A Proliferative Burstduring Preadolescence Establishesthe Final Cardiomyocyte NumberNawazish Naqvi,1,8 Ming Li,2,8 John W. Calvert,3 Thor Tejada,1 Jonathan P. Lambert,3 Jianxin Wu,2 Scott H. Kesteven,2

Sara R. Holman,2 Torahiro Matsuda,1 Joshua D. Lovelock,1 Wesley W. Howard,1 Siiri E. Iismaa,2,7 Andrea Y. Chan,2

Brian H. Crawford,4,5 Mary B. Wagner,4,5 David I.K. Martin,6 David J. Lefer,3 Robert M. Graham,2,7,* and Ahsan Husain1,*1Division of Cardiology, Department of Medicine, Emory University School of Medicine, Atlanta, GA 30322, USA2Victor Chang Cardiac Research Institute, Sydney, NSW 2010, Australia3Division of Cardiothoracic Surgery, Department of Surgery, Carlyle Fraser Heart Center, Emory University School of Medicine, Atlanta,

GA 30308, USA4Department of Pediatrics, Emory University School of Medicine, Atlanta, GA 30322, USA5Center for Cardiovascular Biology, Children’s Healthcare of Atlanta, Atlanta, GA 30322, USA6Children’s Hospital Oakland Research Institute, Oakland, CA 94609, USA7University of New South Wales, Kensington, NSW 2033, Australia8Co-first author*Correspondence: b.graham@victorchang.edu.au (R.M.G.), ahusai2@emory.edu (A.H.)

http://dx.doi.org/10.1016/j.cell.2014.03.035

SUMMARY

It is widely believed that perinatal cardiomyocyteterminal differentiation blocks cytokinesis, therebycausing binucleation and limiting regenerative repairafter injury. This suggests that heart growth shouldoccur entirely by cardiomyocyte hypertrophy duringpreadolescence when, in mice, cardiac mass in-creases many-fold over a few weeks. Here, weshow that a thyroid hormone surge activates theIGF-1/IGF-1-R/Akt pathway on postnatal day 15and initiates a brief but intense proliferative burst ofpredominantly binuclear cardiomyocytes. This prolif-eration increases cardiomyocyte numbers by�40%,causing a major disparity between heart and cardio-myocyte growth. Also, the response to cardiac injuryat postnatal day 15 is intermediate between thatobserved at postnatal days 2 and 21, further sug-gesting persistence of cardiomyocyte proliferativecapacity beyond the perinatal period. If replicatedin humans, this may allow novel regenerative thera-pies for heart diseases.

INTRODUCTION

The regulation of heart size during postnatal development is a

fundamental process directly relevant to remodeling of the heart

in response to congenital heart diseases. Postnatal change in the

size of the mammalian heart through replication of cardiac mus-

cle cells (cardiomyocytes [CMs]) is thought to be limited by early

postnatal terminal differentiation (Soonpaa et al., 1996; Walsh

et al., 2010). This notion was proposed as early as 1894 by Biz-

zozero, who suggested that replication of CMs ceases at birth

and classified mature CMs as elementi perenni, or cells of static

populations.

The view that CMs terminally differentiate in the neonatal

period (by postnatal day 5 [P5]) is supported by evidence that

during early preadolescence (from P5 to P14), the expression

of genes responsible for cell-cycle reentry, mitosis, and cyto-

kinesis falls precipitously (Walsh et al., 2010). This change is pre-

ceded between P5 and P10 by extensive binucleation of CMs

(Soonpaa et al., 1996; Walsh et al., 2010), widely considered a

marker of terminal differentiation; by P7, hearts lose regenerative

capacity (Porrello et al., 2011). Between P10 and P21 (weaning),

estimates of S phase indicate that CMs are quiescent (Soonpaa

et al., 1996). Assessments of mitosis in murine CMs at select

ages (Walsh et al., 2010) also support the conclusion that repli-

cation ceases by P5–P7.

Inmammals, the heart growsmarkedly between the immediate

postneonatal period and puberty. If CMs are terminally differen-

tiated, this growth should be due almost entirely to an increase in

the volume of constituent CMs, which throughout postneonatal

life account for 80% of the volume of the myocardium (Li et al.,

1996). In humans, a disparity between changes in CM volume

and heart volume is readily observed between birth and 20 years

(Mollova et al., 2013). This disparity suggests a 3.4-fold increase

in the CM population number (CPN). Senyo et al. (2013) have

investigated the source of such new CMs in the mouse, the

only species in which the timing of terminal differentiation has

been evaluated. They report that CMs are added to postneonatal

hearts at a rate of 0.76% per year and that these new cells are

derived from a small fraction (<0.2%) of mononuclear CMs that

retain proliferative capacity. This rate of CM addition predicts

only a negligible (�1.06-fold) increase in CPN between the onset

of terminal differentiation (around P5) and puberty (P35).

Here, we show a 1.4-fold increase in CPN during the preado-

lescent period, which occurs as a discrete proliferative burst on

P15 initiated by a surge in thyroid hormone (T3). Proliferation is

Cell 157, 795–807, May 8, 2014 ª2014 Elsevier Inc. 795

Figure 1. Rapid Body Growth Involves CM Elongation and Eccentric LV Remodeling

(A and B) Concomitant increases in body and heart weights of wild-type (WT) mice during the period from preadolescence (P10) to just after puberty (P35).

(C) Increase in heart size from P10 to P35 is illustrated by hematoxylin and eosin-stained coronal heart sections.

(D–L) Hemodynamic and cardiac and CM morphological changes in WT mice from P10 to P35. LVEDD and LVED volume indicate left ventricular end-diastolic

dimension and volume, respectively; LV FWd, LV free wall thickness in diastole.

Data are shown as mean ± SEM. The number of animals, or cells, studied is shown by n. ***p < 0.001.

evident from an increase in CPN, the re-expression of mitosis-

related genes, readily apparent mitotic figures in mature mono-

and binuclear CMs and, consistent with cell division giving rise

to smaller progeny, a sharp fall in both mono- and binuclear

CM volume. The brevity of this proliferative burst could explain

why it has previously gone undetected. This study provides

compelling evidence for retention of CM proliferative compe-

tence long after the neonatal period, which requires a significant

revision of the generally accepted view of CM terminal

differentiation.

796 Cell 157, 795–807, May 8, 2014 ª2014 Elsevier Inc.

RESULTS

Disparity between Heart and CM Growth duringPostnatal DevelopmentBetween early preadolescence (�P10) and puberty (�P35),

mouse body weight nearly doubles each week (Figure 1A).

Assuming that circulatory volume increases in direct proportion

to body weight, circulatory volume should increase by �15%

each day, with equivalent increases in heart weight (Figures 1B

and 1C). Echocardiography shows that between P10 and P35,

Figure 2. A Period of CM Proliferation dur-

ing Preadolescent Heart Growth

(A) Total numbers of cardiomyocytes in both

cardiac ventricles of mice (CM population number

[CPN]). The number of animals studied is shown in

square brackets.

(B–G) Enhanced expression of the mitosis-related

genes Ki67, Cyclin B1, polo-like kinase-1 (Plk 1),

aurora A, Survivin, and anillin on P15. Also note

suppressed expression of all these genes in P35

hearts (p < 0.001 versus P13 values). Values were

determined using RNA prepared from five animals

at each time point.

(H–J) An example of flow cytometric analysis of

BrdU+/cardiac troponin T+ (cTnT+) CM-derived

nuclei obtained from a mouse given a single

intraperitoneal injection of BrdU on the night of

P14 and then sacrificed on P18.

(K) A representative example of analysis of BrdU

uptake (at P14 evening) and ploidy, indicating that

96.4% of nuclei were 2n and 3.6% were 4n (on

P18) in this cell preparation from a single heart.

Data are shown as mean ± SEM. *p < 0.05; **p <

0.01; ***p < 0.001.

stroke volume increases 3.5-fold (p < 0.001) (Figure 1D). This is

associated with left ventricle (LV) chamber remodeling, giving

an 86% increase in LV end-diastolic dimension (LVEDD) (p <

0.001; Figure 1E) and a 4.6-fold increase in LV volume at diastole

(p < 0.001; Figure 1F), without a significant change in LV free wall

thickness at diastole (FWd or h) (Figure 1G). This adaptation

produces a 52% decrease in the LV h/Ri ratio (where Ri is the in-

ternal LV chamber radius; Figure 1H), consistent with eccentric

hypertrophy, andmaintains the LVweight-to-stroke volume ratio

(1.76:1 at P10 versus 1.78:1 at P35). Also between P10 and P35,

the LVEDD length-to-diameter ratio decreases by 40% (p <

Cell 157, 795

0.001; Figure 1I), indicating increased LV

sphericity. At the cellular level, CM length

increases by 46 mm (p < 0.001; Figure 1K)

between P10 and P35, with minimal

(+1 mm) change in diameter (p < 0.001;

Figure 1L).

The increase in ventricular weight be-

tween P10 and P35 (21.7 ± 1.43 mg, n =

9 at P10 versus 75.3 ± 5.56 mg, n = 5 at

P35; +3.47-fold; p < 0.001) exceeds the

increase in ventricular CM volume by

1.7-fold, calculated on the basis of a

cylindrical model (18.2 ± 0.31 pl, n = 511

at P10 versus 36.3 ± 0.78 pl, n =

497; +1.99-fold; p < 0.001). This disparity

between increases in heart and CM

volume suggested an increase in CM

numbers during preadolescence.

Extensive CM Proliferation in thePreadolescent HeartWe determined total CM numbers in

ventricular myocardium by enzymatic

disaggregation and direct cell counting. Estimates of total CM

numbers (summarized in Figure 2A) identify two distinct in-

creases in CPN: an �40% increase between P1 and P4, and

a further �40% increase (�500,000 CMs) between P14

and P18. A total of 22% of the post-P14 CPN increase occurred

by �4:00 p.m. on P15 (P15 afternoon or P15A; p < 0.001;

Figure 2A), with no further change between P18 and P365.

Because variable CM yields among mice of different ages might

confound our count, we calculated the CM fraction ofmyocardial

volume-to-CM volume ratio, a yield-independent method for

estimating CM numbers (Chaudhry et al., 2004), and found

–807, May 8, 2014 ª2014 Elsevier Inc. 797

1.26 ± 0.03 3 106 CMs in both ventricles at P14 (n = 10) versus

2.2 ± 0.06 3 106 at P18 (n = 5) (p < 0.001). Thus, both a hemo-

cytometer-based method and a yield-independent method

show a large increase in CM numbers between P14 and P18.

The latter method, because it requires several assumptions,

likely overestimates the increase. Collectively, these data indi-

cate that the preadolescent increase in CPN results from a

discrete CM proliferative burst at �P15, rather than continuous

low-level CM addition.

