Gene, 72 (1988) 313-322

Elsevier

313

(Supercoiled plasmids; triple DNA hehces; aftinity modification; DNA cleavage)

Valentin V. Vlassov, Sergei A. Gaidamakov, Valentina F. Zarytava, Dimitri G. Knorre, Asya S. Levina, Alla A. Nikonova, Larisa M. Podust and Olga S. Fedorova

Received 5 March 1988 Accepted 31 March 1988 Received by publisher 3 May 1988

SUMMARY

Chemical modification of double-stranded (ds) DNA with alkyiating ohgodeoxynucleotide (ohgo) deriva- tives, 5’-p(N-2-chloroethyl-N-methylamino) benzylamides of oligos, has been investigated. In contrast to relaxed plasmid DNAs, the superhelical molecules interact with the oligo derivatives and specific alkylation of the DNAs occurs at the regions complementary to the ohgo reagents. Alkylating derivatives of ohgo- cytidylates and pT(pCpT), react with corresponding homop~d~~homo~~e tracts within ds DNA fragments due to triple helix formation.

INTRODUCTION

Single-stranded nucleic acids may be mod&d at a definite site with reagents containing ohgo moiety complementary to the nucleotide sequence of the target nucleic acid properly chosen in the vicinity of the site (Belikova et al., 1967). A number of model

Conespondence fo: Dr. V.V. Vlassov, Institute of Bioargauic Chemistry, Siberian Division of the Academy of Sciences of U.S.S.R., Lavrentiev Prospekt 8, Novosibirsk 63oo4to (U.S.S.R.) Tel. (383-2)353152. * Presented at the EMBO/INSERM Workshop on ‘Regulation of Gene Expression by RNA Structure and Anti-messengers’, Les Arcs, Savoie (France) 28 February-4 March X988.

oligos, RNA molecules, and ss DNA fragments were shown to be modified with high level of selectivity using this approach (for a review see Knorre and Vlassov, 1985). However, the approach in its original version apparently cannot be applied to rno~ca~o~ of the selected regions ofthe ds DNA. One can hope, however, to accomplish sequence-specific modifica-

Abbreviations: bp, base pair(s); RSA, bovine serum albumin; Cl RCH,NHpXpX...X, 5’-p(~~2-ehloroethyl-N-methylatninof-

benzylamides of olig~eox~~nncleotide, see ah.0 Fig. f; d, deoxy; dNTP, deoxynucieoside triphosphate; ds, double strand(ed); DlT, dithiothreitoi: EtdRr, ethidium bromide; IdDNA, alkaline denatured supercoiled DNA; nt, nucleotide(s); ohgo, oligodeoxynucleotide; PolIk, Kleuow (large) fragment of E. cali DNA polymerase I; Pu, purine; Py, pyrimidine; SDS, sodium dodecyl sulfate; ss, single strand(ed); c, supercoiling density of circular DNA determined according to Keher (1975).

314

tion of DNA with oligo derivatives when the target DNA is negatively supercoiled. In this case binding

of oligo derivatives to the DNA may be expected due to partial unwinding of the molecules and D-loop formation. Another approach to achieve sequence specific modification of DNA consists in using oligo(dPy) reagents which are capable of forming triple helical complexes with corresponding homo- (Py)-homo(Pu) tracts in ds DNAs (Le Doan et al., 1987; Moser and Dervan, 1987). We investigated the reaction of plasmid DNAs with alkylating oligo derivatives and we have found that the superhelical DNAs react with the derivatives in a sequence- specific way. We have observed also that ds DNA

fragments containing (dG), * (dC), and (dCT), *

(dGA), tracts can be selectively modified in the vicinity of these tracts using alkylating derivatives of oligodeoxycytidylates and oligo pT(pCpT),, respec- tively, under conditions favouring triple-stranded

complex formation.

MATERIALS AND METHODS

(a) Oligudeoxynucleutides and their derivatives

Oligos and their reactive derivatives were synthe- sized according to methods described previously (Knorre et al., 1985; Godovikova et al., 1986) and purified by chromatography on Nucleosil 5-C-18 columns in a methanol gradient. Oligos were labelled at their 5’ ends using T4 polynucleotide kinase and [ y-3ZP]ATP (Radiopreparat, Tashkent, U.S.S.R.).

