1 23

Cardiovascular Toxicology ISSN 1530-7905 Cardiovasc ToxicolDOI 10.1007/s12012-014-9266-y

Mitogen-Activated Protein KinasesPathways Mediate the Sunitinib-InducedHypertrophy in Rat Cardiomyocyte H9c2Cells

Hesham Mohamed Korashy, Hani A. Al-Suwayeh, Zaid H. Maayah, MushtaqAhmad Ansari, Sheikh Fayaz Ahmad &Saleh A. Bakheet

1 23

Your article is protected by copyright and all

rights are held exclusively by Springer Science

+Business Media New York. This e-offprint is

for personal use only and shall not be self-

archived in electronic repositories. If you wish

to self-archive your article, please use the

accepted manuscript version for posting on

your own website. You may further deposit

the accepted manuscript version in any

repository, provided it is only made publicly

available 12 months after official publication

or later and provided acknowledgement is

given to the original source of publication

and a link is inserted to the published article

on Springer's website. The link must be

accompanied by the following text: "The final

publication is available at link.springer.com”.

Mitogen-Activated Protein Kinases Pathways Mediatethe Sunitinib-Induced Hypertrophy in Rat CardiomyocyteH9c2 Cells

Hesham Mohamed Korashy • Hani A. Al-Suwayeh •

Zaid H. Maayah • Mushtaq Ahmad Ansari •

Sheikh Fayaz Ahmad • Saleh A. Bakheet

� Springer Science+Business Media New York 2014

Abstract Sunitinib (SUN) is a multi-targeted tyrosine

kinase inhibitor used for the treatment of gastrointestinal

stromal tumors and renal cell carcinoma. Cardiotoxicity

has been reported as a significant side effect associated

with the SUN treatment, yet the mechanism is poorly

understood. The main purpose of this study was to inves-

tigate the potential effects of SUN on cardiac hypertrophic

genes and the role of mitogen-activated protein kinases

(MAPKs) signaling pathway in rat cardiomyocyte H9c2

cell line. In the present study, real-time quantitative poly-

merase chain reaction showed that the treatment of H9c2

cells with increasing concentrations of SUN (0, 1, 2.5, and

5 lM) significantly induced hypertrophic gene markers,

such as brain natriuretic peptides (BNP) and myosin heavy

chain (b-MHC and a-MHC) in concentration- and time-

dependent manners. The onset of mRNA induction was

observed as early as 9 h and remained elevated for at least

18 h after treatment with SUN 5 lM. At the protein level,

Western blot analysis showed that SUN increased BNP and

b-MHC, while it inhibited a-MHC protein levels in a

concentration-dependent manner. These SUN-mediated

effects were associated with increase in cell size and

hypertrophy by approximately 70 % at the highest con-

centration, 5 lM. Importantly, inhibition of the MAPK

signaling pathway using SB203580 (p38 MAPK inhibitor),

U0126 (extracellular signal-regulated kinase inhibitor), and

SP600125 (c-Jun NH2-terminal kinase inhibitor) signifi-

cantly potentiated the SUN-induced BNP and b-MHC

mRNA levels, but did alter the a-MHC level. Whereas at

the protein level, MAPK inhibitors generally decreased the

SUN-induced BNP, whereas only SB and U0 increased

b-MHC protein levels with no effect on a-MHC, which were

associated with a significant decrease in cell size. Together,

these results indicate that SUN induced hypertrophic gene

expression through MAPK-dependent mechanisms.

Keywords Sunitinib � H9c2 cells � Cardiac hypertrophy �Brain natriuretic peptides � Myosin heavy chain � MAPKs

Introduction

Sunitinib (SUN) is a multi-targeted tyrosine kinase inhib-

itor (TKI) that has been recently approved for the treatment

of gastrointestinal stromal tumors (GIST) and renal cell

carcinoma (RCC) [1–4]. Its activity against other tumor

types such as hepatocellular carcinoma or non-small cell

lung cancer is currently investigated in numerous clinical

trials [5, 6]. Although SUN has improved survival rates in

patients with RCC and GIST, several adverse effects have

been reported, such as gastrointestinal disturbances, skin

abnormalities, arthralgia, mucositis, aesthesia and altered

sense of taste [7]. Most importantly, SUN causes signifi-

cant cardiotoxicity, such as hypertension, reduction in left

ventricular ejection fraction (LVEF), and QT interval

prolongation. For example, approximately 15 % of GIST

and 28 % of RCC patients who received SUN had devel-

oped hypertension [5]. Moreover, 46 % of patients with

imatinib-resistant metastatic GIST who received SUN

developed hypertension, whereas 8 % have developed

heart failure [8].

Several mechanisms have been proposed for the SUN-

induced cardiotoxicity. In this regards, it has been

H. M. Korashy (&) � H. A. Al-Suwayeh � Z. H. Maayah �M. A. Ansari � S. F. Ahmad � S. A. Bakheet

Department of Pharmacology and Toxicology, College of

Pharmacology, King Saud University, P.O. Box 2457,

Riyadh 11451, Kingdom of Saudi Arabia

e-mail: hkorashy@ksu.edu.sa

123

Cardiovasc Toxicol

DOI 10.1007/s12012-014-9266-y

Author's personal copy

suggested that SUN induces cardiotoxicity by inhibiting

ribosomal S6 kinase (RSK) resulting in mitochondrial

damage and eventually cardiac hypertrophy. Furthermore,

inhibiting AMP-activated protein kinase (AMPK) is

another proposed cardiotoxic mechanism of SUN [9–11].

However, Hasinoff and co-workers have reported that the

inhibitions of RSK and AMPK are not the main mecha-

nism of cardiotoxicity of SUN and suggested the

involvement of other kinases [12]. Among these kinases

enzymes, mitogen-activated protein kinases (MAPKs)

contribute to many signal transduction pathways, which

are involved in controlling intracellular activities [13].

The MAPKs signaling pathway consists of a number of

kinases including p38 MAPK, extracellular signal-regu-

lated kinase (ERK) and c-Jun NH2-terminal kinase (JNK)

[14]. Several studies have reported the involvement of

MAPKs in myocardial hypertrophy and disorganization of

myocytes. For example, it has been shown that inhibition

of p38 MAPK slows the rate of myocardial infarction,

whereas increases the left ventricular contractility [15].

On the other hand, activation of ERK MAPK reduces the

number of cardiomyocytes undergoing apoptosis in the

intact heart [16].

