Differentiation-Associated Reprogramming of theTransforming Growth Factor b Receptor PathwayEstablishes the Circuitry for Epithelial Autocrine/Paracrine RepairJonathan M. Fleming1, Saqib Shabir1, Claire L. Varley1, Lisa A. Kirkwood1, Angela White2, Julie Holder2,

Ludwik K. Trejdosiewicz1, Jennifer Southgate1*

1 Jack Birch Unit for Molecular Carcinogenesis, Department of Biology, University of York, York, United Kingdom, 2 GlaxoSmithKline R&D, Ware, United Kingdom

Abstract

Transforming growth factor (TGF) b has diverse and sometimes paradoxical effects on cell proliferation and differentiation,presumably reflecting a fundamental but incompletely-understood role in regulating tissue homeostasis. It is generallyconsidered that downstream activity is modulated at the ligand:receptor axis, but microarray analysis of proliferative versusdifferentiating normal human bladder epithelial cell cultures identified unexpected transcriptional changes in keycomponents of the canonical TGFb R/activin signalling pathway associated with cytodifferentiation. Changes includedupregulation of the transcriptional modulator SMAD3 and downregulation of inhibitory modulators SMURF2 and SMAD7.Functional analysis of the signalling pathway revealed that non-differentiated normal human urothelial cells responded inparacrine mode to TGFb by growth inhibition, and that exogenous TGFb inhibited rather than promoted differentiation. Bycontrast, in differentiated cell cultures, SMAD3 was activated upon scratch-wounding and was involved in promoting tissuerepair. Exogenous TGFb enhanced the repair and resulted in hyperplastic scarring, indicating a feedback loop implicit in anautocrine pathway. Thus, the machinery for autocrine activation of the SMAD3-mediated TGFbR pathway is establishedduring urothelial differentiation, but signalling occurs only in response to a trigger, such as wounding. Our studydemonstrates that the circuitry of the TGFbR pathway is defined transcriptionally within a tissue-specific differentiationprogramme. The findings provide evidence for re-evaluating the role of TGFbR signalling in epithelial homeostasis as anautocrine-regulated pathway that suppresses differentiation and promotes tissue repair. This provides a new paradigm tohelp unravel the apparently diverse and paradoxical effect of TGFb signalling on cell proliferation and differentiation.

Citation: Fleming JM, Shabir S, Varley CL, Kirkwood LA, White A, et al. (2012) Differentiation-Associated Reprogramming of the Transforming Growth Factor bReceptor Pathway Establishes the Circuitry for Epithelial Autocrine/Paracrine Repair. PLoS ONE 7(12): e51404. doi:10.1371/journal.pone.0051404

Editor: Yao Liang Tang, University of Cincinnati, United States of America

Received September 20, 2012; Accepted November 2, 2012; Published December 19, 2012

Copyright: � 2012 Fleming et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permitsunrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: JMF was in receipt of a Biotechnology & Biological Sciences Research Council Industrial CASE studentship with GlaxoSmithKline. JS holds a researchchair supported by York Against Cancer. AW and JH are employees of GlaxoSmithKline. The funders did not control the study design, data collection and analysis,decision to publish, or preparation of the manuscript.

Competing Interests: The authors have read the journal’s policy and have the following conflicts: Affiliations: AW and JH are employees of GlaxoSmithKline.Patent: The differentiated normal human urothelium used in this study is patented as Cross W and Southgate J (2004), Biomimetic Urothelium, WO2004/011630.This does not alter the authors’ adherence to all the PLOS ONE policies on sharing data and materials.

* E-mail: jennifer.southgate@york.ac.uk

Introduction

The high capacity of epithelial tissues for self-repair and renewal

is effected through locally-regulated proliferation and differentia-

tion of resident progenitor cells rather than recruitment of

exogenous progenitor cells to the site. A dysfunction of regener-

ative mechanism(s) lies at the heart of numerous age-related

diseases that afflict epithelial tissues, from chronic wounding and

inflammation through to cancer, making epithelia a key target for

regenerative and replacement therapies. As a model epithelium for

regenerative studies, the uro-epithelial lining of the bladder and

associated urinary tract provides an excellent system, being

mitotically-quiescent with a low constitutive turnover rate, but

with an exceptionally high capacity for regeneration [1]. In

addition, urothelium expresses specific, highly objective markers of

terminal differentiation, such as the uroplakins [2,3], that define its

specialised function as a urinary barrier.

In determining the mechanisms that orchestrate and mediate

regeneration, a common perception is that the epithelium relies on

the subjacent stroma. Indeed, an elegant recent study in the mouse

bladder has provided evidence of an inductive paracrine loop

operating between urothelium and stroma [4]. Nevertheless, there

is also considerable evidence for autonomous growth regulation,

for example through autocrine activation of epidermal growth

factor receptor (EGFR) signalling [5].

The TGFb superfamilies of ligands and cognate receptors act as

major regulators of tissue development and homeostasis. Although

TGFb is thought of primarily as an anti-proliferative agent, it can

also influence cell migration and promote apoptosis, and crucially,

act as an inducer of epithelial to mesenchymal transition (EMT), a

process implicated in tissue differentiation and wound-healing [6].

The precise effects of TGFb can be paradoxical – for example, it

may act as growth inhibitor or mitogen depending on concentra-

tion, cell type and context [7]. Similarly, its pro-apoptotic effects

PLOS ONE | www.plosone.org 1 December 2012 | Volume 7 | Issue 12 | e51404

can be context-dependent, as illustrated by the observation that

TGFb promotes death by neglect only of post-activated T cells,

but has no effect during T cell activation [8].

Responses to TGFb are governed at several levels, including the

nature of the ligand and the cell type-specific transcriptome that

specifies the repertoire of surface receptors, the downstream

SMAD-mediated and interactive signal transduction pathways and

available transcriptional targets. In concert, these provide the basis

for a cellular response that is influenced by the proliferative,

differentiated and pathogenic status of the cell [9].

Much of the understanding of the role of TGFb in human cells

derives from studies of tumour-derived cell lines maintained in

‘‘simple’’ two-dimensional culture. In order to address its role in a

more sophisticated tissue system, we have exploited a normal

human epithelial cell culture system that we have previously

demonstrated can be switched from a regenerative to differenti-

ated phenotype. In serum-free, low calcium conditions, normal

human urothelial (NHU) cells display a highly proliferative

regenerative phenotype and do not express markers of urothelial

differentiation, even at confluency [10]. These same cultures self-

organise to form a stratified, functionally-differentiated urothelium

when switched to appropriate in vitro conditions [11]. Alterna-

tively, terminal differentiation may be induced pharmacologically

by activation of PPARc with concurrent inhibition of EGFR; this

initiates a programme of transcriptional changes that results in

expression of a late/terminal-differentiated urothelial cell pheno-

type [12,13,14].

