www.elsevier.com/locate/ybbrc

Biochemical and Biophysical Research Communications 349 (2006) 1406–1411

BBRC

ER stress contributes to ischemia-induced cardiomyocyte apoptosis

Eva Szegezdi a, Angela Duffy c, Martin E. O’Mahoney a, Susan E. Logue a,Louise A. Mylotte c, Timothy O’Brien b,c, Afshin Samali a,c,*

a Department of Biochemistry, National University of Ireland, Galway, Irelandb Department of Medicine, National University of Ireland, Galway, Ireland

c Regenerative Medicine Institute (REMEDI), National Centre for Biomedical Engineering Science, National University of Ireland, Galway, Ireland

Received 1 September 2006Available online 12 Septemeber 2006

Abstract

Myocardial ischemia is a severe stress condition that leads to loss of cardiomyocytes. The cell loss is attributed to apoptosis, althoughthe exact mechanisms involved are only partially defined, which limits therapeutic opportunities. Here, we show caspase activation andapoptosis in neonatal rat cardiomyocyte cultures subjected to simulated ischemia by serum, glucose, and oxygen deprivation (SGO).Caspase activation was preceded by endoplasmic reticulum (ER) stress and the activation of the unfolded protein response (UPR),detected by the induction of Grp78, induction and splicing of XBP1, and phosphorylation of eukaryotic initiation factor 2-a (eIF2a).At a later time the ER stress response switched from UPR and cytoprotective response to a pro-apoptotic response as demonstratedby the upregulation of CHOP and processing of pro-caspase-12. Thus, we provide evidence that the ER can generate and propagateapoptotic signals in response to ischemic stress and this pathway is therefore a novel target for prevention of ischemia-mediatedcardiomyocyte loss.� 2006 Elsevier Inc. All rights reserved.

Keywords: Cardiomyocytes; Ischemia; Unfolded protein response; ER stress; Apoptosis; PERK; Ire1; ATF6; CHOP; Caspase-12

Myocardial ischemia is a severe trauma for cardiomyo-cytes. The simultaneous drop in cellular oxygen and glu-cose supply leads to ATP depletion, which triggersprofound molecular alterations. Initially, the Na+/K+

pump, which is the major Na+ extrusion pathway incardiomyocytes, comes to a halt leading to the accumula-tion of Na+ in the cytosol. High intracellular Na+ concen-tration in turn blocks or reverses the function of the plasmamembrane Na+/Ca2+ exchanger, causing Ca2+ influx.Simultaneously, the intracellular K+ and Mg2+ concentra-tion drops [1,2]. In addition to the ionic changes, inabilityto resynthesize ATP by oxidative phosphorylation alsoleads to acidification due to accumulation of inorganicphosphate and the glycolytic end-product lactate [3].

As a result, ischemia causes extensive biochemicalchanges in the cytosol, but also affects the cytoskeleton

0006-291X/$ - see front matter � 2006 Elsevier Inc. All rights reserved.

doi:10.1016/j.bbrc.2006.09.009

* Corresponding author. Fax: +353 91 494596.E-mail address: afshin.samali@nuigalway.ie (A. Samali).

and other cellular organelles. For example, the intermedi-ate filaments of the cytoskeleton collapse into large perinu-clear aggregates, the actin fibres relocalize around thenucleus, and microtubules break up. Mitochondria swelland lose structure, leading to cessation of the oxidativephosphorylation [4]. To cope with the stress, both cytosolicand mitochondrial heat shock proteins, including Hsp70,60, and 27, are induced [5].

