A Type IV-Secretion-Like System Is Required for Conjugative DNA Transport of Broad-Host-Range...

JOURNAL OF BACTERIOLOGY, Mar. 2007, p. 2487–2496 Vol. 189, No. 60021-9193/07/$08.00�0 doi:10.1128/JB.01491-06Copyright © 2007, American Society for Microbiology. All Rights Reserved.

A Type IV-Secretion-Like System Is Required for Conjugative DNATransport of Broad-Host-Range Plasmid pIP501 in

Gram-Positive Bacteria�

Mohammad Y. Abajy,1 Jolanta Kopec,1,2 Katarzyna Schiwon,1 Michal Burzynski,1† Mike Doring,1Christine Bohn,1 and Elisabeth Grohmann1*

Department of Environmental Microbiology/Genetics, University of Technology, D-10587 Berlin, Germany,1 andInstitute for Chemistry, Karl-Franzens-Universitat Graz, A-8010 Graz, Austria2

Received 21 September 2006/Accepted 24 December 2006

Plasmid pIP501 has a very broad host range for conjugative transfer among a wide variety of gram-positive bacteria and gram-negative Escherichia coli. Functionality of the pIP501 transfer (tra) genes in E.coli was proven by pIP501 retrotransfer to Enterococcus faecalis (B. Kurenbach, C. Bohn, J. Prabhu, M.Abudukerim, U. Szewzyk, and E. Grohmann, Plasmid 50:86–93, 2003). The 15 pIP501 tra genes areorganized in a single operon (B. Kurenbach, J. Kopec, M. Magdefrau, K. Andreas, W. Keller, C. Bohn,M. Y. Abajy, and E. Grohmann, Microbiology 152:637–645, 2006). The pIP501 tra operon is negativelyautoregulated at the transcriptional level by the conjugative DNA relaxase TraA. Three of the 15 pIP501-encoded Tra proteins show significant sequence similarity to the Agrobacterium type IV secretion systemproteins VirB1, VirB4, and VirD4. Here we report a comprehensive protein-protein interaction map of allof the pIP501-encoded Tra proteins determined by the yeast two-hybrid assay. Most of the interactionswere verified in vitro by isolation of the protein complexes with pull-down assays. In conjunction withknown or postulated functions of the pIP501-encoded Tra proteins and computer-assisted prediction oftheir cellular location, we propose a model for the first type IV-secretion-like system encoded by aconjugative plasmid from gram-positive bacteria.

Conjugative plasmid transfer is one of the most importantmechanisms for the spread of antibiotic resistance genes andthereby the emergence of multiple resistant pathogenic bacte-ria. pIP501 is a 30,599-bp plasmid with the broadest knownhost range for a conjugative plasmid originating from gram-positive (G�) bacteria. pIP501 can self-transfer to a variety ofG� bacteria, including pathogens and nosocomial pathogenssuch as streptococci, staphylococci, enterococci, listeria, mul-ticellular Streptomyces lividans, and also to gram-negative(G�) Escherichia coli (32). The pIP501 tra region is organizedin an operon comprising almost half of the plasmid genome. Itbears 15 genes, all of which are putatively involved in conju-gative plasmid transfer. Cotranscription of all 15 tra genes wasshown by reverse transcription-PCR in Enterococcus faecalisJH2-2 (33). The tra genes are transcribed throughout thegrowth cycle of E. faecalis, and their expression level remainsconstant independent of the growth phase. The pIP501 traoperon is negatively autoregulated at the transcriptional levelby the first gene product of the operon, the TraA relaxase (33).The TraA relaxase was biochemically characterized as the en-zyme attacking a specific dinucleotide within oriT, thereby ini-tiating the directed transfer of the plasmid single strand to the

recipient. The TraA relaxase and its amino-terminal relaxasedomain TraAN246 (the first 246 amino-terminal amino acids)were shown to bind to oriT and to the tra operon promoter,Ptra, which partially overlaps with oriT (30, 33).

Three of the 15 tra gene products show significant similaritywith type IV secretion system (T4SS) components required forconjugative DNA transport, DNA transformation, and transferof effector proteins from G� bacteria to eukaryotic hosts (forrecent reviews, see references 14, 15, 34, and 46). Orf5pIP501 isa putative VirB4-like ATPase, Orf7pIP501 is a VirB1-type lytictransglycosylase, and Orf10pIP501 is a putative VirD4-like cou-pling protein (Fig. 1). These proteins are also conserved in thepIP501-related plasmids pRE25 from E. faecalis, pSK41/pGO1from Staphylococcus aureus, and pMRC01 from Lactococcuslactis (in pMRC01, the Orf7 ortholog is missing). Details onthe modular structure of the tra regions of these plasmids andtheir similarities have been summarized by Grohmann et al.(26). The Orf7pIP501 protein has been shown to efficientlycleave peptidoglycan isolated from E. faecalis as well as fromE. coli (C. Sollu and E. Grohmann, unpublished data). Func-tional characterization of the two putative ATPases/ATP bind-ing proteins is in progress.

The T4SSs from G� bacteria have been studied in somedetail on genetic, biochemical, and structural-biological levels,resulting in several models for the assembly and functioning ofthe secretion machinery (1, 14, 34). Many important data forthe construction of the T4SS models and verification of geneticand biochemical data have been derived from protein-proteininteraction studies performed by use of the yeast two-hybridassay, the bacterial two-hybrid assay, and in vitro protein-pro-tein interaction studies (17, 18, 23, 27, 35, 47, 49, 53). To

* Corresponding author. Mailing address: Department of Environ-mental Microbiology/Genetics, FR1-2, Franklinstrasse 28/29, Univer-sity of Technology Berlin, D-10587 Berlin, Germany. Phone: (49)30-31473187. Fax: (49) 30-31473673. E-mail: [email protected].

† Present address: Department of Biochemistry and Molecular Bi-ology, University of Medical Sciences, Poznan, Poland.

� Published ahead of print on 5 January 2007.

2487

on June 9, 2015 by guesthttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

analyze the putative type IV-secretion-like system (T4SLS)encoded by a G� plasmid, we tested all of the 15 pIP501-encoded Tra proteins in a LexA yeast two-hybrid system forinteraction with themselves and each other. Qualitative andquantitative interaction data were obtained and led to a com-prehensive protein-protein interaction map of the pIP501-en-coded Tra proteins. The major Tra protein complexes wereverified in vitro by pull-down assays. On the basis of the inter-action data, computer predictions of the localization of the Traproteins, and functions of some of the Tra proteins, we con-structed an architectural model for the structure of the pIP501-encoded T4SLS.

MATERIALS AND METHODS

Strains and growth conditions. Genotypes and relevant features of all usedstrains are listed in Table 1. E. faecalis JH 2-2 (29) harboring pIP501 wascultivated in brain heart infusion medium (Becton Dickinson, Sparks, MD)supplemented with 20 �g chloramphenicol/ml at 37°C. E. coli JM109 (Promega,Mannheim, Germany), E. coli XL10 (Stratagene, Amsterdam, The Netherlands),and BL21-CodonPlus(DE3)-RIL (Stratagene, Amsterdam, The Netherlands)harboring the expression plasmids or the yeast two-hybrid plasmids (Table 2)were grown in LB medium supplemented with 100 �g ampicillin/ml at 37°C.Saccharomyces cerevisiae L40ccU was grown in yeast extract-peptone-dextrosemedium or in SD medium (Synthetic Drop out; Becton Dickinson, Sparks, MD),lacking the respective amino acids, at 30°C, as described below (see “Yeasttwo-hybrid assay”).

