Wnt Signaling Has Opposing Roles in the Developing and the Adult Brain That Are Modulated by Hipk1

Wnt Signaling Has Opposing Roles in the Developing and the Adult Brain That AreModulated by Hipk1

Cinzia Marinaro1, Maria Pannese2, Franziska Weinandy3, Alessandro Sessa4, Andrea Bergamaschi1, Makoto M. Taketo5,

Vania Broccoli4, Giancarlo Comi6, Magdalena Gotz3, Gianvito Martino1 and Luca Muzio1

1Neuroimmunology Unit, Institute of Experimental Neurology (INSPE), Division of Neuroscience and 2Genetic Expression Unit,

Department of Genetics and Cell Biology, San Raffaele Scientific Institute, Milan, Italy, 3Institute of Stem Cell Research, National

Research Center for Environment and Health Institute of Stem Cell Research, 85764 Neuherberg-Munich, Germany, 4Stem Cells and

Neurogenesis Unit, Division of Neuroscience, San Raffaele Scientific Institute, 20132 Milan, Italy, 5Department of Pharmacology,

Graduate School of Medicine, Kyoto University, Kyoto 606-8501, Japan and 6Department of Neurology, Institute of Experimental

Neurology (INSPE), San Raffaele Scientific Institute, 20132 Milan, Italy.

Gianvito Martino and Luca Muzio have contributed equally to this work.

Address correspondence to Luca Muzio, Neuroimmunology Unit, Institute of Experimental Neurology (INSPE), Division of Neuroscience San Raffaele

Scientific Institute, 20132 Milan, Italy. Email: [email protected].

The canonical Wnt/Wingless pathway is implicated in regulatingcell proliferation and cell differentiation of neural stem/progenitorcells. Depending on the context, b-Catenin, a key mediator of theWnt signaling pathway, may regulate either cell proliferation ordifferentiation. Here, we show that b-Catenin signaling regulates thedifferentiation of neural stem/progenitor cells in the presence of theb-Catenin interactor Homeodomain interacting protein kinase-1 gene(Hipk1). On one hand, Hipk1 is expressed at low levels during theentire embryonic forebrain development, allowing b-Catenin to fosterproliferation and to inhibit differentiation of neural stem/progenitorcells. On the other hand, Hipk1 expression dramatically increases inneural stem/progenitor cells, residing within the subventricular zone(SVZ), at the time when the canonical Wnt signaling induces celldifferentiation. Analysis of mouse brains electroporated with Hipk1,and the active form of b-Catenin reveals that coexpression of bothgenes induces proliferating neural stem/progenitor cells to escapethe cell cycle. Moreover, in SVZ derive neurospheres cultures,the overexpression of both genes increases the expression of thecell-cycle inhibitor P16Ink4. Therefore, our data confirm that theb-Catenin signaling plays a dual role in controlling cell proliferation/differentiation in the brain and indicate that Hipk1 is the crucialinteractor able to revert the outcome of b-Catenin signaling in neuralstem/progenitor cells of adult germinal niches.

Keywords: b-Catenin, Hipk1, Stem cells, SVZ, Wnt

Introduction

During early forebrain development, cortical radial glia (RG)

preferentially undergo symmetric cell divisions (Haydar et al.

2003) to tangentially expand the cortical field (Chenn and

Walsh 2003). At later time points, RG switch to asymmetric cell

divisions, diminish their number into germinal niches, and

migrate as differentiated cells toward the cortical plate (Haydar

et al. 2003). Nevertheless, a subset of RG persist in germinal

neurogenic areas of the mature brain as adult neural stem/

precursor cells (aNPCs) (Gotz and Huttner 2005) where they

continue to generate new neurons fated to become olfactory

bulbs neurons. Several molecular machineries, acting in pro-

liferating RG of developing forebrain, are also operating in adult

germinal neurogenic areas (Doetsch and Alvarez-Buylla 1996;

Brill et al. 2009). Among them, the canonical Wnt signaling

exerts a critical role (Dickinson et al. 1994; Lee et al. 2000;

Backman et al. 2005; Subramanian et al. 2009). Wnts are

secreted glycoproteins (Galceran et al. 2000; Lee et al. 2000),

bind to specific cell-surface receptor belonging to the Frizzled

protein family, and activate the protein Disheveled (Dsh). This

latter protein, in turn, induces the reduction of Glycogen

Synthase Kinase (GSK-3b) activity (Cook et al. 1996). This

event leads to the accumulation of b-Catenin in the cytoplasm

as well as its nuclear migration and target gene regulation

(Willert and Nusse 1998). On the other hand, in the absence

of the Wnt intracellular signaling cascade, GSK-3b induces

b-Catenin degradation throughout its phosphorylation.