In the brain, ischemia has been shown to also target theendoplasmic reticulum (ER) and ischemic neurons activatethe ER stress response (unfolded protein response, UPR)to protect themselves [6]. Generally, the UPR is triggeredby accumulation of protein aggregates in the ER lumen.The ER lumen has a high redox potential to maintain anoxidizing environment, which, together with the high pro-tein and Ca2+ concentration, provides the ideal milieu forprotein folding. Physiological or pathophysiological condi-tions that alter this milieu hinder protein folding and causeaggregation of nascent polypeptide chains [7]. Three ER

E. Szegezdi et al. / Biochemical and Biophysical Research Communications 349 (2006) 1406–1411 1407

transmembrane receptors, namely PERK, ATF6, and Ire1,monitor the homeostasis of the ER and trigger the UPR.The UPR acts on several levels; it rapidly attenuates gener-al protein synthesis, induces the expression of ER chaper-one proteins, and enhances the degradation of malfoldedproteins [7]. Although the UPR is primarily an adaptiveresponse, if the stress persists, the ER stress receptors canalso trigger pro-apoptotic pathways to initiate cell death [8].

The sarco-endoplasmic reticulum of cardiomyocytesforms an extensive network that interweaves the cell. Inaddition to its general cellular functions, the sarcoplasmicreticulum is also vital for contractibility of cardiomyocytes.Nevertheless, to date little is known as to how ischemiaaffects the homeostasis of the sarcoplasmic reticulum, andonly indirect evidence is available to suggest that ischemiain the heart induces ER stress. It has been shown thatreduction of ER Ca2+ activates ATF6 and induces Grp78in cardiomyocyte cultures [9]. Also, ER preconditioningwith low dose tunicamycin protects H9c2 neonatal cardio-myocyte cells against prolonged ATP depletion or oxida-tive stress [10]. A DNA microarray analysis of the heartfrom MPC-1 (monocyte chemotactic protein-1) over-expressing mice, an experimental model of ischemia, iden-tified induction of ER chaperones [11].

The involvement of apoptosis in cardiomyocyte deathduring ischemia is a relatively new concept and to datemost studies have focused on the role of the death receptorand mitochondrial death pathways [12,13]. Here, we exam-ined whether ischemia induces the UPR and more impor-tantly, whether induction of the UPR during ischemiaactivates the ER stress death pathway. We show for thefirst time that ischemia induces all three arms of theUPR: PERK, ATF6, Ire1, and their downstream targets.In addition to the UPR, induction of CHOP and cleavageof pro-caspase-12 were also detected. These data demon-strate activation of UPR during ischemia in cardiomyo-cytes and that ER stress is involved in the onset ofischemic cell death.

Materials and methods

Cell culture and treatments. Primary cultures of neonatal cardiomyocyteswere isolated from 1 to 4-day-old Sprague–Dawley rats, as described pre-viously [14]. Briefly, rats were euthanized and hearts excised. After scalpelhomogenization, overnight trypsin digestion at 4 �C, and a collagenasetreatment for 20 min at 37 �C, cardiomyocytes were enriched by Percollgradient centrifugation (Amersham) and plated at a density of 1 · 105/ml inDMEM/F12 medium supplemented with 10% newborn calf serum, 100 U/ml penicillin, 100 lg/ml streptomycin, 1 mM sodium pyruvate (Gibco-BRL), 5% insulin transferrin selenite (ITS) liquid supplement media, and100 lM 5-bromo-2-deoxyuridine on culture plates coated with 0.2% gelatin.Cells were cultured at 37 �C and 5% CO2. To mimic endogenous ischemia,cultures were exposed to hypoxic conditions (O2/N2/CO2, 0.5:94.5:5), usinga hypoxia gas chamber (Russkin) in the absence of glucose and serum, usingglucose-free DMEM (Gibco-BRL) supplemented with 10 mM 2-deoxy-glucose, 100 U/ml penicillin, 100 lg/ml streptomycin, 1 mM sodium pyru-vate, and 5% ITS liquid supplement media. Thapsigargin (2 lM) in normalculture medium was used to induce ER stress. All animal experiments wereperformed in accordance with the ethical regulations of NUI, Galway. Allreagents were from Sigma, unless otherwise stated.