Myocardial hypertrophy and disorganization of myo-

cytes are usually attributed to an imbalance in the

expression of several hypertrophic genes, such as myosin

heavy chain (MHC) and brain natriuretic peptides (BNP)

[17]. During cardiac hypertrophy, a-MHC expression is

down-regulated, whereas that of BNP and b-MHC are

upregulated [18]. This was supported by the observations

that treatment of patients having dilated cardiomyopathy

with b-adrenergic receptor blocker was accompanied with

an increase in a-MHC and a decrease in the level of

b-MHC [19]. Several signaling pathways have been shown

to modulate the expression of hypertrophic genes including

MAPKs. Importantly, a cross talk between MAPK signal-

ing pathway and hypertrophic genes has been reported. In

that, inhibition of the p38 MAPK in cardiac hypertrophied

rat resulted in a significant decrease in the expression of b-

MHC and several natriuretic peptides, but not in healthy

rats [20]. In addition, it has been reported that activation of

ERK MAPK induced the expression of hypertrophic genes

through stimulation of cardiac transcriptional factor

GATA4 [21–24].

In the light of information described above, the possi-

bility that SUN induces cardiac hypertrophy through

MAPK-dependent pathway could not be ruled out. There-

fore, the current study was designed to (a) examine the

potential cellular hypertrophic effect of SUN in rat

cardiomyocytes H9c2 cells and (b) explore the role of

MAPK signaling pathway using specific pharmacological

inhibitors.

Materials and Methods

Materials

Dulbecco’s Modified Eagle’s Medium (DMEM) and

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bro-

mide (MTT) were purchased from Sigma-Aldrich Chemi-

cal Co. (St. Louis, MO, USA). SUN malate, SP600125,

U0126, and SP203580 were obtained from LC Laborato-

ries (Woburn, MA, USA). Primary antibodies specific to a-

MHC, b-MHC, BNP, and peroxidase-conjugated second-

ary antibody were supplied from Santa Cruz Biotechnol-

ogy, Inc. (Santa Cruz, CA, USA). DNA primers were

obtained from Integrated DNA Technologies, IDT (Coral-

ville, IA, USA). TRIzol reagent was supplied by Invitrogen

Co. (San Diego, CA, USA). High Capacity cDNA Reverse

Transcription kit and SYBR� Green PCR Master Mix were

purchased from Applied Biosystems� (Foster city, CA,

USA). The Western blot detection enhanced chemilumi-

nescence (ECL) kits were obtained from GE Healthcare

Life Sciences (Piscataway, NJ, USA). Nitrocellulose

membrane (0.45 lm) was purchased from Bio-Rad Labo-

ratories (Hercules, CA, USA). All other chemicals were

purchased from Fisher Scientific Co. (Toronto,

ON, CANADA).

Cells Culture and Treatment

Rat cardiomyocyte H9c2 cells (American Type Cell Cutler,

Manassas, VA, USA) were maintained in DMEM with

phenol red supplemented with 10 % fetal bovine serum,

20 lM L-glutamine, 100 IU/ml penicillin G, and 10 lg/ml

streptomycin. Cells were grown in 75 cm2 tissue culture

flasks at 37 �C under a 5 % CO2 humidified environment.

The cells were seeded in 12- and 6-well cell culture

plates in DMEM culture media for RNA and protein assays,

respectively. In all experiments, the cells were treated for

the indicated time intervals in serum-free media with vari-

ous concentrations of SUN in the presence and absence of

three chemical inhibitors for MAPKs. Stock solutions of

SUN were prepared fresh in dimethyl sulfoxide (DMSO)

just prior to each experiment, where the DMSO concen-

tration in all the treatment did not exceed 0.05 % (v/v).

H9c2 Cell Viability

H9c2 cell viability in response to SUN was determined by

measuring the capacity of reducing enzymes present only

in viable cells to convert 3-[4,5-dimethylthiazol-2-yl]-2,5-

diphenyltetrazolium bromide (MTT) to formazan crystals

[25]. For this purpose, H9c2 cells were incubated for 24 h

with wide range of concentrations of the tested compounds.

Cardiovasc Toxicol

123

Author's personal copy

Thereafter, the medium was replaced with 100 lL of

serum-free medium that contains 1.2 lM of MTT dis-

solved in phosphate buffer saline (PBS), pH 7.4. The plate

was then incubated in the CO2 incubator at 37 �C for 2 h,

prior to the addition of 100 lL of isopropyl alcohol to each

well, with continuous shaking for 1 h until the formazan

crystals were dissolved. The color intensity in each well

was measured at 550 nm using BIO-TEK instruments EL

312e microplate reader. The percentage of cell viability

was calculated relative to control wells designated as

100 % viable cells using the following formula: cell via-

bility = (Atreated)/(Acontrol) 9 100 %. The median inhibi-

tory concentration (IC50) was calculated by the linear

regression from the plot using SigmaStat� for Windows,

Systat Software Inc. (San Jose, CA).

RNA Extraction and cDNA Synthesis

After treatment with the test compound for the specified

time periods, total cellular RNA was isolated using

TRIzol reagent (Invitrogen�) according to the manufac-

turer’s instructions and quantified by measuring the

absorbance at 260 nm. RNA quality was determined by

measuring the 260/280 ratio (*2.0). Thereafter, first

strand cDNA synthesis was performed using the high-

capacity cDNA reverse transcription kit (Applied Bio-

systems�), according to the manufacturer’s instructions as

described previously [26]. Briefly, 1.5 lg of total RNA

from each sample was added to a mixture of 2.0 ll of

109 reverse transcriptase buffer, 0.8 ll of 259 dNTP mix

(100 mM), 2.0 ll of 109 reverse transcriptase random

primers, 1.0 ll of MultiScribe reverse transcriptase, and

3.2 ll of nuclease-free water. The final reaction mixture

was kept at 25 �C for 10 min, heated to 37 �C for

120 min, heated for 85 �C for 5 min, and finally cooled to

4 �C.

Quantification of mRNA Expression by Real

Time-Polymerase Chain Reaction (RT-PCR)

Quantitative analysis of specific mRNA expression was

performed by RT-PCR by subjecting the resulting cDNA

products to PCR amplification using 96-well optical reac-

tion plates in the ABI Prism 7500 System (Applied Bio-

systems�). The 25-ll reaction mixture contained 0.1 ll of

10 lM forward primer and 0.1 ll of 10 lM reverse primer

(40 nM final concentration of each primer), 12.5 ll of

SYBR Green Universal Mastermix, 11.05 ll of nuclease-

free water, and 1.25 ll of cDNA sample. Rat primers

(Table 1) were synthesized and purchased from IDT. The

fold change in the level of target mRNAs between treated

and untreated cells was corrected by the level of b-actin.