In this study. we applied a microarray approach to identify gene

expression changes common to both in vitro methods for inducing

urothelial cytodifferentiation. The discovery of transcriptional

changes in the canonical TGFb signalling pathway suggested that

TGFb-related signalling was involved in the cytodifferentiation

process. To test this hypothesis, the effects of exogenous and

endogenous TGFb signalling on cell growth, differentiation and

wound repair were examined. Our data support a number of

unexpected conclusions leading to a re-evaluation of the precise

role of TGFbR signalling in epithelial homeostasis.

Materials and Methods

MaterialsPD153035 (EGFR tyrosine kinase inhibitor; Calbiochem);

SB431542 (TGFb Superfamily Type I Activin Receptor-Like

Kinase receptor inhibitor; Sigma) and troglitazone (TZ: PPARcagonist; gift from Parke-Davis Pharmaceutical Research) were

dissolved in DMSO. Human recombinant TGFb1 (R&D Systems)

and TGFb2 (Peprotech) were dissolved in buffer. Appropriate

solvent controls were included in all experiments.

Rabbit affinity-purified heteroantibodies against AKT, pAKT,

pERK and pSMAD3 (Cell Signaling Technology), and against

SMAD3 (Abcam) were used together with monoclonal antibodies

to ERK (clone 16; Transduction Laboratories), Ki67 (clone MM1;

Novocastra)), cyclin D1 (clone DCS-6; Cell Signaling Technology)

and b-actin (clone AC-15; Sigma). Secondary antibodies used for

western blot analysis were Alexa 680-conjugated goat anti-mouse

IgG or Alexa 800-conjugated goat anti-rabbit IgG (Invitrogen) and

for immunofluorescence were goat anti-mouse or goat anti-rabbit

secondary antibody conjugated to Alexa 488 (green) or Alexa 594

(red) (Invitrogen).

Cell cultureHuman biological samples were sourced ethically with informed

written consent from patients and approval for use in research

from the Leeds (East) and the York Research Ethics Committees.

Finite NHU cell lines were established as detailed elsewhere

[15,16]. For routine propagation, cultures were maintained as

monolayers in low calcium (0.09 mM) Keratinocyte Serum Free

Medium (Invitrogen) containing bovine pituitary extract and EGF,

and supplemented with cholera toxin (KSFMc). Cultures were

sub-cultured at just-confluence as described [15,16] and used for

experiments between passages 3 to 5.

For induction of differentiation, NHU cell cultures were treated

with either a) 1 mM TZ with concurrent 1 mM PD153035 to block

downstream EGFR signalling (TZ/PD; [13]) or b) 5% adult

bovine serum (ABS, Harlan Sera-Lab) and 2 mM CaCl2 (ABS/

Ca2+) as described [11]). Control (non-differentiated) cultures were

maintained in parallel in KSFMc and used at the same time points

(between 24 to 144 hours). Cultures were lysed in situ with

TRIzolH to prepare RNA by the manufacturer’s recommended

protocol (Invitrogen). RNA samples were treated with a DNA-free

kit (Ambion) and quantified by UV spectrophotometry.

The HeLa-S3 cell line was used in some experiments as a

positive control.

UPK2-eGFP lentivirusA lentivirus was produced using the ViralPowerTM Promoterless

Lentiviral GatewayH Expression system (Invitrogen) in which

enhanced GFP (eGFP) was expressed under the control of the

UPK2 promoter. The 1.8 kb functional fragment of the UPK2

promoter [17] was amplified from 500 ng of human genomic

DNA using Expand high fidelity Taq polymerase enzyme (Roche)

using primers 59 AGG CTT CAC CCC AGA CCC ACT GC39

and 59GCT GGG CTG GGA GGT GGA ATA GG 39. The

resulting fragment was ligated into the pENTRTM 59-TOPOH TA

cloning vector using topoisomerase, transformed into TOP10

E.coli and selected in kanamycin (50 mg/ml). Successful transfor-

mants were selected by their EcoRI digestion pattern and were

verified by dye-terminator sequencing (Lark Technologies). eGFP

was cloned into the pENTRTM vector and selected as above. Both

vectors were combined with the Lenti6/R4/R2/V5-DEST vector

and incubated with LR ClonaseTM Plus to produce an expression

clone by homologous recombination. Expression constructs were

transformed into One shotH Stbl3TM chemically-competent E.coli,

selected with 100 mg/ml ampicillin and purified using a Qiagen

endofreeTM Maxi-prep column. UPK2-eGFP lentivirus produced

from 293FT packaging cells as per the ViraPower Lentiviral

Expression Systems protocol (Invitrogen) was filtered through a

0.45 mm filter and used immediately to transduce NHU cells in the

presence of 6 mg/ml polybrene. Following selection of stable

transductants with 1 mg/ml blasticidin, eGFP fluorescence was

used as a correlate of UPK2 expression in NHU cells following

induction of differentiation.

MTT assayThe relative biomass of cultures was determined using a methyl

thiazolyldiphenyl tetrazolium bromide (MTT) assay to assess

mitochondrial dehydrogenase activity. NHU cells were seeded in

96-well plates at 2.56103 cells/well. One plate was left untreated

to establish initial cell viability at T = 0. The remaining plates were

incubated with inhibitors or recombinant growth factors in 6

replicates. To assay, wells were incubated with 200 ml MTT

(0.5 mg/ml) at 37uC for 4 hours and the formazan crystals were

dissolved in 200 ml DMSO and measured spectrophotometrically.

Time lapse microscopy for scratch/migration analysisNHU cells were seeded at 2.56105 cells/well in 24 well plates in

KSFMc in the presence or absence of 5% ABS/2 mM CaCl2 and

grown to confluence where cultures were contact-inhibited and

TGFbR Pathway Reprogramming during Differentiation

PLOS ONE | www.plosone.org 2 December 2012 | Volume 7 | Issue 12 | e51404

out of cell cycle [18]. Media were replenished every 2–3 days.

Cultures were pre-treated with TGFb and/or inhibitors for

3 hours and then scratched once using a P100 pipette tip to

generate a 500 mm wound, washed in KSFMc to remove cell

debris and replenished with fresh medium containing appropriate

treatment. Cultures were observed by differential interference

contrast videomicroscopy (Olympus IX81 microscope) in an

environmental chamber with an automated mechanical stage.