(b) Plasmids

Plasmid ~160 containing the rearranged gene of mouse K light chain immunoglobulin G (Falkner and Zachau, 1984) was kindly provided by Prof. H.G. Zachau. The 935-bp EcoRI-PstI fragment of this plasmid was cloned in plasmid pUC18. Among the hybrids formed, the plasmid pIG3 was found to contain a shorter 570-bp insert, corresponding to the first 570 bp of the parent EcoRI-PstI fragment.

Plasmid pUR2927b is a derivative of pUR292 with a 2050-bp fragment of the tick-borne encephali- tis virus cDNA. The plasmids were grown in E. coli

K-12lucZdM15 (K12dM15)cells andisolatedusing

the alkaline method (Bimboim and Doly, 1979) fol- lowed by centrifugation in a CsCl gradient. As judged from the electrophoretic analysis, the plasmid prepa- rations contained 5-10% of relaxed DNA. Super- coiled plasmids were prepared by treatment of the plasmids with DNA topoisomerase 1 in the presence of EtdBr. Twenty pg of DNA were incubated at 37°C for 30 min with 5 units of topoisomerase 1 in 100 ~1 of buffer (5 mM Tris - Cl-, pH 7.5, 0.2 M KCl, 5 mM DTT, 0.5 mM EDTA, 100 pg/ml BSA, 20% glycerol) containing lo-100 pg EtdBr/ml. After the incubation, EtdBr and the enzyme were removed by phenol extraction. The superhelicity of the plas- mid preparations produced was determined by two- dimensional electrophoresis according to described procedures (Keller, 1975).

To prepare the circular supercoiled denatured DNA, IdDNA (Camien and Warner, 1986), the supercoiled plasmid DNA (100 pg) was incubated in 100 ~1 of 0.2 M NaOH at 37°C for 30 min. Then 50 ~1 of 3 M Na * acetate, pH 4.8, was added and the DNA was precipitated with 300 ~1 of ethanol. The DNA was collected by centrifugation, washed with 70% ethanol and dissolved in 100 ~1 of 0.01 M Tris + Cl-, pH 8.0, 1 mM EDTA. The content of IdDNA in the DNA preparations was determined by electrophoretic analysis since IdDNA is charac- terised by higher electrophoretic mobility as com- pared to the parent superhelical DNA. The DNA samples prepared according to the described proce- dure contained SO-90% of IdDNA.

(c) DNA fragments

The 302~nt ss DNA fragment containing an oligo(dG) sequence (G17-G34) was prepared and 3’-labelled with [ct-32P]dTTP as described earlier (Vlassov et al., 1987). Conversion of this fragment to partially ds DNA was carried out using PolIk and d(pTGACCCTC’ITCCC)rA as a primer comple- mentary to the nt 261-274 sequence of the fragment. The nt region 275-302 of the fragment remained in an ss form. The reaction mixture contained 0.05 mM offourdNTPs, 10-8Mfragment and2.6 x 10m6M primer in lOO$ of 10 mM Tris * Cl-, pH 7.5,lO mM MgCl,, 50 mM NaCl, 0.1 mM /I-mercaptoethanol. Incubation was carried out in the presence of 0.5 units of PolIk for 10 min at 37°C and stopped by addition of 10 ~1 of 250 mM EDTA, pH 8.3. DNA

315

was isolated by gel electrophoresis in non-denaturing

conditions. To check the completion of the second DNA chain synthesis, the presence of restriction sites PstI (nt 12-17), MspI (nt 166-169), and BspIU (nt 216-219) was determined.

The 120-bp DNA fragment containing the (dCT), - (dGA)6 tract was produced by cleavage of the pU292 7b plasmid DNA with BumHI + HindIII. The 3’ end of the DNA chain, containing the purine tract was labeled at Hind111 site with PolIk. The oligo(dPy)-containing DNA chain was similarly labelled at the BamHI site. The labelled DNA fragments were isolated by electrophoresis in 4% polyacrylamide gel followed by electroelution and ethanol precipitation.