Assay controls were incorporated onto the same plate,

namely, no-template controls to test for the contamination

of any assay reagents. The RT-PCR data were analyzed

using the relative gene expression (i.e., DD CT) method as

described previously [27]. The data are presented as the

fold change in gene expression normalized to the endoge-

nous reference gene and relative to a calibrator. The fold

change in the level of target genes between treated and

untreated cells, corrected by the level of b-actin, was

determined using the following equation: fold

change = 2-D(DCt), where DCt = Ct(target) - Ct(b-actin) and

D(DCt) = DCt(treated) - DCt(untreated).

Protein Extraction and Quantification

Total protein from H9c2 cell lysate was extracted as

described previously [28]. Cells grown in 6-well culture

plates were washed with PBS, after which 0.1 ml of lysis

buffer (50 mM HEPES, 0.5 M sodium chloride, 1.5 mM

magnesium chloride, 1 mM EDTA, 10 % (v/v) glycerol,

1 % Triton X-100, and 5 lL/ml of protease inhibitor

cocktail) was added to each well. The cells were then

harvested, transferred to other tubes, and vortexed every

10 min for 1 h before centrifuged at 10,0009g for 20 min.

The supernatants were collected, and the protein concen-

trations were determined using bovine serum albumin

(BSA) as a standard by the Lowry method [29].

Western Blot Analysis

Western blot analysis was performed using a previously

described method [28, 30]. Briefly, 30–40 lg of protein

from each treatment groups was separated in 10 % sodium

dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis

(PAGE) and then electrophoretically transferred to nitro-

cellulose membrane. Protein blots were then blocked

overnight at 4 �C in blocking solution containing 0.15 M

sodium chloride, 3 mM potassium chloride, 25 mM Tris–

base (TBS), 5 % skim milk powder, 2 % BSA, and 0.5 %

Tween-20. After blocking, the blots were washed several

times with TBS before being incubated with a primary

antibody against either BNP, b-MHC, or a-MHC for 24 h

at 4 �C in TBS solution containing 0.05 % (v/v) Tween-20

and 0.02 % sodium azide. Incubation with a peroxidase-

conjugated rabbit anti-goat IgG secondary antibody was

carried out in blocking solution for 3 h at room tempera-

ture. The bands were visualized using the enhanced

chemiluminescence method according to the manufac-

turer’s instructions (GE Healthcare, Mississauga, ON,

USA). The intensity of BNP, b-MHC, and a-MHC protein

bands was quantified relative to the signals obtained for

glyceraldehyde-3-phosphate dehydrogenase (GAPDH)

protein using ImageJ�, image processing program

(National Institutes of Health, Bethesda, MD).

Cardiovasc Toxicol

123

Author's personal copy

Flow Cytometric Measurement of Cell Size

Relative changes in cell size, as indicator for hypertrophy,

in response to treatments was measured using flow

cytometer as described previously [31]. Briefly, H9c2 cells

were treated for 24 h with test compounds; thereafter, the

medium was removed, and cells were washed with cold

PBS before trypsinizations. The collected cells were cen-

trifuged at 3009g for 5 min and then resuspended with

0.7 ml PBS. Approximately, 104 cells were screened using

Beckman Coulter FC500 Cytomics Benchtop Flow

Cytometer (Beckman Coulter, Inc., CA), and the forward

light scatter (FS) and side light scatter (SS) were recorded

for each cell to determine the relative size and density,

respectively. Control cells were gated so that large sizes

were presumed to represent *10 % of the cell population.

Statistical Analysis

All results were presented as mean ± SEM. The compar-

ative analysis of the results, from various experimental

groups with their corresponding controls, was performed

using SigmaStat� for Windows, Systat Software Inc. (San

Jose, CA). One-way analysis of variance (ANOVA) fol-

lowed by Student–Newman–Keul’s test was carried out to

assess which treatment groups showed significant differ-

ences from the control ones. The differences were con-

sidered significant when p \ 0.05.

Results

H9c2 Cell Viability and Cytotoxicity of SUN

To determine the optimal non-toxic concentration of SUN to

be utilized in the current study, the effects of increasing

concentrations of SUN (1–40 lM) on H9c2 cell viability

were determined by MTT assay [25]. Figure 1 shows that

SUN at all tested concentrations up to 10 lM was not toxic to

the cells with a cell viability of approximately 80 %, whereas

SUN concentrations 20 and 40 lM significantly inhibited

the cell viability by approximately 30 and 53 %, respec-

tively. The IC50 for SUN was calculated to be 33.15 lM

(Fig. 1a). Based on these findings and the therapeutic range

of SUN plasma concentration reported in animal studies [2],

SUN concentrations 1, 2.5, and 5 lM were selected to be

utilized as in vitro concentrations in all subsequent experi-

ments. To further determine whether MAPK inhibitors alter

SUN cytotoxicity, we measured H9c2 cell viability in

response to mixture of SUN (0, 1, 2.5, and 5 lM) and a single

concentration (10 lM) of specific MAPK inhibitors; p38

MAPK (SB203580, SB), ERK (U0126, U0), or JNK

(SP600125, SP) [32]. Our results showed none of the MAPK

inhibitors at the concentrations used altered the cell viability

in response to SUN (Fig. 1b).