DNA preparation and transformation. Extraction and purification of plasmidDNA from E. coli were performed using a QIAGEN kit (QIAGEN, Hilden,Germany) or a Gen Elute plasmid miniprep kit (Sigma-Aldrich, Taufkirchen,Germany). Restriction endonucleases were purchased from Promega (Mann-heim, Germany) and New England Biolabs (Frankfurt am Main, Germany), T4DNA ligase and shrimp alkaline phosphatase were from Roche Diagnostics(Mannheim, Germany), Gen Therm DNA polymerase was from Rapidozym(Berlin, Germany), and Taq DNA polymerase was from GenScript (ScotchPlains, NJ). Synthetic oligonucleotides were purchased from Sigma-Aldrich(Taufkirchen, Germany) or MWG Biotech (Ebersberg, Germany). The enzymeswere used as specified by the suppliers. PCR fragments for cloning experimentswere purified by use of a Wizard SV gel and a PCR Clean-Up system (Promega,Mannheim, Germany). Preparation of competent cells and E. coli transforma-tions with plasmid DNA were performed by standard methods (43). Yeasttransformations were carried out by the lithium acetate method (45).

Cloning of tra genes for protein-protein interactions. (i) Yeast two-hybridassay. The pIP501 tra genes were amplified by PCR using the primers listed inTable 3. They were inserted as SalI/NotI DNA fragments into SalI/NotI-cutpBTM117c and pGAD426 plasmids. The nucleotide sequences of the insertionswere verified by dideoxy chain termination sequencing in an automated se-quencer (ABI prism 310; Perkin Elmer, Rodgau, Jugesheim, Germany) per-formed by Services in Molecular Biology (Berlin, Germany).

(ii) Pull-down assays. The pIP501-borne tra genes were amplified by PCRusing the primers listed in Table 3. They were inserted as SalI/NotI DNAfragments into the SalI/NotI-cut seven-histidine-tag plasmid pQTEV (a gift fromK. Bussow, Max Planck Institute for Molecular Genetics, Berlin) and the gluta-thione S-transferase tag plasmid pGEX-6P-2. orf1 was inserted as a BamHI/KpnIfragment into the BamHI/KpnI-cut six-histidine tag plasmid pQE30 (QIAGEN,Hilden, Germany). orf1N246, encoding the first 246 amino acids of Orf1, was

TABLE 1. Bacterial and yeast strains used in this work

Strain Genotype/relevant features Reference/source

Escherichia coliXL 10 Gold �(mcrA)183 �(mcrCB-hsdSMR-mrr)173 endA1 supE44 thi-1 recA1 gyrA96 relA1

lac Hte �F� proAB lacIqZ�M15 Tn10(Tetr) Amy Cmr�Stratagene

BL21-CodonPlus(DE3)-RIL F� ompT hsdS(rB� mB

�) dcm� Tetr gal � (DE3) endA Hte �argU ileY leuW Cmr� StratageneJM109 recAl endA1 gyrA96 thi hsdR17 supE44 relA1 �(lac-proAB) �F� traD36 proAB.lacIq

lacZ�M15�Promega

Enterococcus faecalisJH 2-2 Rifr Fusr 29

Saccharomyces cerevisiaeL40ccU Derived from L40c (54) uracil prototroph E. Wanker, MDC,

Berlin, Germany

FIG. 1. Organization of the pIP501 tra region. The overlapping oriT and Ptra regions are indicated (not to scale). The operon (orf1 toorf15) is terminated by a putative strong rho-independent termination signal (hairpin). Hatched segments indicate genes encoding proteinssimilar to those identified in G� bacterial T4SSs. The Orf5 protein shows conserved features, a nucleotide binding site motif A (Walker Abox 250GLSGGGKT257) and a motif B (Walker B box 509DEFHFLL515), of proteins belonging to the VirB4 family of nucleoside triphosphate-binding proteins (COG3451). Orf10 is a member of the pfam02534 family of TraG/TrwB/TraD/VirD4 coupling proteins. It shows the P-loopmotif (Walker A box) and a Walker B motif for nucleotide binding. Orf7 (a VirB1 homolog of the Agrobacterium T-DNA transfer system)contains the SLT domain present in bacterial lytic transglycosylases and was shown to cleave peptidoglycan isolated from E. faecalis and E.coli in an in vitro muramidase assay (Sollu and Grohmann, unpublished data). Open reading frames whose corresponding gene productscontain potential signal peptide sequences are marked with a black wedge within the segment.

2488 ABAJY ET AL. J. BACTERIOL.


.org/D

ownloaded from

http://jb.asm.org/

cloned into the unique BamHI and HindIII sites of pQE30 (30). In the maltosebinding protein (MBP) fusion vector pMAL-c2X, the tra genes were inserted asEcoRI/SalI fragments. The nucleotide sequences of the insertions were verifiedby dideoxy chain termination sequencing in an automated sequencer (ABI prism310; Perkin Elmer, Rodgau, Jugesheim, Germany).

Yeast two-hybrid assay. A general description of the two-hybrid system hasbeen detailed elsewhere (21). Before being used in the two-hybrid assay, all 15pBTM117c-tra plasmids were transformed into the yeast L40ccU strain (a kindgift of E. Wanker, MDC Berlin, Germany), and the resulting transformants weretested for the absence of autoactivation of the lacZ and HIS3 reporter genes. Inorder to test for protein-protein interaction, the pBTM117c and pGAD426plasmids carrying the respective tra genes were cotransformed into the yeastL40ccU strain and plated on SD minimal medium lacking leucine and trypto-phan. After incubation at 30°C for 2 to 3 days, the transformants were replicaplated on SD medium lacking leucine, tryptophan, and histidine and with galac-tose and raffinose as sugar sources (SD-leu-tryp-his/gal/raff medium) and incu-bated at 30°C for 3 to 10 days for selection of interacting proteins. From theSD-leu-tryp-his/gal/raff plates, replica filters were made and cells were perme-abilized by freezing in liquid nitrogen (10 s) and thawing at room temperature.Filters were transferred onto Whatman 3MM paper saturated with X-Gal (5-bromo-4-chloro-3-indolyl--D-galactopyranoside acid) solution (10) and incu-bated at 37°C. -Galactosidase-positive clones were tested further by a quantitative-galactosidase assay with CPRG (chlorophenol red--D-galactopyranoside) as thesubstrate. A single colony from the SD-leu-tryp-his/gal/raff plate was inoculatedinto 5 ml SD-leu-tryp-his/gal/raff medium and grown overnight at 30°C. A 1-mlaliquot of this preculture was used to inoculate 5 ml of fresh SD-leu-tryp-his/gal/raff medium. The cells were grown to an A600 of 0.5 to 0.8; the exact A600 wasrecorded. A 1.5-ml aliquot of this culture was centrifuged at 14,000 g for 30 sto harvest the cells. The cells were resuspended in 0.3 ml of buffer 1 (HEPES,2.38%; NaCl, 0.9%; L-aspartate, 0.065%; bovine serum albumin, 1%; Tween 20,0.05% [pH 7.3]; with a concentration factor of 5). A 0.1-ml aliquot of the cellswas permeabilized by two freeze/thaw cycles in liquid nitrogen and a 37°C waterbath. A solution of 0.7 ml of buffer 2 (2.23 mM CPRG in buffer 1) was added andvigorously mixed. Cells were incubated at 37°C until the samples developed a redcolor. To stop color development, 3 mM ZnCl2 (0.5 ml) was added. Sampleswere centrifuged at 14,000 g for 1 min to pellet cell debris. The A578 wasmeasured, and the number of -galactosidase units was calculated with thefollowing formula: -galactosidase units � 1,000 [A578/(t V A600)] (36,37), where t is the elapsed time (in min) of incubation, V is 0.1 concentrationfactor (5), and A600 is the value for 1 ml of sample.