Individual images were captured digitally every 10 minutes for

20 hours and were analysed by measuring the wound area and

expressing it as the percentage healed compared to the original

area of the wound in replicate (n = 3) cultures.

Affymetrix DataFollowing RNA extraction, mRNA was converted to cDNA and

then to biotin-labelled cRNA before hybridising to AffymetrixTM

GeneChip Human Genome U133 Plus 2.0 (HG-U133 Plus 2.0)

arrays. The array chips were washed and scanned at 560 nm using

an Affymetrix GeneChip Scanner.

The MAS5 Algorithm was used for background correction,

normalisation and probe summarisation using ArrayAssist soft-

ware (Affymetrix). Fold-change data were generated by comparing

the non-differentiated proliferating control against the day 6

differentiated cultures. Changes to specific gene targets were

validated on the target RNA and on RNA generated from

independent NHU cell lines by real-time PCR.

Real-Time PCR analysis1 mg DNA-free RNA was reverse-transcribed using 50 ng of

random hexamer primers and Invitrogen’s SuperscriptTM II first-

strand cDNA synthesis kit according to the manufacturer’s

protocol. Reverse transcriptase-negative and no template controls

were included in all experiments and GAPDH was used as the

normalisation transcript. Quantification of transcript expression

was conducted on 10% of the cDNA reaction by real-time PCR

using SYBR-green or TaqMan reagents (Applied Biosystems).

For relative quantification of transcript expression, template

cDNA was mixed with SYBR-green PCR Master Mix and

400 nM of each forward and reverse target gene primer (Table 1)

and analysed on an ABI PrismH 7300 Sequence Detection System.

The thermal profile was: 2 minute hold at 50uC, incubation at

95uC (10 min), followed by 40 cycles of denaturation at 95uC(15 sec) and elongation at 72uC (1 min). Dissociation curves were

performed to confirm the presence of a single amplification

product and the absence of primer dimers for each primer set.

Assay efficiency was validated using the CT slope method prior to

use and both test and endogenous assays were shown to be of

equal efficiency. SYBR-green results were expressed as relative

quantification (RQ) values (Applied Biosystems).

For TaqMan, 5 ml template cDNA was mixed with 12.5 ml of

TaqMan 26Universal Master Mix (Applied Biosystems), 300 nM

of each forward and reverse UPK2 primers, 200 nM of the UPK2

probe (Vic fluorophore), 200 nM each of GAPDH forward and

reverse primers and 150 nM of the GAPDH probe (Fam

fluorophore) as described [19]. Serial dilutions of human genomic

DNA (100 - 0.16 ng) were used to generate standard curves.

Normalised values of UPK2 mRNA were obtained by dividing the

UPK2 amount by the GAPDH endogenous reference amount.

Western blottingCultures were lysed into reducing electrophoresis sample buffer

containing 0.2% (v/v) protease inhibitors (Cocktail Set III,

Calbiochem) and assayed with a Coomassie protein assay reagent

kit (Pierce). Proteins were resolved by electrophoresis on 1 mm 4–

12% Bis-Tris NuPAGE pre-cast polyacrylamide gels (Novex,

Invitrogen). 20–25 mg of sample was loaded alongside 5 ml of All-

Blue pre-stained markers (BioRad), electrophoresed in MOPS or

MES running buffer and electrotransferred to Immobilon PVDF

transfer membrane (Millipore). Membranes were blocked in

OdysseyTM blocking buffer (LI-COR systems) for 1 hour, probed

with primary antibody then secondary antibodies before being

visualised by infrared scanning followed by analysis on an Odyssey

LI-COR infrared scanner. b-actin was used as a loading control to

normalise band density to protein loading. Blots were stripped for

reprobing in Western Blot Recycling Kit reagent (Autogen

Bioclear) for 30 minutes at ambient temperature.

ImmunocytochemistryNHU cells were grown on TeflonH-coated 12-well glass slides

and fixed in a 1:1 mixture of methanol:acetone and air-dried, or

fixed in 10% (v/v) formalin for 15 minutes and washed. Formalin-

fixed slides were permeabilised in 0.1% (w/v) Triton-X. Primary

antibody was applied overnight at 4uC, followed by incubation

with secondary antibody conjugated to Alexa 488 or Alexa 594.

Nuclei were visualised by staining with 0.1 mg/ml Hoechst 33258.

Slides were examined under epifluorescence illumination using an

Olympus BX60 microscope.

ElectrophysiologyElectrophysiological measurements were performed as de-

scribed [11]. NHU cell cultures were grown on 4 mm pore

Snapwell chambers (Corning Incorporated) for seven days in

triplicate. Electrophysiological properties were measured using a

VCC MC2 multi-channel voltage-current clamp (Physiologic

Instruments Inc) and U-2500 vertical modified Ussing chambers

(Warner Instruments) designed to fit the Snapwell inserts. The

spontaneous potential difference (V, measured in mV) and short

circuit current (I, measured in mA) across the urothelial cell layer

were measured using Ag-AgCl microelectrodes connected to the

voltage-current clamp. The transepithelial electrical resistance

(TER) was calculated using Ohm’s law (I = V/R) and adjusted for

the surface area of the membrane (1.13 cm2) to give the TER in

V.cm2.

StatisticsParametric statistics (mean and SD(n-1)) were used throughout

for descriptive purposes and tests of significance were by means of

a two-tailed t-test.

Table 1. Primers for SYBR-green RTqPCR.

Gene Reference Sequence Primer Sequence

SMAD3 NM_005902 TCCAATTCGGAGCGCTTCT

ACTGCTGCATTCCTGTTGACA

TGFbRI NM_004612 AGCGGTCTTGCCCATCTTC

CTATGAGCAATGGCTGGCTTT

TGFbRII NM_003242 TGTCTGTGGATGACCTGGCTAA

TTCTGGAGCCATGTATCTTGCA

SMURF2 NM_022739 CGTGGAGAAGAAGGCCTTGA

CATGTGACAAGAGATACAACCATTCC

Sequences shown are 59-39 with forward primer in bold.doi:10.1371/journal.pone.0051404.t001