Concentration- and Time-Dependent Effects of SUN

on BNP, b-MHC, and a-MHC mRNA Levels

To investigate the capacity of SUN to induce cardiac

hypertrophy in rat cardiomyocyte cells, the mRNA

expression of three hypertrophic gene markers, BNP, b-

MHC, and a-MHC, was determined in H9c2 cells treated

for 12 h with increasing concentrations of SUN (0, 1, 2.5,

and 5 lM) using RT-PCR. Figure 2a shows that SUN

increased the mRNA expression of BNP, b-MHC, and a-

MHC, in a concentration-dependent manner. The maxi-

mum induction was observed at the highest concentration

Fig. 1 Effect of SUN on H9c2 cell viability. a H9c2 cells were

treated for 24 h with various concentrations of SUN (1–40 lM).

b H9c2 cells were treated for 24 h with SUN (0, 1, 2.5, and 5 lM) in

the presence and absence of 10 lM of SB, U0, or SP. Cell viability

was determined using MTT assay. Values are presented as % of the

control (mean ± SEM, n = 6). ?p \ 0.05 compared to control

(0 lM)

Table 1 Rat primers sequences used for RT-PCR reactions

Gene Forward primer Reverse primer

BNP CAGAAGCTGCTGGAGCTGATAAG TGTAGGGCCTTGGTCCTTTG

b-MHC ATCAAGGGAAAGCAGGAAGC CCTTGTCTACAGGTGCATCA

a-MHC TCCTTTATCGGTATGGAGTCTG TGATCTTGATCTTCATGGTGCT

b-ACTIN CCAGATCATGTTTGAGACCTTCAA GTGGTACGACCAGAGGCATACA

Cardiovasc Toxicol

123

Author's personal copy

tested, 5 lM, by approximately eight-, four-, and twofold

for BNP, b-MHC, and a-MHC, respectively.

To better understand the kinetics of the mRNA of

hypertrophic markers in response to SUN, H9c2 cells were

treated for different time intervals: 0, 6, 12, and 18 h with a

single concentration of SUN (5 lM), the concentration that

showed maximum effect. Thereafter, the mRNA expres-

sions of hypertrophic genes were determined by RT-PCR.

The onset of induction of hypertrophic mRNA was

observed as early as 9 h after the treatment with SUN

5 lM and remained elevated for at least 18 h for BNP (11-

fold) and a-MHC (threefold), whereas b-MHC mRNA

(4.5-fold) reached the plateau after 12 h of treatment

(Fig. 2b).

Concentration-Dependent Effects of SUN on BNP,

b-MHC, and a-MHC Protein Levels

To further examine whether the induction of BNP, b-

MHC, and a-MHC hypertrophic gene markers at the

mRNA level in response to SUN (Fig. 2) is translated into

a functional protein, H9c2 cells were treated for 24 h with

SUN (0, 1, 2.5, and 5 lM); thereafter, BNP, b-MHC, and

a-MHC protein levels were determined by Western blot

analysis. Our results showed that incubation of H9c2 cells

with SUN caused a concentration-dependent increase in

the protein expression levels of both BNP and b-MHC by

approximately seven- and twofold, respectively, at the

highest concentration (Fig. 3), whereas a-MHC protein

level was down-regulated by SUN in a concentration-

dependent manner to reach approximately 20 % of its

control value.

Hypertrophy and Increase in H9c2 Cell Size by SUN

To determine whether the SUN-induced hypertrophic gene

markers at the mRNA and protein levels (Figs. 2, 3) were

associated with cellular hypertrophy and increase the cell

size, H9c2 cells were treated for 24 h with SUN (0, 1, 2.5,

and 5 lM); thereafter, cell size was determined by flow

cytometric analysis. Figure 4 shows that treatment of H9c2

cells for 24 h with SUN significantly increased the per-

centage of cell population belonging to region of hyper-

trophy at concentrations 2.5 and 5 lM to 16 % (60 %

increase) and 17 % (70 % increase), respectively, as

compared to control.

Effect of MAPK Inhibitors on the mRNA Expression

Levels of SUN-Induced Hypertrophic Markers

To assess the role of MAPK signaling pathway on the

SUN-induced cardiac hypertrophy markers, H9c2 cells

were pretreated for 2 h with 10 lM of either p38 inhibitor

(SB), ERK inhibitor (U0), or JNK inhibitor (SP) [32].

Thereafter, SUN (5 lM) was added to the cells for addi-

tional 12 h, and the mRNA expression levels of BNP, b-

MHC, and a-MHC were quantified using RT-PCR.

Figure 5a shows that incubation of the cells with 10 lM

of SB, p38 MAPK inhibitor alone slightly but significantly

inhibited the mRNA expression of b-MHC and a-MHC,

but not BNP. However, pretreatment of H9c2 cells with SB

significantly potentiated the SUN-induced BNP and b-

MHC mRNA levels by approximately 200 and 50 %,

respectively, whereas no significant changes were observed

on a-MHC mRNA levels. Similarly, treatment of the cells

with 10 lM ERK inhibitor (U0) alone slightly inhibited b-

MHC and a-MHC, but not BNP, mRNA levels, whereas

further potentiated the SUN-mediated induction of all the

hypertrophic markers (BNP, b-MHC, a-MHC) by

approximately 250, 100, and 75 %, respectively (Fig. 5b).

On the other hand, 10 lM JNK inhibitor (SP) alone did not

significantly alter the basal mRNA levels of any of the

Fig. 2 a Concentration- and b time-dependent effects of SUN on the

mRNA expression levels of hypertrophic genes. H9c2 cells were

treated a with increasing concentrations of SUN (0, 1, 2.5, and 5 lM)

for 12 h and b with SUN 5 lM for different time points (0, 6, 12, and

18 h). BNP, b-MHC, and a-MHC mRNA levels were quantified using

RT-PCR and normalized to b-ACTIN housekeeping gene as

described in the ‘‘Materials and Methods’’ section. Duplicate

reactions were performed for each experiment, and the values are

presented as mean ± SEM (n = 6) and ?p \ 0.05, compared to the

control (concentration = 0 lM) or (time = 0 h)

Cardiovasc Toxicol

123

Author's personal copy

tested hypertrophic markers, while it caused a super-

induction of SUN-induced BNP and b-MHC, but has no

effect on a-MHC mRNA levels (Fig. 5c).

Effect of MAPK Inhibitors on the Protein Expression

Levels of SUN-Induced Hypertrophic Markers

To determine the effect of MAPKs on SUN-induced

hypertrophic markers at the protein levels, H9c2 cells

were pretreated for 2 h with 10 lM of either SB, U0, or

SP; thereafter, SUN (5 lM) was added to the cells for

additional 24, and then, the protein levels of BNP, b-

MHC, and a-MHC were determined by Western blot

analysis.

Figure 6 shows that the induction of BNP protein level

by SUN was significantly inhibited by all the MAPK in-

hibiters, in contrast to mRNA results (Fig. 5). The maxi-

mum inhibitory effect was observed by SP followed by U0,

and then SB. On the other hand, the increase in b-MHC

protein levels by SUN was further potentiated by the p38

and ERK inhibitors, SB and U0, respectively, but not with

JNK inhibitor, SP (Fig. 6). In contrast, all MAPK inhibitors

did not significantly alter SUN-mediated inhibition of a-

MHC protein level.