Expression of fusion proteins. E. coli XL10 or BL21-CodonPlus(DE3)-RILharboring the recombinant expression plasmids was inoculated into 10 ml of LBbroth containing 100 �g/ml ampicillin and 50 �g/ml chloramphenicol and grownovernight at 37°C. The preculture was used to inoculate 200 ml of fresh LB brothcontaining the same antibiotics. The cells were grown at 37°C to A600s of 0.3(7His-Orf8, 22.4 kDa), 0.6 (MBP-Orf7�TMH, 78.5 kDa; 6His-Orf1, 78.6kDa; 6His-Orf1N246, 31.6 kDa; and 7His-Orf15, 33.6 kDa), 0.8 (MBP-Orf4,65.5 kDa; 7His-Orf10, 66.2 kDa; 7His-Orf12, 36.1 kDa; and GST-Orf14, 42.2kDa), or 1.0 (MBP-Orf5, 119.2 kDa; MBP-Orf10, 106.4 kDa; 7His-Orf5, 77.8kDa; and 7His-Orf7, 44.1 kDa) and induced by the addition of isopropyl--D-thiogalactopyranoside (IPTG). Gene expression was induced overnight, with theexception of Orf7 fusions, which were induced only for 3 h due to the cell toxicityof the protein. MBP-Orf7�TMH expression was induced by the addition ofIPTG to a concentration of 0.5 mM. Protein synthesis of all other proteins wasinduced with 1 mM IPTG. The solubility of each protein or protein fragment wasassessed by harvesting the cells, resuspending them in 10 ml of lysis buffer [100mM K2HPO4/KH2PO4, 50 mM (NH4)2SO4, 1% Triton X-100 (pH 7)], lysingthem by the addition of lysozyme (1 mg/ml), and administering ultrasonic treat-ment. The cell debris was pelleted by centrifugation, and the supernatant was

analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by Coomassie blue staining. Partial solubility of 7His-Orf10was achieved by the following procedure: the cell pellet was resuspended in 20mM Tris-HCl, 300 mM NaCl, 1 mM EDTA (pH 7.5). Lysozyme was added to afinal concentration of 1 mg/ml, and the samples were incubated on ice for 20 minand centrifuged at 16,000 g at 4°C for 20 min. The pellet was washed twice with50 mM EDTA (pH 8.0) and centrifuged at 16,000 g at 4°C for 10 min. Thepellet was partially dissolved in buffer A (8 M urea, 20 mM Tris-HCl, 500 mMNaCl, 10 mM imidazole [pH 7.5]) and centrifuged at 30,000 g at 4°C for 30min. The supernatant was loaded onto a Ni2� charged HiTrap chelating column(Amersham Biosciences, Freiburg, Germany) equilibrated with buffer A. The7His-Orf10 protein was eluted in a 10-column-volume gradient with buffer B (8M urea, 20 mM Tris-HCl, 500 mM NaCl, 250 mM imidazole [pH 7.5]) andconcentrated in a Centricon centrifugal filter unit (Millipore, Schwalbach, Ger-many) with a 30-kDa cutoff. The concentrated protein solution was loaded ontoa HiTrap desalting column (Amersham Biosciences, Freiburg, Germany) equil-ibrated with 30 mM Tris-HCl, 300 mM NaCl, 20 mM MgCl2 (pH 7.5). To assessthe integrity and purity of the 7His-Orf10 protein, an aliquot of the purifiedprotein was loaded onto a 10% SDS polyacrylamide gel, followed by Coomassieblue staining. 7His-Orf10 was purified to approximately 80% homogeneity (J.Kopec and E. Grohmann, unpublished data).

In vitro binding experiments. E. coli BL21-CodonPlus(DE3)-RIL lysate orE. coli XL10 lysate with the expression plasmid (pMAL-c2X, pQTEV/pQE30,or pGEX-6P-2) containing the inserted traX gene was mixed with the putativeinteraction partner (E. coli lysate with pQTEV-/pQE30-, pGEX-6P-2-, orpMAL-c2X-traY or partially purified TraY protein) and incubated for com-plex formation for 30 to 60 min at room temperature. The complex wasloaded onto amylose magnetic beads (New England Biolabs, Frankfurt amMain, Germany) and purified as specified by the manufacturer. Alternatively,the mixture of two E. coli lysates was loaded onto Ni-nitrilotriacetic acid(NTA) spin columns (QIAGEN, Hilden, Germany), and the protein complexwas eluted as specified by the manufacturer, mixed with SDS sample buffer,and after heat denaturation, loaded onto SDS-polyacrylamide gels with theappropriate percentage of acrylamide (6 to 12%). Two gels were made percomplex: one was stained with Coomassie brilliant blue (Merck, Darmstadt,Germany), and the other was used for Western blotting. The separatedproteins were blotted onto nitrocellulose membranes (Bio-Rad, Munchen,Germany) using liquid transfer for 1.5 h at 90 mA (Mini ProteanIII system;Bio-Rad, Munchen, Germany). The membranes containing the transferredproteins were initially incubated in the blocking solution (QIAGEN, Hilden,Germany). The seven-histidine-tag fusion protein (six-histidine-tag fusionprotein for Orf1) was detected by incubating the membrane with 5 ml offive-histidine horseradish peroxidase (HRP) conjugate (QIAGEN; dilution,1:5,000), the MBP fusion protein was detected by incubation with 5 ml ofanti-MBP HRP conjugate (New England Biolabs; dilution, 1:5,000), and theGST fusion protein was detected by incubation with 5 ml of anti-GST HRPconjugate (Roche Diagnostics; 1:5,000 dilution) for 1 h at room temperature.The signal was visualized by using the ECL Western blot detection kit(Pierce, Perbio Science, Bonn, Germany) followed by autoradiography.

Cross-linking experiment with 7�His-Orf10. Cross-linking of 7His-Orf10was performed as described by Kopec et al. (30) with minor modifications. Thereaction volume of 50 �l consisted of 0.5 mg/ml protein, 100 mM Bicine (pH 7.5),300 mM NaCl, 1 mM dithiothreitol, and various concentrations of glutaralde-hyde (0.002%, 0.003%, 0.004%, 0.005%, 0.006%, 0.007%, 0.008%, and 0.01%[vol/vol]). The reaction was stopped after 15 min by the addition of 1 M glycine(pH 8.0), to a final concentration of 140 mM. The samples were incubated foranother 5 min. The proteins were precipitated with 400 �l of cold acetone for 2 hat �20°C and centrifuged at 15,000 g for 15 min at room temperature. Priorto being loaded onto a 10% (wt/vol) polyacrylamide gel in the presence of SDS,

TABLE 2. Plasmids used in this work

Plasmid Replicon Size (kb) Relevant features and antibiotic resistancea Reference/source

pIP501 pIP501 30.6 tra� Cmr MLSr 20pBTM117c ColE1/2�m 9.3 PADH1 lexA TRP1 Apr CAN1 E. Wanker, MDC, Berlin, GermanypGAD426 ColE1/2�m 7.8 PADH1 GAL4 LEU2 CYH2r Apr E. Wanker, MDC, Berlin, GermanypQTEV pMB1/ColE1 4.8 Pt4 lacIq His7 Apr 44pGEX-6P-2 pBR322 4.9 Ptac lacIq GST Apr Amersham BioSciencespMAL-c2x pMB1/M13 6.7 Ptac lacIq malE Apr New England BioLabs

a MLS, macrolide, lincosamide, streptogramin B; Cm, chloramphenicol; Ap, ampicillin; CAN1, S. cerevisiae CAN1 gene; CYH2r, resistance to cycloheximide.