To determine the time of onset of mitosis, we measured the

expression of several mitosis-promoting genes in the cardiac

ventricles daily from P13 to P16 (Figures 2B–2G). We found

�5- to 12-fold increases in mRNA levels (p < 0.05) of all these

genes on the morning (�9:00 a.m.) of P15, with levels on P16

falling to near-P13 levels. Thus, CMs are in M phase as early

as 9:00 a.m. on P15. Assuming that the combined duration of

S and G2 phases is �10 hr (for a 24 hr cell cycle), S phase could

start around 10:00 p.m. on P14. To identify S phase timing, we

gave a single intraperitoneal injection of bromodeoxyuridine

(BrdU) (bloodstream half-life �2 hr; Kriss and Revesz, 1962) at

�9:30 p.m. on the night of P14. Mice were sacrificed on P18

and CMs isolated and purified to remove non-CMs; their nuclei

were then liberated by lysis and analyzed by flow cytometry

(an example is shown in Figures 2H–2J). More than 99%of nuclei

from CM-enriched cardiac cells were cTnT positive, arguing

against significant contamination by non-CM nuclei. Flow

cytometry further indicated that 11.3% ± 1.9% (n = 6) of CM-

derived (cardiac troponin T [cTnT]-positive) nuclei were BrdU

positive (e.g., Figure 2J). BrdU’s short half-life in the circulation

makes it unlikely that all CMs entering S phase on the night of

P14 would be labeled by a single intraperitoneal BrdU pulse,

but cell/nuclear divisions during the 3-day chase period would

increase the number of BrdU-labeled nuclei. Thus, while our

findings do not establish the number of nuclei entering S phase

on the night of P14, they do show that a new S phase in CMs be-

gins late on P14.

The long chase period also determined that the BrdU-labeled

nuclei underwent nuclear division after labeling on the evening of

P14. By the end of the chase period, the majority of the BrdU-

labeled CMnuclei were 2n (96.4% ± 0.48%were BrdU+ 2n nuclei

and 3.6% ± 0.5%were BrdU+ 4n nuclei; n = 5/group) (Figure 2K).

Moreover, despite this post-P14 DNA synthesis in CMs, ploidy

was not increased between P14 and P18 (Figure S1 available on-

line). Together, these findings indicate efficient karyokinesis.

We next identified mitotic CMs by monitoring coexpression of

aurora B and the sarcomeric marker protein a-cardiac muscle

actin (SaA) by confocal microscopy. The subcellular localization

of aurora B is dependent on cell-cycle phase, so it can be used to

distinguish between potential outcomes of progression into M

phase (Carmena and Earnshaw, 2003). Transverse sections of

ventricles of mice sacrificed between 8:00 a.m. and 12:00 p.m.

revealed a 36-fold increase in LV CM mitoses between P14

and P15 (p < 0.001) followed by an abrupt 5.8-fold decrease

between P15 and P16 (p < 0.001) (Figures 3A–3E). These

changes paralleled changes in expression of mitosis-promoting

genes (Figures 2B–2G). Nuclear localization of aurora B in most

of the mitotic CMs indicated that these cells were in prophase

(Figure 3B).

798 Cell 157, 795–807, May 8, 2014 ª2014 Elsevier Inc.

Mitotic CM nuclei were not uniformly distributed throughout

the LV wall, being 2.6-fold more abundant in subendocardial

than in subepicardial myofibers of the P15 LV (p < 0.01; Figures

3B and 3F). In these transverse cross sections, CMs in the sub-

endocardium are cut along their short axes, while CMs in the

subepicardium are cut along their long axes; these latter myofib-

ers are oriented circumferentially in the LV wall (Figure 3B).

We also found that 14.5% ± 2.6% of LV CM nuclei were in

mitosis versus 0.73% ± 0.4% in the right ventricle (RV) (Figure 3E)

(n = 5/group; p < 0.001). Figures S2A–S2C illustrate this differen-

tial distribution of mitotic CMs in a transverse section of P15

heart, which is in contrast to the broad distribution of mitotic

CMs in P2 neonatal heart (Figures S3A–S3C).

To verify the abundance of mitotic CMs in P15 cardiac ventri-

cles, we purified CMs after enzymatic disaggregation, and used

a-sarcomeric myosin heavy chain (a-MHC) and aurora B immu-

nofluorescence to identify CMs in M phase. Approximately 10%

of total mitotic P15 CMs were mononuclear (had an aurora

B-positive nucleus or aurora B localized at the anaphase spindle

midzone), and�90% were binuclear (aurora B-positive nuclei or

aurora B localized at the anaphase spindle midzone of 2 pairs of

nuclei) (Figure 3G). A total of 34.2% ± 4.4% and 30.8% ± 2.7% of

mono- and binuclear CMs, respectively, were in M phase (n = 6)

(Figure 3H); this is �2-fold higher than in immunohistochemical

analyses (Figure 3E), which have been shown to underestimate

mitoses (Mollova et al., 2013).

In some mitotic binuclear CMs, we found sarcomeric struc-

tures on the periphery (e.g., Figure 3G shows a binucleate CM

in anaphase, labeled ‘‘A’’). Localized disruption of sarcomeres

may facilitate chromosomemovement and cytokinesis but could

also adversely affect LV function. However, cardiac contractility

was similar in P14 and P15 hearts (LV fractional shortening:

35.8% ± 3% in P14 hearts versus 35.1% ± 2.3% in P15A hearts;

n = 6/group; p = 0.87), suggesting that the sarcomeric disruption

noted in P15 CMs was not sufficient to depress LV function.

Cytokinesis requires the formation and constriction of a

mature contractile ring. Aurora B and the central spindlin com-

ponent mitotic kinesin-like protein (MKLP1) make independent

contributions to this process (Lewellyn et al., 2011). Because

most of the mitotic CMs in P15A hearts were in the LV sub-

endocardium (where myofibers are oriented longitudinally), we

examined CMMKLP1 localization in longitudinal sections, where

axial views of CMs in late mitosis are more likely. Approximately

4% of CMs contained MKLP1 between pairs of CM nuclei (Fig-

ures 3I and 3J). The frequency of these CM MKLP1+ events

and of mitotic figures (Figures S4A–S4E) supports CM prolifera-

tion in P15 hearts.

Modes of Mitosis in Mononuclear and Binuclear CMsMononuclear CMs that have entered M phase can produce two

mononuclear daughter cells via a conventional cell cycle. We

calculated the number of mono-, bi-, and multinuclear CMs

added to the ventricles between the morning of P14 (9:00 a.m.)

and the afternoon of P15 (4:00 p.m.) by multiplying the average

CPN (Figure 2A) by the percentages of CMs that were mono-

nucleate, binucleate, or multinucleate at these times (Figures

4A–4D; Table S1). The most striking change was the addition

of 11.5 3 104 mononuclear CMs (2.3-fold increase). For extant

Figure 3. The Proliferative Burst Is Tempo-

rally Discrete and Involves Division of Pre-

dominantly Subendocardial CMs

(A–D) Immunohistochemical identification of

mitotic CMs (red staining, aurora B+ nuclei in

a-sarcomeric actin+ CMs stained in green) in

transverse cut tissue sections showing localiza-

tion in the subendocardial regions of the left

ventricle (LV) of P15 mice, with few aurora B+ cells

evident in the subepicardial regions of the LV, in

the right ventricle (RV) or in LV sections of P14 or

P16 hearts. The nuclear localization of aurora B

indicates that these CMs are in prophase.

(E and F) Quantitation of aurora B+ cells identified

(A–D), as seen in various regions of the LV and RV

of P14, P15, and P16 hearts.

(G) Quantitation of LV aurora B+ P15-CMs showing

that �90% are binucleated. In the adjacent

photomicrograph, the punctate aurora B staining

(red) indicates that these CMs, labeled P, are in

prophase. In another CM, labeled A (anaphase),

aurora B localization between nuclei pairs is

consistent with its localization at centromeres

between kinetochores, or at the anaphase spindle

midzone (asm). Note also the loss of cross-stria-

tions and marginalization of sarcomeric structures

in the CM labeled ‘‘A’’; blue, DAPI; green, a-MHC.

(H) Approximately equal percentages of P15

mononuclear (1N) and binuclear (2N) CMs are

aurora B+.

(I) CMs in late telophase/cytokinesis in longitudinal

sections of the LV subendocardium, detected

using an MKLP1 antibody. Arrowheads indicate

XY and XZ reconstruction planes in the enlarged

insets.

(J) Frequency of MKLP-1+ CM-specific events in

transverse sections of the LV subendocardium.

Data are shown as mean ± SEM. The number of

animals studied is shown by n or by values in

square brackets. **p < 0.01; ***p < 0.001; gp.,

group. See also Figures S2, S3, and S4.

Cell 157, 795–807, May 8, 2014 ª2014 Elsevier Inc. 799

Figure 4. Increase in CM Population

Number Involves Division of Mono- and

Binuclear CMs

(A–C) Percentage of mononuclear (mono-CM),

binuclear (bi-CM), and multinuclear (multi-CM)

CMs in the hearts of P14, the afternoon of P15

(P15A), and P18 mice.

(D) Number of CMs in cardiac ventricles of P14,

P15A, and P18 mice. Total numbers are shown in

the left panel and the numbers of mono-, bi-, and

multinuclear CMs in these hearts are shown in the

right panel (these data are from Figure 2A). We

calculated the number of mono-, bi-, and multi-

nuclear CMs that are added to the cardiac ven-

tricles by multiplying the average CPN (Figure 2A)

with the percentage of CMs that were mono-, bi-,

or multinuclear at these developmental ages

(shown in Figures 4A–4C). In (A)–(D), the number of

animals studied is shown by the value in square

brackets.

(E–H) Volume (E and F), width (G), and length (H) of

mono- and binuclear CMs in P14, P15A, and P18

mouse hearts. The volume of individual CMs is

represented by a red (mono-CM) or green (bi-CM)

dot and was from the hearts of five mice at each

time indicated (E and F). In (G) and (H), histograms

represent averagewidths or length of CMs (n = 69–

107 mono-CMs/group and n = 391–512 bi-CMs/

group) from five mice at each time indicated.

(I) Scheme illustrating potential modes of cell

cycling during maturational heart growth. Mono-

nuclear CMs undergo a conventional cell cycle to

replicate. Binuclear CMs remain static or undergo

cell division. This involves each of the two nuclei

undergoing karyokinesis, with cytokinesis taking

place between nuclei pairs. This generates two

mononuclear CMs at the two poles and a smaller

binuclear CM remains at the center. Overall, these

processes increase the number of mononuclear

CMs, without greatly changing the number of

binuclear CMs. However, between P14 and the

afternoon of P15 (P15A), mono- and binuclear CM

volume decreases because smaller daughter cells

are generated from larger preexisting CMs.