Effect of MAPK Inhibitors on the Cell Size Level

in SUN-Induced Hypertrophy

To analyze the effect of MAPK inhibitors on SUN-

induced cell hypertrophy, cell size was analyzed by a

flow cytometer. Our results showed that pretreatment of

H9c2 cells with MAPK inhibitors, SB, SP, and U0,

significantly decreased the SUN-induced hypertrophy and

the percentage of increased cell size (17 %) to approxi-

mately 13 % (57 % inhibition), 13 % (57 % inhibition),

and 10 (100 % inhibition), respectively (Fig. 7).

Fig. 3 Concentration-dependent effect of SUN on the protein

expression levels of hypertrophic genes. H9c2 cells were treated for

24 h with increasing concentrations of SUN (0, 1, 2.5, and 5 lM).

BNP, b-MHC, and a-MHC protein levels were determined by

Western blot analysis as described in the ‘‘Materials and Methods’’

section. The proteins were detected using the enhanced

chemiluminescence method and quantified relative to the signals

obtained for GAPDH protein, using ImageJ�. One of the three

representative experiments is shown. The values presented are the

mean of three independent experiments ± SEM (n = 6) and?p \ 0.05, compared to the control (concentration = 0 lM)

Fig. 4 Effect of SUN on H9c2 cell size and hypertrophy. H9c2 cells

were treated with increasing concentrations of SUN (0, 1, 2.5, and

5 lM) for 24 h; thereafter, cell size was analyzed by a flow

cytometer. FS and SS were recorded for each cell to determine the

relative size and density, respectively. One of the three representative

experiments using different cell preparations was only shown

Cardiovasc Toxicol

123

Author's personal copy

Discussion

To our knowledge, the current study demonstrated for the

first time the ability of SUN to induce cellular hypertrophy

and cardiotoxicity through modulating the expression of

cardiac hypertrophic genes via MAPKs-dependent mech-

anism at the transcriptional and translational levels in H9c2

rat cardiac cells.

There has been a controversy on the precise mechanism

of SUN-induced cardiotoxicity. In this context, we have

recently shown that development of cardiac hypertrophy by

SUN in vivo and in vitro rat cardiomyocytes is influenced

by the aryl hydrocarbon receptor signaling pathway [33]. In

addition, previous mechanistic studies have reported that

SUN elicits harmful cardiac effects through inhibiting

AMPK and RSK and damaging the mitochondrial [34] and

increased autophagic flux [35]. However, most of these

previous studies were conducted in vivo, and few of them

have utilized in vitro rat cardiomyocyte cell line H9c2 to

study the cardiotoxicity of SUN. In addition, the involve-

ment of MAPKs pathway has never been investigated.

Therefore, the current study was conducted to determine

the potential effect of SUN on the expressions of cardiac

hypertrophic genes and explore the role of MAPKs in

SUN-induced cardiotoxicity in H9c2 cells.

H9c2 cells are commercially available myogenic cell

lines derived from embryonic rat cardiac ventricle [36].

H9c2 cells show almost identical hypertrophic responses to

those observed in primary cardiomyocytes [37] and exhibit

many of the characteristics of skeletal muscles. Thus, H9c2

cells are usually utilized as in vitro model for studying the

cardiotoxicity of several agents such as doxorubicin and

hydrogen peroxide [38, 39]. The in vitro concentrations of

SUN (1, 2.5, and 5 lM) in the presence and absence of

MAPK inhibitors used in the current study were not toxic

to the cells and were maintained within the therapeutic

range of plasma concentration reported in animal studies

[2] which are in agreement with previous published papers

that utilized SUN (1 and 4 lM) in primary neonatal rat

cardiomyocytes [40].

Cardiac hypertrophy and heart failure are usually asso-

ciated with increased b-MHC and BNP and/or reduced a-

MHC expression levels [16]. Thus, their expressions have

been considered as a good predictor of ventricular dys-

function and decompensated heart failure. The ability of

SUN to induce cardiotoxicity, in the current study, is evi-

denced first by the induction of the hypertrophic markers,

BNP and b-MHC in time- and concentration-dependent

manners at both the mRNA and protein levels, suggesting a

transcriptional mechanism. Our results are supported by the

previous observations that ischemic and dilated cardio-

myopathies are associated with the increased expression of

b-MHC [41]. In addition, treatment with doxorubicin, a

well-known cardiotoxic chemotherapeutic agent, is usually

accompanied by upregulation of b-MHC gene [42]. Fur-

thermore, increased BNP expression level is associated

with the increased risk of heart failure and ventricular

hypertrophy [43] and hence is considered as a diagnostic

biomarker for left ventricular hypertrophy [44]. The second

evidence is the ability of SUN to inhibit a-MHC protein,

whereas induced mRNA, levels in concentration- and time-

dependent manners. The unexpected increase in a-MHC

mRNA could be attributed to a compensatory mechanism

Fig. 5 Effects of MAPK inhibitors on the mRNA levels of SUN-

induced hypertrophic genes. H9c2 cells were treated for 12 h with

SUN (5 lM) in the presence and absence of either SB (a), U0 (b), or

SP (c). Thereafter, the mRNA expression levels of hypertrophic

genes, BNP, b-MHC, and a-MHC, were quantified using RT-PCR

and normalized to b-ACTIN housekeeping gene as described in the

‘‘Materials and Methods’’ section. Duplicate reactions were per-

formed for each experiment, and the values are presented as

mean ± SEM (n = 6) and ?p \ 0.05, compared to the control, and

*p\ 0.05, compared to SUN treatment in the absence of MAPK

inhibitors

Cardiovasc Toxicol

123

Author's personal copy

in response to SUN treatment through a posttranscriptional

modification mechanism. The third evidence is the asso-

ciation of induction of hypertrophic genes with the increase

in cell size. The increase in cell size was also reported with

the treatment to a well-known cardiotoxic agent doxoru-

bicin in rat neonatal cardiomyocytes [45].

There is mounting evidence showing that different

members of the MAPK family are critically involved in the

regulation of signaling pathways, ultimately leading to

cardiac hypertrophy and heart failure [16]. In this context,

it has been recently reported that activation of the p38

MAPK pathway contributes to doxorubicin-induced

cardiotoxicity in H9c2 cells [46], whereas inhibition of

ERK renders neonatal rat cardiomyocytes sensitivity to

daunomycin-induced apoptosis [16]. However, the exact

role of MAPK in SUN-induced cardiotoxicity is unclear.