VOL. 189, 2007 TYPE IV-SECRETION-LIKE SYSTEM IN G� BACTERIA 2489


.org/D

ownloaded from

http://jb.asm.org/

TABLE 3. Oligonucleotides used in this work

Function and name Sequence (5�–3�)c Position

Insertion into pBTM117c, pGAD426,pQTEV, and pGEX6P-2

orf1-SalI-fw CTCGGGTCGACAAGAGAGGTGATACAATTGG 1378–1397a

orf1-NotI-rev CGCTCGCGGCCGCTTTATACACCTCTTGTTT 3385–3402a

orf2-SalI-fw GGCGTCGACAGAGGTGTATAAAATGA 3390–3406a

orf2-NotI-rev CCTGCGGCCGCCTTCTCTATTAAGCAA 3728–3743a

orf3-SalI-fw GCGGTCGACGAGAAGGGAGTTAGTTATG 3738–3756a

orf3-NotI-rev TGGCGCGGCCGCACAATTAAATCACCAC 4142–4157a

orf4-SalI-fw GCGGTCGACAAGCGATACGATGAAAGA 4201–4218a

orf4-NotI-rev CTTGCGGCCGCTCCTAACTATTCAAAAC 4769–4785a

orf5-SalI-fw GCCTCGTCGACAATAGTTAGGAGCGTTAAA 4775–4793a

orf5-NotI-rev TGCTCGCGGCCGCTCTCCCTTCTATTGAATTT 6745–6763a

orf6-SalI-fw GGCGTCGACATTCAATAGAAGGGAGAAA 6747–6765a

orf6-NotI-rev TTCGCGGCCGCAATCACCAACCTTCCTA 8119–8135a

orf7-SalI-fw CCGTCGACATTTCATATCA 33–43b

orf7-NotI-rev CTCGCGGCCGCAACTCCATTTCTT 1160–1172b

orf8-SalI-fw GCGGTCGACGGAAGAAATGGAGTTTGA 1158–1175b

orf8-NotI-rev GGCGCGGCCGCTTCTACTCCTCTCCTA 1703–1718b

orf9-SalI-fw GGCGGTCGACAAGCATGGCGAAGAAGA 1717–1733b

orf9-NotI-rev GCTTGCGGCCGCCTAATAAACTAGTCA 2146–2160b

orf10-SalI-fw GGCCTGTCGACGGGAAAAATGACTAGTTTATTAGC 2138–2161b

orf10-NotI-rev TGCTTGCGGCCGCCATTTGATTTCCTCCGATCT 3801–3820b

orf11-SalI-fw GGCGTCGACCGGAGGAAATCAAATGAA 3805–3822b

orf11-NotI-rev GCTTGCGGCCGCTAAATCCATTAGTAAA 4734–4749b

orf12-SalI-fw GCTTGTCGACGAGGTGTTTACTAATGG 4728–4744b

orf12-NotI-rev GCTTGCGGCCGCCTCTCTTATTTTCTGA 5663–5678b

orf13-SalI-fw GGCCGTCGACATTGTCTTATTATTTTG 5689–5705b

orf13-NotI-rev CCGGCGGCCGCTTTAGCGTATTTCAGTT 6653–6669b

orf14-SalI-fw GCGGTCGACGAGTGCTGAAACAATGGGA 6674–6692b

orf14-NotI-rev GGCGCGGCCGCAATATGCTTTATCTGA 7048–7063b

orf15-SalI-fw GGCGTCGACAGGAGAGAAGAAAATGAAA 7102–7120b

orf15-NotI-rev GCTGCGGCCGCCTTAATTAGATTCTCTT 7951–7968b

Insertion into pMAL-c2Xorf4-EcoRI-fw GCCGAATTCAGCGATACGAGGAAAGA 4202–4218a

orf4-SalI-rev GCCGTCGACCTCCTAACTATTCAAAAC 4769–4786a

orf5-EcoRI-fw GCGGAATTCGTTAAA ACG GAG AAG ATA 4788–4805a

orf5-SalI-rev GGCGTCGACTCCCTTCTATTGAAT TT 6745–6760a

orf7-EcoRI-fw TCCGAATTCTTTCATATCATGGGA 34–48b

orf7-SalI-rev CTCGTCGACAACTCCATTTCTTCCT 1157–1172b

orf7�tmh-EcoRI-fw TCCGAATTCCTAGCAACAGAA 178–189b

orf10-EcoRI-fw GCGGAATTCATGACTAGTTTA 2145–2156b

orf10-SalI-rev GCGGTCGACTTAAAATGGTAA 3789–3800b

Sequencing primerspBTM-seq-fw TCGTAGATCTTCGTCAGCAG 956–976pBTM-seq-rev AGCAACCTGACCTACAGG 1201–1218pGAD-seq-fw TACCACTACAATGGATGATGT 758–778pGAD-seq-rev GCACAGTTGAACTGAACTTGC 899–919pQTEV-seq-fw CCCGAAAAGTGCCACCTG 4712–4729pQTEV-seq-rev GTTCTGAGGTCATTACTGG 277–295pGEX-seq-fw GGTCTGGCAAGCCACGTTTG 869–888pGEX-seq-rev CCGGGAGCTGCATGTGTCAGAGG 1035–1057pMAL-seq-fw ACGCGCAGACTAATTCGAGC 2618–2637pMAL-seq-rev AAGGCGATTAAGTTGGGTAACG 2778–2799orf1-550-seq-fw TGTTTCTGAAATTCGTAAAG 1960–1979a

orf1-1125-seq-fw AAGTTAGAGCAATGGTTAAT 2541–2560a

orf5-center-seq-fw GCTGTTGAGGTATGCTAAAT 5236–5282a

orf5-center-seq-rev CACGTTGTATCGCAAGTGGA 6241–6260a

orf10-center-seq-fw ATCCACGCTATAACGAAGAAG 2650–2670b

orf10-center-seq-rev GCTTTCTGACTTACTTCCGCT 3318–3338b

a GenBank accession number L39769.b GenBank accession number AJ505823.c Added restriction sites and exchanged nucleotides are shown in bold.



.org/D

ownloaded from

http://jb.asm.org/

the pellets were dissolved in loading buffer consisting of 50 mM Tris-HCl (pH6.8), 2 mM EDTA, 2% (wt/vol) SDS, 0.1% (wt/vol) bromophenol blue, 10%(vol/vol) glycerol, and 150 mM -mercaptoethanol and heated to 95°C for 5 min.The samples were electrophoresed at a constant voltage of 180 V and stainedwith Coomassie brilliant blue.

RESULTS

To determine protein-protein interactions of the pIP501-encoded Tra proteins, we selected the yeast two-hybrid methodthat detects proteins capable of interaction with a known pro-tein. The method has the advantage of immediate availabilityof the cloned genes for the interaction proteins. The interac-tions are identified in vivo in Saccharomyces cerevisiae throughreconstitution of the activity of a transcriptional activator (13).The yeast two-hybrid screen identified 18 protein-protein in-teractions of pIP501-encoded Tra proteins in total; seven ofthese interactions were strong, resulting in more than 20 -ga-lactosidase units (Table 4).

Protein-protein interactions of T4SLS proteins. The TraADNA relaxase (Orf1) was shown to dimerize by in vitro cross-linking experiments (30). TraA self-interaction was confirmedby the yeast two-hybrid screen (Table 4).

The putative ATPase Orf5 interacts with itself and withOrf4, Orf7, and Orf14. The VirB4-like putative ATPase Orf5(653 amino acids) was shown to strongly interact with itself(111.8 -galactosidase units) (Table 4). It also interacts withtwo non-T4SLS proteins, Orf4 and Orf14, which are predictedto be located at least partially in the cytoplasm. Orf5 alsobound to the lytic transglycosylase Orf7. This interaction couldpossibly help recruit the putative energizing protein Orf5 to itslocation in the transfer complex.

The lytic transglycosylase Orf7 interacts with itself and withOrf2, Orf5, Orf10, and Orf14. Orf7 (369 amino acids) demon-strated five different interactions with pIP501-encoded Tra

proteins. The protein was shown to interact with all T4SLSproteins encoded by the pIP501 tra operon. It bound to theputative ATPase Orf5, formed homodimers, and bound to theputative coupling protein Orf10. Orf7 self-interaction is inagreement with dimerization of the lytic transglycosylaseVirB1 of the Agrobacterium transfer DNA (T-DNA) transfersystem shown by Ward et al. (53). Putative intermediate com-plex formation between Orf7 and Orf10 could aid in transport-ing the coupling protein to its location in the T4SLS complex.The Orf7-Orf10 interaction is an interaction specific for G�bacteria which has not shown before for any of the T4SSs fromG� bacteria. Orf7 also bound to the predicted cytoplasmicmembrane protein Orf2 and to the Orf14 protein.

The putative coupling Orf10 binds to Orf1, Orf6, and Orf7.Orf10 was excluded as a bait from the screen, as it showedautoactivation when orf10 was cloned into the bait plasmidpBTM117-c. But when Orf1, Orf6, or Orf7 was used as a bait,Orf10 associated with these proteins, showing a very stronginteraction with the Orf6 protein (95.3 -galactosidase units)(Table 4). The proposed interaction with the TraA relaxaseOrf1 was not convincingly shown by the genetic screen (Table4) and therefore had to be verified by the in vitro pull-downassay (see below) (Table 4).