Western blot analysis. Cells were lysed in whole cell lysis buffer (20 mMHepes, pH 7.5, 350 mM NaCl, 1 mM MgCl2, 0.5 mM EDTA, 0.5 mMEGTA, 1% Igepal-630, 0.5 mM dithiothreitol (DTT), 100 lM PMSF, and1 lg/ml pepstatin), except for detection of eIF2a phosphorylation, wherecells were directly lysed in Laemmli buffer. Cellular proteins were sepa-rated by electrophoresis on 8–12% SDS–polyacrylamide gels and trans-ferred onto nitrocellulose membranes. After blocking (5% non-fat milk,0.05% Tween 20 in PBS), blots were incubated with antibodies to caspase-12 (Sigma, rat monoclonal), PKCd (Santa Cruz, rabbit polyclonal),caspase-3 (Cell Signalling Technology, rabbit polyclonal), sarcomerica-actinin (Sigma, mouse monoclonal), Grp78 (StressGen, rabbit polyclonal),XBP-1 (Santa Cruz, rabbit polyclonal), phospho-eIF2a, and total eIF2a(both from Cell Signalling Technology, rabbit monoclonal) and CHOP(Santa Cruz, rabbit polyclonal). To verify equal protein loading, blotswere probed for actin (Sigma, rabbit polyclonal). All primary antibodieswere diluted 1:1000 and the appropriate horseradish peroxidise-conju-gated goat secondary antibodies (Pierce) were used at a 1:5000 dilution.Protein bands were detected with SuperSignal Ultra ChemiluminescentSubstrate (Pierce) on X-ray film (Agfa).

Analysis of caspase activity. Cell lysates (25 ll) and 50 lM carboben-zoxy-Asp-Glu-Val-Asp-7-amino-4-methyl-coumarin (DEVD-AMC) inreaction buffer (100 mM Hepes, 10% sucrose, 5 mM DTT, 0.0001% Ige-pal-630, and 0.1% 3-[(3-cholamidopropyl) dimethylammonio] propane-1-sulphonic acid (CHAPS), pH 7.25) were added in duplicate to a microtiterplate. Liberated AMC was measured using 355 nm excitation and 460 nmemission wavelengths. Fluorescence was measured over time and the dataanalysed by linear regression to determine enzyme activity. Enzymeactivity was expressed as nmoles AMC liberated by 1 mg total cellularprotein per minute.

Hoechst staining. Following treatment, cells grown on coverslips werefixed in 3.7% formaldehyde for 10 min at room temperature and perme-abilized with methanol for an additional 10 min. After a PBS wash, cellswere stained with 100 lg/ml Hoechst 33342. The excess stain was removedby a series of PBS washes. The stained nuclei were visualized using anOlympus BX51 fluorescent microscope.

Haematoxylin–eosin staining. Cells were seeded onto 35 mm dishes at adensity of 5 · 104 cells/ml. After treatment the cells were fixed in 3.7%formaldehyde for 5 min at room temperature. The cytosol was stainedwith eosin Y for 4 min, rinsed in tap water, and stained in Harrishaematoxylin solution for 5 min. Pictures were taken using an OlympusBX51 microscope at a final magnification of 100·.

Immunocytochemical staining for a-actinin. Cells were fixed in 3.7%formaldehyde for 5 min at room temperature and permeabilized with 0.2%Triton X-100 for an additional 5 min. After rinsing with PBS, coverslipswere blocked in 1% BSA containing 5% goat serum for 1 h at roomtemperature. Cells were incubated with 1:1000 dilution of sarcomeric anti-a-actinin antibody in 1% BSA for 1 h at room temperature. The excessantibody solution was removed by 3 series of PBS washes. Cells were thenincubated in 1% BSA containing 1:100 dilution of FITC-conjugated anti-mouse IgG (Sigma) and 100 lg/ml Hoechst 33342 stain in darkness for45 min at room temperature. The excess antibody solution was removedand cells were mounted using Vectashield mounting medium. The stainedcells were visualized using an Olympus BX51 fluorescent microscope.

