1997;57:4600-4607. Published online October 1, 1997.Cancer Res Christophe Badie, Michele Goodhardt, Alastair Waugh, et al. New Mutant Phenotype(180BR) Derived from a Radiosensitive Patient Represents a A DNA Double-Strand Break Defective Fibroblast Cell Line  

  

Updated Version http://cancerres.aacrjournals.org/content/57/20/4600

Access the most recent version of this article at:

  

Citing Articles http://cancerres.aacrjournals.org/content/57/20/4600#related-urls

This article has been cited by 13 HighWire-hosted articles. Access the articles at:

  

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

SubscriptionsReprints and

.pubs@aacr.orgDepartment atTo order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions.permissions@aacr.orgDepartment at

To request permission to re-use all or part of this article, contact the AACR Publications

American Association for Cancer Research Copyright © 1997 on July 15, 2011cancerres.aacrjournals.orgDownloaded from

[CANCER RESEARCH 57. 4600-4607. October 15, 1997]

A DNA Double-Strand Break Defective Fibroblast Cell Line (180BR) Derived froma Radiosensitive Patient Represents a New Mutant Phenotype1

Christophe Badie, Michele Goodhardt, Alastair Waugh, NoëlleDoyen, Nicolas Foray, Patrick Calsou,Belinda Singleton, David Gell, Bernard Salles, Penny Jeggo, Colin F. Arlett, and Edmond-Philippe Malaise2

Laboratoire de Radiobiologie Cellulaire, Centre Natiiimil tie la Recherche Scientifique, UnitéJe Recherche Associée1967, InstituíGustave-Roiissy. 94X05 Villejuif Cedex. France1C, B., N. F.. E-P. M.¡:Unitéde Génétiaiteel Biochimie dit Développement. Départementd'Immitnolttgie. InstituíPasteur. 75724 Paris Cedex 15. France (M. G.. N. D.¡:Medical

Research Council. Cell Mutation Unii, Sussex University. Faliner. Brighton BNÌ9RR. UnìlettKingdom ¡A.W.. B. S.. P. J., C. F. A.¡:Laboratoire de Pharmacologie et ToxicologieFondamentales. Centre National de la Recherche Scientifique UnitéPropre tie Recherche R221. 31077 Toulouse Cedex. France ¡P.C.. B. S.]: and Wellcome Cancer ResearchCampaign Institute and Department of Zoologv, Cambridge University. Cambridge, CB2 1QR. United Kingdom ID. G.I

ABSTRACT

I In 1KOBRcell line was derived from an acute Ivmphohlastic leukemiapatient »hooverresponded to radiation therapy and died following radiation morbidity. ISill! U cells are hypersensitive to the lethal effects ofionizing radiation and are defective in the repair of DNA double-strandbreaks (DSBs). The levels and activity of the proteins of the DNA-depend-

ent protein kinase complex are normal in IXOBR cells. To facilitate ameasurement of Ml)).| recombination, we have characterized ISOI'.KM. a

SV40-transformed line derived from ISOIiK. ISilliKM retains the radio-

sensitivity and defect in DSU repair characteristic of ISill!U. The activitiesassociated with DNA-dependent protein kinase are also normal in

1SOKKM cells. The ability to carry out V(D)J recombination is comparable in I80BKM and a reference control transformed human cell line.MRC5V1. These results show that I80BK and ISIHSKM differ from therodent mutants belonging to ionizing radiation complementation groups4, 5, 6, and 7 and, therefore, represent a new mutant phenotype, in whicha delect in DNA DSB rejoining is not associated with defective V(D)Jrecombination. Furthermore, we have shown that ISOUKcan arrest at theG,-S and (..-M cell cycle checkpoints after irradiation. These results

confirm that 1SOBR can be distinguished from ataxia telangiectasia.

INTRODUCTION

Several radiosensitive cell lines have been derived from cancerpatients who have responded severely to radiotherapy ( 1). Many ofthese cell lines display only modest radiosensitivity, but the cell line180BR is unusual in being extremely hypersensitive (2). 180BR wasderived from a normal skin explant from a 14-year-old patient suf

fering from acute lymphoblastic leukemia. The patient dramaticallyoverresponded to radiation therapy and, subsequently, died as a resultof severe radiation morbidity. He showed no clinical symptoms ofeither AT3 or Nijmegen breakage syndrome and. indeed, was clini

cally normal until the onset of leukemia. The fibroblasts derived fromthis patient are as sensitive to ionizing radiation as those from ATpatients in both growth and plateau phase (2, 3). They are alsohypersensitive after low-dose rate irradiation (4). Unlike AT cells,

which display radioresistant DNA synthesis (5, 6), 180BR cells showa normal level of radiation-induced inhibition of DNA synthesis (2).

Furthermore, in contrast to AT cells. I80BR cells exhibit a major

Received 3/10/97; accepled 8/14/97.The costs of publication of this article were defrayed in part by the payment of page

charges. This article musi therefore be hereby marked advertisement in accordance with18 U.S.C. Section 1734 solely to indicate Ihis fact.

' Work in the laboratory of E-P. M. was supported by the Comitéde Radíoprolection-

Electricitéde France. Work in the Cell Mutation Unit. Sussex University. Palmer.Brighton was supported by a grant from the Kay Kendall Leukaemia Fund and EuropeanUnion Grani FI 3PCT92(XX)7 under the Nuclear Fission Safety Program. D. G. was fundedby Cancer Research Campaign Grant SP2I4.V0102.

•¿�To whom requests for reprints should he addressed, at Laboratoire de Radiobiologie

Cellulaire. PR I. Centre National de la Recherche Scientifique. Unitéde RechercheAssociée1967. Institut Gustave-Roussy. 94805 Villejuif Cedex. France. Phone: (01)42-11-44-98; Fax: (01)42-11-52-36: E-mail: radiobio@igr.fr.

1The abbreviations used are: AT. ataxia telangiectasia: DSB. double-strand break;

DNA-PK. DNA-dependent protein kinase complex; DNA-PKcs. DNA-PK catalytic sub-unit: SCID. severe combined immunodeficiency: FACS. fluorescence-activated cell sorting: BrdUrd. 5-bromo-2'-deoxyuridine: ES. embryonic stem.

defect in their ability to repair DNA DSBs (3). They also display anelevated frequency of radiation-induced chromosome breaks and

chromosomal aberrations (translocations and dicentrics) compared tonormal cell lines (7. 8). 180BR. therefore, represents the first characterized radiosensitive human fibroblast cell line with a major defect inits ability to repair DNA DSBs. Another human cell line. MO59J.derived from a malignant glioma, is similarly highly radiation sensitive and defective in DSB rejoining (9). M059J cells have been shownto lack expression of DNA-PKcs. a subunit of the DNA-PK. which is

known to play a major role in the repair of DNA DSBs in mammaliancells.