Data are shown as mean ± SEM. **p < 0.01; ***p <

0.001. See also Figure S1 and Table S1.

mononuclear CMs to be the sole source of this addition, all

mononuclear CMs present at P14 (calculated to be �8.5 3 104

cells) would need to undergo mitosis on P15. However, the

rate of mitosis in mononuclear CMs on P15 was only�34% (Fig-

ure 3H); this could account for at most 2.93 104 cells (or 25% of

the addition). Moreover, mitosis of mononuclear CMs does not

explain the origin of the 6 3 104 binuclear, and the 9.4 3 104

multinuclear, CMs added between P14 and P15A (Table S1).

Binuclear CMs are thought to be incapable of division,

because polyploidy is considered to indicate terminal differenti-

ation. However, Miyaoka et al. (2012) propose that binuclear

hepatocytes that have enteredM phase assemble all condensed

chromosomes from two nuclei and produce two mononuclear

daughter cells, so that a binuclear cell is ‘‘consumed’’ with the

800 Cell 157, 795–807, May 8, 2014 ª2014 Elsevier Inc.

birth of two mononuclear cells. Our calculations do not support

this as the dominant mechanism, because binuclear CM

numbers increase by �6% (or 6 3 104 cells). Nonetheless, the

finding that �90% of all P15 mitotic CMs are binucleate (Fig-

ure 3G) suggests amajor role for polyploid cells in the CM hyper-

plastic burst. The initiation of M phase and karyokinesis at each

nucleus of a binuclear CM, followed by cytokinesis between

pairs of newly generated daughter nuclei, could yield two small

mononuclear cells at the poles, with a binuclear cell remaining

at the center. The two nuclear divisions would each contribute

one nucleus to the binuclear daughter cell. We refer to this as

the ‘‘2+1 cell cycle.’’ In vitro examples of a 2+1 cell cycle in a

binuclear CM have been observed (Engel et al., 2005). Alterna-

tively, mitotic binuclear CMs could undergo acytokinetic mitoses

to yield multinuclear CMs or not proceed beyond prophase (i.e.,

abortive mitosis).

We considered these possibilities because confocal immuno-

cytochemical studies with aurora B revealed many binuclear

CMs in prophase; others displayed dual karyokinesis with evi-

dence of a spindle midzone between the nuclei in each pair

(that is, postkaryokinesis) (e.g., Figure 3G, inset). If a significant

number of 2+1 cell cycles occur, then the volume of binuclear

cells should decrease precipitously between P14 and the after-

noon of P15. Consistent with this scenario, the average volumes

of bi- and mononuclear CMs decreased by 60% (p < 0.001) and

43% (p < 0.001) (Figures 4E–4H), respectively, despite an

�10% increase in heart weight (from 35.6 ± 0.86 mg, n = 10 at

P14 to 39.1 ± 1.3 mg at P15, n = 11; p < 0.05). If all mitotic mono-

nuclear CMs at P15 undergo a conventional cell cycle to yield

two mononuclear daughter cells, we calculate that it would

require only �7.3% of the binuclear CMs to undergo an uncon-

ventional 2+1 cell cycle in order to achieve the observed increase

in total mononuclear CM numbers, including the 6 3 104 binu-

clear CMs that are added (presumably through subsequent

endocycles in some mononuclear cells) between P14 and

P15A. These concepts are schematically illustrated in Figure 4I.

While some of the 9.4 3 104 multinuclear CMs added between

P14 and P15 might be intermediates of the 2+1 cell cycle,

most are unlikely to divide further because their numbers

decrease by only �7% in the following 3 days (Figure 4D). The

finding that binuclear CM size (but not numbers) decreases

sharply (by �60%), as mononuclear CM numbers increase by

2.3-fold between P14 and P15, supports polyploid CM mitoses

followed by cell division as the major component of the CM pro-

liferative burst.

c-kit+ Cardiac Stem and Progenitor Cells inPreadolescent HeartsWe next evaluated if CM progenitor cells (c-kit+ and Nkx-2.5+)

derived from c-kit+ resident stem cells—the most abundant

CM-forming stem cell in postnatal hearts (Linke et al., 2005)—

might contribute to the mononuclear CM pool. Flow cytometric

analysis of the non-CM fraction of P14 ventricles showed

209 ± 52 (n = 5) c-kit+/Nkx-2.5� small interstitial cells (which

include c-kit+ cardiac- and bone marrow-derived stem cells)

and 69 ± 29 (n = 5) c-kit+/Nkx-2.5+ CM progenitors. These

numbers are insufficient to account for the addition of

�500,000 CMs between P14 and P18.

Thyroid Hormone Triggers Cardiac Growth andHyperplasia during Early PreadolescenceDespite a highly significant correlation (r2 = 0.93; p < 0.0001)

between heart and body weight between P2 and P84 (Figure S5),

from P11 to P18 heart weight increased more than body weight

(Figure S5). This suggests that the preadolescent increase in

heart growth cannot be accounted for by rapid circulatory

volume expansion (or body weight) alone.

Immediately after P10, the rate of heart growth exceeded that

of body growth (Figure 5A), resulting in a rapid 30% increase in

heart-to-body weight ratio between P10 and P17 (p < 0.001).

The initial phase of this increase, between P10 and P14, was

by eccentric hypertrophy. This involved not only a 1.56-fold in-

crease in cardiac mass (p < 0.001; Figure 1B) but also increases

in LV chamber dimensions (1.24-fold increase in LVEDD; p <

0.001) and volume (2.8-fold increase; p < 0.001) (Table S2),

with more prominent increases in CM length than width (Figures

S6A–S6C) but without CM hyperplasia (Figure 2A). These

changes caused a 22%decrease in the h/Ri ratio (p < 0.05; Table

S2), indicating an increase in LV wall stress based on the law of

LaPlace. But ventricular a/b-MHC mRNA ratio also increased

�5-fold (p < 0.01; Figure 5B) and a-MHC levels increased 2.5-

fold (p < 0.05; Figure 5C), while atrial natriuretic factor mRNA

levels (a marker of pathological hypertrophy) were not signifi-

cantly increased (Figure 5D).

This molecular andmorphological signature suggests a 3,30,5-triiodo-L-thyronine (T3 or thyroid hormone)-mediated effect,

since neither physiological nor pathological cardiac hypertrophy

causes large increases in the a/b-MHCmRNA ratio (e.g., Perrino

et al., 2006), but T3 excess does (Haddad et al., 2008). Consis-

tent with this hypothesis, serum T3 levels increase 5.6-fold

between P10 and P12 (Figure 5E). To determine if T3 is neces-

sary for the post-P10 cardiac growth, we inhibited T3 biosyn-

thesis with propylthiouracil (PTU). PTU administration from P7

decreased serum T3 levels at P14 by 43% (p < 0.05) (Figure 5E),

prevented the increase in the a/b-MHC mRNA ratio (Figure 5B),

and reduced heart weight more than body weight, so that by

P14–P18, the heart-to-body weight ratios of PTU-treated mice

were not significantly different from P10 mice (Figure 5F). This

is consistent with a high level of circulating T3 regulating cardiac

growth during early preadolescence. The subsequent decrease

in heart-to-body weight ratio between P16 and P21 (Figure 5A)

was due to a reduced rate of heart growth (relative to the previ-

ous 5 days) (Figure 1B), during which body weight continued to

rise (Figure 1A), but not due to a reduction in serum T3, which re-

mained high between P12 and puberty (Figure 5E).

Hence, preadolescent growth is characterized by a bidirec-

tional disparity in heart and bodyweight changes—first, between

P10 and P16, when heart growth exceeds that of the body, and

subsequently between P16 and P21, when body growth ex-

ceeds that of the heart. Together, these findings suggest that

between P10 and P14, T3 critically modulates the mode

by which body weight/circulatory volume drives heart growth,

allowing a more rapid increase in heart size during early

preadolescence.

We next evaluated the role of T3 in CM hyperplasia. Blockade

of T3 biosynthesis abrogated the developmental increase in the

CPN by P18 (Figure 5G). Also, a 7-day exposure of cultured P14

CMs to T3 (70 nM) produced an �2-fold increase in DNA syn-

thesis (BrdU incorporation) (p < 0.05; Figure 5H).

We then explored a potential link between T3 and insulin-like

growth factor-1 (IGF-1) in preadolescent hearts. The IGF-1-R/

Akt pathway in the heart is both prosurvival and proproliferative

(Dai and Kloner, 2011); IGF-1 is mainly secreted by cardiac

fibroblasts (Horio et al., 2005). Akt is required for phy-

siological growth in response to IGF-1 stimulation (DeBosch

et al., 2006). T3 regulates IGF-1 mRNA in osteoblasts via an

Igf1 thyroid hormone response element (TRE) (Xing et al.,

2012). IGF-1 causes fetal heart CM proliferation by activating

the IGF-1-R/PI3K/Akt pathway (Sundgren et al., 2003), and

postnatal CM numbers are increased in transgenic mice with

Cell 157, 795–807, May 8, 2014 ª2014 Elsevier Inc. 801

Figure 5. Disparity in the Relationship

between Heart and Body Growth with CM

Proliferation Requires a T3 Surge

(A) Temporal change in heart-to-body weight

ratios of wild-type (WT) mice showing that heart

growth exceeds body growth between P10

and P18.

(B and C) Increase in LV a/b-MHC mRNA ratio (B)

and a-MHC expression (western blot above;

quantitation below) (C) from P10 and P14, and

blockade of the increase inmRNA ratio by PTU (B).

(D) Expression of ANP mRNA is not significantly

changed between P10 and P14.

(E) 3,30,5-Triiodo-L-thyronine (T3) levels increase

markedly between P10 and P12 and remain stable

thereafter. The increase in T3 is abrogated by PTU

(red dot and green bar).

(F and G) Increase in heart-to-body weight ratio

from P10 to P14, P15, and P18, and inhibition of

these increases by PTU (F). PTU also prevents the

increase in CPN between P10 and P18 (G).

(H) Treatment of cultured cardiomyocytes isolated

from P14 mice with T3 for 7 days increased the

percentage of BrdU+ CMs (cTnT+).

Data shown are the means ± SEM. The number of

individual animals studied is shown by n. *p < 0.05;

**p < 0.01; ***p < 0.001. See Figures S5, S6, and S7

and Table S2.

cardiac-restricted IGF-1 overexpression (Reiss et al., 1996). We

found that IGF-1 mRNA and IGF-1 expression are increased

2.3-fold (p < 0.05; Figure 6A) and 39-fold (p < 0.05; Figures

6B–6F), respectively, in P15 relative to P10 hearts. Activation

of IGF-1-R requires phosphorylation that activates phosphati-

dylinositol-3 kinase (PI3K), which phosphorylates and activates

Akt. PTU suppressed both phospho-Tyr1161-IGF-1-R/glyceral-

dehyde 3-phosphate dehydrogenase (GAPDH) (Figure 6G and

6H) and phospho-Ser473-Akt/total Akt levels (Figure 6I), indi-

cating the involvement of T3 in activating the IGF-1-R/Akt

pathway in P15 ventricles.