(d) Modification of DNA with the alkylating oligo- deoxynucbtide derivatives

Alkylation of plasmid DNAs was performed at 20°C for 16 h in 0.01 M Tris*Cl-, 0.1 M NaCl, 1 mM EDTA, pH 7.6. Concentrations of the plasmid DNA and the oligo derivatives were 5 x 10 - * M and 5 x 10 - 7 M, respectively. Positions of alkylated

bases in the plasmid DNA were determined using procedures of the genomic sequencing method (Church and Gilbert, 1984). The modified plasmid DNA was digested with ~coI%I and cleaved at posi- tions of the alkylated bases by the hot pipe&line treatment (1 M piperidine, 10 min, 1OO’C). The produced fragments were resolved in 8% poly- acrylamide gel, in 0.05 M Tris borate, pH 8.4 containing 7 M urea. Products of the partial G-specific cleavage of the EcoBI digest of the plas- mid p 160 were separated at the same gel and used as specific markers. After the electrophoresis the DNA fragments were transferred on the nylon membrane using Transfor (LKB) electrophoretic equipment. The membrane was irradiated with W-light (Khandjian, 1986) and hybridization with 5’-32P- labelled oligo I (see Fig. 2) was performed, as de- scribed by Church and Gilbert (1984).

Alkylation of the DNA fragment containing the (dG), - (dC),, tract was performed in 0.1 M NaCl, 0.01 M Na. acetate, 1 mM EDTA, pH 4-7.5 at 25 ’ C. Concentrations of the DNA fragment and the reagent were 1 x lO_sM and 5.2 x 10e4 M, respec- tively. After 25 h incubation the reaction was stopped by addition of 10 ~01s. of 2% LiClO,-acetone solu-

tion. The precipitate was washed with ethanol, re-

dissolved in 1 M piperidine and heated 10 min at 100 ’ C. The DNA fragments were repeatedly precipi-

tated with acetone, dissolved in 5 ~1 of 80% formamide and heated for 1 min at 100” C to com- plete denaturation.

The DNA fragment containing (dCT), * (dGA), tract was modified in 0.01 M potassium biphthalate buffer, pH 4.0-6.2, containing 0.1 M NaCl, 1 mM EDTA. Concentrations of the DNA fragment and the reagent were 1 x 10m8 M and 5 x 10e4 M, respectively. The incubation was performed at 25°C for 25 h. Alkylated DNA was isolated by precipi- tation with 10 ~01s. of 2% LiC104 acetone solution. Cleavage of DNA at alkylated guanosine residues was accomplished by hot piperidine treatment. To cleave DNA at the aIkylated cytosine residues, the DNA was dissolved in 10 ~1 of water. To this solu- tion, 10 ~1 of dioxan and 20 ~1 of hydrazine hydrate were added and the mixture was incubated at 0°C for 30 min (Kirkegaard et al., 1983). DNA was precipitated with ethanol, washed with 5% acetyl- acetone to remove hydrasin hydrate and treated with hot piperidine.

RESULTS AND DISCUSSION

(a) Seque~~ce-specific chemical modification of su- perhelical plasmid DNA with alkylating oligodeoxy- nucleotide derivatives

In the experiments on the modification of super- helical DNAs we targeted alkylating oligo deriva- tives (Fig. 1) to a fragment of the mouse light K-chain immunoglobulin gene cloned in plasmids ~160 and

Cl RCH2NHpX(pX)n

CH2CH2

R = C,,:lNG

Fig. 1. Structure of the alkylating oligoderivatives, 5’-p(N- 2-chloroethyl-N-methylamino) benzylamides of oligodeoxyribo- nucleotide. n, number of nucleotide units X, varying from 9 to 24.