There is a large body of evidence indicating several different

roles exerted by Wnt signaling in both developing and aNPCs.

Wnts transiently induce RG to proliferate during early neuro-

genesis (Logan and Nusse 2004), induce midend gestational RG

to differentiate by promoting the expression of proneural genes,

such as Ngn1 (Hirabayashi et al. 2004; Israsena et al. 2004;

Guillemot 2007), force aNPCs of the adult dentate gyrus to exit

the cell cycle by modulating the expression of NeuroD1

(Kuwabara et al. 2009), and increase proliferating rates of

Mash1+progenitor cells belonging to the adult subventricular

zone (SVZ) (Adachi et al. 2007). The effects exerted by Wnt

signaling on RG versus aNPCs are largely depending on the

context in which such pathway operates and, above all, on the

presence of specific interactor proteins. For instance, secreted

Frizzled--related proteins (Sfrps) and Dickkopf (Dkk1) are

extracellular Wnt’s inhibitors (Semenov et al. 2001; Mao et al.

2002; Bovolenta et al. 2008), while Groucho proteins repress the

activation of Wnt/b-Catenin downstream genes by acting in the

nucleus on TCF/Lef-dependent targets (Daniels and Weis 2005).

Here, we show that the opposite role exerted by Wnts on

proliferating RG versus aNPCs is largely depending on the

presence of the Homeobox-interacting protein kinase1

(Hipk1) gene. Hipk1 is scarcely expressed in RG forced by

Wnts to proliferate while it raises in SVZ aNPCs forced by Wnts

to differentiate. We also found that Hipk1 operates within SVZ

aNPCs owing to the fact that it induces the expression of

p16INK4a by physically interacting with b-Catenin.

Materials and Methods

Mouse Strains and Husbandryb-Cateninflox/flox transgenic mouse line was provided by Jackson

laboratories (Brault et al. 2001), b-CateninEx3 mouse line contains

2 LoxP sequences upstream and downstream the b-Catenin third

� The Author 2011. Published by Oxford University Press. All rights reserved.

For permissions, please e-mail: [email protected]

doi:10.1093/cercor/bhr320

Advance Access publication November 17, 2011

Cerebral Cortex October 2012;22:2415– 2427

by guest on Decem

ber 2, 2016http://cercor.oxfordjournals.org/

Dow

nloaded from

http://cercor.oxfordjournals.org/

exon (Harada et al. 1999), BAT-Gal transgenic mouse line was provided

by Dr Piccolo (Maretto et al. 2003), and GlastCreERT2 transgenic mouse

line was provided by Dr Gotz (Mori et al. 2006). GfapCre mouse line

(Zhuo et al. 2001) was obtained from Jackson laboratory, and

NestinCreERT2 mouse line was provided by Dr Kageyama (Imayoshi

et al. 2008). Transgenic mice were repeatedly backcrossed onto

C57BL/6 (Charles River) mice and were genotyped by polymerase

chain reaction (PCR) as previously described (Harada et al. 1999; Brault

et al. 2001; Zhuo et al. 2001; Maretto et al. 2003; Mori et al. 2006).