TGFbR Pathway Reprogramming during Differentiation

PLOS ONE | www.plosone.org 3 December 2012 | Volume 7 | Issue 12 | e51404

Figure 1. Analysis of differentiating NHU cells. NHU cells were differentiated by (a) TZ/PD or (b) ABS/Ca2+ protocols, as described in Materialsand Methods, for the times indicated. Following RNA extraction, cDNA was generated and absolute quantitative PCR for UPK2 was performed. TheVIC-labelled UKP2 product was normalised against the internal control (FAM-labelled GAPDH). Bars represent mean 6 SD of triplicate PCRdeterminations. NHU cells transduced with UPK2-eGFP lentivirus were (c) left untreated, or differentiated by (d) TZ/PD or (e) ABS/Ca2+ protocols andassessed by epifluorescence; 6 day timepoint shown. Scale bar 80 mm. To verify changes in TGFb target gene expression during differentiation,cultures from an independent NHU cell line were induced to differentiate with TZ/PD or ABS/Ca2+ for 72 h (f). RTqPCR using comparativequantification by cycle threshold (CT) with SYBRgreen was performed in triplicate and normalised against the internal control (GAPDH). Data showTGFb pathway-associated gene expression in response to treatment with TZ/PD or ABS/Ca2+ versus vehicle control. Bars represent mean 6 SD.doi:10.1371/journal.pone.0051404.g001

TGFbR Pathway Reprogramming during Differentiation

PLOS ONE | www.plosone.org 4 December 2012 | Volume 7 | Issue 12 | e51404

Results

Urothelial cytodifferentiation and associated genechanges

Expression of urothelium differentiation-restricted uroplakin 2

(UPK2) transcript was used as a marker to monitor the

differentiation status of NHU cell cultures. Whereas there was

minimal UPK2 expression in control cultures maintained in

standard growth medium, both differentiation-inducing protocols

(TZ/PD and ABS/Ca2+) resulted in time-dependent increases in

UPK2 transcript (Figs. 1A–B). NHU cultures stably transduced

with UPK2-eGFP lentivirus contained few eGFP-expressing cells

even at confluence (Fig. 1C). Following induction of differentia-

tion, a majority of cells became fluorescent within 6 days. Cells

differentiated pharmacologically by TZ/PD remained discrete and

rounded, whereas those differentiated by ABS/Ca2+ formed

integrated, overlying cell sheets (Figs. 1D–E). To identify gene

expression changes common to both differentiation strategies,

gene arrays were performed on cRNA derived from parallel

cultures harvested at 6 days post induction of differentiation. The

array data for the two differentiation-inducing protocols was

validated by examining changes in expression of marker genes

associated with differentiated urothelium, including UPK2 (Table

S1).

A pair-wise comparison of the arrays against a non-differenti-

ated control was used to identify genes that showed significant

(p,0.01) changes in expression based on a log2-fold change in

signal intensity. Using the TZ/PD protocol, the expression of 2511

genes was significantly increased and 2926 showed a decrease.

With ABS/Ca2+, 2326 genes were increased and 1984 decreased.

2116 gene changes were common to both protocols.

The method-independent subset of gene changes common to

both differentiation-inducing protocols was assessed by functional

ontology within the IngenuityTM Systems software suite. This

indicated gene expression changes implicated in programs of

cellular growth/proliferation, migration, death, and cell-cell

signaling. Within the growth factor signalling category, TGFb,

IGF-1, HGF and EGF emerged as the top four modified

pathways, with 8/83 (9.6%), 7/100 (7.0%), 7/103 (6.8%) and 3/

49 (6.1%) gene changes for each pathway, respectively.

Table 2. AffymetrixTM genechip analysis in differentiatedversus proliferative NHU cells.

ABS/Ca2+ TZ/PD

Ligand TGFb1 23.62 nc

TGFb2 +5.30 nc

TGFb3 A A

Receptor TGFbRI 21.69 21.53

TGFbRII 27.06 22.29

R-SMAD SMAD1 nc nc

SMAD2 nc nc

SMAD3 +5.06 +3.79

SMAD5 nc nc

SMAD9 A A

Co-SMAD SMAD4 nc nc

I-SMAD SMAD6 A A

SMAD7 21.44 22.02

SMURF SMURF1 nc nc

SMURF2 22.77 24.27

NHU cells were differentiated with TZ/PD or ABS/Ca2+ and harvested after 6days. Biotin-labelled cRNA generated from control (proliferating) and 6 daydifferentiated cultures was hybridised to U133 genechips.Numbers represent fold change; + and 2 indicate increased and decreasedexpression, respectively; nc = no change and A = absent.doi:10.1371/journal.pone.0051404.t002

Figure 2. Effect of differentiation on SMAD3 and pSMAD3protein expression in NHU cells. (a) Protein lysates were preparedfrom NHU cells treated with 0.1% DMSO (control), TZ/PD or ABS/Ca2+

for 1, 3 and 6 days. Cell extracts (25 mg) were resolved on 4–12% Bis-Trispolyacrylamide gels and transferred onto PDVF membranes. Mem-branes were incubated with titrated primary antibodies for 16 h at 4uCto SMAD3 and pSMAD3, as indicated. Bound antibody was detectedwith Alexa FluorH 680 and LI-COR IRDyeTM 800 conjugated secondaryantibodies and visualised using the OdysseyTM Imaging System. b-actinwas used as an internal loading control. HeLa cells treated with TGFb1(2 ng/ml) for 24 h was used as a positive control. L is the molecular sizeladder. (b) NHU cells were seeded at 500 cells/cm2 onto glass slides,allowed to adhere and treated with or without TZ/PD or ABS/Ca2+ for 6days and fixed in formalin. Media were replaced every 3 days with freshtreatments. Indirect immunofluorescence was performed with anti-SMAD3 and anti-pSMAD 3 antibodies as indicated and detected withAlexa 594-conjugated secondary antibodies. Picture inserts show therespective Hoescht 33258 nuclear stain. Scale bar 90 mm.doi:10.1371/journal.pone.0051404.g002

TGFbR Pathway Reprogramming during Differentiation

PLOS ONE | www.plosone.org 5 December 2012 | Volume 7 | Issue 12 | e51404

Differentiation-associated changes in the TGFb pathwayPathway analysis with Ingenuity software was used to infer (at

the transcript level) which components of the TGFbR pathway

components were expressed and/or modified by differentiation.

Present in both proliferative and differentiated cultures were

expressed all the necessary pathway components for the canonical

TGFbR/Activin/SMAD pathway, whereas components of the

BMP/Nodal-related SMAD signalling pathway were either absent

or showed no change in expression following differentiation

(Table 2; a full profile of TGFb type I and II receptor expression is

shown in Supplementary Table S2).