A range of radiosensitive rodent cell lines have been described andrepresent at least 11 complementation groups (10, 11). Mutants belonging to three of these groups (ionizing radiation groups 4. 5, and 7)are defective in DNA DSB rejoining. The genes defined by thesegroups (XRRC4, XRCC5, and XRCC7) and XRCC6 have recently beenidentified. XRCC4, which is defective in the hamster XR-1 cell line,

is of unknown function (12). XRCC5. XRCC6, and XRCC7 encodecomponents of the protein complex. DNA-PK. DNA-PK consists ofDNA-PKcs and a DNA-targeting component, Ku. Ku is a heterodimer

comprising two monomers, one of M, 70,000 and the other of M,86.000. Ku86 (Ku80; XRCC5) is defective in xrx-6. XR-V15B (Lilo), and .V.V/-3(17), and the repair defects of these rodent mutants can

be partially complemented by human Ku80 cDNA and fully complemented by hamster Ku80 cDNA. None of the rodent mutants isolatedon the basis of their radiosensitivity have been proven to be defectivein Ku70, but recently. ES cell lines that are defective in Ku70 havebeen derived and show radiosensitivity.4 DNA-PKcs is defective in

the hamster V-3 and the mouse seid cell lines (18-21). All these

rodent cell lines are unable to carry out effective V(D)J recombination, and seid and Ku80 knockout mice manifest a SCID phenotype(Ref. 22; for reviews see Refs. 23 and 24). These results show,therefore, that the DNA-PK complex plays a key role in the repair ofionizing radiation-induced DSBs, as well as DSBs arising during

V(D)J recombination. Wiler et al. (25) have also shown that a SCIDdefect in thoroughbred foals, which is associated with hypersensitiv ityto radiation as well as V(D)J recombination deficiency, results from adefect in DNA-PKcs. demonstrating that DNA-PK plays the same role

in other mammals.Here, we have further characterized 180BR cells for their ability to

carry out V(D)J recombination, for activities associated with DNA-

PK, and for their ability to arrest at cell cycle checkpoints. On thebasis of our results, 180BR is shown to differ from AT, from therodent mutants, and from the glioma cell line M059J. and. thus,represents a new class of DSB repair-defective mutant.

4 Y. Gu. S. Jin. Y. Gao, D. T. Weaver, and F. W. Alt. Ku-70 deficient ES cells have

increased ioni/ing radiosensitivity. defective DNA-end binding activity, and inability tosupport V(D)J recombination, submitted for publication.

4600

American Association for Cancer Research Copyright © 1997 on July 15, 2011cancerres.aacrjournals.orgDownloaded from

DNA REPAIR »KFI-CT IN A HYPERSENSITIVE MUTANT PHENOTYPE

MATERIALS AND METHODS

Cell Lines. I80BRM is a SV40-transformed cell line derived from 180BR

(kindly provided by Dr. Iliakis. Thomas Jefferson University. Philadelphia),which is not immortalized and slops growing after 20-25 passages. MRC5VIis a SV40-transformed and immortalized cell line derived from the normalhuman fibroblast cell line. MRC5 (26). IBR3 is a normal primary' human

fibroblast that was used as a control for the cell cycle studies. Cells werecultured in MEM supplemented with 15 or 20% PCS without antibiotics.

Irradiation and Cell Survival. Cells were irradiated with a "7Cs 7-raysource at a dose rale of 1.45 Gymin '. For pulsed-field gel electrophoresis

studies, the culture flasks were placed on ice for 30 min prior to irradiation, andthe cullure medium was kept cool (2°C)throughout the period of irradiation.

For cell survival, cells in exponentially growing phase were trypsini/.ed andirradiated 4 h after plating. Colonies were fixed and stained after 9-12 days ofincubation. The survival curves were fitted with the linear-quadratic model.

The parameters (mean inactivation dose) and the surviving fraction at 2 Gywere calculated and used to characterize the intrinsic radiosensitivity (27).

Measurement of DNA DSBs. The DNA DSB rejoining protocol is detailed elsewhere (7). Briefly, 2 X IO5 exponentially growing cells were grown

for 4 days in MEM plus 20% FCS before labeling and irradiation. The fractionof cells in S phase, which was routinely 30-50%. was measured by cytoflu-

orometry. Experiments measuring repair kinetics were fitted using the formuladescribed by Foray el al. (28).

Preparation of Cell Extracts. Cells were collected in midexponemialphase of growth. Nuclear extracts were prepared according to a publishedprotocol (29. 30), except that the final dialysis was performed for 3 h in anexcess volume of 50 mM Tris-HCI (pH 7.5). 10% glycerol. 100 mvt potassiumglutamate. I mM EDTA. and I mM DTT. Whole-cell extracts were prepared as

described previously (30). After preparation, all of the extracts were immediately frozen and stored at —¿�80°C.

DNA End Binding (Mobility-Shift (lei Electrophoresis Assay). These

assays were carried out in two laboratories using slightly different protocols.Assays using the transformed cells were carried out using a probe preparedfrom an aliquot of the 123-bp DNA ladder digested with Aval (both from LifeTechnologies, Inc.) to generate 123-bp monomers. These were separated byelectrophoresis in 1% agarose, recovered, and redissolved in 10 mM Tris-HCI(pH 7.5)-l m M EDTA. The 123-bp fragments were end-labeled with[a-12P]dCTP (NEN) using DNA polymerase I Klenow fragment (Life Tech

nologies. Inc.).The bandshift assay using transformed cell extracts was performed as

follows: 3 jug of nuclear protein extracts were incubated for 30 min at 30°C

with about 0.1 ng of probe (--50(10 cpm) and 1 (j,g of closed circular plasmid

DNA as a nonspecific competitor in 20 jul of 20 mM Hepes-KOH (pH 7.5). 0.2

mM EDTA, 1 mM EGTA. 100 mM NaCl. 7 nui MgCU I mM DTT. and 5%glycerol. The samples were then chilled on ice, and the products were separated by 5% nondenaturating PAGE.

Assays using (he primary lines were carried out using a -y-12P-labeled

double-stranded oligonucleolide MI/M2 (13. 31). Whole-cell extracts (5 fig)were incubated with the probe at r(X>mtemperature for 30 min. and DNA-

prolein complexes were resolved on 4% polyacrylamide gels containing 59rglycerol (13, 31). In these assays, nonspecific circular plasmid DNA was notused as a competitor.

In Vitro DNA-PK Assay. The DNA-PK activity of the primary and trans

formed cells was also analyzed in different laboratories. For both procedures,DNA-PK activity was analyzed by measuring the phosphorylation of a p53-derived peptide as described by Lees-Miller el al. (32), with modifications asfollows: 45 ¿¿gof nuclear protein extract were incubated for 15 min at 3()°Cwith 74 kBq of [•»'-"PJATP(222 TBq/mmol: NEN) and in 20 fi\ of 25 mM

Hepes-KOH (pH 7.9), 50 mM KC1. 10 mM MgCK. 1 m.MDTT, 0.1% NonidetP-40, and 20% glycerol. Reactions were conducted in the presence or absence

of 250 ng of sonicated calf thymus DNA and 5.6 nmol of peptide EP-

PLSQEAFADLWKK (Promega). as indicated. The products were separated on22%, SDS/polyacrylamide gel. electrophoresed in Tris, glycine, and SDSbuffer. The gel was then dried and autoradiographed. and the radioactivity inthe excised peptide bands was quantified by scintillation counting. For primarylines, the procedure was followed according to Anderson and Lees-Miller (33).