Postnatal mice were injected with bromodeoxyuridine (BrdU)

(100 mg/kg) for 9 h before the sacrifice. They were killed by anesthetic

overdose and transcardially perfused with 4% paraformaldehyde in

phosphate-buffered saline (PBS) pH 7.2. Brains were then fixed 4%

paraformaldehyde in PBS pH 7.2 for 12 h at +4 �C and cryoprotected for

24 h in 30% Sucrose (Sigma) in PBS at +4 �C. Brains were subsequently

sectioned at 10 lm. b-Galactosidase assay was performed on 200-lmthick slices adult BAT-Gal slices as previously described (Mallamaci

et al. 2000). Pregnant female was killed by cervical dislocation at

appropriate time points, and brains were collected in ice-cold PBS as

previously described (Muzio et al. 2002). Before the sacrifice, pregnant

dams received the injections of the S-phase tracer EdU (5-ethynyl-

2#-deoxyuridine; Invitrogen) at the concentration of 100 mg/kg. All

efforts were made to minimize animal suffering and to reduce the

number of mice used, in accordance with the European Communities

Council Directive of 24 November 1986 (86/609/EEC). All procedures

involving animals were performed according to the guidelines of the

Institutional Animal Care and Use Committee of the San Raffaele

Scientific Institute (IACUC number 429). GlastCreERT2 transgenic mice

were crossed with b-Cateninflox/flox and Rosa26YFP mice. Starting from

P30, mice received 2 Tam treatments (Tam, 2 mg/day, LASvendi) of

1 week each with a washing out period of 1 week in between. Long-

term effects of b-Catenin deprivation were analyzed 2 months after the

last injection. NestinCreERT2 mice were crossed with b-CateninEx3

mice, and starting from P30, double transgenic mice were injected with

Tam (5 mg/day, Sigma) for 5 consecutive days. A washing-out period of

time of 1 week was applied and then mice were injected with EdU for

9 h before the sacrifice.

Immunofluorescence and In Situ HybridizationImmunofluorescence was performed as previously described

(Centonze et al.). Sections were washed for 5 min 3 times in PBS and

then incubated in the blocking mix (PBS 13/FBS 10%/BSA 1 mg/mL/

Triton X 100 0.1%), for 1 h at room temperature. Antibodies were

diluted in blocking mix and incubated at + 4�C overnight as suggested

by manufacturer’s instructions. The following day, sections were

washed in PBS for 5 min, 3 times, and fluorescent secondary antibodies

diluted in blocking mix (concentration suggested by the manufac-

turer’s instructions) were applied. Slides were washed 3 times in PBS

for 5 min and incubated in Dapi solution for nuclei counterstaining.

When necessary, antigens were unmasked by boiling samples in 10 mM

sodium citrate (pH 6) for 5 min.

The following antibodies were used: a-mouse TuJ1 (Babco), rabbit

a-phospho H3 (Upstate), rabbit a-glial fibrillary acidic protein (GFAP;

Dako), mouse a-GFP (Abcam), chicken a-GFP (Chemicon), rabbit a-GFP(Molecular probes), rat a-Dcx (SantaCruz), rat a-BrdU (Abcam), mouse

a-BrdU (BD), EdU detection kit (Invitrogen), rabbit a-Tbr2 (Millipore),

mouse a-RC2 (Millipore), rabbit a-LacZ (Abcam), rabbit a-Olig2

(Millipore) and rabbit a-Id-1 (Bio Check Ink.), mouse a-Cre (Chemicon),

rabbit a-Iba-1 (Wako), mouse a-PSA-NCAM (Santa Cruz), and rabbit

a-NG2 (Chemicon). Appropriate fluorophore-conjugated secondary

antibodies (Alexa-fluor 488, 546, and 633, Molecular Probes) were used.

Nuclei were stained with 4#-6-Diamidino-2-phenylindole (DAPI; Roche).

Id-1 was detected by using the TSA System (Perkin Elmer). Light

(Olympus, BX51 with 34 and 320 objectives) and confocal (Leica, SP5

with340 objective)microscopywas performed to analyze tissue and cell

staining. Analysis was performed by using Leica LCS lite software and

Adobe Photoshop CS software.

In situ hybridization was performed as previously described (Muzio

et al. 2002; Centonze et al. 2009). Briefly, Ten-micrometer thick brain

sections were postfixed 15 min in 4% paraformaldehyde then washed

3 times in PBS. Slides were incubated in 0.5 mg/mL of Proteinase K in

100 mM Tris-HCl (pH 8) and 50 mM Ethylenediaminetetraacetic acid

(EDTA) for 10 min at 30 �C. This was followed by 15 min in 4%

paraformaldehyde. Slices were then washed 3 times in PBS then washed

in H2O. Sections were incubated in Triethanolamine 0.1 M (pH 8) for

5 min, then 400 lL of acetic anhydride was added 2 times for 5 min

each. Finally, sections were rinsed in H2O for 2 min and air-dried.

