1 23

Plant Molecular BiologyAn International Journal on MolecularBiology, Molecular Genetics andBiochemistry ISSN 0167-4412 Plant Mol BiolDOI 10.1007/s11103-011-9814-9

Expression of lorelei-like genes inaposporous and sexual Paspalum notatumplants

Silvina Andrea Felitti, José GuillermoSeijo, Ana María González, MaricelPodio, Natalia Verónica Laspina, LorenaSiena, Juan Pablo Amelio Ortiz, et al.

1 23

Your article is protected by copyright and

all rights are held exclusively by Springer

Science+Business Media B.V.. This e-offprint

is for personal use only and shall not be self-

archived in electronic repositories. If you

wish to self-archive your work, please use the

accepted author’s version for posting to your

own website or your institution’s repository.

You may further deposit the accepted author’s

version on a funder’s repository at a funder’s

request, provided it is not made publicly

available until 12 months after publication.

Expression of lorelei-like genes in aposporous and sexualPaspalum notatum plants

Silvina Andrea Felitti • Jose Guillermo Seijo • Ana Marıa Gonzalez •

Maricel Podio • Natalia Veronica Laspina • Lorena Siena •

Juan Pablo Amelio Ortiz • Silvina Claudia Pessino

Received: 4 December 2010 / Accepted: 23 July 2011

� Springer Science+Business Media B.V. 2011

Abstract Gametophytic apomictic plants form non-

reduced embryo sacs that generate clonal embryos by

parthenogenesis, in the absence of both meiosis and egg-

cell fertilization. Here we report the sequence and

expression analysis of a lorelei-like Paspalum notatum

gene, n20gap-1, which encodes a GPI-anchored protein

previously associated with apomixis in this species. Phy-

logeny trees showed that n20gap-1 was evolutionary rela-

ted to the Arabidopsis thaliana lorelei genes At4g26466

and At5g56170. The lorelei At4g26466 disruption was

shown to be detrimental to sperm cell release in arabid-

opsis. RFLP (Restriction Fragment Length Polymorphism)

analysis revealed the occurrence of several homologous

sequences in the Paspalum notatum genome, exhibiting

polymorphisms genetically linked to apomixis. Real-time

PCR showed that lorelei-family genes present a minor

activity peak at pre-meiosis and a major one at anthesis.

The apomictic genotype analyzed showed a significantly

increased activity at pre-meiosis, post-meiosis and anthesis

with respect to a sexual genotype. In situ hybridization

assays revealed expression in integuments, nucellus and the

egg-cell apparatus. Several n20gap-1 alleles differing

mainly at the 30 UTR sequence were identified. Allele-

specific real-time PCR experiments showed that allele 28

was significantly induced in reproductive tissues of the

apomictic genotype with respect to the sexual genotype at

anthesis. Our results indicate that P. notatum lorelei-like

genes are differentially expressed in representative sexual

(Q4188) and apomictic (Q4117) genotypes, and might play

a role in the final stages of the apomixis developmental

cascade. However, the association of n20gap-1 expression

with the trait should be confirmed in significant number of

sexual and apomictic genotypes.

Keywords Apomixis � Apospory � Lorelei �Paspalum notatum � Plant reproduction

Introduction

Apomixis is an asexual mode of reproduction through

seeds described in more than 400 plant species belonging

to 35 different angiosperm families (Nogler 1984; Ozias-

Akins 2006). The trait is frequently associated with hybrid

origin and/or polyploidy (Richards 2003). Apomictic plants

produce seeds containing clonal embryos with a maternal

genetic constitution. It is highly unlikely that this trait

could have evolved from sexual ancestors through ran-

domly occurring mutations, because it is polyphyletic in

origin and involves the alteration of several independent

developmental steps. Instead, apomixis might have arisen

through deregulation of the sexual developmental pathway

by a mechanism that could comprise both genetic and

epigenetic components (Grossniklaus 2001). This coordi-

nated deregulation could be influenced by global regulatory

changes resulting from hybridization and/or polyploidy

(Grossniklaus 2001).

S. A. Felitti � M. Podio � N. V. Laspina � L. Siena �J. P. A. Ortiz � S. C. Pessino (&)

Laboratorio Central de Investigaciones, Facultad de Ciencias

Agrarias, Universidad Nacional de Rosario, Parque Villarino,

S2125ZAA Zavalla, Provincia de Santa Fe, Argentina

e-mail: pessino@arnet.com.ar

J. G. Seijo � A. M. Gonzalez � M. Podio � J. P. A. Ortiz

Facultad de Ciencias Agrarias, Instituto de Botanica del

Nordeste (IBONE), CONICET, Universidad Nacional del

Nordeste, Sargento Cabral 2131, W3402BKG Corrientes,

Argentina

123

Plant Mol Biol

DOI 10.1007/s11103-011-9814-9

Author's personal copy

Due to its potential importance as an enabling technol-

ogy for agriculture, apomixis has been the subject of

exhaustive cytoembryological, cytogenetical and molecular

analyses into its developmental mechanisms (Ozias-Akins

2006). Exploitation of the trait in crop plants would pro-

vide major benefits to agriculture: widespread use and

fixation of hybrid vigor, survival and immediate fixation of

combined genetic resources, including wide-cross progeny

that are unfit when propagated sexually, true seed pro-

duction from crops currently propagated vegetatively and

accelerated breeding programs in response to changing

needs and environments (Spillane et al. 2004).

One of the most frequent apomictic mechanisms is

apospory, a developmental process characterized by the

differentiation of one or several nucellar cells, which ini-

tiate a series of mitotic divisions to generate megaga-

metophytes where all nuclei are non-reduced (2n) (Crane

2001). The resulting 2n egg cells form embryos by par-

thenogenesis. The endosperm can be generated either

autonomously or by pseudogamy (polar nuclei fertiliza-

tion), depending on the species (Crane 2001).

Paspalum notatum Flugge is a rhizomatous subtropical

perennial grass with a highly evolved reproductive strat-

egy, consisting of a combination of vegetative propagation,

sexuality and apomixis (Gates et al. 2004). The species is

organized as an agamic complex including sexual diploid

and aposporous pseudogamous tetraploid cytotypes (Qua-

rin 1992). Sexual tetraploid cytotypes were never collected

from nature, but some plants were artificially produced by

colchicine treatment of diploids and experimental crosses

(Quarin et al. 2003).

The molecular basis of apomixis in P. notatum has been

under examination for more than 10 years. Full genetic

maps were developed at both diploid (sexual) and tetra-

ploid (apomictic) levels (Ortiz et al. 2001; Stein et al.

2007). Fifteen molecular markers completely linked to a

single genomic region controlling apospory were identified

(Stein et al. 2007). The apospory-specific genomic region

(ASGR) showed severe suppression of recombination and

preferential chromosome pairing with one of the three

homologues of the set (Stein et al. 2007). Data derived

from mapping analysis indicated that the P. notatum

chromosomal segment governing apospory could encom-

pass approximately 36 Mbp and might have resulted from

an inversion or a translocation (Stein et al. 2004; Pupilli

et al. 2004; Stein et al. 2007). Similar structural features

(regarding lack of recombination in an extended sequence

and possible occurrence of rearrangements) were reported

for the apomixis-controlling genomic regions of other

aposporous species like Pennisetum ciliare, Pennisetum

squamulatum, Paspalum malacophyllum and Paspalum

simplex (Ozias-Akins et al. 1998; Pupilli et al. 2001; Pupilli

et al. 2004; Akiyama et al. 2005). The non-recombinant

nature of ASGR highly compromised attempts to isolate

genes associated with the trait by direct genetic strategies.

Therefore, expression analyses followed by mapping of

selected candidates were perceived as valid alternative

approaches to facilitate the identification of the apomixis

trigger/s. Several groups focused on the isolation of

sequences differentially expressed in inflorescences of

sexual and apomictic plants (Rodrigues et al. 2003;

Albertini et al. 2004; Laspina et al. 2008; Sharbel et al.

2009; Yamada-Akiyama et al. 2009).

In P. notatum, a comprehensive differential display

analysis revealed 65 transcript sequences differentially

expressed in inflorescences of sexual and apomictic tetra-

ploid plants at late pre-meiotic stages (Laspina et al. 2008).