The reaction was similar to that described above, except that 30 jig ofwhole-cell extract was used. 0.2 mM cold ATP was added to the reaction, and

the peptide was slightly different (EPPLSQEAFADLLKK). The reaction wasterminated with an equal volume of 30% ace(ic acid and spotted onto WhatmanP81 phosphocellulose paper, washed in 15% acetic acid, and quantified byscintillation counting.

Western Blotting. Whole-cell extracts (2-15 mg as indicated) were boiledin SDS-PAGE loading buffer and separated by 6% (for DNA-PKcs analysis)or 8% (for Ku70 and Ku80 analyses) SDS-PAGE. Proteins were transferred tonitrocellulose using a wet-blotting apparatus and blocked from I h to overnightat 4°Cwith 2 or 5% skimmed milk solution and 0.05% Tween 20. The primary

Ku antibodies were Ku80-4 and Ku70-5, which were raised against baculovi-rus-expressed Ku80 and Ku70 proteins, respectively (Serotech. Oxford. UnitedKingdom). The DNA-PKcs antibody was FLA (34). Primary antibody (Ku8()-4or Ku7()-5) was diluted 1:5000 and 1:2500, respectively, in 2% milk solution;FLA (diluted 1:500 in 5% milk) was added for 1-2 h at room temperature,samples were washed extensively in milk solution, and antirabbit immuno-

globulin antibody (diluted 1:2500) was added for I h at room temperature. Thefilter was rewashed and developed using an ECL kit (Amersham).

V(D).| Recombination Assay. Plasmid pH2 Ree is an episomal recombination substrate similar to pBlueRec (35). which contains the SV40 viralorigin, conferring autonomous replication in human cells.5 Ragl (M2CD7.

designated here as pRagl) and Rag2 (R2RCD2. designated here as pRag2)expression vectors were provided by Dr. M. Oettinger (36).

I80BRM and MRC5V1 cells (5 X IO6) were transfected by electroporation

with 2.5 or 5 ng of pH2 Ree and a 5-fold molar excess of pRagl and pRag2

(37). After 48 h, cells were harvested, and plasmid DNA was prepared,digested with Dnp\. and used to transform Eschi'ricliiu etili XL1 blue bacteria

(Stratagene). as described by Kallenbach et al. (38). Rearrangement of therecombination substrate gives rise to blue colonies on Luria broth agar platescontaining 80 mg/ml 5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside. ISOmM isopropyl-1-thio-ß-n-galaclopyranoside. l(X) mg/ml ampicillin. and 10

nig/ml tetracycline. Plasmid DNAs were prepared and sequenced.FACS Analysis. Cells (1-1.2 X 10s) were seeded into duplicate flasks.

Three days later, they were labeled for 30 min with 10 5 M BrdUrd. washed

three times with fresh tissue culture medium, and irradiated or maintained ascontrols, for the times indicated. Each sample was harvested by trypsinizalionand centrifugation (5 min at 400 x #). and the pellet was resuspended in I mlof PBS-A and added dropwise to 8 ml of ice-cold 70% ethanol. Samples werestored at 4°Cprior to immunostaining. Immunostaining was carried out as

described by Begg el at. (39). Samples were analyzed using a Coulter EpicsElite. ESP How cytometer (Coulter Electronics Ltd., Luton, United Kingdom).For the analysis, a linear gate was draw n to include all cells within a cell cyclepropidium iodide fluorescence profile and then projected onto a scatter plot oflogarithmic FITC signal versus propidium iodide integral signal of fluorescence. Regions within the histogram were defined as: nonlaheled cells in G,.gated as A; nonlaheled cells in G2. gated as B: nonlabeled cells in S. gated asF; BrdUrd-labeled cells in G,, gated as D; and BrdUrd-labeled cells in S and

G2, gated as C.

RESULTS

Survival Curves. The radiosensitivities of the primary (1HOBR)and transformed cell line (1SOBRM) were compared with those of acontrol cell line MRC5 and its transformed counterpart. MRC5VI(Fig. 1). Both transformed cell lines were less radiosensitive than theuntransformed lines from which they were derived, but 180BRMremained hypersensitive (Fig. 1). The surviving fractions at 2 Gy forMRC5V1 and MRC5 were 52 and 43<7r,respectively, compared with

14 and 6% for 180BRM and 180BR. respectively. The ratio of themean inactivation dose (D), which quantifies the decrease of radio-

sensitivity associated with transformation, was slightly greaterfor I80BR |/j (I80BRM/I80BR) = 1.46) than it was for MRC5[D(MRC5VI/MRC5) = 1.22].

DSB Repair. Induction of the DSBs in the four cell lines was notsignificantly different (data not shown). However, the DSB rejoining

' J. C. Andrau, N. Doyen. C. Kallcnhach. A. Laquerhe. L. Smith. F. Rougeon. E.

Moustacchi. and I). Papadopoulo. Unusual recombinalional features in cells derived frompatients with Panconi anemia, submitted for publication.

4MII

American Association for Cancer Research Copyright © 1997 on July 15, 2011cancerres.aacrjournals.orgDownloaded from

DNA REPAIR DEFECT [N A HYPERSENSITIVE MUTANT PHENOTYPE

capacities of 180BR and 180BRM were similar and significantlyreduced compared to those of MRC5 and MRC5VI (Fig. 2). In aprevious publication (3) using two primary cell lines 180BR andHF19 (a control cell line) in G0 phase, we analyzed DSB rejoining atmultiple times after irradiation and showed that 180BR has a decreased rate and extent of DSB repair.

DNA End-binding Activity. Rodent mutants with defects in DSBrejoining have been shown previously to have mutations in components of DNA-PK (22. 23, 40). The DNA end-binding activity of Ku

was examined by the electrophoretic mobility shift assay using extracts of primary and transformed 180BR cells, 1BR3 cells, andMRC5VI cells, together with extracts of HeLa cells, rodent CHO-K1cells, and the mutant xrs-6, which is known to lack Ku protein. Bands

Bl and B2 corresponded to the Ku binding activity that is specific for

(0

0.001

DOSE (Gy)Fig. 1. Survival curves for MRC5VI. MRC5, 180BRM. and I80BR cells measured in

the exponential phase of growth. The lines shown are the best-fitting curves calculatedusing the linear-quadratic formula. Data points, means of three replicate experiments;

bars. SE.

100

LUOC

80

240 480 720 960 1200 1440REPAIR TIME (min)

Fig. 2. Repair of DSBs. The percentage of fraction of activity released (FAR) remaining as a function of postirradiation incubation time at 37°Cin exponentially growing

180BR. 180BRM, MRC5. and MRC5V1 cells exposed to 30 Gy. The results have beennormalized to the damage measured at / = 0. Data points, means of three replicale

experiments; bars, SE.