Hybridization was performed overnight at 60 �C with P33 riboprobes at

a concentration ranging from 106 to 107 counts per minute (cpm). The

following day, sections were rinsed in SSC 53 for 5 min then washed in

Formamide 50% SSC 2 3 for 30 min at 60 �C. Then slides were

incubated in Ribonuclease-A (Roche) 20 mg/mL in 0.5 M NaCl, 10 mM

Tris-HCl (pH 8), and 5 mM EDTA 30 min at 37 �C. Sections were

washed in Formamide 50% SSC 23 for 30 min at 60 �C then slides were

rinsed 2 times in SSC 23. Finally, slides were dried by using Ethanol

series. Lm1 (Amersham) emulsion was applied in dark room, according

to manufacturer instructions. After 1 week, sections were developed in

dark room, counterstained with Dapi, and mounted with DPX (BDH)

mounting solution. Mouse Hipk1 probe was generated by PCR on the

basis of the National Center for Biotechnology Information (NCBI)

reference (from nt735 to nt2160 of NCBI Reference Sequence

NM_010432.2), and LacZ riboprobes correspond to the entire

complementary deoxyribonucleic acid (cDNA) obtained from the

pcDNA 3.1-LacZ plasmid.

Tunel AssayTen-micrometer thick sections from E16.5 forebrains were postfixed

in 4% paraformaldehyde, then incubated in Proteinase K buffer for 5#at room temperature, and then exposed to 10 mg/mL Proteinase K

for 15# at room temperature. Reaction was stopped by washing samples

3 times in PBS 13. Slices were then incubated with terminal transferase

buffer for 15# before adding the following reagents: 10 lg/mL Biotin

16-dUTP, 1 mm CoCl2, and 10 U/mL of terminal transferase (Roche).

Reaction was incubated 1 h at 37 �C and stopped with H2O.

Endogenous peroxidase quenching was achieved by incubating slices

in 0.1% H2O2 for 15#. Slices were incubated in blocking buffer (10%

FBS, PBS 13) for 15# and then incubated in Streptavidin/Biotin

amplification kit (Vector) for 2 h. Reaction product was visualized

with 0.05% diaminobenzidine and 0.005% H2O2. Positive controls were

obtained by incubating slices in 3 U/mL DNase for 15# at room

temperature.

Neurospheres CulturesNeurospheres cultures were derived from the SVZ of P30 BAT-Gal

brains as previously described (Pluchino et al. 2008). Briefly, brains

were cut in coronal sections from anterior pole of the brain. The dorsal

SVZ were then microdissected from section approximately 2 mm far

from the anterior pole, and tissues were subsequently incubated 30 min

at 37 �C in Earle’s Balanced Salt solution supplemented with 1 mg/mL

of Papain (27 U/mg, Sigma), 0.2 mg/mL Cysteine (Sigma), and 0.2 mg/mL

EDTA (Sigma). Cells were then transferred in culture media Neurocult

NSCproliferationmedium(StemCell technology) supplementedwith 20

ng/mL Epidermal growth factor (Provitro), 10 ng/mL Basic fibroblast

growth factor (Provitro), and 2 lg/mLHeparin (Sigma). Cellswere plated

at the density of 8000/cm2 and maintained for more than 10 in vitro

passages. Differentiation of aNPCs (n = 3 independent cultures) was

obtained by using the Neurocult NSC differentiation medium (Stem Cell

technology). Briefly, single suspension of cells was plated on Matrigel

(BD) coated 10 mm dishes at the density of 30 000/cm2. Cells were

collected every 2 days starting from the day of plating for real-time (RT)

PCR assays. b-Cateninflox/flox neurospheres cultures were generated as

above and infected with lentiviruses (LVs) expressing the Cre

recombinase or the green fluorescent protein (GFP) (n = 3 independent

experiments) as previously described (Muzio et al. 2009). Vesicular

stomatitis virus-pseudotyped lentivirus generation: pRRLsin.PPT.hCMV

iCre-ires-GFP, Pre plasmid (Borello et al. 2006) was transfected with the

following plasmids: pMDLg/pRRE, pRSV-REV, and pMD2.VSVG into 293T

cells. Then, 14--16 h after DNA transfection, the mediumwas substituted

with fresh culture medium. Thirty-six hours later, cells supernatants

were collected and filtered through a 0.22-lm pore nitrocellulose filter.