Protein-protein interactions of non-T4SLS proteins. Mostinteractions were shown for the Orf14 protein, five interactionsin total, including those with the T4SLS proteins Orf5 andOrf7. Orf14 proved to self-associate and to bind to the putativemembrane-associated Orf8 protein and the cytoplasmic mem-brane protein Orf12 (six or seven predicted transmembranehelices [TMH]). Orf6 bound weakly to the Orf3 protein (oneor two predicted TMH). The predicted cytoplasmic membraneprotein Orf9 (two TMH) interacted strongly with the Orf3protein. Orf15 is postulated to be located in the cell wallassociated with the cytoplasmic membrane protein Orf12. Thisinteraction could enable formation of the outermost part of theDNA/protein secretion machinery.

Most of the in vivo-detected protein-protein interactions wereverified by in vitro pull-down assays with differently (six-histidine-/seven-histidine-, GST-, or MBP-) tagged Tra proteins. All in vitroprotein-protein interaction data are summarized in Fig. 2 andTable 4.

Interactions probably involved in recruitment of Tra pro-teins to the T4SLS complex (Fig. 2A). The interaction of thelytic transglycosylase Orf7 with the putative core complex pro-tein Orf14 was verified by the isolation of a 7His-Orf7–GST-Orf14 complex, association of Orf7 with the putative ATPaseOrf5 by isolation of a 7His-Orf5–MBP-Orf7�TMH complex.Binding of MBP-Orf7�TMH to the putative coupling proteinOrf10 was confirmed by pulling down a complex consisting ofMBP-Orf7�TMH and 7His-Orf10 from the amylose mag-netic beads.

Interactions of postulated core complex components. Asso-ciation of Orf8 with Orf14, thought to constitute an importantpart of the translocation complex in the cytoplasmic mem-brane, was confirmed by complex formation between 7His-Orf8 and GST-Orf14 (Fig. 2B). Interaction of the cytoplasmicmembrane protein Orf12 (six or seven predicted TMH) withOrf14 has been shown by isolation of a 7His-Orf12–GST-Orf14 complex.

TABLE 4. pIP501 Tra protein-protein interactions detected by theyeast two-hybrid system

Bait Prey Growtha ß-Galactosidaseunits

Fold increase inß-galactosidase

activityb

Pull-downassay

Orf1 Orf1 � 9.4 39.1Orf1 Orf10 � 1.1 4.5 �Orf4 Orf5 �� 91.2 380 �Orf5 Orf5 �� 111.8 465.8 �Orf5 Orf7 �� 5.9 24.5 �Orf6 Orf3 � 1.1 4.5Orf6 Orf10 �� 95.3 397 �Orf7 Orf2 � 19.2 80Orf7 Orf5 � 0.75 3.1 �Orf7 Orf7 �� 31.8 132.5 �Orf7 Orf10 �� 34 141.6 �Orf7 Orf14 � 13.8 57.5 �Orf9 Orf3 �� 34.4 143.3Orf14 Orf5 �� 7.8 32.5 �Orf14 Orf8 �� 35.7 148.7 �Orf14 Orf12 �� 7.2 30 �Orf14 Orf14 �� 0.8 3.3Orf15 Orf12 � 0.9 3.8

a Growth on SD-leu-tryp-his/gal/raff medium was observed after 3 days(��), after 4 to 7 days (��), or after more than 7 days (�).

b Increase of ß-galactosidase units compared with bait/prey plasmids withoutinserts.



.org/D

ownloaded from

http://jb.asm.org/

Interactions of the putative coupling protein Orf10. Theweak interaction in the yeast system between the Orf1(TraA relaxase) and the Orf10 coupling protein was provenin vitro by complex formation between 6His-Orf1 andMBP-Orf10 (Fig. 2C). This interaction is a further hint forthe putative coupling role of Orf10. Orf10 is thought to linkthe relaxosome consisting of Orf1 bound to single-strandedpIP501 DNA with the T4SLS complex. 6His-Orf1N246,containing the 246 amino-terminal amino acids of the relax-ase (the relaxase domain), did not support complex forma-

tion with MBP-Orf10. The postulated Orf10 self-associationwas convincingly confirmed by glutaraldehyde cross-linking.At glutaraldehyde concentrations between 0.002% and0.005%, predominantly dimeric 7His-Orf10 forms ap-peared in the 10% SDS polyacrylamide gel, whereas at aglutaraldehyde concentration of 0.01%, only multimericforms were detectable (Fig. 3). Preliminary gel filtrationexperiments with purified 7His-Orf10 confirmed theoligomeric structure of Orf10 (M. Saleh, W. Keller, and E.Grohmann, unpublished data). With the yeast two-hybrid sys-



.org/D

ownloaded from

http://jb.asm.org/

tem, Orf10 dimerization could not be tested due to autoacti-vation of Orf10 in fusion with the BD domain of pBTM117c.Orf10 also interacted with the lytic transglycosylase Orf7 (seeabove).

Interactions of the putative ATPase Orf5. The most impor-tant Orf5 protein interactions could be proven by biochem-ical assays. Orf5 was shown to dimerize (Orf5-Orf5 was oneof the strongest in vivo interactions); to interact with thesoluble protein Orf4 and the lytic transglycosylase Orf7; and

to associate with one of the postulated core componentproteins, the Orf14 protein (Fig. 2D).

Homotypic interaction of the lytic transglycosylase Orf7(Fig. 2E). ORF7 could be isolated as a 7His-Orf7–MBP-Orf7�TMH complex from a Ni affinity column. Orf7 couldfulfill a bifunctional role in the T4SLS process: its amino-terminal specific lytic transglycosylase (SLT) domain wasshown to efficiently cleave peptidoglycan (Sollu and Grohm-ann, unpublished data), and its carboxy-terminal portion is

FIG. 2. In vitro binding assays. (A to E) SDS-PAGE gels (left panels) and corresponding Western blots (right panels). (A) Interactionsprobably involved in recruitment of Tra proteins to the T4SLS complex. (A1) 12% SDS-PAGE. Lane 1, low-range protein standard (Bio-Rad);lane 2, GST-Orf14 lysate; lane 3, 7His-Orf7 lysate; lane 4, negative control 7His-Orf7/GST; lane 5, eluate of the GST-Orf14–7His-Orf7complex. Corresponding Western blot with anti-GST antibodies. (A2) 6% SDS-PAGE. Lane 1, low-range protein standard; lane 2, MBP-Orf7�TMH lysate; lane 3, 7His-Orf5 lysate; lane 4, negative control 7His-Orf5/MBP; lane 5, eluate of the 7His-Orf5–MBP-Orf7�TMHcomplex. Corresponding Western blot with anti-MBP antibodies. (A3) 8% SDS-PAGE. Lane 1, low-range protein standard; lane 2, 7His-Orf10;lane 3, MBP-Orf7�TMH lysate; lane 4, negative control MBP-Orf7�TMH/pQTEV lysate; lane 5, eluate of the MBP-Orf7�TMH–7His-Orf10complex. Corresponding Western blot with anti-Penta-His antibodies.(B) Interactions of postulated core complex components. (B1) 12%SDS-PAGE. Lane 1, low-range protein standard; lane 2, 7His-Orf8 lysate; lane 3, GST-Orf14 lysate; lane 4, proteins not bound to Ni-NTAcolumn; lanes 5 and 6, wash steps after binding of the protein complex; lane 7, eluate of the 7His-Orf8–GST-Orf14 complex. CorrespondingWestern blot with anti-GST antibodies. (B2) 12% SDS-PAGE. Lane 1, low-range protein standard; lane 2, 7His-Orf12 lysate; lane 3, GST-Orf14lysate; lane 4, negative control 7His-Orf12/GST; lane 5, eluate of the 7His-Orf12–GST-ORF14 complex. Corresponding Western blot withanti-GST antibodies. (C) Interactions of the putative coupling protein Orf10 in a 12% SDS-PAGE gel. Lane 1, low-range protein standard; lane2, 6His-Orf1N246; lane 3, negative control MBP/6His-Orf1N246; lane 4, eluate of the MBP-Orf10–6His-Orf1N246 complex; lane 5, eluate ofthe MBP-Orf10–6His-Orf1 complex. Corresponding Western blot with anti-Penta-His antibodies. (D) Interactions of the putative ATPaseORF5. (D1) 12% SDS-PAGE. Lane 1, low-range protein standard; lane 2, MBP-Orf5 lysate; lane 3, 7His-Orf5 lysate; lane 4, negative control7His-Orf5/MBP; lane 5, eluate of the 7His-ORF5–MBP-ORF5 complex. Corresponding Western blot with anti-MBP antibodies. (D2) 12%SDS-PAGE. Lane 1, low-range protein standard; lane 2, GST-Orf14 lysate; lane 3, 7His-Orf5 lysate; lane 4, negative control 7His-Orf5/GST;lane 5, eluate of the 7His-Orf5–GST-Orf14 complex. Corresponding Western blot with anti-GST antibodies. (D3) 10% SDS-PAGE. Lane 1,low-range protein standard; lane 2, MBP-Orf4 lysate; lane 3, 7His-Orf5 lysate; lane 4, negative control 7His-Orf5/MBP; lane 5, eluate of the7His-Orf5–MBP-Orf4 complex. Corresponding Western blot with anti-MBP antibodies. (E) Homotypic interaction of the lytic transglycosylaseOrf7 in a 12% SDS-PAGE. Lane 1, low-range protein standard; lane 2, 7His-Orf7 lysate; lane 3, purified MBP-Orf7�TMH; lane 4, proteins notbound to Ni-NTA column; lane 5, wash step after binding of the protein complex; lane 6, eluate of the 7His-Orf7–MBP-Orf7�TMH complex.Corresponding Western blot with anti-MBP antibodies.