> sjS8 V

a 2u *

B2

B1 •¿�

F —¿�

Fig. 3. DNA end-binding activity in extracts from MRC5V1, 180BRM, IBR3. and180BR. A. experiments were carried out using nuclear extracts (3 |xg) incubated with[a-'-P]dCTP DNA probe (123 bp). B. experiments used »hole-cell extracts (5 ng)incubated with [y-<:iP]dATP-labeled M1/M2 probe. Other differences between the assaysused for the primary and transformed cell extracts are described in "Materials andMethods." F. position of the DNA probe: BI and B2, binding activity that is specific for

double-stranded DNA ends. Lane HeLa. control with HeLa cell extract; Lanes CHO-Kland xrs-6, controls of CHO-Kl and xrs-6 rodent cell line extracts, respectively.

double-stranded DNA ends because both bands were competed with

excess linearized plasmid DNA (data not shown) and were absentfrom extracts of xrs-6 cells. 180BR and 180BRM cells had end-

binding activity that was comparable to that of the control cell lines(Fig. 3).

DNA-PK Activity. The kinase activity of the DNA-PK complexwas analyzed in primary and transformed 180BR and control humanfibroblasts (Fig. 4/4). Background DNA-PK-independent kinase ac

tivity resulted in a low level of phosphorylation of the peptide in theabsence of DNA (Lanes 3 and 6). However, there were similar markedincreases in peptide labeling in both 180BRM and MRC5VI (Lanes 2and 5) and in 180BR and 1BR3 in the presence of linear DNA,indicating similar levels of DNA-PK activity. Quantification ofDNA-PK activity by scintillation counting of the excised gel slices,

corresponding to the peptide substrate, indicated a similar activity inextracts from both 180BRM and MRC5V1 transformed lines (Fig. 4B)as well as in extracts from both 1BR and 180BR untransformed cells(Fig. 4C). Differences in levels of incorporation that were observedbetween the primary and transformed lines are due to differences inthe protocols used to examine the pair of primary lines compared withthe pair of transformed lines.

Analysis of Protein Levels by Immunoblot Analysis. The expression of the components of DNA-PK (Ku70, Ku80, and DNA-

PKcs) was also examined by Western blotting using the primary celllines and antibodies cross-reacting with these proteins. Normal protein

expression was observed in every case (Fig. 5). Similar data have alsobeen obtained using the transformed cell lines (data not shown).

V(D)J Recombination. Because all mammalian cell lines withpronounced defects in DNA DSB rejoining described to date have aconcomitant defect in ability to carry out V(D)J recombination, weexamined whether 180BR had a similar defect. The above experiments confirm that 180BRM maintains the DSB rejoining defect and

4602

American Association for Cancer Research Copyright © 1997 on July 15, 2011cancerres.aacrjournals.orgDownloaded from

DNA RliPAIR DKI-HT IN A HYPKRSI-iNSlïlVI-: MITANT PHI-:NOTYPK

Peptide - + + - + +

DNA + +- + +-

Peptide —¿� •¿�

B

MRCSVI 1SOBRM

strates were completely intact with no observed deletions (data notshown). Introduction of RAG expression vectors into the I80BRMline resulted in V(D)J recombination at frequencies (mean, 0.7%)3-fold lower than that obtained for the control MRCSVI line (2.3%;

Table 1). Analysis of the structure of recombined pH2 Ree plusmidrecovered showed that the recombination junctions were essentiallynormal, in that recombination had occurred at the end of the recombination heptamer without major deletions (Fig. 6). We conclude thatthe frequency of V(D)J recombination in 180BRM cells is in the samerange as that of normal cells and that there is no change in the fidelityof the junctions formed. 180BRM. therefore, does not manifest themarked defect in V(D)J recombination that is characteristic of therodent mutants belonging to complementation groups 4, 5, and 7.

Analysis of the Ability of 1SOBR to Arrest at Cell Cycle Checkpoints. Sensitivity to ionizing radiation in AT cell lines is associatedwith inability to arrest at cell cycle checkpoints (7. 41-43). In contrast, the DNA-PK-defective hamster and ES cell lines, which more

closely resemble 180BR in the magnitude and kinetics of their defectin DSB rejoining, are able to effect cell arrest at cycle checkpoint (44,45). Therefore, to determine whether I80BR had associated cell cyclecheckpoint defects, we examined cell cycle progression by FACSanalysis of cells labeled with BrdUrd for 30 min immediately prior toirradiation and sampled at varying times postirradiation. The unla-

beled and labeled populations that represent cells predominantly inG/G, or S phase, respectively, at the time of irradiation are separatedon the X axis (sample profiles are shown in Fig. 7). The S-phase cells

represent a diffuse band of a size that is intermediate between those ofG, and G, cells. These cells will remain at that position on the X axis,and their progression through the cell cycle at times after irradiationcan be determined from their position on the Y axis.

To examine the integrity of the G,-S checkpoint, the movement of

1BR 180BR

I-

Fig. 4. A. in vitro DNA-PK activity assay. Nuclear extracts (45 ng) from 180BRM andMRC5VI cells were incubated with a p53-derivcd peptide in the presence of ly-12P)ATP.

and the amount of peptide phosphorylation was determined. Reactions were conducted ineither the absence I - ) or presence ( + ) of sonicated calf thymus DNA or peptide substrateas indicated. H. DNA-PK activity in nuclear extracts of MRC5V1 and 180BRM cells. Thepeptide was incubated with nuclear extract (45 /Ag) and (7-t2P]ATP. Peptide phospho

rylation was measured by liquid scintillation counting. Reactions were performed in boththe absence ( - ) and presence ( + ) of sonicated calf thymus DNA. The error bars indicatethe standard error ol the mean. C. whole-cell extracts (30 /j.g) from I80BR and IBR cellswere incubated with a wild-type p53-derivcd peptide (D), which is recognized byDNA-PK. and with a mutated peplide (•).which is not an effective DNA-PK substrate,in the presence of ly-'-PlATP and the level of peplide phosphorylalion determined as

described above. It should be noted that it is not valid to compare the levels of activity inthe extracts from transformed cells with those from the primary cells (i.e., B with C)because different peptides and assay conditions were used.

the radiosensitivity described for I80BR. Because 180BR cells havea low transfection frequency, 180BRM cells were therefore used tomeasure their capacity to carry out V(D)J recombination followingtransfection of the recombination activating genes, pRAGl andpRAGl. The transient V(D)J recombination substrate pH2 Ree wasused to analyze coding junction formation. In the absence of cotrans-

fected RAG expression vectors, no measurable V(D)J recombinationactivity was detected (Table 1), and recovered recombination sub-

Ku70

Ku80

DNA-PKcs

Fig. 5. Immunoblot analysis of extracts from 1BR3 and I80BR. Whole-cell extractsfrom IBR3 and 180BR ceils (2 mg for Ku80. 10 mg for Ku70. and 15 mg for DNA-PKcs)were examined hy Western blotting using antibodies Ku80-4, Ku7()-5, and FLA.