Figure 3. Influence of TGFb and TGFb inhibitors on morphology and proliferation of NHU cell cultures. (a) Phase-contrast micrographsof NHU cell cultures at confluence following growth for 6 days in the presence of 0.1% DMSO, TGFb1 (2 ng/ml) or SB431542 (3 mM). Scale bar:250 mm. (b) MTT assay showing dose-response curves of viable biomass from non-differentiated (proliferative) NHU cells treated for 4 days withTGFb1 and TGFb2. Bars represent mean 6 SD of six replicates. (c) NHU cells were treated with the inhibitors SB431542 (10 mM) or PD153035 (1 mM) inthe presence or absence of TGFb1 (2 ng/ml) for 4 days and viable biomass was assessed by MTT assay. Bars represent means 6 SD of six replicatewells. Statistical analysis was by means of a 2-tailed t-test, *** = p,0.0001. (d) NHU cells from three independent cell lines (A, B, C) were cultured inthe presence or absence of SB431542 (3 mM) for 4 days before growth was assessed by MTT assay. Bars represent means 6 SD of six replicate wells.doi:10.1371/journal.pone.0051404.g003

TGFbR Pathway Reprogramming during Differentiation

PLOS ONE | www.plosone.org 6 December 2012 | Volume 7 | Issue 12 | e51404

TGFbR Pathway Reprogramming during Differentiation

PLOS ONE | www.plosone.org 7 December 2012 | Volume 7 | Issue 12 | e51404

From the arrays, SMAD3 was up-regulated .3-fold in ABS/

Ca2+ and .5-fold in TZ/PD differentiated cell cultures. Although

there was no change in SMAD2 transcript expression, there was a

decrease in SMURF2, a SMAD ubiquitination regulatory factor

responsible for targeting SMAD2 for degradation. There was

downregulation of transcripts for inhibitory SMAD7 and for

TGFb-RI and TGFb-RII. These trends were confirmed by

comparative RTqPCR on samples generated from an independent

cell line at 72 hours post induction of differentiation (Fig. 1F).

To determine whether changes in SMAD3 transcript translated

to changes in protein expression, differentiating NHU cell cultures

were analysed by immunoblotting (Fig. 2A). Total SMAD3 protein

was increased following both differentiation treatments. The

relative amount of phosphorylated SMAD3 (pSMAD3) decreased

in control cells from days 1–6 as cells reached confluence.

Differentiated cells expressed very low amounts of pSMAD3

indicating that although basal SMAD3 expression increased,

actual activity based on phosphorylation decreased, possibly as a

reflection of other changes to the pathway (Table 2). These

findings were confirmed by immunofluorescence (Fig. 2B):

SMAD3 immunolabelling was most intense in differentiated cells,

but pSMAD3 labelling was low or absent in the majority of cells in

all culture conditions, with intense nuclear labelling observed in

occasional cells only.

Effect of TGFb on NHU cell morphology and growthNeither exogenous TGFb ligands, nor specific inhibition of

TGFbRI tyrosine kinase with SB431542 had any effect on the

morphology of NHU cells in culture (Fig. 3A).

MTT biomass assays performed over 6 days showed that

TGFb1 and TGFb2 both induced dose-dependent growth

inhibition of non-differentiated (proliferative) NHU cells, with

IC50 values calculated as 0.2–0.4 ng/ml for TGFb1 and 0.3–

0.5 ng/ml for TGFb2, respectively (Fig. 3B). Subsequent exper-

iments were performed with 2 ng/ml TGFb1, representing .80%

(EC80) of the maximal response, which was equivalent to the

inhibition induced by 1 mM PD153035, an EGFR-specific tyrosine

kinase inhibitor included as positive control (Fig. 3C). 1–10 mM

SB431542 abrogated the growth inhibitory action of TGFb1 and,

when used in the absence of exogenous TGFb1, had a small but

reproducible positive effect on culture biomass (Fig. 3D).

SMAD3 was phosphorylated in NHU cells stimulated with

TGFb1 for 24 hours (Fig. 4). SB431542 inhibited TGFb1-induced

SMAD3 phosphorylation and abrogated the small basal expres-

sion of pSMAD3 seen in control cultures without exogenous

TGFb, indicating autocrine activity (Fig. 4), as the growth medium

supplements contained minimal TGFb activity and did not

account for the baseline activity (Fig. S1). Modulation of TGFbsignalling with exogenous TGFb ligand or SB431542 had small

reciprocal effects on ERK and AKT signalling (Fig. 4). Inhibition

of EGFR activity with PD153035 had little direct effect on

SMAD3 activation, but enhanced the effect of TGFb on pSMAD3

by .50%. This suggested cross-talk between the EGFR/TGFbR

pathways, but the consequence of this for cell phenotype was not

assessed in this study.

Effect of TGFb1 on NHU cytodifferentiationThe changes observed in TGFb-associated transcript and

protein expression suggested that modulation of TGFb/activin

signalling was involved in the differentiation of human urothelial

cells. To test this hypothesis, the effect of exogenous TGFb1 was

assessed on expression of UPK2 transcript by quantitative RT-

PCR (Fig. 5A). As a positive control, NHU cultures were induced

to differentiate using the TZ/PD and ABS/Ca2+ protocols.

TGFb1 alone or in combination with PD153035 or TZ did not

induce UPK2 expression, showing that TGFb1 alone does not

induce or promote differentiation in NHU cell cultures. Inclusion

of TGFb1 into the TZ/PD protocol actually reduced expression of

UPK2 transcript, implying an inhibitory effect on differentiation

by that exogenous TGFb1 (Fig. 5A). Inclusion of SB431542 to

inhibit TGFb signalling did not significantly affect UPK2

transcript expression (not shown).

Transepithelial electrical resistance can be used as a functional

measure of urothelial differentiation and barrier formation. NHU

cell cultures grown in standard growth conditions in KFSMc

medium did not develop a tight barrier, with TER measurements

of ,100 V.cm2, irrespective of whether or not they were cultured

with 2 ng/ml TGFb1 or 3 mM SB431542. The presence of

exogenous TGFb1 or SB431542 during NHU differentiation

induced by the ABS/Ca2+ protocol did not significantly affect

barrier function, with TER values in the region of 2640–

3050 V.cm2 (Fig. 5B).

Effect of TGFb1 on urothelial scratch-wound repairTo investigate whether TGFb1 signalling had a specific role in

regenerative repair, confluent, contact-inhibited cultures of non-

differentiated and ABS/Ca2+ differentiated NHU cells were

scratch-wounded in the presence of 2 ng/ml TGFb1 and/or

3 mM SB431542 or 1 mM PD153035, and the repair was

monitored by time-lapse microscopy. In non-differentiated

cultures, 500 mm scratch wounds repaired within 6 hours in both

control and SB431542-treated cells, but repair was retarded by

exogenous TGFb1, or by inhibiting EGFR with PD153035

(Figs. 5C and 5E).