Akt phosphorylates multiple substrates implicated in cell

survival and heart growth. In CMs, nuclear localization of Akt is

functionally important. Expression of constitutively activated

Akt results in CM hypertrophy (Condorelli et al., 2002), but

nuclear overexpression increases CM numbers (Rota et al.,

2005). Akt was mostly localized to CM nuclei in P15 hearts (Fig-

ures 6J–6N); in P10 hearts, its localization was cytoplasmic.

Consistent with the distribution of mitotic CMs (Figures 3E and

3F), Akt+ CM nuclei were predominantly in the subendocardium

of the P15 LV wall (Figure 6N) and were not detected in the RV.

802 Cell 157, 795–807, May 8, 2014 ª2014 Elsevier Inc.

Collectively, these findings support a

role for T3 in triggering the P15 CM hy-

perplastic burst.

Cardiac Function after MyocardialInfarction in Neonatal and EarlyPostnatal HeartsExtensive cardiac regeneration after

injury, leading to restoration of the ven-

tricular wall without scar formation, is observed in P1, but not

P7 or P14, mice (Porrello et al., 2011, 2013). This is consistent

with the prevailing view that CMs permanently exit the cell cycle

by the end of the neonatal period (at �P5). However, prominent

CM proliferation at P15, as shown above, might allow cardiac

regeneration. We thus evaluated the early regenerative potential

of P15 mouse hearts by subjecting them to myocardial infarction

and comparing their response to those of P2 and P21 animals.

Figure 7A shows examples of P2- and P15-injured hearts at 7

or 21 days postinfarction (dpi). Despite no significant differences

in infarct sizes at 1 dpi (Figure 7B), P21 infarct sizes were 6.8-fold

greater (p < 0.001) at 7 dpi than P2 infarct sizes, while infarct size

was intermediate in P15 hearts; infarct size was also 2.4-fold

greater (p < 0.01) at 7 dpi in P21 versus P15 hearts (Figure 7B).

We next compared levels of DNA synthesis in CMs within the

remote (nonischemic) and border zones, as compared to control

regions in age-matched sham-operated mice. We gave BrdU

intraperitoneally at 1 and 3 dpi and determined the number of

BrdU+ CMs in LVmyocardium at 7 dpi by immunohistochemistry

and confocal microscopy. There was robust cell-cycle activity

throughout the LV myocardium in both sham-operated and

Figure 6. Increased Expression of IGF-1

mRNA and IGF-1 in P15 Ventricles Causes

IGF-1-R and Akt Phosphorylation that Is

Inhibited by PTU

(A–F) Ventricular IGF-1 mRNA levels and IGF-1

immunostaining (IGF-1, red staining; DAPI, blue

staining; B–E, quantitation in F) at P10, P14, P15,

and P16, showing significant increases from P10

to a peak at P15.

(G–I) Immunoblotting (G) of ventricular myo-

cardium obtained from P10 and P15 mice, and

quantitation showing significant increases in the

P-IGF-1-R-to-GAPDH (H), and P-Akt-to-total Akt

ratios (I) between P10 and P15 and suppression of

these increases at P15 by PTU treatment. How-

ever, total Akt/GAPDH levels did not significantly

change at P15 after PTU treatment (I).

(J and K) Cytosolic Akt localization in P10 LV

sections (red) (J). In the presence of a-MHC

staining (green), the cytoplasm appears yellow

due to colocalization of Akt with a-MHC (K).

(L and M) Nuclear Akt localization in P15 LV

sections is evident from the purple staining (white

arrows), which results from the colocalization of

Akt (red) with DAPI (blue), and is also shown in the

adjacent magnified panel (L); nuclear localization

of Akt (indicated by purple staining and white

arrows) does not change the color of cytoplasmi-

cally localized a-MHC (green) (M).

(N) Quantitation of Akt+ CM nuclei shows few if

any cells in P10 right ventricle (RV), in the endo-

cardium (Endo) and epicardium (Epi) of P10 LV,

and in P15 RV. In P15 LV, Akt+ CM nuclei are

readily identified but are 51-fold more abundant in

endo- versus epicardium. n = 3–7 animals for each

individual evaluation.

Data shown are the means ± SEM. In all studies,

*p < 0.05; ***p < 0.001. See Figure S7.

infarcted P2 hearts but�10-fold lower levels of cell-cycle activity

in the border zone of P15 mice (versus that in injured P2 hearts;

p < 0.05) (Figure 7C). BrdU+ CMs were virtually undetectable in

the border zone of infarcted P21 hearts (Figure 7B). The detri-

mental impact of infarction on LV function (LV fractional short-

ening and ejection fraction; Figures 7D and 7E, respectively)

and LV wall thinning (Figure 7F) was not evident in P2 hearts at

7 dpi, as may be expected with extensive regenerative repair

(Figures 7A and 6C); it was intermediate at P15 and severe at

P21 (Figures 7D and 7E). These differences in functional and

morphological outcomes at 7 dpi in P2 and P15 mice were

independent of the size of the initial infarct (Figure 7B). Thus, in

murine hearts, the capacity for cardiac regeneration after P15

is intermediate between that at P2 and at P21.

DISCUSSION

Although CM terminal differentiation has been extensively

studied, when it occurs and what role it plays in early postnatal

heart maturation are fundamental questions that remain largely

unanswered. Here, we show that over a precisely timed interval

during the third week of life, �500,000 CMs are added to the

preadolescent mouse heart. This represents an �40% increase

in CPN, with CM numbers remaining static thereafter. These new

cells are derived from CMs previously believed to have lost,

shortly after birth, their capacity to divide. Further, we find

evidence that thyroid hormone triggers the hyperplastic burst

at P15. Hence, it is likely that terminal differentiation in CMs

does not occur before P15: these findings question the 100-

year-old concept that CMs terminally differentiate in the neonatal

period (Bizzozero, 1894).

The Timing of CM Terminal Differentiation in PostnatalMurine HeartsTerminal differentiation in mature mammalian CMs means that

these cells have permanently withdrawn from the cell cycle.

Mechanisms responsible might include a marked suppression

of basal levels of expression of cell-cycle genes that promote

cell division and/or increased expression of genes that inhibit

the cell cycle (Poolman andBrooks, 1998).When CMs are forced

to reenter the cell cycle, as with forced overexpression of S

phase cyclins, endoreplicative cell cycles (or endocycles) pro-

duce large polyploid cells (Soonpaa et al., 1997). Alternatively,

cells that proceed past theG2/M phase checkpoint undergo acy-

tokinetic mitoses to generate large multinucleate cells (Soonpaa

et al., 1997). However, despite prominent cell-cycle checkpoints

Cell 157, 795–807, May 8, 2014 ª2014 Elsevier Inc. 803

Figure 7. Reparative Response of P2, P15,

and P21 Hearts to Myocardial Infarction

(A) Representative coronal sections of hearts from

P2 and P15 mice at 7 and 21 days postmyocardial

infarction (MI; dpi) induced by left anterior de-

scending coronary artery ligation. Sections are

stained with picrosirius red to delineate scar tissue

(arrows) and fast green to delineate viable

myocardium. Note the virtual absence of scar

tissue in P2 MI mice at 7 and 21 dpi compared to

mice whose MI occurred at P15.

(B) Percent infarct size relative to the LV of P2,

P15, and P21 mice 1 and 7 dpi determined from

2,3,5-triphenyltetrazolium chloride and picrosirius

red with fast green-stained sections, respectively.

Note the differences in infarct sizes at 7 dpi despite

similar infarct sizes at 1 dpi.

(C) BrdU+/a-MHC+ CMs in the remote (non-

ischemic) and border zones of P2, P15, and P21

hearts at 7 dpi, showing fewer cells with evidence

of DNA synthesis (BrdU incorporation) in P15

hearts compared to P2 hearts and the absence of

such cells in P21 hearts.

(D) LV fractional shortening (FS) of P2, P15, and

P21 hearts at 7 dpi or sham operation, determined

from B-mode echocardiographic views at the

midpapillary or apical (peri-infarct) levels. Note the

reduction in FS in P15 hearts and themoremarked

reduction in FS in P21 hearts.

(E) Echocardiographically determined LV ejection

fraction (EF) of P2, P15, and P21 hearts at 7 dpi or

sham operation. Consistent with the changes in

FS, note the significant reduction in EF in the P21

hearts.

(F) Echocardiographically determined LV wall

thickness of P2, P15, and P21 hearts at 7 dpi,

expressed as a ratio of wall thickness in the peri-

infarct or control regions to that at the midpapillary

level. Consistent with the reductions in FS and EF,

note the significant reduction in LV wall thickness

in the P21 hearts.

Data shown are the means ± SEM. In all studies,

n = 3–7 animals for each individual evaluation. *p <

0.05; **p < 0.01; ***p < 0.001; n.s., nonsignificant.

that produce this phenotype, a small number of preexisting CMs

in adult hearts can undergo cell division, which over time may

replace cells lost by apoptosis (Senyo et al., 2013). These may

be a small subset of CMs that have retained replicative com-

petency, or they may reflect a stochastic equilibrium between

replicative competence and terminal differentiation that heavily

favors the latter. This has been taken to suggest that, as murine

CMs exit the neonatal period (immediately after P5), most un-

dergo an endocycle that produces binuclear cells, which are

considered a defining manifestation of terminal differentiation

(e.g., Walsh et al., 2010).

Here, we show that numerous CMs reenter the cell cycle on

the night of P14; this culminates in cell division during P15.

Several lines of evidence suggest that new CMs are derived

from preexisting CMs. First, aurora B labeling indicates that

804 Cell 157, 795–807, May 8, 2014 ª2014 Elsevier Inc.

�30% of both mono- and binuclear CMs are in mitosis on the

morning of P15, and MKLP1 expression in �4% of LV sub-

endocardial CMs indicates impending cytokinesis. MKLP1 plays

an essential role in midbody formation and completion of cyto-

kinesis (Zhu et al., 2005) and marks imminent cytokinesis.

Second, cell counting indicates that 2.6 3 105 CMs are added

to the cardiac ventricles between P14 and P15A. Third, consis-

tent with cell division giving rise to small progeny, the average

mono- and binuclear CM volume abruptly decreases by

�40%–60% and, consistent with extensive cytokinesis, this is

associated with a loss of large mono- and binuclear CMs

observed in P14 ventricles. Fourth, addition of �500,000 CMs

to the cardiac ventricles between P14 and P18 occurs withminor

changes in polyploidy or acytokinetic mitosis (as assayed by

multinucleation). On the morning of P15, �90% of mitotic CMs

are binucleate and, based on nuclear localization of aurora B,

most appear to be in prophase. Those that are in anaphase

display localized disruption of sarcomeres around their nuclei

but no loss of contractile function (LV fractional shortening) dur-

ing the CM replicative burst. Finally, there is a prominent 1-day

increase in many mitosis-regulating genes in P15 heart. These

considerations indicate that murine CMs are not terminally differ-

entiated during early preadolescence and challenge the notion

that binuclear CMs cannot divide.