Table I Analvxis of coding joint formation in IHOBRM und MRC5VI b\ transientV(I))J recomhination assay

Amp1 colonies"

(no.)

Cellline180BRMMRC5VIDNApH2

ReepH2Ree. pRAGl.pRAG2pH2Ree. pRAG 1.pRAG2pH2Ree. pRAGl.pRAG2pH2Ree. pRAGl.pRAG2TotalpH2

ReepH2Ree, pRAGl.pRAG2pH2Ree. pRAGl.pRAG2pH2Ree. pRAGl.pRAG2pH2Ree. pRAGl.pRAG2TotalTotal10,0005.75472,3179.98517.203105.25950.00032.24095.415239.540200.722567.917Blue035176252025633238511.4231.7764,373«*(%)>0.011.80.70.80.30.7>0.0132.71.82.62.3

" Ampr, ampicillin-resistant colonies. The results were obtained from tour independent

transfections for each cell line.' R, recombination frequency ((no. of blue clones X 3)/total no. of clones].

4603

American Association for Cancer Research Copyright © 1997 on July 15, 2011cancerres.aacrjournals.orgDownloaded from

DNA REPAIR DEFECT IN A HYPERSENSITIVE MUTANT PHENOTYPE

CCGCTCTAGAACTAGTGGATCC-CACAGTG-(12)(23)-CACTGTG-GTCGACCTCGAGGGG

Fig. 6. Nucleotide sequence of pH2 Ree recombination junctions recovered from 180BRM mutantcell line following cotransfection with RAG1 andRAG2 expression vectors. Sequences of independent recombined clones are aligned with that of thenative plasmid. —¿�.nucleotide deletions. Boldface

letters, recombination signal heptamers.

CCGCTCTAGAACTAGTGGATCCCCGCTCTAGAACTAGTGGATCCCCGCTCTAGAACTAGTGGATC-CCGCTCTAGAACTAGTGGATC-CCGCTCTAGAACTAGTGGATC-CCGCTCTAGAACTAGTGCCGCTCTAGAACTAGTGCCGCTCTAGAACTAGTCCGCTCTAGAACTAGCCGCTCTAGAACTAGCCGCTCTAGAACTCCGCTC

CAG GTCGACCTCGAGGGGGACCTCGAGGGGGACCTCGAGGGG

CCTCGAGGGGCGAGGGG

GACCTCGAGGGGGACCTCGAGGGG

GAGGGG-TCGACCTCGAGGGG--CGACCTCGAGGGGGGG

CGAGGGG

the unlabeled cells into S phase (gate F) was estimated (fraction ofunlabeled cells in F; sample profiles are shown in Fig. 7 and the datafrom these and other profiles are summarized in Fig. 8). In unirradi-

ated 1BR3 and 180BR cells, a peak number of unlabeled cells hadentered S phase after 12 h. The peak was smaller and less pronouncedfor 180BR, probably due to the decreased proportion and rate ofcycling of these cells. Nevertheless, a pronounced dose-dependentG,-S arrest was observed in both the normal cell line 1BR3 and in

180BR, and it was seen even at the lowest dose examined (1 Gy;Fig. 8).

To examine the integrity of the G2 checkpoint, the ability of thelabeled cells (i.e., those cells that had traversed the G,-S boundary

prior to irradiation) to enter a labeled G, position (gate D) wasestimated. In the unirradiated control population, the majority oflabeled cells entered G, phase 12 h after being released from labeling.At 18 h, the percentage of cells in G, has decreased because they haveprogressed into the subsequent S phase (Fig. 8). This cycling time isapproximately the same for 1BR3 and 180BR. Following radiationwith increasing doses, both cell lines exhibited a delay in entry intoG,, indicating an accumulation of cells at the G2-M checkpoint. 1BR3

1BR3 OGy; Ohr 1BR3 0 Gy; 12 hr 1BR3 3 Gy; 12 hr

ÃŽI

eou 180BR 0 Gy; 0 hr 180BR 0 Gy; 12hr 180BR 3 Gy; 12 hr

BrdUrd FITCFig. 7. FACS analysis of 1BR3 and 180BR following exposure to ionizing radiation. Exponentially growing cells were labeled with BrdUrd for 30 min. the medium was changed,

and cells were washed to remove the BrdUrd and irradiated with the doses indicated. Control cultures received no irradiation. Cells were incubated for the times indicated and thensubjected to FACS analysis. The sample profiles show the progression of cells through the cell cycle after 12 h incubation with or without 3-Gy irradiation. A, untabeled G, cells; B,unlabeled G2 cells; C, labeled S and G, cells; D. labeled G, cells; and F, unlabeled S phase cells.

4604

American Association for Cancer Research Copyright © 1997 on July 15, 2011cancerres.aacrjournals.orgDownloaded from

DNA REPAIR DEFECT IN A HYPERSENSITIVE MUTANT PHENOTYPE

1BR3; Fraction of UnlabeledPopulation in S Phase

180BR; Fraction ofUnlabeled Population in S

Phase03

02

0 10 20 30

Time (Mrs)

1BR3; Fraction ofLabeled Population in G1

0 10 20 30

Time (Mrs)

180BR; Fraction of LabeledPopulation in G1

10 20

Time (Mrs)0 10 20 30

Time (Mrs)

Fig. 8. Percentage of labeled and unlabeled lBR3and 180BR cells in S and G, phasesfollowing irradiation. Cells were treated as described in the legend to Fig. 7. The panelsdisplay the fraction of labeled cells in G, (DID + O or the fraction of unlabeled cells inS phase (FIA + B + Fi for IBR3 and I80BR cells. *. no irradiation; •¿�IGy; A. 3Gy:A, 6Gy. These experiments have been carried out twice, and the results presented arerepresentative of both experiments.

cells that were irradiated with 1 Gy had only a small delay at the G2-Mcheckpoint, but they had a marked arrest at the G,-S boundary, whichis consistent with previous observations that the G,-S checkpoint istriggered by lower doses than is the G2-M checkpoint (Fig. 8). The

magnitude of the G2 delay was more marked in 180BR cells comparedwith 1BR3 cells at the same dose. These results, therefore, show that180BR cells can effect radiation-induced arrest at both the G,-S andG2-M checkpoints.

DISCUSSION

The radiosensitivities of the two transformed cell lines that wereexamined here ( 180BRM and MRC5V1 ) were lower than those of theuntransformed counterpart, in agreement with previous findings ofArieti et al. (46), who showed that the introduction of SV40 T antigenreduced the intrinsic radiosensitivity in cell lines. However, transformation did not change the relative hypersensitivity of 180BR cells.Because the 180BRM cells are transformed but not immortalized(precrisis), whereas the MRC5V1 cells are immortalized (postcrisis),our findings support previous observations that it is transformationrather than immortalization that reduces radiosensitivity (46).180BRM cells also display the DSB repair defect that is characteristicof 180BR cells (3). Therefore, the reduction in radiosensitivity that islinked to transformation does not correlate with the DSB repaircapacity.