By contrast, in differentiated NHU cell cultures (Fig. 5D), the

repair of 500 mm scratch wounds was accelerated when exogenous

TGFb1 was present and was blocked back to control values by

SB431542. Repair was inhibited by PD153035 or by SB431542

alone. Measurement of the time taken to achieve full repair

showed that TGFb-treated and control cultures had healed by 10

and 14 hours, respectively, whereas wounds treated with

SB431542 or PD153035 did not heal over the time course of

the experiment (Fig. 5F). In the presence of exogenous TGFb1, the

repaired region appeared as a pronounced ‘‘scar’’ (Fig. 5G). By

contrast, SB431542 or PD153035 compromised the quality of the

final repair, resulting in persistent unhealed patches along the

wound (Fig. 5G). Combined treatment with PD153035 and

SB431542 did not have an additive effect on wound repair,

suggesting they act through a common pathway (not shown).

pSMAD3 immunolabelling was investigated in ABS/Ca2+-

differentiated cultures following scratch-wounding in the presence

of 2 ng/ml TGFb1, 3 mM SB431542 or 1 mM PD153035 (Fig. 6).

In control cultures, pSMAD3 was only detected in a few cells

Figure 4. Immunoblot analysis of NHU cell response to TGFb signalling. (a) Sub-confluent NHU cells were treated with or without PD153035(1 mM), TGFb (2 ng/ml) or SB431542 (3 mM) for 24 h before preparation of cell lysates. Cell extracts (15 mg) were analysed by Western blot analysis asdescribed in Materials and Methods. b-actin was used as an internal loading control. (b) Gel band densities of the Western blots in (E) using the LI-COR OdysseyTM Imaging System and normalised to b-actin to show the changes in phosphorylated protein. The ratio of phosphorylated:total proteinin the control was taken as 1.0, as indicated by the dashed line.doi:10.1371/journal.pone.0051404.g004

TGFbR Pathway Reprogramming during Differentiation

PLOS ONE | www.plosone.org 8 December 2012 | Volume 7 | Issue 12 | e51404

TGFbR Pathway Reprogramming during Differentiation

PLOS ONE | www.plosone.org 9 December 2012 | Volume 7 | Issue 12 | e51404

immediately along the wound edge and a few cells back. This was

weaker in intensity, but similar in distribution to the pattern of

pSMAD3 labelling observed in TGFb1-treated cultures, where

intense nuclear labelling was present in the 5–10 cells adjacent to

the wound edge (Fig. 6). Cultures treated with either SB431542 or

PD153035 showed limited pSMAD3 labelling along the wound

edge, but this was very much reduced relative to controls.

A very few cells surrounding the wound edge were in the mitotic

cycle in control and TGFb1-treated cultures, as judged by Ki67

immunofluorescence. There was no evidence of Ki67 labelling in

cultures treated with SB431542. This suggests that migration

rather than proliferation was the predominant event contributing

to closure of the scratch wound (Fig. 6).

Discussion

TGFb is a pleiotropic cytokine implicated in tissue develop-

ment, repair, remodelling and pathogenesis. The diversity of its

effects is presumed to be dependent on both the target cell type

and signalling context, including ligand sequestration and the

modulation of ligand release. Interpretation of TGFb signalling is

further complicated by biphasic effects, where responses induced

at low concentrations are different or absent at higher concentra-

tions of agonist, or which, in combination with a second stimulus,

can invoke different responses [20]. Thus, dissection of the precise

relationship between TGFb signalling and cell/tissue response is,

by its very nature, confounded by the complexity of the biological

system studied. This study of a normal human in vitro system that

represents both regenerative and differentiated states has provided

novel insights. We have shown that TGFb signalling is

fundamentally different in proliferating and differentiated urothe-

lial cell cultures, respectively, both in terms of the nature of the

activating signal (paracrine versus autocrine) and the output

response (growth inhibition versus wound-healing). The findings

revealed that urothelial cytodifferentiation induces major changes

in the functional programming of the canonical pathway and this

itself has important implications for pathway modulation in

pathological states. Critically, our study demonstrates that this

pathway reprogramming is secondary to the differentiation process

itself, but contributes to a fundamental property of the mature

tissue in its potential for self-regeneration.

It is axiomatic that the activity of a signal transduction pathway

is modulated through activation/inhibition of the components

rather than direct changes in their expression. However, our

transcriptome and ontology analysis revealed that the TGFb/

TGFbR/Activin/SMAD signalling pathway is a major target for

transcriptional reprogramming during urothelial differentiation.

Confidence that this is a fundamental, differentiation-associated

change is supported by the observation that two independent

differentiation-inducing protocols – one initiating the terminal

differentiation transcriptional programme in individual cells and

the other enabling differentiated tissue development - both

induced common changes in the TGFbR signal transduction

pathway. This was a wholly unexpected observation and suggests a

paradigm shift in pathway function. Whereas there was reduced

expression of the two TGFb receptors in differentiated cells, this

was countered by an upregulation of both SMAD3 effector and

SMURF2, a SMAD ubiquitination regulatory factor responsible

for targeting SMAD2 for degradation. In addition, there was

downregulation of SMAD7, which negatively regulates TGFbRI

Figure 5. Effects of TGFb on differentiation, barrier function and scratch wound repair in NHU cell cultures. (a) NHU cells weredifferentiated with or without TZ/PD or ABS/Ca2+ in the presence or absence of TGFb; UPK2 expression was assessed by RTqPCR after 4 days andnormalised against GAPDH. Controls included SB431542, vehicle (0.1% DMSO), PD153035 and TZ alone. Bars represent means 6 SD of triplicate PCRdeterminations. (b) Barrier function was assessed by TER measurement after 7 days culture of NHU cells seeded at 0.56106 cells/cm2 onto SnapWellTM

membranes and treated with or without ABS/Ca2+ in the presence of DMSO (0.1%), TGFb1 (2 ng/ml) or SB431542 (3 mM). Bars represent mean 6 SDof 3 independent replicate cultures. (c–g) After 7 days pre-culture with or without ABS/Ca2+ to induce differentiation, confluent cultures wereincubated with DMSO (0.1%, vehicle control), TGFb1 (2 ng/ml), SB431542 (10 mM) or PD153035 (1 mM) for 3 h and then scratch-wounded. Cultureswere maintained in respective treatments in an environmental chamber and images were taken every 10 minutes by time-lapse microscopy until thewounds healed. The experiment was repeated on 3 independent NHU cell lines with the same results. Differential interference contrast micrographsare shown for (c) non-differentiated (6 h) and (d) differentiated cultures (8 h) post-wounding; scale bar 500 mm. The time-course of wound repair wasquantified from timelapse micrographs at 2 hour intervals and expressed against the original wound as the percentage healed for confluent (e) non-differentiated and (f) differentiated cultures. Points represent means of triplicate cultures 6 SD. Phase contrast micrographs (g) of repaired scratchwounds in differentiated NHU cell cultures after 16 h in the presence of DMSO (0.1%), TGFb1 (2 ng/ml), PD153035 (1 mM) or SB431542 (3 mM). Scalebar: 500 mm.doi:10.1371/journal.pone.0051404.g005

