technology

(MEXT) Japan.

References

[1] Haioun C, Itti E, Rahmouni A, Meignan M, Reyes F. PET scan in the

therapeutic strategy. Hematol J 2004;5(Suppl 3):S149–53.

[2] Vaidyanathan G, Zalutsky MR. Imaging drug resistance with radio-

labeled molecules. Curr Pharm Des 2004;10(24):2965–79.

[3] Gaa J, Rummeny EJ, Seemann MD. Whole-body imaging with PET/

MRI. Eur J Med Res 2004;9(6):309–12.

[4] Shields AF, Grierson JR, Dohmen BM, Machulla HJ, Stayanoff JC,

Lawhorn-Crews JM, et al. Imaging proliferation in vivo with [18F]FLT

and positron emission tomography. Nat Med 1998;4(11):1334–6.

[5] Sugiyama M, Sakahara H, Sato K, Harada N, Fukumoto D, Kakiuchi

T, et al. Evaluation of 3V-deoxy-3V-18F-fluorothymidine for monitoring

tumor response to radiotherapy and photodynamic therapy in mice. J

Nucl Med 2004;45(10):1754–8.

[6] van Waarde A, Cobben DC, Suurmeijer AJ, Maas B, Vaalburg W,

de Vries EF, et al. Selectivity of 18F-FLT and 18F-FDG for

differentiating tumor from inflammation in a rodent model. J Nucl

Med 2004;45(4):695–700.

[7] Buck AK, Halter G, Schirrmeister H, Kotzerke J, Wurziger I, Glatting

G, Mattfeldt T, et al. Imaging proliferation in lung tumors with PET:

18F-FLT versus 18F-FDG. J Nucl Med 2003;44(9):1426–31.

[8] Barthel H, Cleij MC, Collingridge DR, Hutchinson OC, Osman S,

He Q, et al. 3V-Deoxy-3V-[18F]fluorothymidine as a new marker for

monitoring tumor response to antiproliferative therapy in vivo with

positron emission tomography. Cancer Res 2003;63(13):3791–8.

[9] Shibui S. Randomized controlled trial on malignant brain tumors —

activities of the Japan Clinical Oncology Group-Brain Tumor Study

Group. Neurol Med Chir (Tokyo) 2004;44(4):220–1.

[10] Saito Y, Hotta T, Mikami T, Kurisu K, Kawamoto K, Kiya K, et al.

Establishment of ACNU-resistant rat gliosarcoma cell lines and their

characteristics. Neurol Med Chir (Tokyo) 1991;31(13):846–52.

[11] Thomale J, Huh NH, Nehls P, Eberle G, Rajewsky MF. Repair of

O6–ethylguanine in DNA protects rat 208F cells from tumorigenic

conversion by N-ethyl-N-nitrosourea. Proc Natl Acad Sci U S A

1990;87(24):9883–7.

[12] Mineura K, Fushimi S, Kowada M, Isowa G, Ishizaki K, Ikenaga M.

Linkage between O6-methylguanine-DNA methyltransferase

(O6-MT) activity and cellular resistance to antitumour nitrosoureas

H. Kawai et al. / Nuclear Medicine and Biology 33 (2006) 29–35 35

in cultured rat brain tumour cell strains. Acta Neurochir (Wien)

1990;103(1–2):62–6.

[13] Karran P, Lindahl T, Griffin B. Adaptive response to alkylating agents

involves alteration in situ of O6-methylguanine residues in DNA.

Nature 1979;280(5717):76–7.

[14] Kabuto M, Kubota T, Kobayashi H, Nakagawa T, Kitai R. The

antitumor effect of MX2, a new morpholino anthracycline, against

malignant glioma cell lines and its subcellular distribution. Neurosur-

gery 1995;37(3):471–6 [discussion 476–7].

[15] Mineura K, Watanabe K, Yanagisawa T, Kowada M. Quantification of

O6-methylguanine-DNA methyltransferase mRNA in human brain

tumors. Biochim Biophys Acta 1996;1289(1):105–9.

[16] Ayusawa D, Shimizu K, Koyama H, Kaneda S, Takeishi K, Seno T.

Cell-cycle-directed regulation of thymidylate synthase messenger

RNA in human diploid fibroblasts stimulated to proliferate. J Mol

Biol 1986;190(4):559–67.

[17] Takamiya Y, Abe Y, Tanaka Y, Tsugu A, Kazuno M, Oshika Y, et al.

Murine P-glycoprotein on stromal vessels mediates multidrug

resistance in intracerebral human glioma xenografts. Br J Cancer

1997;76(4):445–50.

[18] Wang J, Chen Z, Xia X, Lu D, Xue J, Ruan C. Improvement of

combination chemotherapy tolerance by introduction of polycistronic

retroviral vector drug resistance genes MGMT and MDR1 into human

umbilical cord blood CD34+ cells. Leuk Res 2002;26(3):281–8.

[19] Engelbergs J, Thomale J, Rajewsky MF. Role of DNA repair in

carcinogen-induced ras mutation. Mutat Res 2000;450(1–2):139–53.

[20] Anda T, Shabani HK, Tsunoda K, Tokunaga Y, Kaminogo M,

Shibata S, et al. Relationship between expression of O6-methyl-

guanine-DNA methyltransferase, glutathione-S-transferase pi in

glioblastoma and the survival of the patients treated with nimustine

hydrochloride: an immunohistochemical analysis. Neurol Res 2003;

25(3):241–8.

[21] Krohn KA, Mankoff DA, Eary JF. Imaging cellular proliferation as a

measure of response to therapy. J Clin Pharmacol 2001;2001(Suppl):

96S–103S.

[22] Kong XB, Zhu QY, Vidal PM, Watanabe KA, Polsky B, Armstrong D,

et al. Comparisons of anti-human immunodeficiency virus activities,

cellular transport, and plasma and intracellular pharmacokinetics of

3V-fluoro-3V-deoxythymidine and 3V-azido-3V-deoxythymidine. Anti-

microb Agents Chemother 1992;36(4):808–18.

[23] Rasey JS, Grierson JR, Wiens LW, Kolb PD, Schwartz JL. Validation

of FLT uptake as a measure of thymidine kinase-1 activity in A549

carcinoma cells. J Nucl Med 2002;43(9):1210–7.

[24] Grierson JR, Schwartz JL, Muzi M, Jordan R, Krohn KA. Metabolism

of 3V-deoxy-3V-[F-18]fluorothymidine in proliferating A549 cells:

validation for positron emission tomography. Nucl Med Biol 2004;

31:829–37.

[25] Buck AK, Schirrmeister H, Hetzel M, Von Der Heide M, Halter G,

Glatting G, et al. Neumaier, 3-deoxy-3-[18F] fluorothymidine-positron

emission tomography for noninvasive assessment of proliferation in

pulmonary nodules. Cancer Res 2002;62(12):3331–4.

[26] Toyohara J, Waki A, Takamatsu S, Yonekura Y, Magata Y,

Fujibayashi Y. Basis of FLT as a cell proliferation marker:

comparative uptake studies with [3H] thymidine and [3H] arabino-

thymidine, and cell-analysis in 22 asynchronously growing tumor cell

lines. Nucl Med Biol 2002;29(3):281–7.

[27] Dittmann H, Dohmen BM, Kehlbach R, Bartusek G, Pritzkow M,

Sarbia M, et al. Early changes in [18F] FLT uptake after chemotherapy:

an experimental study. Eur J Nucl Med Mol Imaging 2002;

29(11):1462–9.