180BR and 180BRM cells express-wild type levels of the threecomponents of DNA-PK (Ku70, Ku80, and DNA-PKcs) and havenormal levels of DNA end binding and DNA-PK activity. Recently,

using antibodies supplied by S. Critchlow and S. P. Jackson (Cambridge University, Cambridge, United Kingdom), we have also shownthat XRCC4, another protein functioning in the DNA-PK-dependent

DSB rejoining mechanism, is expressed at normal levels in 180BR(data not shown). We, therefore, conclude that 180BR is not defectivein XRCC4 or one of the components of DNA-PK. This conclusion is

strengthened by our unpublished observations that, in contrast toSCID cell lines (47), 180BR is not sensitive to the DNA cross-linking

agent mechloretamine.Members of the four complementation groups of rodent mutants

with major defects in DNA DSB repair are also defective in theirability to carry out V(D)J recombination (22-24, 40, 48, 49).4 Our

results here show that 180BRM cells differ from these cell linesbecause they are proficient in their ability to carry out V(D)Jrecombination following introduction of Rag expression vectors.Hence, they do not seem to lack the factors necessary to producea correctly repaired coding junction following initial cutting at therecombination signal sequences. The recombination rate is about 3times lower in 180BRM than in the control cell line, but thisdifference is within the range observed between normal pre-B

lymphocytes (ratio of 4.3; Ref. 35). Moreover, this small difference is much less dramatic than the 30-500-fold decrease in

recombination frequency reported for the hitherto characterizedDSB repair-defective cell lines (12, 14, 17, 18, 22, 50, 51). The

normal V(D)J recombination in 180BRM cells is in agreement withthe clinical observations that the patient from whom the cell linewas derived had no identifiable immune defect (2). In this pheno-

type, 180BRM cells resemble AT cell lines, which are also proficient in their ability to carry out V(D)J recombination (52).

To gain further insight into the nature of the defect in 180BR, wefound that irradiated 180BR cells were able to arrest at both the G,-Sand G-,-M checkpoints. Previously, we have also shown that 180BR

cells inhibit DNA synthesis following irradiation (52). These combined results distinguish 180BR from AT cell lines, which fail toarrest at the G,-S checkpoint (53), and display radioresistant DNA

synthesis.In its cell cycle arrest phenotype, 180BR resembles the other

DSB repair-defective cell lines. The Ku80-defective ES cell lineand primary seid cells both show a radiation induced G,-S arrest

(this is not seen in the rodent mutants or their parents due tochanges in their p53 status; Refs. 44 and 45). Additionally, theKu80 ES cells, as well as seid cells and xrs-6 cells show a morepronounced G2-M arrest than do parental cells (44, 45, 54). At thesame dose, the magnitude of G-, delay is more pronounced in180BR compared with 1BR3. These results indicate that the G,-Sand G-.-M checkpoints are intact in 180BR and that the G-.-M arrest

is triggered by a lower dose, which is consistent with an elevatednumber of unrejoined DSBs.

In conclusion, our results show that 180BR represents a newmutant phenotype that is characterized by hypersensitivity to ionizing radiation and defective DNA DSB rejoining but also byproficiency in its ability to carry out effective V(D)J recombinationand to arrest at G,-S and G2-M cell cycle checkpoints. In additionto the members of groups 4-7, one other DSB repair-defectiverodent mutant, V-C8, has been described, but this cell line differs

from 180BR in displaying radioresistant DNA synthesis (55). Thissuggests that 180BR carries a mutation in a currently unidentifiedgene involved in DSB repair. Because both the patient and hisfibroblast cells were radiosensitive, it appears likely that he carriedthe mutation in his germ line. Surprisingly, the patient was normal

4605

American Association for Cancer Research Copyright © 1997 on July 15, 2011cancerres.aacrjournals.orgDownloaded from

DNA REPAIR DEFECT IN A HYPERSENSITIVE MUTANT PHENOTYPE

until the onset of leukemia. It, therefore, appears that this defectdoes not confer a major growth or developmental problem but mayimpart a predisposition to cancer. 20

ACKNOWLEDGMENTS

We thank Dr. Gest (Association d'Aide àla Recherche Cancérologique de

St. Cloud, Saint Cloud, France) and the Ligue Nationale FrançaiseContre leCancer (Comitédes Hauts-de-Seine. Nanterre. France). The technical assist

ance of the Laboratory of Cytometry (Centre National de la Recherche Scientifique, Villejuif. France) is gratefully acknowledged. We thank Dr. A. Begg(The Netherlands Cancer Institute. Amsterdam, the Netherlands) for help inestablishing the FACS analysis in the Cell Mutation Unit. Medical ResearchCouncil, Sussex University. Falmer, Brighton.

REFERENCES

1. Attard-Monlalio. S. P.. Saha. V.. Kingston, J. E.. Plowman. P. N., Taylor. A. M. R..

Ariel!. C. F.. Bridges. B. A., and Eden. O. B. Increased radiosensilivily in a child wilhT-cell non-Hodgkin's lymphoma. Med. Pedialr. Oncol.. 27: 565-570, 1996.

2. Plowman. P. N.. Bridges. B. A.. Arie!!. C. F.. Hinney. A., and Kingston. J. E. Aninstance of clinical radialion morbidity and cellular radiosensitiviiy. noi associatedwith ataxia-telangieclasia. Br. J. Radio!.. 63: 624-628. 1990.

3. Badie. C.. Iliakis. G.. Foray. N.. Alsbeih. G., Panlelias. G. E.. Okayasu. R.. Cheong.N., Rüssel,N. S., Begg, A. C., Ariel!, C. F.. and Malaise, E. P. Defeciive repair ofDNA double-slrand breaks and chromosome damage in fibroblasls from a radiosen-silive leukemia palien!. Cancer Res., 55: 1232-1234, 1995.

4. Badie. C.. Alsbeih. G.. Reydellel. C.. Ariel!, C.. Fértil,B., and Malaise, E. P.Dose-rale effects on the survival of irradiated hypersensitive and normal humanfibroblasls. Int. J. Radial. Biol.. 70: 563-570, 1996.

5. Houldsworth. J.. and Lavin, M. F. Effect of ionizing radiation of DNA synthesis inataxia telangiectasia. Nucleic Acids Res., 8: 3709-3720, 1980.

6. Painter. R. B.. and Young. B. R. Radiosensitivity in ataxia-lelangieclasia: a newexplanation. Proc. Nail. Acad. Sci. USA. 77: 7315-7317, 1980.

7. Badie. C.. Iliakis. G., Foray, N.. Alsbeih, G., Cedervall. B.. Chavaudra. N.,Panlelias. G.. Arieti. C. F.. and Malaise. E. P. Induclion and rejoining of DNAdouble-slrand breaks and inlerphase chromosome breaks after exposure to X-raysin one normal and two hypersensitive human fibroblasl cell lines. Radial. Res..144: 26-35. 1995.