RFLP (restriction-fragment length polymorphisms) exper-

iments involving one of these sequences (experimental

code N20) showed a marker genetically linked in coupling

to the chromosomal locus governing apospory at a genetic

distance of 22 cM (Laspina et al. 2008). N20 was detected

as a transcript fragment amplified from RNA samples

which originated from sexual individuals (Laspina et al.

2008). Preliminary real-time PCR analysis confirmed a

minor down-regulation in inflorescences of apomictic

plants with respect to sexual ones at late pre-meiotic-

meiotic stages (Laspina et al. 2008). Sequencing revealed

that fragment N20 was homologous to GPI-anchored pro-

teins (Laspina et al. 2008).

The transcript represented by fragment N20 resulted

genetically linked to the apomixis-controlling locus at a

distance of 22 cM (Laspina et al. 2008). Therefore, it does

not qualify as a primary genetic determinant of this

reproductive system. However, its positional association

with the trait could indicate the existence of a cluster of

reproduction-related genes around the ASGR. The influ-

ence of the ASGR proximity on the expression of genes

controlling reproductive processes remains unclear, but

could involve epigenetic phenomenon such as chromatin

structure modification. Our hypothesis is that: (1) full

sequencing of N20 may reveal the existence of different

related alleles/paralogues; (2) Several alleles/paralogues

are represented in the P. notatum genome of sexual and

apomictic plants; (3) N20 is induced at specific stages

during sexual and apomictic development; 4) N20 is dif-

ferentially expressed in a representative sexual genotype

and a representative apomictic genotype at different

developmental stages. The objectives of this work were: (1)

characterize the N20 full cDNA sequence (corresponding

to gene n20gap-1, after N20 GPI-anchored protein-1); (2)

identify different alleles/paralogues; (3) determine gene

copy number in the genome of sexual and apomictic

genotypes; (4) quantify expression in reproductive tissues

of a representative sexual and a representative apomictic

plant, at different developmental stages; (5) analyze

Plant Mol Biol

123

Author's personal copy

reproductive tissue in situ expression in a representative

sexual and a representative apomictic plant, at the devel-

opmental stage of maximal expression and (6) identify

Arabidopsis thaliana putative orthologues and related

mutant germplasm, which could shed light on its potential

role in reproduction

Materials and methods

Plant material

Experiments were conducted on samples originated from

inflorescences of the tetraploid sexual plants Q4188

(2n = 4x = 40) and C4 (2n = 4x = 40), as well as the

tetraploid apomictic plant Q4117 (2n = 4x = 40). Clone

Q4188 is a hybrid derived from a highly sexual genotype

(Q3664) crossed with a natural apomict (Quarin et al.

2003). C4 is recently-formed autotetraploid, obtained after

doubling the chromosome content of a sexual diploid by

the use of colchicine (Quarin et al. 2001). Q4117 is an

obligate apomictic tetraploid clone collected from a natural

population of Southern Brazil (Ortiz et al. 1997). A

P. notatum pseudo-testcross mapping population segre-

gating for apospory (Stein et al. 2007) was used in the

bulked and de-bulked genomic DNA hybridization exper-

iments. This pseudo-testcross population had been obtained

by crossing the fully sexual heterozygous genotype Q4188

(2n = 4x = 40) (female parent) to the fully apomictic

heterozygous genotype Q4117 (2n = 4x = 40) (pollen

donor) (Stein et al. 2007). The total F1 population consisted

of 113 plants, out of which 15 were apomictic and 98

sexual. (Stein et al. 2007), which was in agreement with

previous reports indicating that in P. notatum apospory was

a dominant character with a highly distorted segregation

(Martınez et al. 2003). Ten sexual and ten apomictic F1

hybrids were selected at random to be used in bulked

genomic DNA hybridization experiments. Five sexual and

five apomictic F1 hybrids were selected at random to be

used in de-bulked genomic DNA hybridization experi-

ments (Stein et al. 2007). Plants were maintained in natural

conditions in experimental plots at IBONE (Instituto de

Botanica del Nordeste, Corrientes, Argentina). The com-

plete Paspalum notatum reproductive developmental cal-

endar reported in Laspina et al. (2008) was used for

selecting the appropriate stages for molecular and cyto-

embryological analyses.

Oligonucleotide design and RACE experiments

Two pairs of reverse-oriented gene-specific primers (GSP1

and GSP2) were designed for 30 and 50 RACE reactions,

following the recommendations of the MARATHON

cDNA amplification kit (BD Biosciences Clontech, San

Jose, CA, USA). 30 RACE primers: 50CGAATGCTGTG

CGCCGCTCTCAAGGAA30 and 50CCGTCTTGAGTGTG

GCAGTAGCGTTGTT30; 50 RACE primers: 50CAACAA

CGCTACTGCCACACTCAAGACG30 and 50TACGGCC

GACCCACCATTAGCACCAT30. Oligonucleotides were

23–28 nucleotides long and had from 50 to 70% GC con-

tent with a melting temperature C67�C. PCR reactions

were prepared in a 50 lL final volume mix, containing

2 lL of a MARATHON library product (BD Biosciences

Clontech, San Jose, CA, USA), 19 GoTAQ activity buffer

(Promega, Madison, Wisconsin, USA), 200 lM dNTPs,

0.2 lM gene specific primer (GSP1 and GSP2), 0.2 lM

adaptor-specific primers (AP1 or AP2) and 1.5 U of Go-

TAQ DNA polymerase enzyme (Promega, Madison, Wis-

consin, USA). Initial PCR conditions were the following:

94�C for 1 min followed by 30 cycles of 30 s at 94�C and

4 min at 63�C (both annealing and polymerization tem-

peratures were 63�C). To obtain the final 30 or 50 RACE

product, 2–3 PCR rounds were necessary. Positive and

negative controls were included in each step. Positive

controls consisted of amplifications with two specific oli-

gonucleotides matching in opposite direction that amplified

a small segment within the original sequence fragment.

Negative controls consisted of amplification reactions

using specific and adaptor-complementary primers in the

absence of template DNA. After examination by gel elec-

trophoresis, products were isolated using the SV WIZARD

GEL AND PCR CLEAN UP SYSTEM (Promega, Madi-

son, Wisconsin, USA). Transformation protocols were

taken from the Molecular Cloning Laboratory Manual

(Sambrook and Russell 2001). Plasmids were purified with

the WIZARD PLUS SV MINIPREPS kit (Promega, Mad-

ison, Wisconsin, USA). Insert verification was done by

PCR using the M13 forward and reverse primers and the

following amplification conditions: 94�C for 1 min, 25

cycles of 94�C for 30 s, 63�C for 1 s, 72�C for 1 min.

Sequencing of the 50 and 30 RACE clones was done by

Macrogen Inc (Korea).

Data analysis

Alignments between overlapping 30 and 50 RACE ampli-

fication products and the original sequence were conducted

with ClustalW2 on the EBI-EMBL website (http://www.

ebi.ac.uk/Tools/clustalw2) (Larkin et al. 2007). Analysis of

DNA similarity was carried out using the BLASTn and

BLASTx packages at NCBI (http://www.ncbi.nlm. nih.-

gov/BLAST/) and TAIR (http://www.arabidopsis.org).

Information on characterized germplasm was obtained

from the TAIR website. Conserved domains were detected

with the InterProScan and SMART tools at Expasy (http://

ca.expasy.org/tools/) (Quevillon et al. 2005). The Expasy

Plant Mol Biol

123

Author's personal copy

signal peptide prediction was confirmed by using the Sig-

nalP3 program (Bendtsen et al. 2004). Big-PI Plant Pre-

dictor version 2.1 (Eisenhaber et al. 2003) was used to

detect potential C-terminal GPI modification sites. Thirty-

three (33) sequences encoding plant GPI-anchored proteins

were obtained from NCBI databases (http://www.ncbi.

nlm.nih.gov/). Phylogenetic trees were constructed using

Drawtree application of Phylip version 3.68 (Felsenstein

2005) (with a 2000 bootstrapping). In silico mapping

analysis onto the rice genome was done at the Gramene

webpage (www.gramene.org).