316

EcoRI -150 -130 1

5' 4 AATTCCCCTTGAGTTAAGTGCTOACATGAGCAAGTCT Me tArgThp

. . . . . . CCAGGACTCAGCATGGACATGAGGACC

3’ TCAATTCACGACTGTACTCGTTCA I 3’ TGAGTCGTACCTGTA III

3’ ACGACTGTAC!PCG!P!C II

Hind111

BspR1

PIG3 3200 bp

~160

1OOOObp

Fig. 2. Target DNA sequence in plasmids ~160 and pIG3. In the mouse light K chain immunoglobulin gene, the coding regions L, V, J and C are shown in black. Reactive derivatives (see Fig. 1) of oligos I-III were used for modification of the plasmids.

pIG3. Fig. 2 shows the construction of the plasmids, the target sequence and oligos, to which the reactive groups were coupled. Fig. 3 demonstrates specificity of reaction of the oligo derivatives with the target DNA. Taking into account our data on the reactions of alkylating oligo derivatives with ss DNA (Vlassov et al., 1986), the derivative of oligo III was expected to modify guanosine in position 9 of the immuno- globulin gene. This was found to be the case (Fig. 3) when the denatured plasmid ~160 was treated with the above reagent, and the modification position was determined similarly to the procedure used in the genomic sequencing method (see MATERIALS AND

METHODS, section d). The control experiment (Fig. 3) shows that the reagent does not modify the non-denatured plasmid DNA.

To investigate the effect of the negative super- helicity of DNAs on their interaction with oligos, samples of negatively supercoiled plasmid pIG3 were prepared by treatment of the plasmid with DNA topoisomerase I in the presence of EtdBr (see MATERIALSANDMETHODS, section b). Thesamples were treated with the 5’-32P-labelled alkylating

derivatives of oligos I-III and analysed by electro- phoresis in the agarose gel. Typical results are shown in Fig. 4. In contrast to linearized DNA, the super- coiled plasmid is attacked by the oligo derivative and the extent of modification increases with increasing negative superhelicity. Experiments with alkylating derivatives of oligos II and III demonstrate similar dependence of the reaction on the plasmid super- helicity. Modification occurs at the specific DNA site, as demonstrated by the 32P label incorporation into the 785-bp BspRI fragments of the modified plasmid only (Fig. 5). Under the experimental condi- tions used, plasrnid pIG3 (a = -0.12) was modified by the derivatives of oligos I, II and III to the extent of 0.02, 0.01 and 0.02 mol of reagent per mol of DNA, respectively. These results demonstrate the ability of the oligo derivatives to react with superheli- cal DNA in the absence of other factors influencing the DNA structure.

Since IdDNA (Camien and Warner, 1986) can be used for transfection of E. coli cells, we investigated the reactions of the oligo derivatives with this form of plasmid pIG3. This form of plasmid DNA reacts

1234

C-G +9

Fig. 3. Modification of the plasmid ~160 with the alkylating derivative of oligo III (Fig. 2); 8% polyacrylamide gel (see MATERIALS AND METHODS, section d). Lane 1, guanosine- specific cleavage of the EcoRI digest of the plasmid ~160. Lanes 2-4, alkali-denatured plasmid ~160, plasmid ~160 cleaved at the EcoRI site and circular plasmid ~160 respectively, treated with the alkylating derivative of oligo III. The arrow shows the pro- duct of the specific chemical cleavage of the DNA at the guanosine G9 of the immunoglobulin gene.

with the oligos efficiently (Fig. 4, panel B). Reaction occurs within the 785bp BspRI fragment of the DNA, containing the target nucleotide sequence. Since modification of the IdDNA is achieved easily, this approach may be useful for preparation of plas- mids carrying site-specific modifications and for in-

317

vestigation of the mutations which will be caused by

the modification.

(b) Sequence-specific chemical modification of dsDNA fragments containing dPu * dPy tracts with alkylating oligodeoxyoucleotide derivatives