We suppose that the synchronized and temporally restricted

nature of the CM proliferative burst in P15 hearts has inhibited

its detection. Soonpaa et al. (1996) found near-negligible levels

of S phase in P10–P21 CMs using a 2 hr in vivo 3H-thymidine

labeling protocol. This approach could miss a short synchro-

nized proliferative burst in which S phase starts during the night

of P14 and ends before the morning of P15 (S phase duration in

CMs is not known, but it could last �4 hr in a 24 hr cell cycle). In

support of this notion, we found extensive nuclear localization of

aurora B, indicating that these CMs have just passed the G2/M

phase transit point by the morning of P15. Walsh et al. (2010)

studied CM mitosis in P14, but not P15, CMs. Relative to P15

hearts, we observed very low levels of CM mitoses in P14 or

P16 hearts.

Porrello et al. (2011) report that hearts retain significant cardiac

regenerative potential for a brief time after birth. The link between

regenerative potential and postnatal cell-cycle arrest, as as-

sessed by CM binucleation, was suggested to indicate a brief

neonatal ‘‘cardiac regenerative window’’ that closes before P7.

We show here that CMs are not terminally differentiated at P15.

To ask if regenerative repair is possible at P15, we assessed

recovery from myocardial infarction in neonatal and postnatal

hearts (P2, P15, and P21). Our findings indicate an intermediate

phenotype in hearts injured at P15 (ejection fraction unchanged

but with a 64% depression of fractional shortening at the peri-

infarct level) relative to those injured at P2, which showed a

high degree of repair after injury (ejection fraction unchanged

with no depression of fractional shortening at the peri-infarct

level). Hearts injured at P21 (ejection fraction reduced by 40%,

with�90% depression of fractional shortening at the peri-infarct

level) showed no evidence of injury-induced CM cell-cycle

reentry. This intermediate cardiac pathology in P15-injured

hearts might be due to the level of CM proliferation: BrdU incor-

poration into CMs in the border zone was lower than that in P2-

injured hearts, possibly because CMs terminally differentiate

within the7dpi follow-upperiod.Upregulation of the T3-triggered

IGF-1/IGF-1 receptor (IGF-1R)/phospho-Akt axis at P15,which is

prosurvival (Dai and Kloner, 2011), may also have played a role in

attenuating cardiac pathology in P15- versus P21-injured hearts.

Finally, immune responses to injury influence cardiac regenera-

tion and functional outcomes (Xin et al., 2013), factors that

change profoundly as the neonate transitions into preadoles-

cence (Levy, 2007). These complexities would need elucidation

to enable efficient regenerative repair in preadolescent hearts.

Preadolescent Heart Growth Occurs via a Distinct Formof Physiological HypertrophyIt is axiomatic that the main purpose of heart growth during pre-

adolescence is to increase stroke volume and cardiac output to

accommodate a growth spurt that almost quadruples body

weight (and hence circulatory volume) of P10 mice in just

25 days. Our studies indicate that maturational heart growth,

while sharing similarities with other forms of cardiac hypertro-

phy, shows differences that suggest that it is a distinct form of

physiological hypertrophy.

Mechanistically, LV volume overload of mitral regurgitation

leads to fiber elongation, chamber enlargement, and eccentric

hypertrophy (Grossman et al., 1975). Moreover, an increase in

LV sphericity and a decrease in h/Ri ratio cause an increase in

LV end-diastolic wall stress. By contrast, increases in LV cham-

ber volume during endurance exercise are accommodated by

elliptical remodeling of the heart (Schiros et al., 2013). This limits

the increase in LVEDD and, hence, based on LaPlace’s law (T =

P 3 Ri/h, where T is the tension or wall stress and P is the pres-

sure difference across the LV wall), wall stress and myocardial

oxygen demand do not need to increase as much as with an

equivalent increase in LV volume due to spherical remodeling.

We find that LV chamber sphericity increases, and the h/Ri ratio

decreases (by �50%), during maturational heart growth. Thus,

LV wall stress must increase progressively during maturational

growth. Despite this, stroke volume increases, most likely due

to an increase in a-MHC expression and to CM proliferation.

Maturational heart growth thus combines CM proliferation with

an increase in a-MHC, which correlates directly with overall

cardiac performance (Krenz and Robbins, 2004), thus indicating

a distinct form of cardiac remodeling.

Hyperplastic Heart Growth of Preadolescence InvolvesHemodynamic-Endocrine InterplayWeobserved that preadolescent CM hyperplasia was abrogated

by inhibition of T3 biosynthesis. Moreover, T3 promoted cell-

cycle reentry of cultured P14 CMs. While these findings are

consistent with T3 being both necessary and sufficient for the

preadolescent proliferative burst, the fact that the spike in T3

occurs well before proliferation begins, as well as the uneven

but nonrandom distribution of mitotic CMs within the LV wall,

suggests a greater level of complexity. T3 also causes CMs to

elongate (Pantos et al., 2007), which is expected to increase

LVEDD and hencewall stress.We showed that LVEDD increased

markedly between P10 and P14. During isovolumic LV contrac-

tion, wall stress is higher in subendocardial than in subepicardial

regions (Mirsky, 1973). And, as shown in fetal (Saiki et al., 1997)

and early neonatal CMs (Sedmera et al., 2003), wall stress

stimulates CM replication. Thus, we speculate that the preado-

lescent CM proliferative burst involves an orchestrated interplay

between a permissive increase in T3 level and a regional increase

in wall stress (Figure S7).

These unique features of maturational heart growth are likely

to be important for maintaining cardiac performance during a

critical period of body growth, which is unsupported by

maternal/placental nutrient and oxygen supply and involves

increasing circulatory pressures. Furthermore, the finding that

CM proliferative capacity is sustained well beyond the neonatal

period may have important clinical implications. For example,

congenital hypoplastic heart syndromes are often treated with

palliative surgery and eventually cardiac transplantation. If hu-

man CMs, like those of the mouse, continue to divide efficiently

Cell 157, 795–807, May 8, 2014 ª2014 Elsevier Inc. 805

during preadolescence, this may provide a basis for stimulating

cardiomyogenesis in young patients by the administration of T3.

Indeed, a therapeutic benefit of T3 in the postoperative period

has been reported in newborn children undergoing operations

for complex congenital heart diseases (Chowdhury et al., 2001).

EXPERIMENTAL PROCEDURES

Animals

To minimize size variation, only male mice (C57BL/6J) from litters of six to

seven were used, unless otherwise indicated. To avoid potential inaccuracies

in the timing of birth, only animals with confirmed birthdates were used. Ani-

mals were handled according to Emory University or Victor Chang Cardiac

Research Institute institutional animal care and use committee guidelines.

Echocardiography

Echocardiography was performed under 2% isoflurane anesthesia as

described previously (Li et al., 2008) (see Extended Experimental Procedures).

Ventricular Myocardial Wall Volume

Ventricular volumes were determined from ventricular weights and the known

specific gravity of muscle. See Extended Experimental Procedures for details.

Myocardial Infarction and Infarct Size Determination

Mice were anesthetized and subjected to left anterior descending artery liga-

tion via left thoracotomy. Infarct sizes were determined on triphenyl tetrazo-

lium chloride (1 dpi) or picrosirius red/fast green-stained (7 dpi) sections, using

Image J software (NIH) or scanning by PowerMosaic microscopy, respectively

(see Extended Experimental Procedures).

CM Isolation, Nucleation, Ploidy, and Dimension Analyses

CMs were isolated by Langendorff perfusion and distinguished from non-CMs

by cytoplasmic size and phase-contrast microscopy. Samples (20 ml; �150

CMs/aliquot) were loaded in the counting chamber with a wide-bore pipette

and counted in triplicate using a hemocytometer. After purification, CMs

were stained with 40,6-diamidino-2-phenylindole (DAPI) for nucleation counts,

which were plotted as percentage of counted CMs using procedures

described by us previously (Li et al., 2008). CM dimensions were measured

using NIS-Elements 3.0 software (Nikon) (see Extended Experimental

Procedures).

Immunofluorescence

CMs and hearts were fixed and subjected to immunocytochemical and immu-

nohistochemical evaluation, respectively, as described previously (Li et al.,

2008) (see Extended Experimental Procedures).

Quantitative RT-PCR and Western Blot Analyses

RNA prepared from snap frozen heart ventricles was subject to quantitative

RT-PCR using standard techniques (see Extended Experimental Procedures

for details). Proteins extracted from snap frozen hearts were fractionated by

SDS-PAGE and subjected to immunoblotting, as described elsewhere (Li

et al., 2008) (see Extended Experimental Procedures).

CM Culture and Cardiac Stem Cell Analyses

CMs isolated from P14 hearts were cultured and subjected to T3 and BrdU

treatment and cardiac stem cells determined by flow cytometer analysis after

staining for c-kit and Nkx2-5 as detailed in Extended Experimental

Procedures.

Serum T3 Measurement

Serum T3 levels were determined with a T3 ELISA kit (Alpha Diagnostic

International).

Statistics

Data are presented as the mean ± SEM. Statistical differences of continuous

variables were determined by ANOVA followed by post hoc Bonferroni or

806 Cell 157, 795–807, May 8, 2014 ª2014 Elsevier Inc.

Dunnett’s tests or by Student’s t test. GraphPad Prism software was used

for statistical analysis. p < 0.05 was considered significant.

SUPPLEMENTAL INFORMATION

Supplemental Information includes seven figures and two tables and can be

found with this article online at http://dx.doi.org/10.1016/j.cell.2014.03.035.

AUTHOR CONTRIBUTIONS

N.N, A.H., and R.M.G. were responsible for the original concept and design

of primary experiments. N.N. determined heart weights, CMdimension, ploidy,

and multinucleation and conducted most of the immunohistochemical,

quantitative PCR, and flow cytometry analyses. W.W.H. assisted N.N. in the

analysis of CM dimensions. M.L. performedmost of the Langendorff perfusion

studies, with help from T.M. and J.D.L. M.L. and S.R.H. performed CM isola-

tions, immunocytochemical analyses, and CM culture studies. N.N. and M.L.

performed CPN measurements. J.W.C. and D.J.L. performed and interpreted

echocardiographic studies. J.P.L. performed western blot analyses. T.T.

obtained mouse serum and measured T3 concentration levels. S.H.K., J.W.,

M.L., A.Y.C., and S.E.I. performed myocardial infarction and subsequent

echocardiographic analyses of cardiac dimensions, function, infarct sizes,

and immunohistochemistry. M.B.W. and B.H.C. performed several preliminary

studies (not included here) that formed the basis of the paper. A.H., R.M.G.

D.I.K.M., and N.N. prepared the manuscript. All authors discussed the results

and edited the manuscript.

ACKNOWLEDGMENTS

This work was supported by the Division of Cardiology, Department of Medi-

cine, Emory University; the Carlyle Fraser Heart Center, Emory University Hos-

pital Midtown; NIH grants to A.H. (HL079040), J.W.C. (HL098481), M.B.W.