Genomic hybridization analysis

Genomic DNA was extracted from 6 g of young leaves

using the CTAB method (Murray and Thompson 1980).

DNA quality was estimated by measuring the Abs260/280

index. DNA concentration was measured by using a

QUBIT fluorometer (Invitrogen, Carlsbad, USA). Genomic

DNA hybridization and detection was performed as indi-

cated in Stein et al. (2004) using 30 lg of DNA per sample.

To estimate the n20gap copy number, two bulks were

constructed in vitro with DNA from 10 aposporous and 10

non-aposporous (sexual) F1 individuals. Sexual and apo-

mictic bulks (SB and AB) were digested with EcoRI,

HindIII and PstI by using 1.5 U of enzyme per lg of DNA,

overnight at 37�C.

Reproductive tissue in situ hybridization experiments

Inflorescences in developmental stage I (late pre-meiosis)

or VII (anthesis) (Laspina et al. 2008), were fixed in 4%

paraformaldehyde/0.25% glutaraldehyde/0.01 M phos-

phate buffer pH 7.2, dehydrated in an ethanol series and

embedded in paraffin. Specimens were cut into 7 lm thin

sections and placed onto slides treated with poly-L-lysine

100 lg/mL. Paraffin was removed with a xylol series. The

probes used consisted of the sense and antisense version of

clone n20gap-1, including the complete nucleotide

sequence. The plasmid including insert n20gap-1 was lin-

earized using restriction enzymes NcoI or SalI (Promega,

Madison, Wisconsin, USA). Probes were labelled with the

DIG RNA LABELLING KIT (SP6/T7) (Roche Applied

Science, Mannheim, Germany), following the manufac-

turer’s instructions. Template digested with SalI restriction

enzyme was used to produce a probe from the T7 tran-

scription start (SalI probe). Template digested with NcoI

restriction enzyme was used to produce a probe from the

SP6 transcription start (NcoI probe). SalI probes detected

the antisense strand (sense probe), while NcoI probes

detected the sense strand (antisense probe). Probes were

hydrolysed to 150–200 bp fragments. Prehybridization was

carried out in a buffer of 0.05 M Tris–HCl pH 7.5

containing 1 lg/mL proteinase K, in a humid chamber at

37�C for 10 min. Hybridization was carried out in buffer

containing 10 mM Tris–HCl pH 7.5, 300 mM NaCl, 50%

deionized formamide, 1 mM EDTA pH 8.00, 1 9 Den-

hardt, 10% dextransulphate, 600 ng/mL total RNA and

60 ng of the corresponding probe, in a humid chamber at

42�C overnight. Detection was performed following the

instructions of the ROCHE DIG DETECTION KIT (Roche

Applied Science, Mannheim, Germany), using anti DIG

AP and NBT/BCIP as substrates.

Real-time PCR experiments

Real-time PCR reactions were prepared in a final volume

of 25 lL containing 200 nM gene specific primers, 19

REALMIX qPCR (Biodynamics) and 20 ng of reverse-

transcribed RNA (prepared by using SUPERSCRIPT II,

Invitrogen-Life Technologies). Specific PCR primer

pairs were designed by using Primer 3 (http://biotools.

umassmed.edu/bioapps/primer3_www.cgi.). Tubulin-spe-

cific primers were used to amplify the equal-expression

reference (Albertini et al. 2005). All oligonucleotides were

synthesized by IDT (Integrated DNA technologies,

http://www.idtdna.com/Home/Home.aspx). Amplification

efficiency was controlled to be equivalent for samples and

the corresponding internal control. RT (–) and non-tem-

plate controls were incorporated to the assays. Reactions

were performed on two biological replicates (different

RNA extractions), using four to six technical replicates.

Amplifications were performed in an Rotor-Gene Q ther-

mocycler (Quiagen), programmed as follows: 3 min at

95�C, 45 cycles of 15 s at 95�C, 30 s at 63�C, 20 s at 72�C

and 10 s at 78�C, next 5 min at 72�C. A melting curve (86

10 s cycles from 65 to 90�C, the temperature was increased

by 0.3�C after cycle 2) was produced at the end of the

cycling. Differential expression was estimated by using

both the 2-DDCt method (Livak and Schmittgen 2001) and

REST-RG (Relative Expression Software Tool V 2.0.7 for

Rotor Gene, Corbett Life Sciences). The significance of

differential expression was assessed by using non-para-

metric tests (considering Ct values and an amplification

efficiency of 2) and the REST-RG program (considering

take off values and the efficiency for each particular

amplification reaction). Equivalent conclusions were

obtained with both methods. Figures shown here were

based on results obtained using the REST-RG program

(Relative Expression Software Tool V 2.0.7 for Rotor

Gene, Corbett Life Sciences).

GenBank accession numbers

Clone N20: GQ385196; 30 RACE clone 27: GQ385197; 30

RACE clone 28: GQ385198; 30 RACE clone 29:

Plant Mol Biol

123

Author's personal copy

GQ385199; 30 RACE clone 30: GQ385200; 30 RACE clone

32: GQ385201; 30 RACE clone 33: GQ385202; 30 RACE

clone 34: GQ385203; 30 RACE clone 35: GQ385204; 30

RACE clone 36: GQ385205.

Results

N20gap-1 sequence characterization

The P. notatum n20gap-1 sequence originally isolated

from the sexual genotype was introduced in the Gene Bank

with the number GQ385196. It included the complete

coding region and part of the 50 and 30 UTR regions. A

search at the NCBI non redundant databases using Blastn

revealed that the n20gap-1 sequence matched at best the

maize mRNA full-length sequence ZM_BFc0104L23

(Locus BT063764) and the sorghum mRNA sequence

XM_002452592.1, both encoding putative GPI-anchored

proteins (E-value: 0.0). Blastx analysis showed highest

similarity to the Sorghum bicolor hypothetical pro-

tein SORBIDRAFT_04g029590, XP_002452637, and the

maize GPI-anchored protein NP_001148965 (E-value:

6e-63 and 5e-62, respectively). Within the coding region

the sequence was perfectly conserved, except for the initial

ATG codon position, which in the maize clone was pre-

dicted to be two triplets upstream. Additional Blastx sur-

veys in the Arabidopsis sequences databanks at the TAIR

website showed that P. notatum N20GAP-1 was homolo-

gous to the products of the A. thaliana LORELEI-family

genes At5g56170 (E-val: 1e-42), At2g20700 (E-val:

2e-36), At4g26466 (E-val: 6e-35), and At4g28280 (E-val:

1e-31). The representative gene of this family (At4g26466)

had been implicated in the process of egg-cell fertilization

in arabidopsis. LORELEI At4g26466 null mutants display

impaired sperm cell release into the egg cell, a phenotype

reminiscent of feronia/sirene mutants (Capron et al. 2008;

Boisson-Dernier et al. 2008; Tsukamoto et al. 2010). Since

egg-cell fertilization is absent in P. notatum apomictic

plants (embryos are formed through parthenogenesis), but

the central cell is fertilized to produce the endosperm, we

considered relevant to examine expression of n20gap-1

sequence in more detail.

As a preliminar step, the P. notatum N20GAP-1 protein

sequence was characterized by using bioinformatic tools.

The existence of conserved domains was analyzed by using

InterproScan and SMART tools at the Expasy website

(http://ca.expasy.org/tools). A conserved signal peptide

was detected at the amino-terminal region (from amino

acid 1–23). The same region was predicted to be a signal

peptide by using the SignalP3 program (Bendtsen et al.

2004). A transmembrane domain was predicted to be

located between amino acids 7 and 29. A low complexity

domain was predicted between amino acids 151 and 167.

Big-PI Plant Predictor version 2.1 (Eisenhaber et al. 2003)

detected two potential C-terminal GPI modification sites

represented by amino acids 144 and 143.

ClustalW2 alignments of the P. notatum N20GAP-1

protein sequence with homologous sequences from maize,

rice and A. thaliana allowed the detection of highly con-

served regions (Fig. 1). A core segment between amino

acids 44 and 135 was highly similar among all proteins

compared. Flanking N-terminal and C-terminal regions

were more variable.