It is known that poly(dPu) can form triple- stranded complexes with two complementary poly(dPy) chains (Saenger, 1984). Recently in ex- periments with oligo derivatives bearing free radical generating EDTA * Fe(I1) group, it was shown that triple helix formation can be used for sequence- specific modification of ds DNA (Le Doan et al., 1987; Moser and Dervan, 1987). We investigated reactions of alkylating derivatives of oligo(dC) and oligo pT(pCpT), with DNA fragments containing corresponding Py sequences. One of the DNA frag- ments was the 302-bp dsDNA fragment containing the (dG),s * (dC),s sequence in nt position 17-34. This fragment was modified with alkylating reagents C lRCH,RH(pC), (n = 9 or 15). Triple-stranded structures (dC),s * (dG),s(dC + ), were expected to be formed in the mildly acidic medium (Lee et al., 1979). Incubation of the DNA fragment labelled with 32P at 3’-end of the (dG)is- containing a strand with the oligo(dC) derivatives was carried out for 25 h at 25” C. This time corresponds to live half-times of the transformation of the aromatic 2-chloroethylamine group to intermediate ethylene immonium cation (Grineva et al., 1977) which is known to be the rate-limiting step of alkylation by aromatic 2-chloroethylamines. Similar experiments were performed with 3’-end labelled parent ss DNA fragment (See MATERIALS AND METHODS, section c) containing the (dG)is sequence. The experiments were carried out at pH values ranging from 4.0 to 7.5. After piperidine treatment to cleave the modified fragment at the alkylation points, the samples were analysed by gel electrophoresis. Both the ss and ds DNA fragments were found to be selectively alkylated at specific areas (Fig. 6). The ss DNA at pH 7.0 was modified at the 3’ side of the (dG),s sequence in accordance with antiparallel orientation of oligo(dC’) moiety of the reagent within the duplex (Fig. 6). At the same time, ds DNA at pH 4.5 is modified at the 5’ side of the (dG),, sequence, thus indicating parallel orientation of the oligo derivative and the target sequence typical of triple-stranded

318

Fig. 4. M~cation of the plasmid pIG3 with 32P-labekd reactive derivative of oligo I (Fig. 2); 1.2% agarose gel. (Panel A) Lane 1,

linearized DNA ofplasmid pIG3 (cleaved at the Hind111 site); lanes 2-5, superhelical pIG3 DNA; 17 = 0.056,0.08,0.1,0.12, respectively. Left, W-photograph ofthe EtdBr-stained gel. Right, autoradiogram ofthe gel. Arrows show superhelical DNA (I), relaxed circular DNA (II) and linearized DNA (III). (Panel B) IdDNA of plasmid pIG3. Left, UV-photograph of the EtdBr-stained gel. Right, autoradiogram of the gel. Arrows show superhelical DNA (I) and IdDNA (Id).

1 2 3 1 2 3

Fig. 5. BspRI digest ofthe plasmid pIG3 fo = -0.12) treated with reactive derivatives ofoligos I, II and III (lanes 1,2 and 3, respectively); 4% polyacrylamide get. Left, UV-photograph of the EtdBr-stained gel. Right, autoradiogram of the gel. The arrow indicates the BspRI

319

1234

Fig. 6. (Left) Piperidine-treated end-labeled DNA fragments, containing oligo(dG) tract, autoradiograph of the Maxam-Gilbert sequencing gel. Lanes: 1, control ss DNA fragment; 2, the same fragment partially cleaved at guanosine residues according to the Maxam-Gilbert method; 3, the ds fragment incubated with ClRCH,NH(pQ at pH 4.5; 4, the ss DNA fragment incubated with ClRCH,NH(pC)9 at pH 7. (Right) Orientations of the reagent in complexes with dsDNA and ss DNA; open box, oligo(dG)-containing strand; blackened box, oligo(dC)-containing strand.

complex (dG), - (dC), * (dC + ),. To quantitate the DNA fragment downstream from the (dG),s

products, scanning of the gel was performed. It was sequence was observed (not shown) thus indicating

found that the highest modification extent of the ds that triple-stranded complex, consisting of one DNA

DNA fragment is achieved at pH 4.5 optimal for the strand and two reagent molecules can be formed in

triple-stranded complex formation (Fig. 7). It is these conditions.

noteworthy that at pH 4.0-5.0 modification of the ss Another ds DNA fragment subjected to moditica-

4 7X5-bp fragment containing the target nucleotide sequence. The modified DNA fragment demonstrates somewhat lowerklectrophoretic mobility due to the covalent coupling of the oligo derivatives.