8. Badie. C.. Arieti. C. F.. Iliakis. G., and Malaise. E. P. Comparative studies ofchromosome breaks (PCC). exchange chromosome aberrations (PCC/FISH) anddouble-strand breaks in Ihree different human fibroblasl cell lines. In: U. Hagen. H.

Hung, and C. Slreffer (eds.). Proceedings of Ihe lOlh International Congress ofRadialion Research. Vol. 2. pp. 477-480. Würzburg,Germany: U. Hagen. D. Hardek.H. Jung. C. Slreffer. 1995.

9. Lees-Miller. S. P.. Godboul. R.. Chan, D. W.. Weinfeld. M., Day. R. S.. III. Barran.G. M., and Allalunis-Turner. J. Absence of p350 subunil of DNA-aclivaled proleinkinase from a radiosensilive human cell line. Science (Washington DC). 267: 1183-1185. 1995.

10. Thompson. L. H.. and Jeggo. P. A. Nomenclalure of human genes involved inionizing radialion sensitivity. Mutai. Res., 337: 131-134, 1995.

11. Zdzienicka. M. Z. Mammalian mutants defective in the response to ionizing radiation-induced DNA damage. Mulal. Res.. 336: 203-213. 1995.

12. Li, Z.. Olevrel. T.. Gao. Y., Cheng, H-L., Seed, B.. Slamato, T. D.. Taccioli, G. E.,and Alt. F. W. The XKCC4 gene encodes a novel protein involved in DNA double-strand break repair and V(D)J recombinalion. Cell. 83: 1079-1089. 1995.

13. Taccioli, G.. Blum. T.. Golllieb. T. M.. Prieslly. A.. Demongeot, J.. Mizula, R..Lehmann. A. R., Alt. F. W.. Jeggo, P.. and Jackson. S. P. Ku80 is the produci of IheXRCC5 gene: a link between DNA repair and V(D)J recombinalion. Science (Washington DC). 265: 1442-1445. 1994.

14. Smider, V., Ralhmell. W. K.. Lieber, M. R., and Chu. G. Restoralion of X-rayresistance and V(D)J recombinalion in mulanl cells by Ku cDNA. Science (Washington DC). 266: 288-291. 1994.

15. Errami. A.. Smider. V.. Ralhmell. W. K.. He, D. M.. Hendrickson, E. A.. Zdzienicka.M. Z.. and Chu, G. Ku86 defines the genelic defecl and restores X-ray resistance andV(D|J recombination lo complementation group 5 hamster cell mulanls. Mol. Cell.Biol.. 16: 1519-1526. 1996.

16. Singleton. B. K.. Priestley. A.. Gell. D.. Blunt. T. Jackson. S. P.. Lehmann, A. R.. andJeggo. P. A. Molecular and biochemical characlerizaiion of mulants defective inKu80. Mol. Cell. Biol., in press, 1997.

17. Boubnov. N. V., Hall, K. T., Wills. Z., Lee. S. E.. He, D. M., Benjamin. D. M..Pulaski, C. R.. Band. H.. Reeves, W., Hendrickson. E. A., and Weaver. D. T.Complementation of the ionizing radiation sensitivity. DNA end binding and V(D)Jrecombinalion defects of double-strand break repair mutants by the p86 Ku auloan-tigen. Proc. Nail. Acad. Sci. USA. 92: 890-894. 1995.

18. Blunt. T.. Finnic, N. J., Taccioli, G. E., Smith, G. C. M.. Demongeot, J., Golllieb,T. M.. Mizula. R.. Varghese, A. J.. All, F. W.. Jeggo. P. A., and Jackson. S. P.Defeciive DNA-dependem prolein kinase activity is linked to V(D)J recombinalionand DNA repair defecl associated with Ihe murine seid mulalion. Cell, 80: 1-20,1995.

19. Pelerson, S. R., Kurimasa. M.. Oshimura. M., Dynan. W. S., Bradbury. E. M.. and

4606

21.

22

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

43.

44.

45.

46.

Chen. D. J. Loss of the catalytic subunit of the DNA-dependent protein kinase inDNA double-slrand break-repair mulani mammalian cells. Proc. Nail. Acad. Sci.USA. 92: 3171-3174, 1995.Bouhnov. N. V.. and Weaver. D. T. Seid cells are deficienl in Ku and replicalionprolein A phosphorylalion by the DNA-dependem prolein kinase. Mol. Cell. Biol../5: 5700-5706, 1995.

Kirchgessner. C. U., Patii. C. K.. Evans, J. W.. Cuomo. C. A.. Fried, L. M., Carter.T.. Oeltinger. M. A., and Brown. J. M. DNA-dependem kinase (p350) as a candidalegene for Ihe murine SCID defecl. Science (Washington DC), 267: 1178-1180, 1995.Taccioli. G. E.. Ralhbun, G.. Ollz. E.. Starnato. T.. Jeggo. P. A., and Alt, F. W.Impairmenl of V(D)J recomhinalion in double-slrand break repair mutant. Science(Washington DC). 260: 207-210. 1993.Jackson. S. P.. and Jeggo. P. A. DNA double-slrand repair and V(D)J recombinalion:involvemenl of DNA-PK. Trends Biochem. Sci.. 20: 412-415, 1995.Weaver, D. T. V(D)J recombinalion and double-slrand break repair. Adv. Immunol..5«:29-85, 1995.

Wiler. R.. Leber. R., Moore. B. B., VanDyk, L. F.. Ferryman, L. E.. and Meek, K.Equine severe combined immunodeficiency: a defecl in V(D)J recombination andDNA-dependent prolein kinase aclivity. Proc. Nail. Acad. Sci. USA, 92: 11485-

11489. 1995.Hutschka, L. I., and Holliday. R. Limited and unlimited growlh of SV40-lransformedcells from human diploid MRC-5 fibroblasts. J. Cell Sci., 63: 77-99, 1983.Fértil,B.. Dertinger. H.. Courdi. A., and Malaise, E. P. Mean inaclivalion dose: auseful concepìfor inlercomparison of human cell survival curves. Radial. Res., 99:73-84, 1984.

Foray, N., Badie. C., Alsbeih. G., Fértil.B., and Malaise. E. P. A new modeldescribing the curves for repair of both DNA double-slrand breaks and chromosomedamage. Radial. Res., 146: 53-60, 1996.Jessberger. R., and Berg. P. Repair of deletions and double-strand gaps by homologous recombination in a mammalian in vitro system. Mol. Cell. Biol.. //: 445-457.1991.Schuler. W.. Weiler, I. J., Schuler, A.. Phillips, R. A., Rosenberg, N., Mak. T. W..Kearney. J. F.. Perry. R. P.. and Bosma. M. J. Rearrangemem of anligen receptorgenes is defective in mice with severe combined immune deficiency. Cell, 46:963-972. 1986.Gotllieb. T. M.. and Jackson. S. P. The DNA-dependenl prolein kinase: requiremenlof DNA ends and associalion wilh Ku anligen. Cell. 72: 131-142. 1993.Lees-Miller, S. P.. Sakagushi. K.. Ullrich. S. J., Appella, E., and Anderson. C. W.Human DNA-aclivaled prolein kinase phosphorylates serines 15 and 37 in theamino-lerminal iransaclivalion domain of human p53. Mol. Cell. Biol., 72: 5041-5049. 1992.Anderson. C. W.. and Lees-Miller. S. P. The nuclear serine/threonine protein kinaseDNA-PK. Crit. Rev. Eukaryolic Gene Express., 2: 283-314. 1992.Song, Q.. Lees-Miller, S. P.. Kumar. S., Zhang, N.. Chan, D. W., Smilh, G. C. M.,Jackson. S. P.. Alnemri, E. S.. Lilwack. G.. Khanna. K. K., and Lavin, M. F.DNa-dependenl protein kinase catalytic subunil: a target for an ICE-like protease inapoptosis. EMBO J.. 15: 3238-3246. 1996.