A survey in the NCBI plant sequence databases facili-

tated the recovery of 33 plant GPI-anchored protein

sequences, representing the best hits in Blastx searches.

Sequences were aligned with ClustalW2 and the program

Phylip-3.68 was used to produce a phylogeny tree with

these 33 sequences (Fig. 2a). As expected, the tree showed

that N20GAP-1 was more similar to GPI-anchored proteins

originated from other Poaceae than those from Arabidopsis

thaliana. It was not possible to judge orthology relation-

ships with A. thaliana from this complete tree, since all

A. thaliana sequences were clustered in two single branches

located at identical distance with respect to N20GAP-1. A

second tree was constructed using only N20GAP-1 and

arabidopsis sequences, in order to reveal putative orthology

relationships (Fig. 2b). From this tree it was possible to

infer that n20gap-1 was a putative orthologue to

At5g56170 or At4g26466, since the program located both

genes at the same distance.

Figure 3 shows an alignment between P. notatum

N20GAP-1 and seven protein sequences originated from the

four A. thaliana LORELEI-like genes. Genes At2g20700 and

At4g28280 give rise to two different proteins each, which

differ in the presence or absence of short protein segments

within the highly variable N-terminal region (marked as a

and b in Fig. 3). The first 70 amino acids show low similarity

levels among all five sequences. The central region, which is

involved in recognition, is very well conserved.

As it was stated, one of the A. thaliana sequences

(At4g26466) corresponds to a gene responsible for an

altered reproductive phenotype in the LORELEI gameto-

phytic mutant (Capron et al. 2008). LORELEI At4g26466

mutants display impaired sperm cell release, a phenotype

reminiscent of feronia/sirene mutants (Capron et al. 2008;

Boisson-Dernier et al. 2008; Tsukamoto et al. 2010). Pollen

tubes reaching LORELEI embryo sacs frequently do not

rupture but continue to grow into the embryo sac, reaching

the central cell and then turning back to the micropyle.

Furthermore, LORELEI embryo sacs continue to attract

additional pollen tubes after arrival of the initial one

(Capron et al. 2008). The remaining three genes (At5g56170,

At2g20700 and At4g28280) were described as Arabidopsis

LORELEI-like proteins, since they are highly similar to

Plant Mol Biol

123

Author's personal copy

At4g26466 (Capron et al. 2008). However, no reproductive

phenotype was associated with null mutations involving

them (Capron et al. 2008; Boisson-Dernier et al. 2008,

Tsukamoto et al. 2010). Mutants with disruptions at

At5g56170 showed no distinctive reproductive features, no

reduced seed set or aborted seed phenotypes (Capron et al.

2008; Tsukamoto et al. 2010). No compensatory increase

in expression was observed in At5g56170 gene in a dis-

rupted At4g26466 background (Tsukamoto et al. 2010). No

increase in the frequency of undeveloped or aborted ovules

was observed in the siliques of double mutants of

At5g56170–At4g26466 compared with single mutants of

At4g26466 (Tsukamoto et al. 2010). These observations

suggest that At5g56170 function is not redundant with the

function of At4g26466 in the female gametophyte (Tsu-

kamoto et al. 2010).

RFLP analysis

RFLP analyses were performed on bulks of 10 F1 sexual

and 10 F1 aposporous plants, which originated from an

apomixis-segregating pseudo-testcross population (Stein

et al. 2007), using three different enzymes (EcoRI, HindIII

and PstI). In silico restriction analysis indicated that the

coding sequence had one restriction site for each one of the

enzymes used. Additional restriction sites occurring within

introns cannot be discarded. Therefore, it is possible that

two or even more bands which originated from the same

allele hybridized with the full-length probe. Hybridization

of DNA digested with EcoRI showed a total of seven

bands, while HindIII and PstI revealed a total of 11 and 5

bands, respectively. Even when the parental genotypes are

highly heterozygous tetraploids, these results seem to

indicate the presence of several members of a gene fam-

ily. In silico mapping analysis on the rice genome

detected three homologues with similar E-values located

on different chromosomes, namely LOC_Os02g48980,

LOC_Os06g19990 and LOC_Os09g12620, which also

evidences a moderate copy number for the gene family

members in the Poaceae. Bands co-segregating with apo-

mixis were readily detected, in agreement with results

reported in Laspina et al. (2008). Our results indicate the

Fig. 1 Multiple ClustalW

alignment of plant

GPI-anchored proteins amino

acid sequences recorded in

public databases. Accessions

and names: Z. mays (Zm1

NP_001148965.1, Zm2

NP_001137106.1 and Zm3

ACG39459.1), O. sativa (Os1

Os02g0721700, Os2

EAY87333.1 and Os3

ABR25668.1) and A. thaliana(At5g56170, encoding At

NP_200428.1). P. notatumN20GAP-1 shares between 80.5

and 50.3% amino acid sequence

identity with proteins from

maize, rice and arabidopsis.

Identical residues were

highlighted in black and similar

residues in grey

Plant Mol Biol

123

Author's personal copy

existence of several paralogues for n20gap in P. notatum,

all of which are detected by hybridizing with an n20gap-1

probe. At least one of the paralogues is located near the

ASGR (apospory specific genomic region). However, the

nature of this linked paralogue remains unknown. The

genomic DNA hybridization analysis is shown in Fig. 4.

Isolation of lorelei-like sequences from inflorescences

of an apomictic genotype

In order to extend the sequence toward the 50 and 30 UTR

regions and/or to isolate alleles/paralogues specifically

expressed in the apomictic genotype, MARATHON-RACE

(Rapid amplification of cDNA ends) (Chenchik et al. 1996)

experiments were carried out from inflorescences of the

apomictic genotype Q4117. Although the 50 RACE experi-

ments did not produce discrete bands, nested gene-specific

primers oriented downstream resulted in the recovery of 30

RACE products, allowing isolation of several unisequences

with highly significant similarity with the original N20

fragment (clones 27, 28, 29, 30, 32, 33, 34, 35 and 36).

Sequence alignments between RACE cDNA fragments and

the original N20 clone are shown in Fig. 5.

Sequences isolated from inflorescences of the apomictic

plant represented different alleles/gene members well-

conserved within the coding region but highly variable at

the 30 UTRs. Sequencing errors were considered not sig-

nificant, since variation involved strings of several nucle-

otides, and/or the same sequences were identified several

times in different sequencing reactions. Three groups of

sequences could be detected based on the 30 UTR similarity

(Family I—represented by clones 27, 28, 32, 33; Family

II—represented by clones 29, 34; Family III—represented

by clone 30). Clones 35 and 36 appeared to be incomplete,

showing exactly the same extension as the original N20

clone, but a slightly variable sequence.

Construction of a phylogenetic tree showed that

sequences representing the different families identified (I,

II and III) showed identical orthology relationship with

arabidopsis LORELEI sequences as the original n20gap-1

(Fig. 6). Therefore, they were considered to be alleles

originated from either paralogue At4g26466 or At5g56170.

However, the assignment of orthology is only tentative. It

is important to consider that ClustalW2 alignments were

performed only with a partial sequence (30-RACE

sequences encompassed only a part of the coding region

Fig. 2 Phylogeny tree including plant proteins similar to N20GAP-1.

a Tree including 33 plant rice, maize and arabidopsis sequences. As

expected, N20GAP-1 clustered closer to GPI-anchored proteins from

other Poaceae (maize and rice). b Tree including only arabidopsis

sequences. N20GAP-1 grouped preferentially with genes At4g26466

(LORELEI) and At5g56170 (LORELEI-like). Consensus trees fol-

lowing 2,000 bootstraps. The numbers on the branches indicate the

number of times the partition into the two sets that are separated by

that branch occurred among the trees, out of 100 trees

(100 = 100% = 2,000). At arabidopsis thaliana, In ipomoea nil, Osoryza sativa, Pp physcomitrella patens subsp. Patens, Ps picea

sitchensis, Pt populus trichocarpa, Rc ricinus communis, Vr vigna

radiata, Vv vitis vinifera, Zm zea mays

Plant Mol Biol

123

Author's personal copy

and the complete 30 UTR). Full protein sequences should

be used to establish more solid results.