320

P ( o\* 1

60

Fig. 7. Effect of pH on reactions of the oligo derivative

4 5 6 7 pt.4

ClRCH,NH(pC), with ds DNA fragment, containing

(de),, ’ (dG),s tract (0); ClR~H~NHpT(pCpT)~ with the ds DNA fragment, containing (Ctf6*(AG)e tract (a) and CIRCH,NH(pC), with ss DNA fragment, containing oligo(dG)

sequence (0).

tion was a 120-bp fragment cont~g (dCT), * (dGA), tract (Fig. 8). The oligo(dPu) containing strand of the fragment was labelled with 32P at the H&d111 site. It was found, that at pH 4-6.4, alkylating reagent C 1 RCI-I,NHpT(pCpT), reacts with the fragment. Electrophoresis under denat~g conditions reveals an ad~tion~ DNA band with lower electrophoretic mobility. Piperidine treatment resulted in complete elimination of this band and formation of the DNA fragment corre- sponding to the product of cleavage of the parent DNA at guanosine G29 (Fig. 9). This guanosine residue could be alkylated only in the case of parallel orientation of the oligo derivative in the complex, suggesting that the reaction proceeded within the ~ple-shaded complex. pH dependence of the reaction shows a maximum at pH 5.3 (Fig. 7), at high pH value, as compared to the reaction with the oligo(dC) derivative. Apparently, the nucleotide composition of the oligo derivative provided a shift

Fig. 9. Modification of the ds DNA Fragment, containing

(dAG), . @C-U, tract with the alkylating derivative ClRCH~N~pT(p~T)~; autora~o~aph of the Maxam-Gilbert sequencing gel. Lanes: 1, the fragment, partially cleaved at guanosine residues according to the Maxam-Gilbert method; 2, piperidine-treated fragment, modified with the oligo derivative; 3, control DNA fragment. Position of G29 in the target event is shown in Fig. 8.

B amHI 10 I

.

t

. ClRCH,~,pTCTCTCTCTCTCT 3

. * . 5’ -G'GATCCCGCATTCrCCCAGCTCGTGGACGAAGAGAGAGAGAGACACC~GCC~- 3’ -CCTAGGGCGTAAGACCGTCGAG~ACCTGCTTCTCTCTCTCTCTCTGTGGAG~GGG- Fig. 8. Target sequence for reagent ClRCH,NHpT(pCpT), in the DNA fragment containing (dPy) . (dPu) tract.

321

of the cytosine pK toward higher pK values. To investigate modification of the other strand of the target DNA which contains poly(dPy) sequence, this chain was labelled at the BumHI site. It was found that the extent of modification of this DNA strand does not exceed 1% under optimal reaction con- ditions. The specificity of the reaction toward the two DNA chains apparently can be explained by the relatively higher nucleophilicity of guanosine residues in one strand as compared to cytidines on the other strand and easy availability of the nucleophilic guanosine atoms N7 on the major DNA groove, where the reagent is bound. The experiments de- scribed demonstrate the possibility to achieve se- quence-specific modification of ds DNA with alkylating derivatives of oligos targeted to oligo(dPu) - (dPy) tracts. The advantage of the alkylating reactive groups over the EDTA * Fe(I1) group is their efficiency over a broad pH range and in the presence of bivalent cations.

Formation of triple-stranded complexes is not a general approach to sequence specific DNA modifi- cation as the approach using the ds complexes. However, its limitations have not been investigated as yet. It is known, that triple-stranded helices may contain both polydeoxyribo- and polyribonucleotide sequences (Sarocchi-Landonsy et al., 1977) and that poly(dR) * poly(dPu) DNAs containing 5-methyl- cytosine instead of cytosine form a triplex at pH below 8 (Lee et al., 1984). Therefore it may be expected that a significant number of ds DNA sites capable of specific modification with oligo deriva- tives may be found in the majority of DNA molecules.

ACKNOWLEDGEMENTS

We thank Prof. H.G. Zachau for providing plas- mid ~160, Dr. A.S. Boutorin for the help in prepa- ration of 32P-labeled reagents, Dr. K.A. Katiani for the sample of DNA topoisomerase 1 and Drs. A.G. Pletnev and V. Yamshikov for the plasmid pUR292 7b.

REFERENCES

Beliiova, A.M., Zarytova, V.F. and Grineva, N.I.: Synthesis of ribonucleosides and diibonucleoside phosphates containing

2chloroethylamine and nitrogen mustard residues. Tetra- hedron L&t. 8 (1967) 3557-3562.