To obtain high-titer vector stocks, the cells supernatants were

Hipk1 and b-Catenin Regulate Proliferation of Cortical Precursor Cells d Marinaro et al.2416

by guest on Decem


Dow

nloaded from


concentrated by ultracentrifugation (55 kg, 140 min, 20 �C). Then,supernatantswerediscarded, and thepelletswere suspended in 100 lLof PBS 13, split in 20 lL aliquots, and stored at –80 �C. LV stocks

were titrated by infecting HeLa cells with serial dilution of the viral

stocks. Then, after 5 days, cells were harvested and titer was

calculated on the basis of GFP expression by flow cytometry.

b-Cateninflox/flox neurospheres were dissociated in single cells and

plated at the concentration of 50 000/well. Soon after plating cells

received iCre- or GFP-expressing lentiviruses, and cells were

collected at days 8 and 9 after lentivirus delivery for western blot

and RT analysis.

X-Gal staining on BAT-Gal derived aNPCs (n = 3 independent

neurospheres cultures) was performed as follow. Briefly, upon fixation

in 0.2% glutaraldehyde, 2% formaldehyde in 0.1 M phosphate buffer

pH 7.4, supplemented with 2 mM MgCl2, and 5 mM ethyleneglycol-bis

(2-aminoethylether)-N,N,N#,N#-tetra acetic acid for 5 min, cells were

washed 3 times in PBS 13 and incubated in the staining solution

(PBS 13, MgCl2 2 mM, Na-Deoxycholate 0.01%, Nonidet P.40 0.02%

supplemented with potassium ferricyanide 5 mM, potassium ferrocy-

anide 5 mM, and 1 mg/mL X-gal) overnight. Cells were then washed

3 times in PBS 13 and collected on cover slip for the analysis.

Neurospheres cultures were also nucleofected by using Amaxa

Mouse NSC Nucleofector kit. Briefly, 6 3 106 single cells derived from

established BAT-Gal neurospheres cultures (n = 3 independent

cultures) were combined with 1 lg of Nestin-D90-b-Catenin-GFPwith or without increasing amounts of CMV-fHIPK1 (1 or 2 lg) and

then transferred in a single cuvette for nucleofection (Program A-033)

accordingly with manufacturer’s instructions. After nucleofections,

cells were grown in standard culture medium for 24 h before total RNA

extraction.

Chromatin Immune PrecipitationNeurospheres cultures from the SVZ of P30 BAT-Gal mice2 Q3 were

obtained as above described and then used for chromatin immune

precipitation (ChiP) assay. Undifferentiated and differentiated neural

stem cells (2 3 106) were collected and fixed in 1% formaldehyde.

Extracts were incubated in cytoplasmic and nuclear lysis buffers.

Sonication was performed in ice (Branson sonicator 450, 8 3 10$), andextracts were subsequently precleaned in Protein-A sepharose (Sigma)

(20% of supernatants were collected as inputs). Each sample was then

probed overnight with following antibodies: rabbit a-b-Catenin (cell

signaling), rabbit a-GFP (molecular probes), or vehicle. Extracts were

then incubated with Protein-A sepharose (Sigma) for 3 h and washed

with low salt buffer, high salt buffer, LiCl buffer, and 10 mM Tris-HCl

pH8, 1 mM EDTA pH8.5 buffer. Elution of complexes was performed

by adding the elution buffer (1% Sodium dodecyl sulfate [SDS],

0.1%NaHCO3). Reverse cross-linking reaction was performed by

incubating extracts in RNase A (0.02 mg/mL), NaCl 0.3 M at 65 �Cfor 4 h. Samples were then extracted with Phenol/Chloroform

extraction buffer accordingly to standard laboratory procedures and

resuspended in 50 lL of H2O. One microliter from each sample was

used for the detection of p16INK4a promoter region by using PCR and

the following primers: p16INK4a ChiP F: GTTGCACTGGGGAGGAAG-

GAGAGA and p16INK4a ChiP R: CCTGCTACCCACGCTAACACC.