Quantitative chronological characterization

of the n20gap family expression during apomictic

and sexual development

Real-time PCR experiments were conducted in order to

estimate n20gap activity levels at several sexual and

aposporous developmental stages covering the whole

reproductive calendar introduced in Laspina et al. (2008).

Spikelets from genotypes Q4188 (sexual) and Q4117

(apomictic) at pre-meiosis (step 0), late pre-meiosis/mei-

osis (steps I-II), post-meiosis (steps IV-V) and anthesis

(steps VII) were classified based on macromorphology

and microscopic observation of pollen developmental

stages, as indicated in Laspina et al. (2008). Initially, a

primer pair that amplified a short conserved sequence

within the protein coding region was used for amplifica-

tion. This primer pair was designed to target sequences

originated from all lorelei-like transcripts (it does not

discriminate alleles or paralogues). Each amplification

reaction was prepared in triplicate, and at least three

technical replicates were run.

In the sexual genotype (Q4188), the lowest activity was

observed at post-meiosis (Fig. 7a). N20gap was signifi-

cantly up-regulated at anthesis with respect to post-meiosis

(expression ratio: 3.488). No highly significant differential

activity was detected between pre-meiotic, meiotic and

post-meiotic stages. In the apomictic genotype (Q4117),

the lowest activity was detected at meiosis (Fig. 7b).

N20gap was significantly up-regulated at pre-meiosis with

respect to meiosis (expression ratio 10.98), at post-meiosis

with respect to meiosis (expression ratio 3.69) and at

anthesis with respect to meiosis (expression ratio 33.32).

Considering both the apomictic and sexual genotypes, two

activity peaks were detected: a minor one at pre-meiosis

and a major one at anthesis. However, a significantly

higher expression variation was observed for the apomictic

genotype with respect to the sexual one: maximal expres-

sion variation ratios of 3.69 and 33.32 were observed in the

sexual and the apomictic plants, respectively (Fig. 7a, b).

Regulation of expression seems to be more drastic in the

apomictic plant, since the distance between the minimal

and maximal expression level is very much increased. A

chronological comparative expression profile for the apo-

mictic and the sexual genotypes revealed that n20gap was

significantly up-regulated at pre-meiosis, post-meiosis and

Fig. 3 Multiple ClustalW

alignment of amino acid

sequences from arabidopsis

GPI-anchored proteins recorded

in public databases. P. notatumN20GAP-1 shares between 50.9

and 43.2% amino acid sequence

identity with proteins from

arabidopsis. Identical residues

are highlighted in black and

similar residues in grey. Genes

At4g28280 and At2g20700

generate two different proteins

each (a and b)

Plant Mol Biol

123

Author's personal copy

anthesis in the apomictic plant with respect to the sexual

one (Fig. 7c). In agreement with results reported by

Laspina et al. (2008), expression was slightly higher in the

sexual genotype at late pre-meiosis/meiosis. However,

significant differential expression could not be confirmed at

this particular stage. In summary, results showed in

Fig. 7a–c, suggest that n20gap maximal activity takes

place at anthesis, and differential regulation is occurring at

pre-meiosis, post-meiosis and anthesis between the apo-

mictic and the sexual genotypes used in this particular

analysis.

In situ hybridization experiments on reproductive

tissues

For a better characterization of the expression pattern, in situ

hybridization experiments were carried out on reproductive

tissues of the apomictic and sexual genotypes at late

premeiosis and anthesis. DIG-labelled antisense (NcoI-Sp6)

and sense (SalI-T7) probes obtained from n20gap-1 were

used to assess the specific location of expression (Fig. 8).

Probes generated from n20gap-1 have the potential to

hybridize with several P. notatum n20gap paralogues, as it

was shown in RFLP experiments, so the pattern observed

should be considered a combined signal. In situ hybridization

is not a quantitative technique, therefore it is not possible to

infer differential expression unless differences in signal

intensity were drastic.

The developmental phase of the flowers examined cor-

responded to stage I and stage VII in the reproductive

calendar of P. notatum (Laspina et al. 2008). Stage I

immediately precedes the megaspore mother cell differ-

entiation in sexual plants and the emergence of apospory

initials in the nucellus of aposporous plants. Candidate

transcripts displaying differential expression had originally

been isolated from inflorescences at this stage (Laspina

et al. 2008). Stage VII corresponds to anthesis, when a

maximal expression of n20gap was detected.

Hybridization with the N20 NcoI probe (antisense

probe) showed a moderate signal in stage I immature

ovules and pollen mother cells of the sexual genotype,

while the apomictic genotype displayed no significant

signal (Fig. 8). The N20 SalI probe (sense probe) produced

no significant signal in both plant types. A control probe

that originated from a transcript with uniform expression in

differential display experiments (N47) revealed compara-

ble signals in tissues from both plant types (not shown).

At anthesis, hybridization with the N20 NcoI probe

(antisense probe) showed a strong signal in ovules of the

apomictic genotype (Fig. 8). The signal was restricted to

the integuments, the nucellus, and the cytoplasm of the

embryo sac cells (egg cell apparatus and central cell). Lack

of hybridization at inner nucellus and inside the embryo sac

is probably due to the presence of massive vacuoles.

Hybridization in the sexual genotype followed a similar

pattern. The N20 SalI probe (sense probe) produced no

significant signal on both plant types. These results indi-

cated that the sense strand of the n20gap-1 gene is

expressed in integuments, nucellus and embryo sac cells in

both plant types.

Allele-specific expression

The n20gap general primers used in real-time PCR

experiments described in the previous section had been

designed to match conserved sequences included in the

GPI-anchored protein coding region, and did not discrim-

inate different alleles/paralogues within the n20gap family.

However, the prior identification of several alleles of

n20gap-1 allowed specific amplification based on the

Fig. 4 Genomic DNA hybridization analysis of n20gap in sexual and

apomictic P. notatum genotypes. a Sexual (SB) and Apomictic (AB)

bulked genomic DNAs digested with EcoRI, HindIII and PstI and

hybridized with clone n20gap-1 (680 bp) as a probe. Bulks were

made of genomic DNA originating from ten F1 sexual (SB) or ten F1

apomictic (AB) genotypes. Multiple band patterns revealed the

occurrence of several alleles/gene members for n20gap. Several

genetic polymorphisms were observed between bulks. b Hybridization

with n20gap-1 probe on debulked genomic DNA digested with

HindIII. Genomic DNAs originated from 5 sexual and 5 aposporous

F1 progenies from a segregating family. Arrows indicate bands co-

segregating with apospory. The fragment marked with an asterisk had

already been mapped onto the P. notatum genome, and was found to

be linked to the apospory-governing locus at 22 cM (Laspina et al.

2008). The DNA ladder (Lambda-EcoRI-HindIII) migration was

indicated on the left

Plant Mol Biol

123

Author's personal copy

sequence variation observed at the 30 UTR. Additional

primers were designed onto the 30 UTR region in order to

specifically amplify sequences corresponding to four

n20gap-1 alleles (Family I: alleles 27 and 28; Family II:

allele 34; Family III: allele 30). Bands of the expected

molecular weights corresponding to the specific alleles,

which originated from parental plants Q4117 and Q4188

genomic DNAs were observed in polyacrylamide gels (data

not shown). That indicated that all four alleles were present

in both tetraploid parental plants. Specific real-time PCRs

were performed for each allele (27, 28, 30 and 34) on

samples collected from the apomictic (Q4117) and sexual

(Q4188) genotypes at anthesis. Average expression ratios

are shown in Fig. 9.

Allele 27 did not amplify in the first 40 cycles. Allele 28

resulted over-expressed in the apomictic plant with respect

to the sexual one at a highly-significant level (ratio 4.150).

Alleles 30 and 34 were found over-expressed in the apo-

mictic plant with respect to the sexual one at a non-sig-

nificant level (ratios 2.022 and 2.112, respectively)

Fig. 5 Isolation of several

n20gap allelic sequences from

inflorescences of aposporous

P. notatum. The original N20

sequence had been isolated from

sexual plants. 30 RACE

extensions were obtained from a

MARATHON library originated

from an apomictic genotype

(Q4117). Sequences overlapped

with high similarity to the 30 end

of the N20 sequence, and

extended the sequence toward

the 30 UTR region. Three groups

of transcripts could be identified

based on the homology at the 30

UTR (group 1: clones 27, 28,

32, 33; group 2: clones 29, 31,

34 and group 3: clone 30).