Figure 6. Localisation of phospho-SMAD3 in scratch-woundeddifferentiated NHU cell cultures. NHU cells were induced todifferentiate by 7 day culture with ABS/Ca2+ prior to treatment withDMSO (0.1%, vehicle control), TGFb1 (2 ng/ml), SB431542 (3 mM) orPD153035 (1 mM) for 3 hours and then scratched. Cells were maintainedin treatments for 8 hours post-wounding and formalin fixed beforeimmunofluorescence labelling as described in the Materials andMethods. Picture inserts or merged images show the respectiveHoechst 33258 nuclear stain. Yellow lines indicate wound margins.Scale bar: 100 mm.doi:10.1371/journal.pone.0051404.g006

TGFbR Pathway Reprogramming during Differentiation

PLOS ONE | www.plosone.org 10 December 2012 | Volume 7 | Issue 12 | e51404

through interactions with SMURF2. The reduced receptor

expression in association with an upregulation of effector and

downregulation of inhibitory components of the pathway indicates

a shift in the threshold for pathway activation and the potential for

a more vigorous response once activation has been triggered.

TGFb has long been associated with growth regulation and

differentiation during tissue development and repair, and in some

systems, it has been reported that TGFb induced differentiation as

a corollary of its growth inhibitory effects [21,22]. However, far

from inducing differentiation, we found that exogenous TGFb had

an inhibitory effect. A role for TGFb signalling in urothelial

cytodifferentiation has been previously suggested [23,24] and these

reports are consistent with our interpretation of this study –

namely that the TGFb signalling machinery is altered as a

consequence, rather than function of urothelial differentiation.

Because TGFbR signalling had no apparent role in the

differentiation process itself, we examined its contribution to

wound repair in differentiated urothelial cell sheets. These

experiments revealed that repair was inhibited by the blocking

of TGFbR-specific tyrosine kinase in absence of exogenous TGFband also that exogenous TGFb induced hypertrophic scarring.

The former observation is indicative of autocrine TGFbR

signalling, which is further supported by the immunolocalisation

evidence showing pSMAD3 activation in proximity to the wound

edge. Thus, the machinery for autocrine activation of the

SMAD3-mediated TGFbR pathway is established during differ-

entiation, but activation occurs only in response to a trigger, such

as wounding.

The urothelium functions as a urinary barrier, for which the

ability to repair (proliferation) and to provide a physical barrier

(differentiation) are both critical but conflicting attributes. In its

normal state, human urothelium is mitotically-quiescent, but

individual cells retain a high proliferative capacity. Whereas there

is evidence, particularly in the mouse, that paracrine signalling

from other tissue compartments such as the stroma may play a role

in driving urothelial repair [4], there is also evidence, shown here

and elsewhere [5] that at least in man, the urothelium functions

autonomously through autocrine signalling to regulate self-repair.

A pre-requisite for epithelial tissue wound repair is the release of

cells from the epithelial community to assume a migratory,

‘‘wound-healing’’ phenotype. This is achieved by dissolution of

tight junctions which, with ERK-mediated dissolution of adherens

junctions [25] is part of the EMT phenomenon mediated by

TGFb. In non-differentiated NHU cell culture, the Ca2+

concentration (0.09 mM) is below the threshold required for E-

cadherin homodimerisation, which constrains the formation of

adherens and tight junctions. Thus, NHU cells assume an EMT-

like phenotype, as evidenced by migratory behaviour, deposition

of fibronectin and expression of the cognate a5b1 integrin

receptor [26]. In such conditions, proliferating NHU cells

responded to exogenous TGFb by growth arrest and by inhibition

of migration in scratch wound repair. This cytostatic response is in

keeping with the recognised role of TGFb as a tumour suppressor

that promotes G1-cell cycle arrest through induction of the cyclin-

dependent kinase inhibitors [27,28].

Thus we provide a unifying hypothesis to explain the apparent

paradoxical effects of TGFbR signalling on epithelial repair and

differentiation in which the hardware and circuitry for autocrine

activation of the SMAD3-mediated TGFbR pathway is estab-

lished during differentiation, but activation occurs only in response

to a trigger, such as wounding.

Supporting Information

Figure S1 Influence of medium supplements on thebasal phosphorylation of SMAD3 in NHU cell cultures.NHU cells were grown in KSFMc or KSFM with no supplements,

with BPE alone (60 mg/ml) or EGF alone (6 mg/ml), all in the

presence or absence of SB431542 (3 mM). KSFMc with TGF-b1

(2 ng/ml) was used as a positive control for pSMAD3 activation.

Cell lysates (25 mg) were assessed by Western blot analysis as

described in the Materials and Methods. b-actin was used as an

internal loading control. Similar results were found with HeLa

cells (not shown).

(DOCX)

Table S1 Verification that differentiated NHU cellcultures used for Affymetrix arrays expressed estab-lished urothelial differentiation-associated genes. Anal-

ysis of marker gene expression from arrays performed at 144 h

post induction of differentiation by ABS/Ca2+ and TZ/PD

protocols compared to the autologous 24 h non-differentiated

control culture. Results expressed as log2 fold change. A minus

denotes a reduction in expression. The panel of marker genes

assessed were: PLK1. Cell cycle/proliferation marker. Cytoker-atins. Whereas KRT7 is expressed by all urothelial layers in situ

and showed no change following differentiation; KRT13, a

marker of transitional differentiation was upregulated and the

KRT14 squamous differentiation marker was downregulated [14].

Uroplakins. Urothelial differentiation was accompanied by

expression of uroplakin genes, which in human are restricted to

the terminally-differentiated superficial urothelial cells [2,13].

Claudins. Changes in tight junction composition accompany

urothelial differentiation, including expression of claudin 4 [12].

(DOC)

Table S2 Expression of TGFb ligands and probes takenfrom analysis of gene chip data. P = present; A = absent

(DOC)

Acknowledgments

The authors thank clinical colleagues for supplying urothelial tissues. R

Duke and J Hinley are thanked for excellent technical support.