(HL088488), and T.T. (T32HL007745); a John and Mary Brock Translational

Research Fund grant (to A.H.); a Regenerative Engineering and Medicine

(REM) center at Emory and Georgia Tech grant (to A.H. and N.N.); an Emory

and Children’s Center for Cardiovascular Biology pilot grant (to A.H., N.N.,

and M.B.W.); an American Heart Association Scientist Development grant

(to N.N.); National Health and Medical Research Council of Australia grants

(to R.M.G, S.E.I., and M.L.); a Heart Foundation of Australia grant (to R.M.G.,

M.L., and S.E.I.); an R.T. Hall Estate grant (to R.M.G., M.L., and S.E.I.); and

an Australian Research Council Stem Cells Australia, Special Initiative in

Stem Cell Science grant (to R.M.G.). We thank Michael P. Feneley for help

with interpretation of the cardiac hemodynamic data, and Alexa Mattheyses

at the Integrated Cellular Imaging Core, Emory University, for advice and

training in 3D-SIM microscopy.

Received: June 24, 2013

Revised: January 22, 2014

Accepted: March 12, 2014

Published: May 8, 2014

REFERENCES

Bizzozero, G. (1894). Growth and regeneration of the organism. BMJ 1,

728–732.

Carmena, M., and Earnshaw, W.C. (2003). The cellular geography of aurora

kinases. Nat. Rev. Mol. Cell Biol. 4, 842–854.

Chaudhry, H.W., Dashoush, N.H., Tang, H., Zhang, L., Wang, X., Wu, E.X., and

Wolgemuth, D.J. (2004). Cyclin A2 mediates cardiomyocyte mitosis in the

postmitotic myocardium. J. Biol. Chem. 279, 35858–35866.

Chowdhury, D., Ojamaa, K., Parnell, V.A., McMahon, C., Sison, C.P., and

Klein, I. (2001). A prospective randomized clinical study of thyroid hormone

treatment after operations for complex congenital heart disease. J. Thorac.

Cardiovasc. Surg. 122, 1023–1025.

Condorelli, G., Drusco, A., Stassi, G., Bellacosa, A., Roncarati, R., Iaccarino,

G., Russo, M.A., Gu, Y., Dalton, N., Chung, C., et al. (2002). Akt induces

enhanced myocardial contractility and cell size in vivo in transgenic mice.

Proc. Natl. Acad. Sci. USA 99, 12333–12338.

Dai, W., and Kloner, R.A. (2011). Cardioprotection of insulin-like growth

factor-1 during reperfusion therapy: what is the underlying mechanism or

mechanisms? Circ. Cardiovasc. Interv. 4, 311–313.

DeBosch, B., Treskov, I., Lupu, T.S., Weinheimer, C., Kovacs, A., Courtois, M.,

and Muslin, A.J. (2006). Akt1 is required for physiological cardiac growth.

Circulation 113, 2097–2104.

Engel, F.B., Schebesta, M., Duong, M.T., Lu, G., Ren, S., Madwed, J.B., Jiang,

H., Wang, Y., and Keating, M.T. (2005). p38 MAP kinase inhibition enables

proliferation of adult mammalian cardiomyocytes. Genes Dev. 19, 1175–1187.

Grossman, W., Jones, D., and McLaurin, L.P. (1975). Wall stress and patterns

of hypertrophy in the human left ventricle. J. Clin. Invest. 56, 56–64.

Haddad, F., Qin, A.X., Bodell, P.W., Jiang, W., Giger, J.M., and Baldwin, K.M.

(2008). Intergenic transcription and developmental regulation of cardiac

myosin heavy chain genes. Am. J. Physiol. Heart Circ. Physiol. 294, H29–H40.

Horio, T., Maki, T., Kishimoto, I., Tokudome, T., Okumura, H., Yoshihara, F.,

Suga, S., Takeo, S., Kawano, Y., and Kangawa, K. (2005). Production and

autocrine/paracrine effects of endogenous insulin-like growth factor-1 in rat

cardiac fibroblasts. Regul. Pept. 124, 65–72.

Krenz, M., and Robbins, J. (2004). Impact of beta-myosin heavy chain expres-

sion on cardiac function during stress. J. Am. Coll. Cardiol. 44, 2390–2397.

Kriss, J.P., and Revesz, L. (1962). The distribution and fate of bromodeoxyur-

idine and bromodeoxycytidine in the mouse and rat. Cancer Res. 22, 254–265.

Levy, O. (2007). Innate immunity of the newborn: basic mechanisms and clin-

ical correlates. Nat. Rev. Immunol. 7, 379–390.

Lewellyn, L., Carvalho, A., Desai, A., Maddox, A.S., and Oegema, K. (2011).

The chromosomal passenger complex and centralspindlin independently

contribute to contractile ring assembly. J. Cell Biol. 193, 155–169.

Li, F., Wang, X., Capasso, J.M., and Gerdes, A.M. (1996). Rapid transition of

cardiac myocytes from hyperplasia to hypertrophy during postnatal develop-

ment. J. Mol. Cell. Cardiol. 28, 1737–1746.

Li, M., Naqvi, N., Yahiro, E., Liu, K., Powell, P.C., Bradley, W.E., Martin, D.I.,

Graham, R.M., Dell’Italia, L.J., and Husain, A. (2008). c-kit is required for

cardiomyocyte terminal differentiation. Circ. Res. 102, 677–685.

Linke, A., Muller, P., Nurzynska, D., Casarsa, C., Torella, D., Nascimbene, A.,

Castaldo, C., Cascapera, S., Bohm, M., Quaini, F., et al. (2005). Stem cells in

the dog heart are self-renewing, clonogenic, and multipotent and regenerate

infarcted myocardium, improving cardiac function. Proc. Natl. Acad. Sci.

USA 102, 8966–8971.

Mirsky, I. (1973). Ventricular and arterial wall stresses based on large deforma-

tion analyses. Biophys. J. 13, 1141–1159.

Miyaoka, Y., Ebato, K., Kato, H., Arakawa, S., Shimizu, S., and Miyajima, A.

(2012). Hypertrophy and unconventional cell division of hepatocytes underlie

liver regeneration. Curr. Biol. 22, 1166–1175.

Mollova, M., Bersell, K., Walsh, S., Savla, J., Das, L.T., Park, S.Y., Silberstein,

L.E., Dos Remedios, C.G., Graham, D., Colan, S., and Kuhn, B. (2013). Cardi-

omyocyte proliferation contributes to heart growth in young humans. Proc.

Natl. Acad. Sci. USA 110, 1446–1451.

Pantos, C., Xinaris, C., Mourouzis, I., Malliopoulou, V., Kardami, E., and

Cokkinos, D.V. (2007). Thyroid hormone changes cardiomyocyte shape and

geometry via ERK signaling pathway: potential therapeutic implications in

reversing cardiac remodeling? Mol. Cell. Biochem. 297, 65–72.

Perrino, C., Naga Prasad, S.V., Mao, L., Noma, T., Yan, Z., Kim, H.S., Smithies,

O., and Rockman, H.A. (2006). Intermittent pressure overload triggers hyper-

trophy-independent cardiac dysfunction and vascular rarefaction. J. Clin.

Invest. 116, 1547–1560.

Poolman, R.A., and Brooks, G. (1998). Expressions and activities of cell cycle

regulatory molecules during the transition from myocyte hyperplasia to hyper-

trophy. J. Mol. Cell. Cardiol. 30, 2121–2135.

Porrello, E.R., Mahmoud, A.I., Simpson, E., Hill, J.A., Richardson, J.A., Olson,

E.N., and Sadek, H.A. (2011). Transient regenerative potential of the neonatal

mouse heart. Science 331, 1078–1080.

Porrello, E.R., Mahmoud, A.I., Simpson, E., Johnson, B.A., Grinsfelder, D.,

Canseco, D., Mammen, P.P., Rothermel, B.A., Olson, E.N., and Sadek, H.A.

(2013). Regulation of neonatal and adult mammalian heart regeneration by

the miR-15 family. Proc. Natl. Acad. Sci. USA 110, 187–192.

Reiss, K., Cheng, W., Ferber, A., Kajstura, J., Li, P., Li, B., Olivetti, G., Homcy,

C.J., Baserga, R., and Anversa, P. (1996). Overexpression of insulin-like

growth factor-1 in the heart is coupled with myocyte proliferation in transgenic

mice. Proc. Natl. Acad. Sci. USA 93, 8630–8635.

Rota, M., Boni, A., Urbanek, K., Padin-Iruegas, M.E., Kajstura, T.J., Fiore, G.,

Kubo, H., Sonnenblick, E.H., Musso, E., Houser, S.R., et al. (2005). Nuclear

targeting of Akt enhances ventricular function and myocyte contractility.

Circ. Res. 97, 1332–1341.

Saiki, Y., Konig, A., Waddell, J., and Rebeyka, I.M. (1997). Hemodynamic alter-

ation by fetal surgery accelerates myocyte proliferation in fetal guinea pig

hearts. Surgery 122, 412–419.

Schiros, C.G., Ahmed, M.I., Sanagala, T., Zha, W., McGiffin, D.C., Bamman,

M.M., Gupta, H., Lloyd, S.G., Denney, T.S., Jr., and Dell’Italia, L.J. (2013).

Importance of three-dimensional geometric analysis in the assessment of

the athlete’s heart. Am. J. Cardiol. 111, 1067–1072.

Sedmera, D., Thompson, R.P., and Kolar, F. (2003). Effect of increased pres-

sure loading on heart growth in neonatal rats. J. Mol. Cell. Cardiol. 35,

301–309.

Senyo, S.E., Steinhauser, M.L., Pizzimenti, C.L., Yang, V.K., Cai, L., Wang, M.,

Wu, T.D., Guerquin-Kern, J.L., Lechene, C.P., and Lee, R.T. (2013). Mamma-

lian heart renewal by pre-existing cardiomyocytes. Nature 493, 433–436.

Soonpaa, M.H., Kim, K.K., Pajak, L., Franklin, M., and Field, L.J. (1996). Cardi-

omyocyte DNA synthesis and binucleation during murine development. Am. J.

Physiol. 271, H2183–H2189.

Soonpaa, M.H., Koh, G.Y., Pajak, L., Jing, S., Wang, H., Franklin, M.T., Kim,

K.K., and Field, L.J. (1997). Cyclin D1 overexpression promotes cardiomyo-

cyte DNA synthesis and multinucleation in transgenic mice. J. Clin. Invest.

99, 2644–2654.

Sundgren, N.C., Giraud, G.D., Schultz, J.M., Lasarev, M.R., Stork, P.J., and

Thornburg, K.L. (2003). Extracellular signal-regulated kinase and phosphoino-

sitol-3 kinase mediate IGF-1 induced proliferation of fetal sheep cardiomyo-

cytes. Am. J. Physiol. Regul. Integr. Comp. Physiol. 285, R1481–R1489.