Phylogenetic analysis shown in

Fig. 2 panels a and b was done

using the original N20 sequence

(the sequence at the top here).

Phylogenetic analysis shown in

Fig. 6 was done using allelic

sequences 27, 28, 30 and 34,

which represent all allelic

groups detected

Plant Mol Biol

123

Author's personal copy

(Fig. 9). Results indicate that transcripts originated from

n20gap allele 28 are significantly over-expressed in the

apomictic genotype at anthesis, and are probably respon-

sible for the increase of general expression shown in Fig. 7.

Discussion

GPI anchored proteins (GAPs) are broadly distributed

among eukaryotic organisms, including protozoa, fungi,

plants, insects, and mammals (Nosjean et al. 1997). They

vary widely in size, ranging from 12 to 175 kDa (Nosjean

et al. 1997). In mammals, they are generally located on lipid

rafts organized as discrete domains in the outer layer of the

cell membrane, exposed on the cell surface and attached to

the membrane by the glycosylphosphatidylinositol anchor.

GAPs can be released from their anchor into the extracellular

medium in a reaction catalyzed by phospholipase C. These

molecules display diverse biological functions, most of them

characterized in mammals and/or protozoans (Paulick and

Fig. 5 continued

Plant Mol Biol

123

Author's personal copy

Bertozzi 2008), participating in a variety of processes related

with cell to cell adhesion, cell to cell communication and

signal transduction. Some of them behave as enzymes, dis-

playing alkaline phosphatase, 50 nucleotidase, or peptidase

activities, among others (Paulick and Bertozzi 2008).

Limited functional characterization of GPI-anchored

proteins has been performed in plants. Only a few genes

encoding GAPs have been described in terms of function in

A. thaliana. The gene COBRA is required for polarized cell

expansion in the root (Schindelman et al. 2001), and the

gene NDR-1 is involved in signal transduction during dis-

ease resistance (Coppinger et al. 2004). A classical arabi-

nogalactan protein containing a GPI anchor has been

shown to be involved in the initiation of female gameto-

genesis in A. thaliana and has been proposed to be involved

in intercellular signalling between sporophytic and game-

tophytic cells (Acosta-Garcia and Vielle-Calzada 2004).

Characterization of the gametophytic A. thaliana LORELEI

Fig. 5 continued

Plant Mol Biol

123

Author's personal copy

mutants revealed that a GPI-anchored protein encoded by

gene At4g26466 was responsible for the altered phenotype,

consisting of an impaired delivery of the male sperm into

the egg-cell (Capron et al. 2008). Besides pollen tube

reception, lorelei also has a role in double fertilization and

early seed development (Tsukamoto et al. 2010).

Here we present the structural and expression charac-

terization of Paspalum notatum transcript n20gap-1, which

encodes a GPI-anchored protein and had been previously

associated with aposporous apomixis in P. notatum

(Laspina et al. 2008). Full sequencing allowed analysis of

the transcript and its derived protein structure and estima-

tion of their phylogenetic relationships with other plant

GPI-anchored proteins. The n20gap-1 sequence is highly

homologous to all A. thaliana LORELEI family members,

but appears to be more related with genes At4g26466

(LORELEI) and At5g56170 (LORELEI-like). General

primers which amplify all LORELEI-like family tran-

scripts revealed an increased expression in genotype Q4117

(apomictic) with respect to Q4188 (sexual) at premeiosis,

postmeiosis and anthesis. Allele-specific primers revealed

three particular alleles (28, 30 and 34) were overexpressed

in the apomictic genotype at anthesis, but only one of them

(28) at a highly-significant level. This observation suggests

that n20gap-1 expression pattern might be differential

between sexual and apomitic genotypes. However, the

assessment of association of an increased expression of

n20gap-1 with apomixis will require the analysis of a

significant number of sexual and apomictic genotypes. In a

future work we will evaluate expression in a significant

number of inflorescences collected from apomictic and

sexual F1 individuals derived from the cross Q4188 9

Q4117 at anthesis (the stage when maximal activity was

observed)

LORELEI (At4g26466) is expressed in the arabidopsis

synergid cells prior to fertilization, probably taking part in

a signalling mechanism by which the female gametophyte

recognizes the arrival of a compatible pollen tube and

promotes sperm release (Capron et al. 2008). Pollen tubes

reaching lorelei embryo sacs frequently do not rupture but

continue to grow. Furthermore, lorelei embryo sacs con-

tinue to attract additional pollen tubes after arrival of the

initial one (Capron et al. 2008). Transcription was detected

in ovaries from stage 12c and mature female gametophyte

Fig. 5 continued

Plant Mol Biol

123

Author's personal copy

containing stage 14 flowers. The gene is not expressed in

pollen, pollen tubes or in the stigma and style portions of

pistils, consistent with its female gametophyte-specific

function (Tsukamoto et al. 2010). Unlike LORELEI, the

rest of the arabidopsis LORELEI-related sequences

(At5g56170, At2g20700 and At4g28280) are expressed in

pollen, pollen tubes, sporophytic pistil tissues and in the

early stages of female gametophyte development in Ara-

bidopsis (stages 11 and 12a). However, during ovule

development, expression of LORELEI-like genes increases

at anthesis and overlaps with LORELEI (stages 12b, 12c

and 14) (Tsukamoto et al. 2010). General expression

quantitation for n20gap is in agreement with results

reported for their Arabidopsis putative orthologues. Real-

time PCR showed that n20gap-like sequences were

expressed at early stages of ovule development in the

sexual and apomictic genotypes. In situ hybridization pat-

terns revealed that the n20gap transcript expressed in

immature ovule and pollen mother cells of the sexual

genotype at late pre-meiosis. At anthesis, expression was

localized in integuments, nucellus, egg-cell apparatus and

the central cell in both plant types.

Since apomictic plants are characterized by the occur-

rence of parthenogenesis (embryo development in the

absence of fertilization) and pseudogamy (fertilization of

the polar nuclei to form the endosperm), it would be rel-

evant to determine if over-expression of At4g26466 and/or

At5g56170 could reveal developmental alterations related

with this trait late stages. Here we report that sexual

genotype Q4188 displayed lower levels of lorelei-like

transcripts expression with respect to aposporous genotype

Q4117 at pre-meiosis, post-meiosis and anthesis. Confir-

mation of differential expression should be carried out in a

Fig. 6 Phylogeny tree including four representative n20gap-1 alleles

and A. thaliana LORELEI sequences. Consensus tree following 2,000

bootstraps. Numbers on the branches indicate the number of times the

partition into the two sets that are separated by that branch occurred

among the trees, out of 100 trees. (100 = 100% = 2,000). All

P. notatum sequences clustered close to At4g26466 (LORELEI) and

At5g56170 (LORELEI-like) genes, so they were considered to

represent alleles of either of them

Fig. 7 Quantitative chronological characterization of n20gap family

expression during apomictic and sexual development. a Relative

expression ratios for sexual genotype Q4188 at premeiosis, meiosis,

postmeiosis and anthesis (reference stage: postmeiosis). b Relative

expression ratios for the apomictic genotype Q4117 at premeiosis,

meiosis, postmeiosis and anthesis (reference stage: meiosis). c Rela-

tive expression comparison for both genotypes at the different

developmental stages (reference stage: meiosis, apomictic genotype).

Error bars were not provided for the combination genotype/stage

with the minimal expression, because it was considered to be the

control sample (expression ratio 1) in the relative quantification

procedure. S sexual, A apomictic

Plant Mol Biol

123

Author's personal copy

significant number of apomictic and sexual plants, but the

present results suggest that an increased activity of these

candidates could bring out its probable function.