RT-PCR. Total RNA from cells exposed to thapsigargin or ischemictreatment was isolated using the GenElute mammalian total RNAextraction kit (Sigma) according to the manufacturer’s instructions.Reverse transcription was carried out with 2 lg total RNA and oligo(dT)(Invitrogen) using 20 U/25 ll reaction AMV reverse transcriptase (Sigma)according to the manufacturer’s instructions. ATF4-, XBP1-, splicedXBP1 (sXBP1), and GADD34-specific sequences were amplified during 32cycles of 30 s denaturing at 94 �C, 60 s annealing at 56 �C, and 60 sextension at 72 �C, with the following primers: ATF4 forward 5 0-CCGAGATGAGCTTCCTGA-3 0; ATF4 reverse 5 0-CTCCTTGCCGGTGTCTGA; XBP1 forward 5 0-CAGACTACGTGCGCCTCTGC-3 0; XBP1reverse 5 0-CTTCTGGGTAGACCTCTGGG; sXBP1 forward 5 0-TCTGCTGAGTCCGCAGCAGG-3 0; sXBP1 reverse 5 0-CTCTAAGACTAGAGGCTTGG; GADD34 forward: TTTCTAGGCCAGACACATGG; GADD34 reverse: TGTTCCTTTTTCCTCCGTGG. GAPDH was used as

1408 E. Szegezdi et al. / Biochemical and Biophysical Research Communications 349 (2006) 1406–1411

a loading control, its cDNA was amplified during 26 cycles of 30 sdenaturing at 94 �C, 60 s annealing at 56 �C, and 60 s extension at 72 �C,with the following primers: GAPDH forward 5 0-ACCACAGTCCATGCCATC-3 0; GAPDH reverse 5 0-TCCACCACCCTGTTGCTG.

Fig. 1. Ischemia induces apoptotic cell death in primary rat cardiomyo-cytes. To mimic ischemia, cardiomyocytes were exposed to serum, oxygen,and glucose deprivation for the times indicated. (A) Morphologicalchanges were determined in cardiomyocytes subjected to 24 h ischemia byboth Haematoxylin–Eosin staining (upper panel) and Hoechst staining(lower panel). (B) DEVDase activity in ischemic cardiomyocytes wasmeasured in whole cell lysates. The graph shows the average of threeseparate experiments ± SD. (C) Caspase-mediated degradation of sarco-meric a-actinin in ischemic cardiomyocytes detected by immunostaining(upper panel) and by Western blotting of whole cell lysates (lower panel).

Results

Ischemia initiates apoptosis in cardiomyocytes

All experiments were carried out on primary neonatalrat cardiomyocyte preparations. The purity of the prepara-tions was between 85% and 97% cardiomyocytes, based onsarcoplasmic a-actinin immunostaining (data not shown).To mimic in vivo ischemic conditions, cells were subjectedto a combination of serum, glucose, and oxygen depriva-tion (SGO) as described in Materials and methods. After24 h ischemia shrunken cells with condensed or fragmentednuclei, characteristic of apoptotic cells, were detectable incardiomyocyte cultures (Fig. 1A). The apoptotic mode ofcell death was confirmed by detecting activation and activ-ity of caspase proteases. Cardiomyocyte cultures subjectedto 4 h ischemia expressed a 3-fold increase in DEVDaseactivity, which was associated with processing of pro-cas-pase-3 and cleavage of the caspase-3 substrate, PCKd(Fig. 1B). Primary cardiomyocyte cultures may contain asmall percentage of fibroblasts or other non-cardiomyocytecells. Immunostaining for a-actinin, a cardiomyocyte-spe-cific caspase-3 substrate [15], revealed its breakdown andloss of staining following 4 h ischemia (Fig. 1C). Westernblot analysis identified 45 and 25 kDa processed fragments,confirming cleavage of a-actinin in ischemic cardiomyo-cytes (Fig. 1C). Collectively, these data confirmed thatexposure of primary neonatal cardiomyocytes to ischemiainduces apoptotic cell death.