Thus, the second objective of the current study was to

explore the role of MAPK in SUN-induced cardiac

hypertrophy. Due to the significant physiological and

pathological roles of MAPKs, various pharmacological

MAPK inhibitors have been developed to counteract their

actions. Thus, the direct involvement of MAPKs was

assessed by investigating whether inhibition of the MAP-

Ks, p38, ERK, and JNK, using specific pharmacological

Fig. 6 Effects of MAPK inhibitors on the protein expression levels of

SUN-induced hypertrophic genes. H9c2 cells were treated for 24 h

with SUN (5 lM) in the presence and absence of SB, U0, or SP. The

protein expression levels of BNP, b-MHC, and a-MHC was

determined by Western blot analysis using the enhanced chemilumi-

nescence method and quantified relative to the signals obtained for

GAPDH protein, using ImageJ�. One of the three representative

experiments is shown. The values presented are the mean of three

independent experiments as mean ± SEM, ?p \ 0.05, compared to

the control, and *p \ 0.05, compared to SUN treatment in the

absence of MAPK inhibitors

Fig. 7 Effects of MAPK inhibitors on H9c2 cell size and hypertrophy

induced by SUN. H9c2 cells were treated for 24 h with SUN (5 lM)

in the presence and absence of 10 lM of SB, U0, or SP; thereafter,

cell size was analyzed by a flow cytometer. FS and SS were recorded

for each cell to determine the relative size and density, respectively.

One of the three representative experiments using different cell

preparations was only shown

Cardiovasc Toxicol

123

Author's personal copy

inhibitors, SB, U0, and SP, respectively, would modulate

the SUN-induced changes in the hypertrophic genes. These

pharmacological inhibitors of MAPK, SB [47–50], U0 [49,

51, 52], and SP [49, 50, 53] are widely and extensively

used in our laboratory and by other researchers as selective

and specific inhibitors for p38, ERK, and c-JNK MAPK

pathways, respectively, in different cell lines and animal

tissues.

In the current study, the modulations of cardiac hyper-

trophy by SUN were differentially controlled by MAPKs.

Although MAPK inhibitors alone particularly SP and U0,

but not SP, slightly inhibited the mRNA expression of BNP

and b-MHC, our results clearly suggest that activation of the

MAPK signaling pathway is required for the modulations of

cardiac hypertrophy by SUN in a MAPK- and hypertrophic

gene-dependent manner, as summarized in Table 2. For

example, our results showed that inhibition of all MAPKs

pathways significantly potentiated the SUN-induced BNP

mRNA, but inhibited its protein levels. On the other hand,

the SUN-induced b-MHC mRNA and protein levels were

further enhanced by blocking all MAPK pathway. However,

the mRNA and protein expression levels of a-MHC were not

affected by MAPK inhibition. Importantly, the SUN-

induced hypertrophy and increased cell size were signifi-

cantly attenuated by pretreatment of H9c2 cells with NAPK

inhibitors, SB, U0, and SP, in which SP showed the maxi-

mum protection. In agreement with our observations, it has

been demonstrated that the inhibition of p38 MAPK was

found to slow the rate of infarction/death and reduce the

production of inflammatory mediators, such as interleukins

1 and 8 and tissue necrosis factor-a [34].

In conclusion, to our knowledge, the current study is

considered the first in demonstrating the effect of SUN on the

expression of hypertrophic genes and the direct involvement

of MAPKs in SUN cardiotoxicity. Further investigations are

encouraged to explore the role of MAPK on in vivo model.

Acknowledgments This work is supported by the King Abdulaziz

City for Science and Technology (KACST) Grant # A-S-10-0192 and

the College of Pharmacy Research Center, King Saud University,

Saudi Arabia.

Conflict of interest There are no financial or other interests with

regard to this manuscript that might be construed as a conflict of

interest. All of the authors are aware of and agree to the content of the

manuscript and their being listed as an author on the manuscript.

References

1. Atkins, M., Jones, C. A., & Kirkpatrick, P. (2006). Sunitinib

maleate. Nature Reviews Drug Discovery, 5, 279–280.

2. Faivre, S., Demetri, G., Sargent, W., & Raymond, E. (2007).

Molecular basis for sunitinib efficacy and future clinical devel-

opment. Nature Reviews Drug Discovery, 6, 734–745.

3. Kassem, M. G., Motiur Rahman, A. F., & Korashy, H. M. (2012).

Sunitinib malate. Profiles of Drug Substances, Excipients, and

Related Methodology, 37, 363–388.

4. Rini, B. I. (2007). Sunitinib. Expert Opinion on Pharmacother-

apy, 8, 2359–2369.

5. Cheng, A. L., Kang, Y. K., Lin, D. Y., Park, J. W., Kudo, M.,

Qin, S., et al. (2013). Sunitinib versus sorafenib in advanced

hepatocellular cancer: results of a randomized phase III trial.

Journal of Clinical Oncology, 31, 4067–4075.

6. Waqar, S. N., Gopalan, P. K., Williams, K., Devarakonda, S., &

Govindan, R. (2013). A phase I trial of sunitinib and rapamycin in

patients with advanced non-small cell lung cancer. Chemother-

apy, 59, 8–13.

7. Goodman, V. L., Rock, E. P., Dagher, R., Ramchandani, R. P.,

Abraham, S., Gobburu, J. V., et al. (2007). Approval summary:

Sunitinib for the treatment of imatinib refractory or intolerant

gastrointestinal stromal tumors and advanced renal cell carci-

noma. Clinical Cancer Research, 13, 1367–1373.

8. Chu, T. F., Rupnick, M. A., Kerkela, R., Dallabrida, S. M.,

Zurakowski, D., Nguyen, L., et al. (2007). Cardiotoxicity asso-

ciated with tyrosine kinase inhibitor sunitinib. Lancet, 370,

2011–2019.

9. Imig, J. D., Zhao, X., Capdevila, J. H., Morisseau, C., & Ham-

mock, B. D. (2002). Soluble epoxide hydrolase inhibition lowers

arterial blood pressure in angiotensin II hypertension. Hyperten-

sion, 39, 690–694.