Author Contributions

Conceived and designed the experiments: JMF CLV AW JH JS.

Performed the experiments: JMF SS CLV LAK. Analyzed the data:

JMF SS CLV LAK LKT JS. Wrote the paper: JMF CLV LKT JS.

References

1. Hicks RM (1975) The mammalian urinary bladder: an accommodating organ.

Biol Rev Camb Philos Soc 50: 215–246.

2. Olsburgh J, Harnden P, Weeks R, Smith B, Joyce A, et al. (2003) Uroplakin gene

expression in normal human tissues and locally advanced bladder cancer.

J Pathol 199: 41–49.

3. Sun TT, Liang FX, Wu XR (1999) Uroplakins as markers of urothelial

differentiation. Adv Exp Med Biol 462: 7–18; discussion 103–114.

4. Shin K, Lee J, Guo N, Kim J, Lim A, et al. (2011) Hedgehog/Wnt feedback

supports regenerative proliferation of epithelial stem cells in bladder. Nature

472: 110–114.

5. Varley C, Hill G, Pellegrin S, Shaw NJ, Selby PJ, et al. (2005) Autocrine

regulation of human urothelial cell proliferation and migration during

regenerative responses in vitro. Exp Cell Res 306: 216–229.

TGFbR Pathway Reprogramming during Differentiation

PLOS ONE | www.plosone.org 11 December 2012 | Volume 7 | Issue 12 | e51404

6. Heldin CH, Landstrom M, Moustakas A (2009) Mechanism of TGF-beta

signaling to growth arrest, apoptosis, and epithelial-mesenchymal transition.

Curr Opin Cell Biol 21: 166–176.

7. Zi Z, Chapnick DA, Liu X (2012) Dynamics of TGF-beta/Smad signaling.

FEBS Lett 586: 1921–1928.

8. Sillett HK, Cruickshank SM, Southgate J, Trejdosiewicz LK (2001) Transform-

ing growth factor-beta promotes ‘death by neglect’ in post-activated human T

cells. Immunology 102: 310–316.

9. Caja L, Kahata K, Moustakas A (2012) Context-dependent action of

transforming growth factor beta family members on normal and cancer stem

cells. Curr Pharm Des.

10. Lobban ED, Smith BA, Hall GD, Harnden P, Roberts P, et al. (1998) Uroplakin

gene expression by normal and neoplastic human urothelium. Am J Pathol 153:

1957–1967.

11. Cross WR, Eardley I, Leese HJ, Southgate J (2005) A biomimetic tissue from

cultured normal human urothelial cells: analysis of physiological function.

Am J Physiol Renal Physiol 289: F459–468.

12. Varley CL, Garthwaite MA, Cross W, Hinley J, Trejdosiewicz LK, et al. (2006)

PPARgamma-regulated tight junction development during human urothelial

cytodifferentiation. J Cell Physiol 208: 407–417.

13. Varley CL, Stahlschmidt J, Lee WC, Holder J, Diggle C, et al. (2004a) Role of

PPARgamma and EGFR signalling in the urothelial terminal differentiation

programme. J Cell Sci 117: 2029–2036.

14. Varley CL, Stahlschmidt J, Smith B, Stower M, Southgate J (2004b) Activation

of peroxisome proliferator-activated receptor-gamma reverses squamous meta-

plasia and induces transitional differentiation in normal human urothelial cells.

Am J Pathol 164: 1789–1798.

15. Southgate J, Hutton KA, Thomas DF, Trejdosiewicz LK (1994) Normal human

urothelial cells in vitro: proliferation and induction of stratification. Lab Invest

71: 583–594.

16. Southgate J, Masters JR, Trejdosiewicz LK (2002) Culture of Human

Urothelium. In: Freshney RI, Freshney MG, editors. Culture of Epithelial

Cells. 2nd edition ed. New York: J Wiley and Sons, Inc. pp. 381–400.

17. Zhang J, Ramesh N, Chen Y, Li Y, Dilley J, et al. (2002) Identification of human

uroplakin II promoter and its use in the construction of CG8840, a urothelium-specific adenovirus variant that eliminates established bladder tumors in

combination with docetaxel. Cancer Res 62: 3743–3750.

18. Walker DC, Hill G, Wood SM, Smallwood RH, Southgate J (2004) Agent-basedcomputational modeling of wounded epithelial cell monolayers. IEEE Trans

Nanobioscience 3: 153–163.19. Southgate J, Varley CL, Garthwaite MA, Hinley J, Marsh F, et al. (2007)

Differentiation potential of urothelium from patients with benign bladder

dysfunction. BJU Int 99: 1506–1516.20. Shinar DM, Rodan GA (1990) Biphasic effects of transforming growth factor-

beta on the production of osteoclast-like cells in mouse bone marrow cultures:the role of prostaglandins in the generation of these cells. Endocrinology 126:

3153–3158.21. Bombara C, Ignotz RA (1992) TGF-beta inhibits proliferation of and promotes

differentiation of human promonocytic leukemia cells. J Cell Physiol 153: 30–37.

22. Massague J (1998) TGF-beta signal transduction. Annu Rev Biochem 67: 753–791.

23. de Boer WI, Rebel JM, Vermey M, de Jong AA, van der Kwast TH (1994)Characterization of distinct functions for growth factors in murine transitional

epithelial cells in primary organotypic culture. Exp Cell Res 214: 510–518.

24. Booth C, Harnden P, Selby PJ, Southgate J (2002) Towards defining roles andrelationships for tenascin-C and TGFbeta-1 in the normal and neoplastic

urinary bladder. J Pathol 198: 359–368.25. Zavadil J, Bottinger EP (2005) TGF-beta and epithelial-to-mesenchymal

transitions. Oncogene 24: 5764–5774.26. Southgate J, Kennedy W, Hutton KA, Trejdosiewicz LK (1995) Expression and

in vitro regulation of integrins by normal human urothelial cells. Cell Adhes

Commun 3: 231–242.27. Hannon GJ, Beach D (1994) p15INK4B is a potential effector of TGF-beta-

induced cell cycle arrest. Nature 371: 257–261.28. Herrera RE, Makela TP, Weinberg RA (1996) TGF beta-induced growth

inhibition in primary fibroblasts requires the retinoblastoma protein. Mol Biol

Cell 7: 1335–1342.

TGFbR Pathway Reprogramming during Differentiation

PLOS ONE | www.plosone.org 12 December 2012 | Volume 7 | Issue 12 | e51404