Ischemia triggers the unfolded protein response in primary

cardiomyocytes

In order to examine the effect of ischemia on the ER,induction of Grp78 (Bip), a marker of ER stress was deter-mined. Ischemia (2–4 h) induced Grp78 both at mRNAand protein levels (Fig. 2A and B). To compare the kineticsand the extent of Grp78 induction, cardiomyocyes weretreated with a specific ER stressor, thapsigargin (an inhib-itor of the SERCA pump). Thapsigargin caused a similarincrease in Grp78 expression as ischemia, although thekinetics of mRNA induction was faster, between 0 and2 h treatment (Fig. 2A and B).

Since induction of Grp78 is indicative of the activationof the UPR, we examined which of the three branches ofthe UPR are activated by ischemia in cardiomyocytes.The activation of the UPR receptors Ire1, ATF6, andPERK was detected by monitoring their target molecules.In primary cardiomyocytes, induction of a sXBP1 mRNA(frame-shift splice variant of XBP1) occurred during thefirst 2 h of exposure to ischemia, and the level and thekinetics of induction were similar to those of thapsigar-

Fig. 2. Ischemia induces expression of Grp78 at both mRNA and protein levels. Cardiomyocyte cultures were subjected to ischemia or thapsigargin (Tg,2 lM) for the indicated times. (A) Total RNA was isolated from ischemic (upper panel) and thapsigargin-treated (lower panel) cardiomyocytes and theGrp78 message was amplified by RT-PCR. GAPDH was used as a loading control. (B) Induction of Grp78 protein expression in ischemic (upper panel)and thapsigargin-treated (lower panel) cardiomyocytes detected by Western blotting. Actin was used as a loading control. The images are representativesof three separate experiments.

E. Szegezdi et al. / Biochemical and Biophysical Research Communications 349 (2006) 1406–1411 1409

gin-treated cells, indicating that ATF6 and Ire1 are bothactivated during ischemia (Fig. 3A and B). Activation ofATF6 transcription factor induces expression of XBP1mRNA [16]. Ire1 has an endoribonuclease domain, bywhich it splices a 26 nucleotide fragment out of the XBP1mRNA. The generated frame-shift splice variant (sXBP1)codes for a transcription factor that induces the expressionof ER chaperones. Therefore, accumulation of sXBP1mRNA in the cell is the result of the coordinated actionof ATF6 and Ire1.

Fig. 3. Ischemia activates all three arms of the UPR. Cardiomyocyte culturestimes indicated. Accumulation of spliced XBP1 (sXBP1) mRNA in response tototal RNA samples. GAPDH mRNA was also amplified and used as a loadinthapsigargin treatment was detected in whole cell lysates by Western blotting usserve as loading controls. Induction of the PERK-targets ATF4 and GADdetermined by RT-PCR on total RNA samples. GAPDH message was also amindependent experiments.

Phosphorylation of eIF2a was clearly detectable as earlyas 1 h after induction of ischemia and the level of phosphor-ylation was comparable to that induced by thapsigargin(Fig. 3C and D). Phosphorylation of eIF2a was followedby accumulation of both ATF4 and GADD34 mRNA,detected by RT-PCR (Fig. 3E and F). These results indicatethat in addition to the Ire1 and ATF6 pathways, the PERKpathway is also activated early during ischemia. ActivatedPERK phosphorylates and inhibits the a-subunit of theeukaryotic initiation factor 2 (eIF2a), which leads to atten-

were subjected to ischemia or treated with thapsigargin (Tg, 2 lM) for the(A) ischemia, and (B) thapsigargin treatment was detected by RT-PCR ing control. Phosphorylation of eIF2a in response to (C) ischemia and (D)ing p-eIF2a antibody. Expression of total eIF2a and actin was detected toD34 mRNAs during (E) ischemia, and (F) thapsigargin treatment wasplified and used as a loading control. All images are representative of three

Fig. 4. Prolonged ischemia leads to induction of an ER stress-mediated apoptotic pathway. Cardiomyocytes were exposed to ischemia or thapsigargin(Tg, 2 lM) for 0–24 h and whole cell lysates were prepared. (A) Expression of CHOP in ischemic (upper panel) and thapsigargin-treated (lower panel)cardiomyocytes was detected by Western blotting. (B) Prolonged ischemia (upper panel) and thapsigargin treatment (lower panel) induce pro-caspase-12processing detected on Western blots of whole cell lysates. Membranes were probed for actin and used as a loading control.