.org/D

ownloaded from

http://jb.asm.org/

postulated to be released as an immunoreactive Orf7* protein.The Orf7 amino acid sequence shows significant similarity withVirB1 in the region where VirB1 is processed to VirB1* (4),which leads us to the speculation that, similarly, Orf7 could beprocessed to VirB1. One possible role of the processed proteincould be participation in direct interactions with the recipientcell.

DISCUSSION

We have generated a comprehensive protein-protein inter-action map of the pIP501-encoded Tra proteins based upon

the data obtained by two different approaches, the yeast two-hybrid assay and in vitro pull-down assays. The interactionscrucial for building up a speculative model of the T4SLS en-coded by pIP501 were proven by both methods. On the basis ofthese data, together with the predicted localization of the pro-teins and functional characterization of some of them, wepropose a possible scenario for assembly of the pIP501-en-coded T4SLS (Fig. 4): the Orf7 lytic transglycosylase for whichpeptidoglycan cleavage activity has been demonstrated onmurein substrates from different origins (Sollu and Grohmann,unpublished observations) should play a crucial role in localopening of the peptidoglycan, thereby facilitating assembly ofthe transenvelope transport complex. The role of Orf7 shouldbe more pronounced than that of lytic transglycosylases en-coded by T4SSs of G� bacteria because of the greater thick-ness and the multilayered structure of the peptidoglycan in G�bacteria. In T4SSs of G� bacteria, such as the prototypeAgrobacterium transfer DNA (T-DNA) transfer system, tumorformation was attenuated (38), and RSF1010 transfer capacitywas reduced approximately 10-fold (9) in a virB1 mutant. Inthe F-like R1-19 transfer system, conjugative transfer fre-quency was reduced 5- to 10-fold (5, 6) in mutants affectingthe lytic transglycosylase P19. In none of the mutants wastransfer proficiency completely abolished, indicating thatlytic transglycosylases encoded on the bacterial chromosomemight have replaced the plasmid-encoded enzyme. The chro-mosomes of G� bacteria encode only a limited number ofmuramidases, which potentially could replace the plasmid-en-coded lytic transglycosylase activity. This hypothesis is cur-rently being tested on a pIP501 orf7 knockout mutant. Orf7associates with itself and interacts with other T4SLS compo-

FIG. 3. Glutaraldehyde cross-linking of 7His-Orf10. Samples of0.5 mg/ml of 7His-Orf10 were incubated with increasing glutaralde-hyde concentrations. The products were loaded onto a 10% SDSpolyacrylamide gel, electrophoresed at a constant voltage of 180 V,and stained with Coomassie brilliant blue. Lane 1, SeeBlue plus2-prestained protein standards (Invitrogen, Karlsruhe, Germany); lane2, no glutaraldehyde; lanes 3 to 10, glutaraldehyde at 0.002% (lane 3).0.003% (lane 4), 0.004% (lane 5), 0.005% (lane 6), 0.006% (lane 7),0.007% (lane 8), 0.008% (lane 9); and 0.01% (lane 10).

FIG. 4. Working model for pIP501 conjugative transfer. The postulated DNA secretion complex is assembled in a manner reminiscent of asimplified T4SS. Arrows indicate protein-protein interactions determined with the yeast two-hybrid system. Protein localization is consistent withcomputer predictions made by using Psort (22), PHDhtm (42), HMMTOP (50, 51), TMPred (28), TMAP (39, 40), and TopPred (16, 52) (availableat www.expasy.org). Decreased shading of peptidoglycan (PG) symbolizes Orf7-mediated local opening of PG. (a) Protein-protein interactionsdetected for Orf7. (b) Assembly of the putative pIP501 transport apparatus. Numbers refer to proteins specified by the pIP501 tra region. Dashedarrows mark putative ATPases. CM, cytoplasmic membrane; ssDNA, single-stranded DNA; NTP, nucleoside triphosphate; NDP, nucleosidediphosphate.



.org/D

ownloaded from

http://jb.asm.org/

nents, such as the putative ATPase Orf5 and the putativeOrf10 coupling protein. The latter interaction seems to bespecific for G� bacteria, as it has not been shown for any T4SScoupling protein from G� bacteria. Furthermore, Orf7 inter-acts with the postulated cytoplasmic membrane protein Orf2and the Orf14 protein. For the Orf2 protein, this association isthe only interaction demonstrated until now. By interactionwith Orf5, Orf10, and Orf14, Orf7 might recruit these proteinsand enable their incorporation in the transport apparatus. Atthe N terminus, Orf7 possesses a potential signal peptide se-quence (SignalP 3.0) (8), and at the C terminus, it shows highsimilarity with the COG3942 family of surface antigens (score,108; E value, 1e�24). Several secreted or possibly secretedproteins from Streptococcus and Staphylococcus spp. belong tothis family. This observation fits well with putative secretion ofthe C terminus of Orf7 (Orf7*) after cleavage at a processingsite similar to that in VirB1, located between the SLT domainand the carboxyl terminus with similarity to COG3942 familyproteins.

The putative coupling protein Orf10, which interacts withthe relaxase TraA (Orf1), could link the relaxosome, consistingof TraA bound at oriT of the pIP501 T strand, with the trans-port apparatus. The TraA relaxase was shown to be a dimer insolution and to preferentially bind in a dimeric form to itscognate oriT (30). Orf10 oligomerization could be shown byglutaraldehyde cross-linking and gel filtration (data notshown). A three-dimensional structure prediction of Orf10based upon the known TrwB structure (coupling protein ofR388) (24, 25) showed significant similarity of the two struc-tures (J. Kopec,W. Keller, and E. Grohmann, unpublisheddata).

One possible candidate for delivering energy by ATP hydro-lysis for establishment of the DNA transfer machinery and forthe transport process would be the VirB4-like Orf5 protein.Alternatively, energy could be supplied by the putative cou-pling protein Orf10. ATP-binding and hydrolysis tests are inprogress for both proteins to investigate this assumption. Pre-liminary experiments showed ATP-binding and ATPase activ-ities for both Orf5 and Orf10 (R. Salih, M. Saleh, M. Abajy, J.Kopec, and E. Grohmann, unpublished results). A possibletransenvelope structure could be built up by the Orf8, Orf14,Orf12, and Orf15 proteins. Orf8 and Orf15 contain potentialsignal peptides at their N termini; for Orf8, a TMH in theN-terminal portion was postulated. Depending on the algo-rithm applied, for ORF15, one or two TMH were found (oneat the amino terminus and another one at the carboxy termi-nus). The PSORTb v.2.0 program (22) suggested cell walllocalization for the Orf15 protein. Therefore, Orf15 could pos-sibly make up the outermost portion of the transport complex.For Orf12, five to seven TMH have been postulated. Orf12 andOrf14 were analyzed with the Secretome 2.0 prediction tool (7)(www.cbs.dtu.dk/services/SecretomeP-2.0/), which predicts non-classically secreted proteins (proteins without a signal pep-tide). For both proteins, a high SecP score for nonclassicallysecreted proteins was obtained (threshold, 0.5), namely, 0.94for Orf12 and 0.84 for Orf14.