Walsh, S., Ponten, A., Fleischmann, B.K., and Jovinge, S. (2010). Cardiomyo-

cyte cell cycle control and growth estimation in vivo—an analysis based on

cardiomyocyte nuclei. Cardiovasc. Res. 86, 365–373.

Xin, M., Olson, E.N., and Bassel-Duby, R. (2013). Mending broken hearts:

cardiac development as a basis for adult heart regeneration and repair. Nat.

Rev. Mol. Cell Biol. 14, 529–541.

Xing, W., Govoni, K.E., Donahue, L.R., Kesavan, C., Wergedal, J., Long, C.,

Bassett, J.H., Gogakos, A., Wojcicka, A., Williams, G.R., and Mohan, S.

(2012). Genetic evidence that thyroid hormone is indispensable for prepubertal

insulin-like growth factor-I expression and bone acquisition in mice. J. Bone

Miner. Res. 27, 1067–1079.

Zhu, C., Bossy-Wetzel, E., and Jiang, W. (2005). Recruitment of MKLP1 to the

spindle midzone/midbody by INCENP is essential for midbody formation and

completion of cytokinesis in human cells. Biochem. J. 389, 373–381.

Cell 157, 795–807, May 8, 2014 ª2014 Elsevier Inc. 807

Supplemental Information

EXTENDED EXPERIMENTAL PROCEDURES

AnimalsTo minimize size variation only male mice (C57BL/6J) from litters of 6–7 were used, unless otherwise indicated. To avoid potential

inaccuracies in the timing of birth, only animals with confirmed birth dates were used. Animals were handled according to Emory

University or Victor Chang Cardiac Research Institute Institutional Animal Care and Use Committee Guidelines.

Heart-to-Body Weight RatiosMice were weighed and, after excising, hearts were washed with phosphate buffered saline (PBS), and then drained by gently

squeezing in cotton gauze before weighing. For ventricular weight determination, hearts were reweighed after removal of the atria.

Ventricular Myocardial Wall Volume MeasurementVentricular weight in grams was multiplied by the known value for specific gravity of muscle (1.06 g/ml) to obtain ventricular

myocardial volume (Chaudhry et al., 2004).

EchocardiographyEchocardiography was performed on mice using a Vevo 770 or 2,100 ultrasound system (VisualSonics) under �1%–2% isoflurane

(Aragon et al., 2011). For evaluations of cardiac dimensions and hemodynamics after myocardial infarction, B-mode images were

taken of LV long axis (LAX) followed by four short axis (SAX) views at the midpapillary level, and then at successive 1, 2 and

3 mm intervals toward the apex. LV length was measured from the apical dimple to the base of the aortic valve leaflets from the

LAX images at end-diastole (ED) and end-systole (ES). The areas boarded by the endo- and epicardium were determined by planim-

etry of all four SAX images at ED and ES, and from this amodified Bullet formula was applied to derive ED and ES LV volumes (LVvol =

L x (mean endocardial area) x 5 / 6). In addition, tissue cross-sectional area (CSA) and fractional area change (FAC) for each SAX

image were calculated. From the ED CSA data, mean chamber radius (r = O(endocardial area/p) and wall thickness (h = O(epicardialarea/p) – r) were calculated. To estimate the degree of EDwall thinning in infarcted tissue, the shortest dimension between endo- and

epicardial borders in akinetic regionswasmeasured at 3mm from themid papillary level in P15 andP21 operatedmice and at 2mm in

P2 operated mice. For normal ventricles of sham controls, this was done by measuring the shortest dimension in the region of the LV

between the anterior and posterior free walls. The acquisition of images and evaluation of data were performed by independent

operators, who were blinded to the treatment (sham versus myocardial infarction).

Myocardial InfarctionMice (P15 and P21) were anesthetized using i.p. xylazine (13 mg/kg), ketamine (100 mg/kg) and atropine (0.5 mg/kg), and after

endotracheal intubation were mechanically ventilated while resting on a heating pad. Anaesthesia was maintained using 1.5%–

2% isoflurane. For P2 mice, anesthesia was induced by cooling the pups for 4 min inside a glove finger placed on iced water. After

lateral thoracotomy in the 4th intercostal space, the left anterior descending artery (LAD) was ligated (9-0 suture for P15 and P21

mice, 10-0 suture for P2 mice) and the chest closed with 7-0 silk. Buprenorphine (0.075 mg/kg) and frusemide (5 mg/kg) were

administered postoperatively. For sham operations, the chest cavity was opened, the pericardial sac was blunt dissected and

the chest then closed. 5-Bromo-2-deoxyuridine (BrdU; 30 mg/kg) was administered postsurgery by intraperitoneal injection on

days 1 and 3.

Infarct Size DeterminationInfarct size was determined 24 hr and 7 days after LAD ligation from myocardial sections subjected to triphenyl tetrazolium chlo-

ride (TTC) or picrosirius red/fast green staining (PSR/FG), respectively. TTC staining was performed on freshly isolated myocar-

dium and infarcted (white) and uninfarcted (red-brown) tissue quantified using Image J software (NIH) as described (Bohl et al.,

2009). For PSR/FG staining, tissue was initially fixed in 2% paraformaldehyde and then paraffin-embedded, and then 5-mm sec-

tions stained, as described (Westenbrink et al., 2007). The entire LV surface area was scanned at high power (x20) using a Power

Mosaic microscope (Leica DM6000, Wetzlar, 35578, Germany) and stained regions determined digitally using Image J software.

Infarct size was calculated and expressed as a percentage of the entire LV surface area as we described previously (Du et al.,

2006).

Cardiomyocyte Isolation, Nucleation, Ploidy, BrdU Labeling, and Dimension AnalysesHearts were perfused with perfusion buffer (120 mM NaCl, 15 mM KCl, 0.5 mM KH2PO4, 5 mM NaHCO3, 10 mM HEPES, and 5 mM

glucose, at pH 7.0) for 4 min and with perfusion buffer containing 2 mg ml–1 collagenase (Worthington) for 15–22 min at 37�C. Theheart was placed in Stop buffer comprising perfusion buffer plus 10%w/v bovine calf serum and 12.5 mMCaCl2. The perfused heart

was gently disaggregated by teasing apart the tissue with scissors followed by passage through pipettes of progressively smaller

diameters (Li et al., 2008). The final cell suspension was loaded onto a hemocytometer. To avoid losses, CMs were not purified

but were distinguished from non-CMs by cytoplasmic size and phase contrast microscopy. CMs were much larger than non-CMs

and were easily identifiable for counting and immune-phenotyping. Three aliquots were counted per heart and the results averaged.

Cell 157, 795–807, May 8, 2014 ª2014 Elsevier Inc. S1

Inadequately digested hearts were discarded. CM numbers were independently verified by corresponding authors’ laboratories at

Emory University and the Victor Chang Cardiac Research Institute, and were found to be in excellent agreement.

To label cells in S phase, a single intraperitoneal injection of BrdU (30 mg/ml) was administered on the night of P14 and mice were

sacrificed on P18.

To inhibit thyroid hormone biosynthesis, PTU was administered to mothers at 0.15% (w/v) in the drinking water from P7–P14 for

serum T3 and heart weight measurements and from P7–P18 for determining the CPN. Investigators blinded to genotype and age

determined all quantitative variables.

For the determination of ploidy, dimension and nucleation analyses, the cell suspension was incubated at 22�C for 5 min and CMs

pelleted by centrifugation at 18 g for 1min. The pellet was resuspended in Stop buffer andwashed 3 times using centrifugation at 18 g

for 1 min. These low-speed washes allowed isolation of CMs to > 95% purity, as assessed by flow cytometric identification of their

troponin T+/propidium iodide+ nuclei as a percentage of total nuclei.

For ploidy determination, CMs were fixed in ice-cold 70% v/v ethanol. Nuclei were liberated as described (Terry and White, 2006).

CMs were digested in 0.2 M HCl and 1 mg/ml pepsin at 37�C for 15 min and digestion stopped with PBS. Nuclei were pelleted and

washed twice in PBS. The purity of the CM nuclei was evaluated as above. A solution containing 200 mg/ml propidium iodide and

12 mg/ml RNase was added, mixed gently and nuclei incubated at 22�C for 30 min and analyzed using an Accuri C6 flow cytometer

(BD). At least 30,000 nuclei were analyzed per heart. For BrdU labeling, isolated CM nuclei were stained with cardiac Troponin T

(cTnT, ab8295, Abcam), BrdU (ab6326, Abcam) and propidium iodide followed by flow cytometric analysis.

For CM dimension and nucleation analyses, CMs fixed in BD Cytofix (BD) were cytospun onto lysine-coated slides. Coverslips

were mounted using Vectashield H-1500 4’,6-Diamidino-2-phenylindole (DAPI)-containing medium (Vector Laboratories) for nucle-

ation analysis. Images were acquired on a Leica DM6000 microscope. CM dimensions were measured using NIS-Elements 3.0 soft-

ware (Nikon). CM length was determined by aligning coordinates to the Max Feret diameter. CM width was determined manually by

measuring the length of a line drawn perpendicular to the cell-long axis at the level of the nucleus. For binuclear CMs thewidth at each

nucleus was determined and averaged. CM area and volumewere determined using the formulaep(d/2)2 andp(d/2)2,l, respectively,where d and l are CM diameter and length, respectively.

P14 CM Cell CultureCMs from P14mice were isolated by Langendorff perfusion as described (O’Connell et al., 2007), with the following modifications: 1)

dissociated tissue was filtered through a 0.2 mm pore size nylon mesh to remove large pieces of undigested tissue; 2) after three

washes in Stop buffer containing increasing calcium concentrations, the CM pellet was re-suspended in MEM containing 10%

v/v FBS, 100 U ml–1 penicillin, 100 mg ml–1 streptomycin and 10 mM BDM; and 3) CMs were plated onto poly-D-lysine-treated

(0.01% w/v; Sigma), laminin-coated (10 mg ml–1; Invitrogen) 8-chamber slides (LabTek Permanox; Nunc) at 3,500 cells/chamber.

Plated CMs were allowed to attach for 2 hr at 37�C, 2% CO2. Medium was changed to growing media (MEM (GIBCO), 10% v/v

FBS, 100 U ml–1 penicillin, 100 mg ml–1 streptomycin) with or without 70 nM T3 and CMs were cultured for 7 days. BrdU(10 mM,

Sigma) was added 24 before termination of the experiment. CMs were fixed by washing twice with PBS, fixing 5 min with 2% w/v

paraformaldehyde, followed by four PBS washes, then stored at 4�C in PBS.