Kallenbach. S.. Goodhardi. M.. and Rougeon. F. A rapid lesi for V(D)J recombinalion. Nucleic Acids Res., IS: 6730. 1990.Oellinger. M. A., Schatz, D. G., Gorka, C., and Ballimore, D. RAG-1 and RAG-2.adjacenl genes lhal synergislically actívaleV(D)J recombinalion. Science (Washington DC). 248: 1517-1523. 1990.

Chu, G.. Hayakawa. H., and Berg, P. Eleclroporalion for Ihe efficient Iransfection ofmammalian cells wilh DNA. Nucleic Acids Res.. 15: 1311-1326, 1987.Kallenbach. S., Doyen. N., Fanion d'Andon. M.. and Rougeon, F. Three lymphoid-

specifícfactors accounl for all junctional diversily characteristic of somatic assemblyof T-cell receptor and immunoglobulin genes. Proc. Nati. Acad. Sci. USA. 89:2799-2803. 1992.

Begg. A. C.. Moonen. L.. Hofland. I.. Dessing. M.. and Bartelink, H. Human lumourcell kinetics using a monoclonal antibody against iododeoxyuridine: inlralumoursampling varialions. Radiolher. Oncol. //: 337-347. 1988.

Jeggo. A. P.. Taccioli. G. E.. and Jackson, S. P. Menage àIrois: double strand breakrepair. V(D)J recombinalion and DNA-PK. BioEssays. 17: 949-957. 1995.Bloscher. D.. Siguí.D.. and Hannan. M. A. Fibroblasls from alaxia lelangieclasia(AT) and AT helerozygoles show an enhanced level of residual DNA double-strandbreaks after low dose-rale g-irradialion as assayed by pulsed field gel eleclrophoresis.Int. J. Radial. Biol.. 60: 791-802, 1991.Wurm. R.. Burnel. N. G.. Duggal. N.. Yamold. J. R.. and Peacock. J. H. Cellularradiosensilivily and DNA damage in primary human fibroblasls. Im. J. Radial. Oncol.Biol. Phys., 30: 625-633, 1994.Foray. N., Arien, C. F.. and Malaise, E. P. Dose-rale effecl on induclion and repairrate of radialion-induced DNA double-slrand breaks in a normal and an alaxialelangieclasia human fibroblasl cell line. Biochimie. 77: 900-905. 1995.Nussenzweig, A.. Chen, C.. Da Cosía Soares, V., Sanchez, M.. Sokol. K..Nussenzweig. M. C., and Li, G. C. Requiremenl for Ku80 in growlh and immunoglobulin V(D)J recombinalion. Nalure (Lond.), 382: 551-555, 1996.Fried, L. M.. Koumenis. C.. Peterson. S. R.. Green, S. L.. Vanzijl, P.. Allalunis-Turner. J., Chen. D. J.. Fishel. R., Giaccia, A. J.. Brown, J. M.. and Kirchgessner.C. U. The DNA-damage response in DNA-dependenl prolein kinase-deficienl SCIDmouse cells: replicalion proiein-A hyperphosphorylalion and p53 induclion. Proc.Nail. Acad. Sci. USA, 93: 13825-13830, 1996.

Arlell, C. F.. Green, M. H. L., Prieslley, A., Harcourt, S. A., and Mayn, L. V.Comparalive human cellular radiosensitivily: the effecl of Ihe SV40 Iransformalionand ¡mmortalisalion on the y-irradialion survival of skin derived fibroblasls fromnormal individuals and from alaxia-lelangieclasia paliems and helerozygoles. Int. J.Radial. Biol., 54: 911-928. 1988.

American Association for Cancer Research Copyright © 1997 on July 15, 2011cancerres.aacrjournals.orgDownloaded from

DNA REPAIR DEFECT IN A HYPERSENSITIVE MUTANT PHENOTYPE

47. Tanaka, T.. Yamagami, T.. Oka, Y., Nomura. T.. and Sugiyama. H. The seid mutation impaired in DNA double-strand break repair and defective for V(D)J recombination,in mice causes defects in the repair system for both double-strand DNA breaks and Mutât.Res., 336: 279-291. 1995.DNA cross-links. Mutât.Res.. 288: 277-280. 1993. 52. Hsieh, C. L., Ariel!. C. F.. and Lieber, M. R. V(D)J recombination in ataxia

48. Pergola. F.. Zdzienicka. M. Z.. and Lieber. M. V(D)J recombination in mammalian telangiectasia. Bloom's syndrome and a ligase I-associated immunodeficiency disor-

cell mutants defective in DNA double-strand break repair. Mol. Cell. Biol., 13: der. J. Biol. Chem., 2(M: 20105-20109. 1993.3464-3471. 1993. 53. MacKinnon. P. J. Ataxia-telangiectasia: an inherited disorder of ionizing-radiation

49. Weaver. D. T. What to do at an end: DNA double-strand break repair. Trends Genet.. sensitivity in man. Hum. Genet.. 75: 197-208, 1987./// 388-392. 1995. 54. Weibezahn. K. F., Lohrer. H.. and Herrlich. P. Double strand break repair and G2

50. He, D. M.. Lee. S. E.. and Hendrickson, E. A. Restoration of X-ray and etoposide block in Chinese hamster ovary cells and their radiosensitive mutants. Mutât.Res.,resistance. Ku-end binding activity and V(D)J recombination to the Chines 145: 177-183. 1985.hamster sxi-3mutant by a hamster Ku 86 cDNA. Mutât. Res.. 363: 43-56, 55. Verhaeg, G. W. C. T.. Jongmans, W.. Morolli. B.. Jaspers, N. G. J., Van der Schans.1996. G. P., Lohman, P. H. M.. and Zdzienicka, M. Z. A novel type of X-ray sensitive

51. Lee, S. E.. Pulaski. C. R., He, D. M., Benjamin. D. M., Voss, M., Um, J., and Chinese hamster cell mutant with radioresistant DNA synthesis and hampered DNAHendrickson. E. A. Isolation of mammalian cell mutants that are X-ray sensitive double-strand break repair. Mutât.Res.. 337: 119-129, 1995.

4607

American Association for Cancer Research Copyright © 1997 on July 15, 2011cancerres.aacrjournals.orgDownloaded from