10. Force, T., Krause, D. S., & Van Etten, R. A. (2007). Molecular

mechanisms of cardiotoxicity of tyrosine kinase inhibition. Nat-

ure Reviews Cancer, 7, 332–344.

11. Gustafsson, A. B., & Gottlieb, R. A. (2007). Bcl-2 family

members and apoptosis, taken to heart. American Journal of

Physiology Cell Physiology, 292, C45–C51.

12. Hasinoff, B. B., Patel, D., & O’Hara, K. A. (2008). Mechanisms of

myocyte cytotoxicity induced by the multiple receptor tyrosine

kinase inhibitor sunitinib. Molecular Pharmacology, 74, 1722–1728.

13. Pearson, G., Robinson, F., Beers Gibson, T., Xu, B. E., Karan-

dikar, M., Berman, K., et al. (2001). Mitogen-activated protein

(MAP) kinase pathways: regulation and physiological functions.

Endocrine Reviews, 22, 153–183.

14. Liang, Q., & Molkentin, J. D. (2003). Redefining the roles of p38

and JNK signaling in cardiac hypertrophy: dichotomy between

cultured myocytes and animal models. Journal of Molecular and

Cellular Cardiology, 35, 1385–1394.

15. Yin, H., Zhang, J., Lin, H., Wang, R., Qiao, Y., Wang, B., et al.

(2008). p38 mitogen-activated protein kinase inhibition decreases

TNFalpha secretion and protects against left ventricular remod-

eling in rats with myocardial ischemia. Inflammation, 31, 65–73.

16. Zhang, W., Elimban, V., Nijjar, M. S., Gupta, S. K., & Dhalla, N.

S. (2003). Role of mitogen-activated protein kinase in cardiac

hypertrophy and heart failure. Experimental and Clinical Cardi-

ology, 8, 173–183.

Table 2 Summary of the effects of MAPK inhibitors on SUN-

induced cardiac hypertrophic genes as compared to SUN alone

mRNA level Protein level

BNP b-MHC a-MHC BNP b-MHC a-MHC

SUN alone : : : : : ;

SUN ? SB :: :: $ ; :: $SUN ? U0 :: :: :: ; :: $SUN ? SP :: :: $ ; ; $

: induction, ; inhibition, $ no change, :: super-induction

Cardiovasc Toxicol

123

Author's personal copy

17. Barry, S. P., Davidson, S. M., & Townsend, P. A. (2008).

Molecular regulation of cardiac hypertrophy. International

Journal of Biochemistry and Cell Biology, 40, 2023–2039.

18. Lin, H., Xu, L., Liu, H., Sun, Q., Chen, Z., & Yuan, G. (2011).

KLF4 promotes the odontoblastic differentiation of human dental

pulp cells. Journal of Endodontics, 37, 948–954.

19. Chang, S. W., Lee, S. Y., Kum, K. Y., & Kim, E. C. (2014).

Effects of ProRoot MTA, Bioaggregate, and Micromega MTA on

odontoblastic differentiation in human dental pulp cells. Journal

of Endodontics, 40, 113–118.

20. Kerkela, R., Ilves, M., Pikkarainen, S., Tokola, H., Ronkainen, V.

P., Majalahti, T., et al. (2011). Key roles of endothelin-1 and p38

MAPK in the regulation of atrial stretch response. American

Journal of Physiology Regulatory, Integrative and Comparative

Physiology, 300, R140–R149.

21. Kerkela, R., Pikkarainen, S., Majalahti-Palviainen, T., Tokola,

H., & Ruskoaho, H. (2002). Distinct roles of mitogen-activated

protein kinase pathways in GATA-4 transcription factor-medi-

ated regulation of B-type natriuretic peptide gene. Journal of

Biological Chemistry, 277, 13752–13760.

22. Han, J., & Molkentin, J. D. (2000). Regulation of MEF2 by p38

MAPK and its implication in cardiomyocyte biology. Trends in

Cardiovascular Medicine, 10, 19–22.

23. Yang, C. C., Ornatsky, O. I., McDermott, J. C., Cruz, T. F., &

Prody, C. A. (1998). Interaction of myocyte enhancer factor 2

(MEF2) with a mitogen-activated protein kinase, ERK5/BMK1.

Nucleic Acids Research, 26, 4771–4777.

24. Liang, Q., Wiese, R. J., Bueno, O. F., Dai, Y. S., Markham, B. E.,

& Molkentin, J. D. (2001). The transcription factor GATA4 is

activated by extracellular signal-regulated kinase 1- and 2-med-

iated phosphorylation of serine 105 in cardiomyocytes. Molecu-

lar and Cellular Biology, 21, 7460–7469.

25. Korashy, H. M., & El-Kadi, A. O. (2008). Modulation of TCDD-

mediated induction of cytochrome P450 1A1 by mercury, lead,

and copper in human HepG2 cell line. Toxicology In Vitro, 22,

154–158.

26. Korashy, H. M., Maayah, Z. H., Abd-Allah, A. R., El-Kadi, A.

O., & Alhaider, A. A. (2012). Camel milk triggers apoptotic

signaling pathways in human hepatoma HepG2 and breast cancer

MCF7 cell lines through transcriptional mechanism. Journal of

biomedicine and biotechnology, 2012, 593195.

27. Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative

gene expression data using real-time quantitative PCR and the 2(-

Delta Delta C(T)) method. Methods, 25, 402–408.

28. Korashy, H. M., & El-Kadi, A. O. (2004). Differential effects of

mercury, lead and copper on the constitutive and inducible

expression of aryl hydrocarbon receptor (AHR)-regulated genes

in cultured hepatoma Hepa 1c1c7 cells. Toxicology, 201,

153–172.

29. Lowry, O. H., Rosebrough, N. J., Farr, A. L., & Randall, R. J.

(1951). Protein measurement with the Folin phenol reagent.

Journal of Biological Chemistry, 193, 265–275.

30. Sambrook, J., Fritsch, E. F., & Maniatatis, T. (1989). In N. Ford

(Ed.), Molecular cloning: A laboratory manual. Plainview, NY:

Cold Spring Harbour Laboratory Press.

31. Korashy, H. M., & El-Kadi, A. O. (2006). The role of aryl hydro-

carbon receptor and the reactive oxygen species in the modulation

of glutathione transferase by heavy metals in murine hepatoma cell

lines. Chemico-Biological Interactions, 162, 237–248.