Apospory in P. notatum is governed by one or several

genes located within a single non-recombinant genomic

region of around 36 Mbp, which appears to have suffered

an inversion (Stein et al. 2004). The genetic linkage

between an n20gap gene and the ASGR (apospory specific

genomic region) had been reported previously (Laspina

et al. 2008) and was confirmed here. Since the probes used

to map the n20gap locus detect conserved regions, they did

not discriminate among paralogues, so the nature of the

n20gap-related sequence linked to the ASGR remains

unknown. In future work it should be determined which

one of the paralogues is actually linked to the ASGR. The

linkage between the n20gap gene and the ASGR and its

association with an altered expression needs also to be

investigated further. If only genetic components were

involved in the triggering of apomixis, the lack of full

linkage would have been enough evidence to discard it as

the gene governing the trait. However, if both genetic and

epigenetic factors were acting, n20gap or any other gene

located close to the apo-region should not be excluded as

possible triggers of the trait. The occurrence of particular

phenotypes associated with inversions that cause epigenetic

alterations of large neighbouring regions have been repor-

ted in other organisms (Grewal and Elgin 2002). Moreover,

the proximity of n20gap to the apospory-governing region

Fig. 8 Reproductive tissue in situ hybridization of sexual an

apomictic genotypes. a–d Show hybridization with the N20gap1NcoI probe (antisense probe) on reproductive organs at late-preme-

iosis. a and c Correspond to the apomictic genotype (Q4117), while

b and d to the sexual one (C4). e–l Show hybridization with the

N20gap1 NcoI probe (antisense probe) on reproductive organs at

anthesis. e–j Correspond to the apomictic genotype (Q4117), while

k and l to the sexual one. Expression is localized mainly in

integuments, nucella and embryo sac cells. m and n Show hybrid-

ization with the N20gap1 SalI probe (sense probe) on reproductive

organs of the apomictic and sexual genotype at anthesis, respectively.

ea egg apparatus, es embryo sac, in integuments, nu nucellus, Ovovule, pmc pollen mother cells. Bars: 100 lm

Plant Mol Biol

123

Author's personal copy

could be indicative of the existence of a cluster of repro-

ductive genes around the ASGR. If n20gap genes were

affected by trans-acting factors originated from the neigh-

bouring ASGR, genetic linkage would not be an essential

condition for differential activity. Alternatively, if n20gap

genes were regulated through an epigenetic mechanism

affecting a large region around the non-recombinant ASGR,

the existence of genetic linkage would be necessary for

differential activity. The minor activity peak observed at

early pre-meiosis, just before the differentiation of apospory

initials, together with the partial linkage to the ASGR,

favours the hypothesis that assigns a role of one or several

of the lorelei-like genes at the apospory onset. However, the

drastic activation of n20gap observed at a late develop-

mental stage (anthesis) and the prior evidence involving the

LORELEI family in the fertilization process supports its

function as a downstream participant rather than a trigger of

apomixis.

In the last few years a considerable amount of infor-

mation has been generated from several projects aimed at

exploring contrasting gene expression in inflorescences of

sexual and apomictic plants (Albertini et al. 2004; Laspina

et al. 2008; Cervigni et al. 2008; Sharbel et al. 2009;

Yamada-Akiyama et al. 2009). In parallel, detailed surveys

of transcripts expressed during A. thaliana megagameto-

phyte development also have been carried out, and an

important number of Arabidopsis gametophytic mutants

have been identified and characterized (Pagnussat et al.

2005; Hee-Ju et al. 2005; Steffen et al. 2007). The inte-

gration of information originating from both sources will

contribute to the elucidation of many of the developmental

steps involved in apomixis. Since apomixis frequently

occurs in wild, highly-heterozygous, poorly-characterized

species, the reference to model plants will greatly accel-

erate the discovery of the molecular pathways related to

this trait. However, the triggering of the character, the

regulation of gene activity, the association with polyploidy

and the occurrence of novel genes must of necessity be

examined directly in natural apomicts. It will be difficult or

even impractical to transfer results from model species

when investigating these particular issues.

Acknowledgments Thanks are due to Prof. Camilo Quarin for

kindly providing the plant material used in this work. We thank

Dr. Michael Hayward, Dr. Peggy Ozias-Akins and Dr. Marta Bianchi

for valuable corrections and suggestions that helped to improve the

manuscript. This work was funded by Agencia Nacional de Promo-

cion Cientıfica y Tecnologica, Argentina (ANPCyT PICT 2003

13578, PICT 2007 00476 and PME 2006 03083); Consejo Nacional

de Investigaciones Cientıficas y Tecnicas Argentina (CONICET, PIP

2008 6805); Centro Argentino Brasileno de Biotecnologıa (CABBIO

Proy. 2004 012). Podio M, Laspina N and Siena L received a fel-

lowship from CONICET (Consejo Nacional de Investigaciones

Cientıficas y Tecnicas, Argentina). Felitti SA, Seijo JG., Gonzalez

AM, Ortiz JPA and Pessino SC are career members of CONICET

(Consejo Nacional de Investigaciones Cientıficas y Tecnicas,

Argentina).

References

Acosta-Garcia G, Vielle-Calzada JP (2004) A classical arabinogalac-

tan protein is essential for the initiation of female gametogenesis

in Arabidopsis. Plant Cell 16:2614–2628

Akiyama Y, Hanna WW, Ozias-Akins P (2005) High-resolution

physical mapping reveals that the apospory-specific genomic

region (ASGR) in Cenchrus ciliaris is located on a heterochro-

matic and hemizygous region of a single chromosome. Theor

Appl Genet 111:1042–1051

Fig. 9 Quantitative expression characterization of n20gap-1 allelic

variants during apomictic and sexual development. The relative

expression ratios for different representative alleles (28, 30 and 34) at

anthesis is shown. a Allele 28. b Allele 30. c Allele 34. Expression of

allele 27 was undetectable. Standard deviations were indicated with

lines at the top of the bars. Error bars were not provided for the

sexual genotype, since it presented the minimal expression, and was

therefore considered to be the control sample (expression ratio 1) in

the relative quantification procedure. S sexual, A apomictic

Plant Mol Biol

123

Author's personal copy

Albertini E, Marconi G, Barcaccia G, Raggi L, Falcinelli M (2004)

Isolation of candidate genes for apomixis in Poa pratensis. Plant

Mol Biol 56:879–894

Albertini E, Marconi G, Reale L, Barcaccia G, Proceddu A, Ferranti F,

Falcinelli M (2005) SERK and APOSTART. Candidates genes for

apomixis in Poa pratensis. Plant Physiol 138:2185–2199

Bendtsen JD, Nielsen H, von Heijne G, Brunak S (2004) Improved

prediction of signal peptides-SignalP 3.0. J Mol Biol 340:783–795

Boisson-Dernier A, Frietsch S, Kim TH, Dizon MB, Schroeder JI

(2008) The peroxin loss-of-function mutation abstinence by

mutual consent disrupts male-female gametophyte recognition.

Curr Biol 18:63–68

Capron A, Gourgues M, Neiva LS, Faure J-E, Berger F, Pagnussat G,

Krishnan A, Alvarez-Mejia C, Vielle-Calzada J-P, Lee Y-R, Liu

B, Sundaresan V (2008) Maternal control of male-gamete

delivery in Arabidopsis involves a putative GPI-anchored protein

encoded by the LORELEI Gene. Plant Cell 20:3038–3049

Cervigni GDL, Paniego N, Pessino S, Selva JP, Dıaz M, Spangenberg

G, Echenique V (2008) Gene expression in diplosporous and

sexual Eragrostis curvula genotypes with differing ploidy levels.