The proteins Orf3, Orf6, and Orf9, which all possibly containTMH, could build part of the scaffold structure of the secretionapparatus. Orf9 also contains a possible signal peptide se-quence with a high probability of cleavage (0.92). Orf6 showed

strong interaction (95.3 -galactosidase units) with the putativecoupling protein Orf10. For two proteins with postulatedTMH, Orf11 and Orf13, no interactions could be detected sofar. Both proteins show no significant similarity to any charac-terized protein in the data bank. The soluble protein Orf4, withno significant match in the data bank, showed high affinity(91.2 -galactosidase units, Table 4) for the Orf5 protein in theyeast two-hybrid screen. A possible physiological significanceof this association has to be further investigated.

Comparisons of the plasmid-encoded conjugative transfersystems in G� bacteria revealed two general mechanisms gov-erning conjugative plasmid transfer, namely (i) a T4SLS mech-anism such as that proposed for the broad-host-range plasmidspIP501, pRE25, pMRC01, and pSK41/pGO1 (26, 33, 34); theClostridium perfringens plasmid pCW3 (3); and the E. faecalissex pheromone plasmids as exemplified by pCF10 (31); and (ii)a completely distinct mechanism exerted by the multicellularG� bacteria (26, 41).

In G� bacteria, the close contact between donor and recip-ient cells preceding conjugative transfer is thought to be es-tablished without the help of pili. With the exception of theEnterococcus sex pheromone plasmids, the mechanism of es-tablishing physical contact between G� donor and recipientcells is not known (reviewed in references 11 and 19). Inter-estingly, last year, pili were characterized in all three of theprincipal streptococcal pathogens that cause invasive disease inhumans, Streptococcus pyogenes, S. agalactiae, and S. pneumo-nia (reviewed in reference 48). In G� bacteria, pili are typi-cally formed by noncovalent interactions between pilin sub-units. By contrast, the recently discovered pili in G� pathogensare formed by covalent polymerization of adhesive pilin sub-units. Pili of G� pathogens are likely to have a function similarto that in G� bacteria, where they play a key role in theadhesion and invasion process and in pathogenesis. In G�bacteria, only type IV pili were shown to allow the transfer ofgenetic material (12). Type IV pilin-like proteins have alsobeen demonstrated to be involved in genetic transformation ofG� bacteria (reviewed in reference 2). Although no pilin-likegenes have been found on conjugative plasmids with a G�bacterial origin, participation of pilus-like structures in theconjugative transfer process of G� bacteria cannot be ex-cluded to date.

In summary, we have presented a first model for a T4SLtransfer system encoded by the broad-host-range plasmidpIP501 with self-transmission capability to a wide variety ofG� bacteria and to G� E. coli. The further elucidation of thepIP501 conjugative transfer mechanism should also aid in de-ciphering the transfer process of the related staphylococcal andenterococcal antibiotic resistance plasmids, enabling the devel-opment of specific agents inhibiting T4SLS processes in G�pathogens.

ACKNOWLEDGMENTS

We thank E. Lanka for critical reading of the paper; K. Bussow, MaxPlanck Institute for Molecular Genetics, Berlin, Germany, for the giftof plasmid pQTEV; and Ralf Sopora for skillful technical assistance.We acknowledge M. Saleh and W. Keller for the gel filtration exper-iments.

M.Y.A. is a recipient of a doctoral fellowship from the University ofAleppo, Syria. J.K. received a scholarship from Berliner Programm zurForderung der Chancengleichheit fur Frauen in Forschung und Lehre.



.org/D

ownloaded from

http://jb.asm.org/

This work was partially supported by the Austrian Science Foundation(FWF project P15040).

REFERENCES

1. Atmakuri, K., E. Cascales, and P. J. Christie. 2004. Energetic componentsVirD4, VirB11 and VirB4 mediate early DNA transfer reactions required forbacterial type IV secretion. Mol. Microbiol. 54:1199–1211.

2. Averhoff, B. 2004. DNA transport and natural transformation in mesophilicand thermophilic bacteria. J. Bioenerg. Biomembr. 36:25–33.

3. Bannam, T. L., W. L. Teng, D. Bulach, D. Lyras, and J. I. Rood. 2006.Functional identification of conjugation and replication regions of the tet-racycline resistance plasmid pCW3 from Clostridium perfringens. J. Bacteriol.188:4942–4951.

4. Baron, C., M. Llosa, S. Zhou, and P. C. Zambryski. 1997. VirB1, a compo-nent of the T-complex transfer machinery of Agrobacterium tumefaciens, isprocessed to a C-terminal secreted product, VirB1*. J. Bacteriol. 179:1203–1210.

5. Bayer, M., R. Eferl, G. Zellnig, K. Teferle, A. Dijkstra, G. Koraimann, andG. Hogenauer. 1995. Gene 19 of plasmid R1 is required for both efficientconjugative DNA transfer and bacteriophage R17 infection. J. Bacteriol.177:4279–4288.

6. Bayer, M., R. Iberer, K. Bischof, E. Rassi, E. Stabentheiner, G. Zellnig, andG. Koraimann. 2001. Functional and mutational analysis of P19, a DNAtransfer protein with muramidase activity. J. Bacteriol. 183:3176–3183.

7. Bendtsen, J. D., L. Kiemer, A. Fausboll, and S. Brunak. 2005. Non-classicalprotein secretion in bacteria. BMC Microbiol. 5:58–71.

8. Bendtsen, J. D., H. Nielsen, G. von Heijne, and S. Brunak. 2004. Identifica-tion of prokaryotic and eukaryotic signal peptides and prediction of theircleavage sites. J. Mol. Biol. 340:783–795.

9. Bohne, J., A. Yim, and A. N. Binns. 1998. The Ti plasmid increases theefficiency of Agrobacterium tumefaciens as a recipient in virB-mediated con-jugal transfer of an IncQ plasmid. Proc. Natl. Acad. Sci. USA 95:7057–7062.

10. Breeden, L., and K. Nasmyth. 1985. Regulation of the yeast HO gene. ColdSpring Harbor Symp. Quant. Biol. 50:643–650.

11. Chandler, J. R., and G. M. Dunny. 2004. Enterococcal peptide sex phero-mones: synthesis and control of biological activity. Peptides 25:1377–1388.

12. Chen, I., and D. Dubnau. 2003. DNA transport during transformation.Front. Biosci. 8:5544–5556.

13. Chien, C. T., P. L. Bartel, R. Sternglanz, and S. Fields. 1991. The two-hybridsystem: a method to identify and clone genes for proteins that interact witha protein of interest. Proc. Natl. Acad. Sci. USA 88:9578–9582.

14. Christie, P. J., K. Atmakuri, V. Krishnamoorthy, S. Jakubowski, and E.Cascales. 2005. Biogenesis, architecture, and function of bacterial type IVsecretion systems. Annu. Rev. Microbiol. 59:451–485.

15. Christie, P. J., and E. Cascales. 2005. Structural and dynamic properties ofbacterial type IV secretion systems (review). Mol. Membr. Biol. 22:51–61.

16. Claros, M. G., and G. von Heijne. 1994. TopPred II: an improved softwarefor membrane protein structure predictions. Comput. Appl. Biosci. 10:685–686.

17. de Paz, H. D., F. J. Sangari, S. Bolland, J. M. Garcia-Lobo, C. Dehio, F. dela Cruz, and M. Llosa. 2005. Functional interactions between type IV se-cretion systems involved in DNA transfer and virulence. Microbiology 151:3505–3516.