1410 E. Szegezdi et al. / Biochemical and Biophysical Research Communications 349 (2006) 1406–1411

uation of general (cap-dependent) protein translation. Inhi-bition of the cap-dependent protein synthesis enables thetranslation of ATF4 transcription factor and GADD34protein phosphatase 1 (PP1)-interacting protein, throughan alternative, cap-independent translation pathway [17].

The ER stress-induced apoptotic pathway is activated during

prolonged ischemia

During prolonged or severe ER stress the cytoprotectiveUPR can switch to a pro-apoptotic response to initiate celldeath. Therefore, we questioned whether the ER stress-med-iated apoptotic pathway is a component of ischemia-induced cell death in primary cardiomyocytes. So far, theER stress-mediated apoptotic pathway is only partially char-acterized, although some ER stress-specific components ofthe pathway have been identified. For instance, the tran-scription factor CHOP has been shown to play a central roleby altering the balance of pro- and anti-apoptotic Bcl-2 pro-teins to promote apoptosis [18]. Another specific componentof the pathway is caspase-12, which is localized to the ER andis processed only in response to ER stress [8].

To confirm that these proteins are actual markers of ERstress-induced apoptosis in cardiomyocytes, both proteinswere examined in thapsigargin-treated cardiomyocytes.Induction of CHOP as well as processing of pro-caspase-12 was detectable in response to thapsigargin treatment(Fig. 4A and B). Exposure of primary cardiomyocyte cul-tures to ischemia also led to induction of CHOP, whichwas detectable following 2 h ischemia (Fig. 4A). Ischemiaalso triggered processing of pro-caspase-12, which occurredbetween 4 and 8 h of ischemia (Fig. 4B). These results pointout that not only the protective UPR is prompted by ische-mic stress, but prolonged ischemia induces severe damagethat initiates the ER stress-mediated apoptotic pathway.

Discussion

While there is mounting evidence emphasizing the roleof the UPR and ER stress in cerebral ischemia, there is

only circumstantial evidence available implying involve-ment of the ER stress response in cardiac ischemia [19].It was recently demonstrated that Grp78 induction andXBP1 splicing occur in hypoxic cardiomyocytes [20,21].Zhang et al. also demonstrated that pre-induction ofGrp78 by tunicamycin, an ER stressor, protects cardio-myocytes from lethal injury due to prolonged ATP deple-tion or excessive oxidative stress [10].

There is no information, however, regarding the activa-tion of the UPR, in particular which branches of the UPRare activated, or the kinetics of their activation. Here, weshow that ischemia, without reperfusion, is sufficient toactivate all three branches of the UPR in primary neonatalrat cardiomyocytes. We detected marked induction ofsXBP1 mRNA, a marker for the coordinated action ofactive ATF6 and Ire1. The early appearance of sXBP1mRNA, during the first 2 h of ischemia, and the level ofinduction were comparable to those induced by thapsigar-gin, the classical ER stressor. Activation of the thirdbranch of the UPR, the PERK pathway also occurred.The PERK substrate eIF2a was phosphorylated duringthe first hour of ischemia, to a similar extent as it was phos-phorylated by thapsigargin. Phosphorylation of eIF2a wasfollowed by the induction of the transcription factor ATF4and the PP1-interacting protein GADD34, both genes spe-cific targets of the PERK/eIF2a pathway.