ImmunofluorescenceCMs were fixed in 2% w/v paraformaldehyde for 5 min. After preblocking, CMs were stained with cardiac troponin T (ab10214,

Abcam, 1:600); a-MHC (ab-15, Abcam, 1:600); BrdU (ab6326, Abcam, 1:200) and Aurora B (ab2254, Abcam, 1:100) in 5% v/v

goat serum (GS). All secondary antibodies (Alexa Fluor 488 or 594 goat anti-mouse, -rat, or -rabbit) were from Molecular Probes.

DAPI was used to stain nuclei. Images were acquired on a confocal microscope (Zeiss LSM 700).

Hearts fixed in 2% w/v paraformaldehyde were processed for immunohistochemistry as described (Li et al., 2008). Sections were

stained with antibodies against a-MHC (1:100 v/v), aurora B (1:25), a-sarcomeric actin (1:100), MKLP1 (1:35) and IGF-1 (ab9572,

Abcam, 1:70) and Akt (4691S, cell signaling) in 5% v/v GS. Alexa Fluor-488, and �594 goat anti-mouse or anti-rabbit secondary

antibodies were used. DAPI was used to stain nuclei. To determine if a nucleus of interest was in a CM, several focal planes were

examined by confocal microscopy. For quantitative immunohistochemistry the relative expression/mm2 determined from three 20Xfields of left ventricle of each mouse sample was quantified using NIS Elements AR 3.0 software (Nikon Corporation).

Quantitative RT-PCRRNA extracted from snap frozen ventricular hearts using a mirVana miRNA kit (Ambion) and real-time qRT-PCR performed as

described (Li et al., 2008). Primers for mitosis genes are previously described (Li et al., 2008). Primers for: aMHC were 50: AGTACTTTGCCAGCATTGCAG, 30: CGGACACCTCTCCCTGAGAGA; bMHC were 50: AATATTTTGCTGTTATTGCCGC, 30: CAGT

CGTCTCTCCTTGGGAGAT; ANP 50: CCTGTGTACAGTGCGGTGTC, 30: ACACACCACAAGGGCTTAGG and IGF-1 were 50: ATAAAGATACACATCATGTC, 30: TTGTAGGCTTCAGTGGGGCAC.

Western Blot AnalysisAfter extracting of snap frozen heart tissues with RIPA buffer (Sigma), 20 mg of protein was fractionated on 4%–15%precast Bio-Rad

gels and then transferred to Bio-Rad’s PVDF membrane. Membranes were probed using antibodies to either a-MHC (sc-168676,

S2 Cell 157, 795–807, May 8, 2014 ª2014 Elsevier Inc.

Santa Cruz), p-IGF-1-R (phospho-Tyr1161-IGF-1-R, Ab39398, Abcam), Akt (4691S, cell signaling), p-AKT (phospho-Ser473-Akt,

4060S, Cell signaling) or GAPDH (Cell signaling) as the primary antibodies. Goat anti-mouse IgG (Sigma) or anti-rabbit IgG (Bio-

Rad) conjugated to HRP were used as secondary antibodies. Protein detection was accomplished using a Super Signal West

Dura Kit (Thermo Scientific).

Serum T3 MeasurementBlood was collected into microfuge tubes from mice anesthetized with isoflurane (3%). After 1 hr at 22�C, serum was obtained by

centrifugation at 1,500 g for 5 min at 4�C. Serum T3 levels were determined using an ELISA assay (Alpha Diagnostic International).

c-kit-Positive Cardiac Stem Cells AnalysesCardiac cells were isolated as described above, and centrifuged at 18 g for 1 min to remove CMs. Non-CMs, which include cardiac

stem cells and CMprogenitors, in the supernatant were filtered through a 40 mmmesh, centrifuged at 340 g for 5min at 4�C, and fixed

and permeabilized using a cytofix/cytoperm kit (BD PharMingen). After preblocking with 10% v/v GS + 1% w/v BSA for 1 hr, cells

were stained for c-kit (c-kit-APC antibody, BD) and Nkx-2.5 (Nkx-2.5 antibody conjugated with Alexa Fluor 488, Santa Cruz), and

analyzed using an Accuri C6 Flow cytometer.

StatisticsData are presented as the mean ± standard error of the mean (SEM). Statistical differences of continuous variables were determined

by ANOVA followed by post hoc Bonferroni or Dunnett’s tests or by Student’s t test. GraphPad Prism software was used for statistical

analysis. p < 0.05 was considered significant.

SUPPLEMENTAL REFERENCES

Aragon, J.P., Condit, M.E., Bhushan, S., Predmore, B.L., Patel, S.S., Grinsfelder, D.B., Gundewar, S., Jha, S., Calvert, J.W., Barouch, L.A., et al. (2011). Beta3-

adrenoreceptor stimulation amelioratesmyocardial ischemia-reperfusion injury via endothelial nitric oxide synthase and neuronal nitric oxide synthase activation.

J. Am. Coll. Cardiol. 58, 2683–2691.

Bohl, S., Medway, D.J., Schulz-Menger, J., Schneider, J.E., Neubauer, S., and Lygate, C.A. (2009). Refined approach for quantification of in vivo ischemia-

reperfusion injury in the mouse heart. Am. J. Physiol. Heart Circ. Physiol. 297, H2054–H2058.

Du, X.-J., Gao, X.M., Kiriazis, H., Moore, X.L., Ming, Z., Su, Y., Finch, A.M., Hannan, R.A., Dart, A.M., and Graham, R.M. (2006). Transgenic alpha1A-adrenergic

activation limits post-infarct ventricular remodeling and dysfunction and improves survival. Cardiovasc. Res. 71, 735–743.

O’Connell, T.D., Rodrigo, M.C., and Simpson, P.C. (2007). Isolation and culture of adult mouse cardiac myocytes. Methods Mol. Biol. 357, 271–296.

Terry, N.H., and White, R.A. (2006). Flow cytometry after bromodeoxyuridine labeling to measure S and G2+M phase durations plus doubling times in vitro and

in vivo. Nat. Protoc. 1, 859–869.

Westenbrink, B.D., Lipsic, E., van der Meer, P., van der Harst, P., Oeseburg, H., DuMarchie Sarvaas, G.J., Koster, J., Voors, A.A., van Veldhuisen, D.J., van Gilst,

W.H., and Schoemaker, R.G. (2007). Erythropoietin improves cardiac function through endothelial progenitor cell and vascular endothelial growth factor medi-

ated neovascularization. Eur. Heart J. 28, 2018–2027.

Cell 157, 795–807, May 8, 2014 ª2014 Elsevier Inc. S3

Figure S1. Ploidy State in CM Nuclei from Preadolescent Mouse Hearts, Related to Figure 4

Ploidy of P10, P14 and P18 ventricular CMs as a percentage of total CM nuclei.

The number of individual animals studied is shown in square brackets. *p < 0.05; **p < 0.01.

S4 Cell 157, 795–807, May 8, 2014 ª2014 Elsevier Inc.

Figure S2. Colocalization of DAPI and Aurora B in a Cross Section of a P15 Heart, Related to Figure 3

(A–C) Merged image in (A) showing colocalization of DAPI (blue) and aurora B (red) in a mid papillary transverse plane of a P15 heart (the right ventricle is shown

on the left, and left ventricle on the right of each panel), with CMs labeled with a-sarcomeric actin (green). Distribution of nuclei labeled with DAPI is shown in (B),

and the distribution of aurora B, which is mostly found in nuclei, is shown in (C). Note the high density of mitotic nuclei within the subendocardial region of the LV

and the relatively sparse distribution of mitotic nuclei in the LV subepicardial region and the RV wall.

Cell 157, 795–807, May 8, 2014 ª2014 Elsevier Inc. S5

Figure S3. Colocalization of DAPI and Aurora B a Cross Section of a P2 Heart, Related to Figure 3

(A–C). Merged image in (A) showing colocalization of DAPI (blue) and aurora B (red) in mid papillary transverse plane of a P2 heart (the right ventricle is shown on

the left, and the left ventricle on the right of each panel), with CMs labeled with a-sarcomeric actin (green). Distribution of nuclei labeled with DAPI is shown in (B),

and the distribution of aurora B, which is mostly found in nuclei, is shown in (C). Note the high density of mitotic nuclei throughout the LV and the RV.

S6 Cell 157, 795–807, May 8, 2014 ª2014 Elsevier Inc.

Figure S4. Examples of Mitotic Figures in CMs Observed in the LV of P15 Hearts, Related to Figure 3

(A–D) CMs stained with propidium iodide (red; nuclei) and a-sarcomeric actin (green) showing cells in different stages of mitosis: P, prophase (A and D); PM,

prometaphase (B); M,metaphase (C). These imageswere obtained by three-dimensional structured illuminationmicroscopy (3D-SIM). 3D-SIMwas performed on

an inverted Nikon microscope running NIS Elements with a 100x oil objective, NA 1.49.

(E) Percentage of mitotic LV CMs (CM mitotic index) in P15 hearts.

The number of individual hearts examined is shown by n. PI, propidium iodide.

Cell 157, 795–807, May 8, 2014 ª2014 Elsevier Inc. S7

Figure S5. Relation between Heart and Body Weight in Mice over the first 84 Days of Life, Related to Figure 5

Overall, heart and body weight are very tightly correlated, but heart growth exceeds body growth between P11 and P18 exceeds (green data points).

S8 Cell 157, 795–807, May 8, 2014 ª2014 Elsevier Inc.

Figure S6. Changes in CM Morphometry between P10 and P14, Related to Figure 5

(A–C) The increase in CM volume (A) between P10 and P14 is predominantly due to an increase in CM length (B) rather than width (C).

The number of cells evaluated is shown by n. ***p < 0.001.

Cell 157, 795–807, May 8, 2014 ª2014 Elsevier Inc. S9

Figure S7. A Model for the Role of Thyroid Hormone (T3) in CM Proliferation During Maturational Heart Growth, Related to Figures 5 and 6

Maturational heart growth during early preadolescence (P10 to P14) is characterized by eccentric hypertrophy where an increase in chamber dimension is not

matched by a corresponding increase in ventricular wall growth. This leads to an increase in h/Ri ratio, which is expected to increase LV wall stress due to

considerations of the Lawof Laplace. This change in heart shape is produced by CMgrowth, characterized by a prominent increase in CM length. A T3 surge soon

after P10 plays an important role in this hypertrophic growth and it increases a-MHC by P14. T3 also activates the IGF-1/IGF1-R pathway in the heart causing

phosphorylation and nuclear localization of the proto-oncogene Akt. Thus, T3 triggers CM proliferation in P15 hearts and blockade of T3 signaling by PTU inhibits

this response. Both mono- and binuclear CMs participate in this proliferative response, but binuclear CM proliferation is more conspicuous. This proliferation

produces smaller daughter cells, which prominently reduce average CM volumes. Thus, maturational heart growth between P10 and P14 is by eccentric hy-

pertrophy due to CM elongation, and between P14 and P15 CM hyperplasia expands CM numbers by about 40%, thereby establishing the final CM population

number during preadolescence.

S10 Cell 157, 795–807, May 8, 2014 ª2014 Elsevier Inc.