18. Ding, Z., Z. Zhao, S. J. Jakubowski, A. Krishnamohan, W. Margolin, andP. J. Christie. 2002. A novel cytology-based, two-hybrid screen for bacteriaapplied to protein-protein interaction studies of a type IV secretion system.J. Bacteriol. 184:5572–5582.

19. Dunny, G. M., M. H. Antiporta, and H. Hirt. 2001. Peptide pheromone-induced transfer of plasmid pCF10 in Enterococcus faecalis: probing thegenetic and molecular basis for specificity of the pheromone response. Pep-tides 22:1529–1539.

20. Evans, R. P., Jr., and F. L. Macrina. 1983. Streptococcal R plasmid pIP501:endonuclease site map, resistance determinant location, and construction ofnovel derivatives. J. Bacteriol. 154:1347–1355.

21. Fields, S., and R. Sternglanz. 1994. The two-hybrid system: an assay forprotein-protein interactions. Trends Genet. 10:286–292.

22. Gardy, J. L., M. R. Laird, F. Chen, S. Rey, C. J. Walsh, M. Ester, and F. S.Brinkman. 2005. PSORTb v.2.0: expanded prediction of bacterial proteinsubcellular localization and insights gained from comparative proteomeanalysis. Bioinformatics 21:617–623.

23. Gilmour, M. W., J. E. Gunton, T. D. Lawley, and D. E. Taylor. 2003.Interaction between the IncHI1 plasmid R27 coupling protein and type IVsecretion system: TraG associates with the coiled-coil mating pair formationprotein TrhB. Mol. Microbiol. 49:105–116.

24. Gomis-Ruth, F. X., and M. Coll. 2001. Structure of TrwB, a gatekeeper inbacterial conjugation. Int. J. Biochem. Cell Biol. 33:839–843.

25. Gomis-Ruth, F. X., G. Moncalian, R. Perez-Luque, A. Gonzalez, E. Cabezon,F. de la Cruz, and M. Coll. 2001. The bacterial conjugation protein TrwBresembles ring helicases and F1-ATPase. Nature 409:637–641.

26. Grohmann, E., G. Muth, and M. Espinosa. 2003. Conjugative plasmid trans-fer in gram-positive bacteria. Microbiol. Mol. Biol. Rev. 67:277–301.

27. Harris, R. L., and P. M. Silverman. 2004. Tra proteins characteristic ofF-like type IV secretion systems constitute an interaction group by yeasttwo-hybrid analysis. J. Bacteriol. 186:5480–5485.

28. Hofmann, K., and W. Stoffel. 1993. TMBASE—a database of membranespanning protein segments. Biol. Chem. Hoppe-Seyler 374:166.

29. Jacob, A. E., and S. J. Hobbs. 1974. Conjugal transfer of plasmid-bornemultiple antibiotic resistance in Streptococcus faecalis var. zymogenes. J. Bac-teriol. 117:360–372.

30. Kopec, J., A. Bergmann, G. Fritz, E. Grohmann, and W. Keller. 2005. TraAand its N-terminal relaxase domain of the Gram-positive plasmid pIP501show specific oriT binding and behave as dimers in solution. Biochem. J.387:401–409.

31. Kozlowicz, B. K., M. Dworkin, and G. M. Dunny. 2006. Pheromone-inducibleconjugation in Enterococcus faecalis: a model for the evolution of biologicalcomplexity? Int. J. Med. Microbiol. 296:141–147.

32. Kurenbach, B., C. Bohn, J. Prabhu, M. Abudukerim, U. Szewzyk, and E.Grohmann. 2003. Intergeneric transfer of the Enterococcus faecalis plasmidpIP501 to Escherichia coli and Streptomyces lividans and sequence analysis ofits tra region. Plasmid 50:86–93.

33. Kurenbach, B., J. Kopec, M. Magdefrau, K. Andreas, W. Keller, C. Bohn,M. Y. Abajy, and E. Grohmann. 2006. The TraA relaxase autoregulates theputative type IV secretion-like system encoded by the broad-host-rangeStreptococcus agalactiae plasmid pIP501. Microbiology 152:637–645.

34. Llosa, M., and F. de la Cruz. 2005. Bacterial conjugation: a potential tool forgenomic engineering. Res. Microbiol. 156:1–6.

35. Llosa, M., S. Zunzunegui, and F. de la Cruz. 2003. Conjugative couplingproteins interact with cognate and heterologous VirB10-like proteins whileexhibiting specificity for cognate relaxosomes. Proc. Natl. Acad. Sci. USA100:10465–10470.

36. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring HarborLaboratory Press, Cold Spring Harbor, NY.

37. Miller, J. H. 1992. A short course in bacterial genetics. Cold Spring HarborLaboratory Press, Cold Spring Harbor, NY.

38. Mushegian, A. R., K. J. Fullner, E. V. Koonin, and E. W. Nester. 1996. Afamily of lysozyme-like virulence factors in bacterial pathogens of plants andanimals. Proc. Natl. Acad. Sci. USA 93:7321–7326.

39. Persson, B., and P. Argos. 1994. Prediction of transmembrane segments inproteins utilising multiple sequence alignments. J. Mol. Biol. 237:182–192.

40. Persson, B., and P. Argos. 1996. Topology prediction of membrane proteins.Protein Sci. 5:363–371.

41. Reuther, J., C. Gekeler, Y. Tiffert, W. Wohlleben, and G. Muth. 2006. Uniqueconjugation mechanism in mycelial streptomycetes: a DNA-binding ATPasetranslocates unprocessed plasmid DNA at the hyphal tip. Mol. Microbiol.61:436–446.

42. Rost, B., P. Fariselli, and R. Casadio. 1996. Topology prediction for helicaltransmembrane proteins at 86% accuracy. Protein Sci. 5:1704–1718.

43. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY.

44. Scheich, C., F. H. Niesen, R. Seckler, and K. Bussow. 2004. An automated invitro protein folding screen applied to a human dynactin subunit. Protein Sci.13:370–380.

45. Schiestl, R. H., and R. D. Gietz. 1989. High efficiency transformation ofintact yeast cells using single stranded nucleic acids as a carrier. Curr. Genet.16:339–346.

46. Schroder, G., and E. Lanka. 2005. The mating pair formation system ofconjugative plasmids—a versatile secretion machinery for transfer of pro-teins and DNA. Plasmid 54:1–25.

47. Shamaei-Tousi, A., R. Cahill, and G. Frankel. 2004. Interaction betweenprotein subunits of the type IV secretion system of Bartonella henselae. J.Bacteriol. 186:4796–4801.

48. Telford, J. L., M. A. Barocchi, I. Margarit, R. Rappuoli, and G. Grandi.2006. Pili in gram-positive pathogens. Nat. Rev. Microbiol. 4:509–519.

49. Terradot, L., N. Durnell, M. Li, D. Li, J. Ory, A. Labigne, P. Legrain, F.Colland, and G. Waksman. 2004. Biochemical characterization of proteincomplexes from the Helicobacter pylori protein interaction map: strategies forcomplex formation and evidence for novel interactions within type IV se-cretion systems. Mol. Cell. Proteomics 3:809–819.

50. Tusnady, G. E., and I. Simon. 1998. Principles governing amino acid com-position of integral membrane proteins: application to topology prediction J.Mol. Biol. 283:489–506.

51. Tusnady, G. E., and I. Simon. 2001. The HMMTOP transmembrane topol-ogy prediction server. Bioinformatics 17:849–850.

52. von Heijne, G. 1992. Membrane protein structure prediction. Hydrophobic-ity analysis and the positive-inside rule. J. Mol. Biol. 225:487–494.

53. Ward, D. V., O. Draper, J. R. Zupan, and P. C. Zambryski. 2002. Peptidelinkage mapping of the Agrobacterium tumefaciens vir-encoded type IV se-cretion system reveals protein subassemblies. Proc. Natl. Acad. Sci. USA99:11493–11500.



.org/D

ownloaded from

http://jb.asm.org/

A Type IV-Secretion-Like System Is Required for Conjugative DNA Transport of Broad-Host-Range...

Documents

Transcript of A Type IV-Secretion-Like System Is Required for Conjugative DNA Transport of Broad-Host-Range...