Birnboim, H.C. and Doly, J.: A rapid alkaline extraction proce- dure for screening recombinant plasmid DNA. Nucleic Acids

Res. 7 (1979) 1513. Camien, M.N. and Warner, R.C.: Denaturation of covalently

closed circular DNA. J. Biol. Chem. 261 (1986) 6026-6033. Church, G.M. and Gilbert, W.: Genomic sequencing. Proc. Natl.

Acad. Sci. USA 81 (1984) 1991-1995. Falkner, F.G. and Zachau, H.G.: Correct transcription of an

immunoglobulin K gene requires an upstream fragment containing conserved sequence elements. Nature 310 (1984) 71-74.

Godovikova, T.S., Zarytova, V.F. and Khaliiskaya, L.M.: Reactive phosphamides of mono- and dinucleotides. Bioorg. Khim. 12 (1986) 475-481.

Grineva, N.I., Lomakina, T.S., Tigeeva, N.G. and Chimitova, T.A.: Kinetics of C-Cl bonds ionisation in C(N-2-chloroethyl- N-methyl-amino)benxyl-5’-phosphoamides of nucleosides and oligonucleotides. Bioorg. Khim. 3 (1977) 210-214.

Keller, W.: Determination ofthe number of superhelical turns in simian virus 40 DNA by gel electrophoresis. Proc. Natl. Acad. Sci. USA 72 (1975) 4876-4880.

Khandjian, E.W.: UV crossliig of RNA to nylon membrane enhances hybridization signals. Mol. Biol. Rep. 11 (1986) 107-l 15.

Kirkegaard, K., But, H., Spassky, A. and Wang, J.C.: Mapping of single-stranded region in duplex DNA at the sequence level: single-strand specific cytosine methylation in RNA polymerase-promoter complexes. Proc. Natl. Acad. Sci. USA 80 (1983) 2544-2548.

Knorre, D.G. and Vlassov, V.V.: Complementary-addressed (sequence-specific) modification of nucleic acids. Progr. Nucl. Acids Res. Mol. Biol. 32 (1985) 292-320.

Knorre, D.G., Vlassov, V.V.,Zarytova, V.F. and Karpova, G.G.: Nucleotide and oligonucleotide derivatives as enzyme and nucleic acid targeted irreversible inhibitors. Chemical aspects. Adv. Enzyme Regul. 24 (1985) 277-300.

Le Doan, T., Perrouault, L., Praseuth, D., Habhoub, N., Decout, J.L., Thuong, N.T., Lhomme, J. and Helene, C.: Sequence- specific recognition, photocrosslinking and cleavage of the DNA double helix by an oligo[a]-thymidylate covalently linked to an axidoproflavine derivative. Nucleic Acids Res. 15 (1987) 7749-7760.

Lee, J.C., Johnson, D.A. and Morgan, A.R.: Complexes formed by (pyrimidine),, . (purineX, DNAs on lowering the pH are three-stranded. Nucleic Acids Res. 6 (1979) 210-214.

Lee, J.C., Woodsworth,M.L.,Labimer, L.J.P. and Morgan,A.R.: Poly(pyrimidine) * poly(purine) synthetic DNAs containing 5-methylcytosine form stable triplexes at natural pH. Nucleic Acids Res. 12 (1984) 6603-6614.

Lyamichev, V.I., Mirkin, S.M. and Frank-Kamenetskii, M.D.: Structures of homopurine-homopyrimidine tract in super- helical DNA. J. Biomol. Struct. Dyn. 3 (1986) 667-669.

322

Moser, H.E. and Dervan, P.B.: Sequence-specific cleavage of double helical DNA by triple helix formation. Science 238 (1987) 645-650.

Saenger. W.: Principles of Nucleic Acids Structure. Springer Verlag, New York, 1984, p. 292.

Sarocchi-Landonsy, M.T., Hass, B.L. and Guschlbauer, W.: Interaction of ohgocytidylates with T7 DNA in neutral and

acid media. Biochemistry 16 (1977) 5414-5420.

Vlassov, V.V., Zarytova, V.F., Kutiavin, LV., Mamaev, S.V. and Podyminogin, M.A.: Complementary addressed modification and cleavage of a single stranded DNA fragment with alkylat- ing oligonucleotide derivatives. Nucl. Acids Res. 14 (1986) 4065-4076.

Edited by J.-J. ToulmC.