The UPR is primarily an adaptive response, aiming torestore ER homeostasis and protect the cell from stress.The importance of the UPR in protecting stressed cardio-myocytes was first shown by Vitadello et al., who demon-strated that overexpression of Grp94 reduces ischemiccell death in cardiomyocytes [22]. However, if the stress isprolonged and the adaptive response fails, the UPR recep-tors can launch a pro-apoptotic response and initiate cellsuicide. This apoptotic programme originates from theER, independent of the mitochondria, and may contributeto cardiomyocyte loss. Although the ER stress-mediatedapoptotic pathway is only partially characterized, two spe-cific hallmarks of the process have been identified [23].These are the induction of the pro-apoptotic transcription

E. Szegezdi et al. / Biochemical and Biophysical Research Communications 349 (2006) 1406–1411 1411

factor CHOP and activation of the ER-localized caspase,caspase-12. Prolonged ischemia led to induction of CHOP,which occurred between 4 and 8 h of exposure. Processingof pro-caspase-12 was also detectable, and occurred in thesame time frame, between 4 and 8 h of ischemic exposure.These results emphasize that ischemia not only induces theUPR, but if prolonged, the UPR receptors launch a pro-apoptotic response which probably drives the cell towardsdeath.

Although, we have shown that cardiomyocytesrespond to an ischemic insult by activating all threeUPR receptors to counteract the cellular stresses evokedby SGO deprivation, in the setting of prolonged ischemiathe UPR fails to restore cellular homeostasis and a pro-apoptotic ER stress pathway is initiated. The regulationof this effect may be via upregulation of CHOP andcleavage of caspase-12. The activated ER stress deathpathway, in concert with the mitochondrial death path-way, causes caspase activation, cytoskeletal breakdown,and nuclear fragmentation, leading to the final demiseof the cell. The ER stress pathway is therefore a noveltarget for prevention of ischemia-mediated cardiomyo-cyte loss.

Acknowledgments

This work was supported by grants from Higher Educa-tion Authority of Ireland (PRTLI-III), SFI CSET grant toREMEDI and SFI PI award to A.S.

References

[1] M. Avkiran, Protection of the ischaemic myocardium by Na+/H+exchange inhibitors: potential mechanisms of action, Basic Res.Cardiol. 96 (2001) 306–311.

[2] W.E. Cascio, T.A. Johnson, L.S. Gettes, Electrophysiologic changesin ischemic ventricular myocardium: I. Influence of ionic, metabolic,and energetic changes, J. Cardiovasc. Electrophysiol. 6 (1995)1039–1062.

[3] L.H. Opie, Myocardial metabolism and heart disease, Jpn. Circ. J. 42(1978) 1223–1247.

[4] T. Iwai, K. Tanonaka, R. Inoue, S. Kasahara, N. Kamo, S. Takeo,Mitochondrial damage during ischemia determines post-ischemiccontractile dysfunction in perfused rat heart, J. Mol. Cell. Cardiol. 34(2002) 725–738.

[5] A. Samali, S. Orrenius, Heat shock proteins: regulators of stressresponse and apoptosis, Cell Stress Chaperones 3 (1998) 228–236.

[6] T. Hayashi, A. Saito, S. Okuno, M. Ferrand-Drake, R.L. Dodd, P.H.Chan, Oxidative injury to the endoplasmic reticulum in mouse brainsafter transient focal ischemia, Neurobiol. Dis. 15 (2004) 229–239.

[7] D.T. Rutkowski, R.J. Kaufman, A trip to the ER: coping with stress,Trends Cell Biol. 14 (2004) 20–28.

[8] E. Szegezdi, U. Fitzgerald, A. Samali, Caspase-12 and ER-stress-mediated apoptosis: the story so far, Ann. N.Y. Acad. Sci. 1010(2003) 186–194.

[9] D.J. Thuerauf, H. Hoover, J. Meller, J. Hernandez, L. Su, C.Andrews, W.H. Dillmann, P.M. McDonough, C.C. Glembotski,Sarco/endoplasmic reticulum calcium ATPase-2 expression is regu-lated by ATF6 during the endoplasmic reticulum stress response:intracellular signaling of calcium stress in a cardiac myocyte modelsystem, J. Biol. Chem. 276 (2001) 48309–48317.