Plant Mol Biol 67:11–23

Chenchik A, Mogadam F, Siebert P (1996) A new method for full-

length cDNA cloning by PCR. In: Krieg PA (ed) A laboratory

guide to RNA: isolation, analisis and synthesis. Wiley-Liss, Inc.,

New York, pp 273–321

Coppinger P, Repetti PP, Day B, Dahlbeck D, Mehlert A, Staskawicz

BJ (2004) Overexpression of the plasma membrane localized

NDR1 protein results in enhanced bacterial disease resistance in

Arabidopsis thaliana. Plant J 40:225–237

Crane C (2001) Classification of apomictic mechanisms. In: Savidan

Y, Carman G, Dresselhaus T (eds) Flowering of Apomixis: From

Mechanisms to Genetic Engineering. CIMMYT, IRD, European

Commission DG VI, Mexico, pp 24–43

Eisenhaber B, Wildpaner M, Schultz CJ, Borner GHH, Dupree P,

Eisenhaber F (2003) Glycosylphosphatidylinositol lipid anchor-

ing of plant proteins. Sensitive prediction from sequence- and

genome-wide studies for arabidopsis and rice. Plant Physiol

133:1691–1701

Felsenstein J (2005) PHYLIP (phylogeny inference package) version

3.6. Department of Genome Sciences, University of Washington,

Seattle

Gates RN, Quarin CL, Pedreira CGS (2004) Bahiagrass. In: Moser LE,

Burson BL, Sollenberger LE (eds) Warm-season (C4) grasses,

Agron. Monogr. 45. ASA, CSSA, SSSA, Madison, WI, pp 651–680

Grewal SI, Elgin SC (2002) Heterochromatin: new possibilities for

inheritance of structure. Curr Opin Genet Dev 12:178–187

Grossniklaus U (2001) From sexuality to apomixis: molecular and

genetic approaches. In: Savidan Y, Carman JG, Dresselhaus T

(eds) The flowering of apomixis: from mechanisms to genetic

engineering. Centro Internacional de Mejoramiento de Maız y

Trigo (CIMMYT), Mexico, pp 168–211

Hee-Ju Y, Hogan P, Sundaresan V (2005) Analysis of the female

gametophyte transcriptome of Arabidopsis by comparative

expression profiling. Plant Physiol 139:1853–1869

Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA,

McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R,

Thompson JD, Gibson TJ, Higgins DG (2007) Clustal W and

Clustal X version 2.0. Bioinformatics 23:2947–2948

Laspina NV, Vega T, Seijo JG, Gonzalez AM, Martelotto LG, Stein J,

Podio M, Ortiz JPA, Echenique VC, Quarin CL, Pessino SC

(2008) Gene expression analysis at the onset of aposporous

apomixis in Paspalum notatum. Plant Mol Biol 67:615–628

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression

data using real-time quantitative PCR and the 2-DDCt method.

Methods 25:402–408

Martınez EJ, Hopp E, Stein J, Ortiz JPA, Quarin CL (2003) Genetic

characterization of apospory in tetraploid Paspalum notatumbased on the identification of linked molecular markers. Mol

Breed 12(4):319–327

Murray MG, Thompson WF (1980) Rapid isolation of high molecular

weight plant DNA. Nucleic Acids Res 8:4321–4325

Nogler GA (1984) Gametophytic apomixis. In: Johri BM (ed)

Embryology of angiosperms. Springer, Berlin, pp 475–518

Nosjean O, Briolay A, Roux B (1997) Mammalian GPI proteins:

sorting, membrane residence and functions. Biochim Biophys

Acta 1331:153–186

Ortiz JPA, Pessino SC, Leblanc O, Hayward MD, Quarin CL (1997)

Genetic fingerprinting for determining the mode of reproduction

in Paspalum notatum, a subtropical apomictic forage grass.

Theor Appl Genet 95:850–856

Ortiz JPA, Pessino SC, Bhat V, Hayward MD, Quarin CL (2001) A

genetic linkage map of diploid Paspalum notatum. Crop Sci

41:823–830

Ozias-Akins P (2006) Apomixis: developmental characteristics and

genetics. Crit Rev Plant Sci 25:199–214

Ozias-Akins P, Roche D, Hanna WW (1998) Tight clustering and

hemizygosity of apomixis-linked molecular markers in Pennise-tum squamulatum implies genetic control of apospory by

divergent locus that may have no allelic form in sexual gentypes.

Proc Natl Acad Sci USA 95:5127–5132

Pagnussat GC, Yu HJ, Ngo QA, Rajani S, Mayalagu S, Johnson CS,

Capron A, Xie LF, Ye D, Sundaresan V (2005) Genetic and

molecular identification of genes required for female gameto-

phyte development and function in Arabidopsis. Development

132:603–614

Paulick MG, Bertozzi CR (2008) The glycosylphosphatidylinositol

anchor: a complex membrane-anchoring structure for proteins.

Biochemistry 47:6991–7000

Pupilli F, Lambobarda P, Caceres ME, Quarin CL, Arcioni S (2001)

The chromosome segment related to apomixis in Paspalumsimplex is homoeologous to the telomeric region of the long arm

of rice chromosome 12. Mol Breed 8:53–61

Pupilli F, Martınez EJ, Busti A, Calderini O, Quarin CL, Arcioni S

(2004) Comparative mapping reveals partial conservation of

synteny at the apomixis locus in Paspalum spp. Mol Genet

Genomics 270:539–548

Quarin CL (1992) The nature of apomixis and its origin in Panicoid

grasses. Apomixis Newsl 5:8–15

Quarin CL, Espinoza F, Martınez EJ, Pessino SC, Bovo OA (2001) A

rise of ploidy level induces the expression of apomixis in

Paspalum notatum. Sex Plant Reprod 13:243–249

Quarin CL, Urbani MH, Blount AR, Martınez EJ, Hack CM, Burton

GW, Quesenberry KH (2003) Registration of Q4188 and Q4205,

sexual tetraploid germplasm lines of Bahiagrass. Crop Sci

43:745–746

Quevillon E, Silventoinen V, Pillai S, Harte N, Mulder N, Apweiler

R, Lopez R (2005) InterProScan: protein domains identifier.

Nucleic Acids Res 33:W116–W120

Richards AJ (2003) Apomixis in flowering plants: an overview. Philos

Trans R Soc Lond B 358:1085–1093

Rodrigues JC, Cabral GB, Dusi DMA, Mello LV, Rinden D, Carneiro

VT (2003) Identification of differentially expressed cDNA

sequences in ovaries of sexual and apomictic plants of Brachi-aria brizantha. Plant Mol Biol 53:745–757

Sambrook J, Russell DW (2001) Molecular cloning: a laboratory

manual. Cold Spring Harbor Laboratory Press, Cold Spring

Harbor

Schindelman G, Morikami A, Jung J, Baskin TI, Carpita NC,

Derbyshire P, McCann MC, Benfey PN (2001) COBRA encodes

a putative GPI-anchored protein, which is polarly localized and

Plant Mol Biol

123

Author's personal copy

necessary for oriented cell expansion in Arabidopsis. Genes Dev

15:1115–1127

Sharbel T, Voigt M-L, Corral JM, Thiel T, Varshney A, Kumlehn J, Vogel

H, Rotter B (2009) Molecular signatures of apomictic and sexual

ovules in the Boechera holboellii complex. Plant J 58:870–882

Spillane C, Curtis MD, Grossniklaus U (2004) Apomixis technology

development-virgin birth in farmers’ fields. Nat Biotechnol

22(6):687–691

Steffen JG, Kang I, MacFarlane J, Drews GN (2007) Identification of

genes expressed in the Arabidopsis female gametophyte. Plant J

51:281–292

Stein J, Quarin CL, Martınez EJ, Pessino SC, Ortiz JPA (2004)

Tetraploid races of Paspalum notatum show polysomic inheri-

tance with preferential chromosome pairing and suppression of

recombination around the apospory-controlling locus. Theoret

Appl Genet 109:186–191

Stein J, Pessino SC, Martınez EJ, Rodrıguez MP, Siena LA, Quarin

CL, Ortiz JPA (2007) A genetic map of tetraploid Paspalumnotatum Flugge (bahiagrass) based on single-dose molecular

markers. Mol Breed 20:153–166

Tsukamoto T, Qin Y, Huang Y, Dunatunga D, Palanivelu R (2010) A

role for LORELEI, a putative glycosylphosphatidylinositol

anchored protein, in Arabidopsis thaliana double fertilization

and early seed development. Plant J 62:571–588

Yamada-Akiyama H, Akiyama Y, Ebina M, Xu Q, Tsuruta S, Yazaki

J, Kishimoto N, Kikuchi S, Takahara M, Takamizo T, Sugita S,

Nakagawa H (2009) Analysis of expressed sequence tags in

apomictic guineagrass (Panicum maximum). J Plant Physiol

166:750–761

Plant Mol Biol

123

Author's personal copy