32. Korashy, H. M., & El-Kadi, A. O. (2008). The role of redox-

sensitive transcription factors NF-kappaB and AP-1 in the mod-

ulation of the Cyp1a1 gene by mercury, lead, and copper. Free

Radical Biology and Medicine, 44, 795–806.

33. Maayah, Z. H., Ansari, M. A., El Gendy, M. A., Al-Arifi, M. N.,

& Korashy, H. M. (2014). Development of cardiac hypertrophy

by sunitinib in vivo and in vitro rat cardiomyocytes is influenced

by the aryl hydrocarbon receptor signaling pathway. Archives of

Toxicology, 88, 725–738.

34. Clark, J. E., Sarafraz, N., & Marber, M. S. (2007). Potential of

p38-MAPK inhibitors in the treatment of ischaemic heart disease.

Pharmacology and Therapeutics, 116, 192–206.

35. Zhao, Y., Xue, T., Yang, X., Zhu, H., Ding, X., Lou, L., et al.

(2010). Autophagy plays an important role in sunitinib-mediated

cell death in H9c2 cardiac muscle cells. Toxicology and Applied

Pharmacology, 248, 20–27.

36. Kimes, B. W., & Brandt, B. L. (1976). Properties of a clonal

muscle cell line from rat heart. Experimental Cell Research, 98,

367–381.

37. Watkins, S. J., Borthwick, G. M., & Arthur, H. M. (2011). The

H9C2 cell line and primary neonatal cardiomyocyte cells show

similar hypertrophic responses in vitro. In Vitro Cellular and

Developmental Biology Animal, 47, 125–131.

38. Chen, Q. M., Tu, V. C., Wu, Y., & Bahl, J. J. (2000). Hydrogen

peroxide dose dependent induction of cell death or hypertrophy in

cardiomyocytes. Archives of Biochemistry and Biophysics, 373,

242–248.

39. Zordoky, B. N., Aboutabl, M. E., & El-Kadi, A. O. (2008).

Modulation of cytochrome P450 gene expression and arachi-

donic acid metabolism during isoproterenol-induced cardiac

hypertrophy in rats. Drug Metabolism and Disposition, 36,

2277–2286.

40. French, K. J., Coatney, R. W., Renninger, J. P., Hu, C. X., Gales,

T. L., Zhao, S., et al. (2010). Differences in effects on myocar-

dium and mitochondria by angiogenic inhibitors suggest separate

mechanisms of cardiotoxicity. Toxicologic Pathology, 38,

691–702.

41. Reiser, P. J., Portman, M. A., Ning, X. H., & Schomisch Mora-

vec, C. (2001). Human cardiac myosin heavy chain isoforms in

fetal and failing adult atria and ventricles. American Journal of

Physiology Heart and Circulatory Physiology, 280, H1814–

H1820.

42. Hydock, D. S., Wonders, K. Y., Schneider, C. M., & Hayward, R.

(2009). Voluntary wheel running in rats receiving doxorubicin:

effects on running activity and cardiac myosin heavy chain.

Anticancer Research, 29, 4401–4407.

43. Lee, H. S., Son, C. B., Shin, S. H., & Kim, Y. S. (2008). Clinical

correlation between brain natriutetic peptide and anthracyclin-

induced cardiac toxicity. Cancer Research and Treatment, 40,

121–126.

44. Jarolim, P. (2006). Serum biomarkers for heart failure. Cardio-

vascular Pathology, 15, 144–149.

45. Spallarossa, P., Altieri, P., Aloi, C., Garibaldi, S., Barisione, C.,

Ghigliotti, G., et al. (2009). Doxorubicin induces senescence or

apoptosis in rat neonatal cardiomyocytes by regulating the

expression levels of the telomere binding factors 1 and 2.

American Journal of Physiology Heart and Circulatory Physi-

ology, 297, H2169–H2181.

46. Guo, R. M., Xu, W. M., Lin, J. C., Mo, L. Q., Hua, X. X., Chen,

P. X., et al. (2013). Activation of the p38 MAPK/NF-kappaB

pathway contributes to doxorubicin-induced inflammation and

cytotoxicity in H9c2 cardiac cells. Molecular Medicine Reports,

8, 603–608.

47. Huang, X. Z., Li, Z. R., Zhu, L. B., Huang, H. Y., Hou, L. L., &

Lin, J. (2014). Inhibition of p38 mitogen-activated protein kinase

attenuates butyrate-induced intestinal barrier impairment in A

Caco-2 cell monolayer model. Journal of pediatric Gastroen-

terology and Nutrition (in press).

48. Chen, R., Li, X., Lu, S., Ma, T., Huang, X., Mylonakis, E., Liang,

Y., & Xi, L. (2014). Role of extracellular signal-regulated kinases

1 and 2 and p38 mitogen-activated protein kinase pathways in

regulating replication of Penicillium marneffei in human macro-

phages. Microbes and Infection, 16, 401–408.

Cardiovasc Toxicol

123

Author's personal copy

49. Choi, H., Nguyen, H.N., & Lamb, F.S. (2014). Inhibition of

endocytosis exacerbates TNFalpha-induced endothelial dysfunc-

tion via enhanced JNK and p38 activation. American Journal of

Physiology Heart Circulatory Physiology, 306, H1154–H1163.

50. Park, G. B., Choi, Y., Kim, Y. S., Lee, H. K., Kim, D., & Hur, D.

Y. (2014). ROS-mediated JNK/p38-MAPK activation regulates

Bax translocation in Sorafenib-induced apoptosis of EBV-trans-

formed B cells. International Journal of Oncology, 44, 977–985.

51. Su, X., Wang, X., Zhang, K., Yang, S., Xue, Q., Wang, P., & Liu,

Q. (2014). ERK inhibitor U0126 enhanced SDT-induced cyto-

toxicity of human leukemia U937 cells. General Physiology

Biophysics (in press).

52. Randhawa, H., Kibble, K., Zeng, H., Moyer, M. P., & Reindl, K.

M. (2013). Activation of ERK signaling and induction of colon

cancer cell death by piperlongumine. Toxicology In Vitro, 27,

1626–1633.

53. Qin, W., Liu, P., Zhang, R., Huang, S., Gao, X., Song, Z., Wang,

R., Chen, L., Guo, B., & Lin, Z. (2014). JNK MAPK is involved

in BMP-2-induced odontoblastic differentiation of human dental

pulp cells. Connective Tissue Research, 55, 217–224.

Cardiovasc Toxicol

123

Author's personal copy