[10] P.L. Zhang, M. Lun, J. Teng, J. Huang, T.M. Blasick, L. Yin, G.A.Herrera, J.Y. Cheung, Preinduced molecular chaperones in theendoplasmic reticulum protect cardiomyocytes from lethal injury,Ann. Clin. Lab. Sci. 34 (2004) 449–457.

[11] A. Azfer, J. Niu, L.M. Rogers, F.M. Adamski, P.E. Kolattukudy,Activation of endoplasmic reticulum stress response during thedevelopment of ischemic heart disease, Am. J. Physiol. Heart Circ.Physiol. 291 (2006) H1411–H1420.

[12] J.L. Reeve, A.M. Duffy, T. O’Brien, A. Samali, Don’t loseheart–therapeutic value of apoptosis prevention in the treat-ment of cardiovascular disease, J. Cell. Mol. Med. 9 (2005)609–622.

[13] T.M. Scarabelli, R.A. Gottlieb, Functional and clinical repercussionsof myocyte apoptosis in the multifaceted damage by ischemia/reperfusion injury: old and new concepts after 10 years of contribu-tions, Cell Death Differ. 11 (Suppl. 2) (2004) S144–S152.

[14] P. Simpson, S. Savion, Differentiation of rat myocytes in single cellcultures with and without proliferating nonmyocardial cells. Cross-striations, ultrastructure, and chronotropic response to isoproterenol,Circ. Res. 50 (1982) 101–116.

[15] C. Communal, M. Sumandea, P. de Tombe, J. Narula, R.J. Solaro,R.J. Hajjar, Functional consequences of caspase activation in cardiacmyocytes, Proc. Natl. Acad. Sci. USA 99 (2002) 6252–6256.

[16] A.H. Lee, N.N. Iwakoshi, L.H. Glimcher, XBP-1 regulates a subsetof endoplasmic reticulum resident chaperone genes in the unfoldedprotein response, Mol. Cell. Biol. 23 (2003) 7448–7459.

[17] J.D. Blais, V. Filipenko, M. Bi, H.P. Harding, D. Ron, C. Koumenis,B.G. Wouters, J.C. Bell, Activating transcription factor 4 istranslationally regulated by hypoxic stress, Mol. Cell. Biol. 24(2004) 7469–7482.

[18] K.D. McCullough, J.L. Martindale, L.O. Klotz, T.Y. Aw, N.J.Holbrook, Gadd153 sensitizes cells to endoplasmic reticulum stress bydown-regulating Bcl2 and perturbing the cellular redox state, Mol.Cell. Biol. 21 (2001) 1249–1259.

[19] D.J. DeGracia, H.L. Montie, Cerebral ischemia and the unfoldedprotein response, J. Neurochem. 91 (2004) 1–8.

[20] K. Terai, Y. Hiramoto, M. Masaki, S. Sugiyama, T. Kuroda, M.Hori, I. Kawase, H. Hirota, AMP-activated protein kinase protectscardiomyocytes against hypoxic injury through attenuation of endo-plasmic reticulum stress, Mol. Cell. Biol. 25 (2005) 9554–9575.

[21] D.J. Thuerauf, M. Marcinko, N. Gude, M. Rubio, M.A. Sussman,C.C. Glembotski, Activation of the unfolded protein response ininfarcted mouse heart and hypoxic cultured cardiac myocytes, Circ.Res. 99 (2006) 275–282.

[22] M. Vitadello, D. Penzo, V. Petronilli, G. Michieli, S. Gomirato, R.Menabo, F. Di Lisa, L. Gorza, Overexpression of the stress proteinGrp94 reduces cardiomyocyte necrosis due to calcium overload andsimulated ischemia, Faseb J. 17 (2003) 923–925.

[23] E. Szegezdi, S.E. Logue, A.M. Gorman, E. Samali, Mediators of ERstress-induced apoptosis, EMBO Rep. 7 (2006) 880–885.