Amplicons were detected by standard agarose electrophoresis.

Real-Time PCRTotal RNA was extracted by using RNeasy Mini Kit (Qiagen) according

to manufacturer’s recommendations including DNase (Promega) di-

gestion. cDNA synthesis was performed by using ThermoScript RT-PCR

System (Invitrogen) and Random Hexamer (Invitrogen) according to

the manufacturer’s instructions in final a volume of 20 lL. The

LightCycler 480 System (Roche) and SYBR Green JumpStart Taq

ReadyMix for High Throughput Q-PCR (Sigma). Depending from

experiments, samples were normalized by using the following

housekeeping genes: Histone H3 and b-actin. b-actin F: GACTCC-

TATGTGGGTGACGAGG; b-actin R: CATGGCTGGGGTGTTGAAGGTC;

H3 F: GGTGAAGAAACCTCATCGTTACAGG CCTGGTAC; H3 R: CTGC-

AAAGCACCAATAGCTGCAC TCTGGAAGC. Gene specific primers:

p16INK4a F: CCTGGAACTTCGCGGCCAATCCC; p16INK4a R: GCTCC-

CTCCCTCTGCTCCCTCC; p19Arf F: CTGGGGGCGGCGCTTCTCACC;

p19Arf R: TCTAGCCTCAACAACATGTTCACG; Human p16INK4a

F: TTCCTGGACACGCTGGTGGTG; Human p16INK4a R: ATCGGG-

GATGTCTGAGGGACC; Hipk1 F: GCTAGCTGACTGGAGGAATGCC;

Hipk1 R: TGGTCTTGGACAGGAACTAGGG; Ki67 F: CCGAACAGACTT-

GCTCTGGCCTAC; Ki67 R: CTGGGCTGTGAGTGCCAAGAGAC; Lef1 F:

CCGTGGTGCAGCCCTCTCACGC; Lef1 R: ATTTCAGGAGCTGGAGGG-

TGTCTGG.

Luciferase AssayTOP-Flash luciferase reporter plasmid was a gift from R. T. Moon

(University of Washington, Seattle), while Fop-Flash plasmid was

purchased by Chemicon. Luciferase assays were performed by using

the dual-luciferase assay system (Promega, Madison, WI) accordingly

with manufacturer’ instructions. Hek293T cells (4.5 3 104) were

seeded in 12-well plates and transfected with TOP-Flash (0.5 lg), prlTK(0.1 lg), D90-bCatenin/GFP (0.5 lg), and increasing concentration of

fHipk1 (0.1, 0.5, 0.7, 1, and 2 lg). Control experiments were done by

transfecting cells with Fop-Flash plasmid (0.5 lg), prlTK (0.1 lg), D90-bCatenin/GFP (0.5 lg), and fHipk1 (2lg). Measurement of luciferase

activity was done by using the dual-luciferase system (Promega) on

a luminometer (GloMax 20/20 Luminometer; Promega). Relative

luciferase activity was reported as a ratio of firefly over Renilla

luciferase readouts.

Western Blot and Protein CoimmunoprecipitationWestern blot detection of antigens was performed as previously described

(Centonze et al. 2009). Briefly, 106 b-Cateninflox/flox cells were infected

with Cre-ires-GFP or GFP lentiviruses at Multiplicity Of Infection of 10.

Upon infection, cells were collected, respectively, at days 8 and 9. Total

cell extracts were obtained by incubating cells in lyses buffer (Sucrose 320

mM [Sigma], 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid 1 mM pH

7.4 [Sigma], and MgCl2 1 mM (Sigma) supplemented with Protease

inhibitor cocktail, Sigma). Ten micrograms of each protein extract was run

on SDS--polyacrylamide gel electrophoresis (PAGE) electrophoresis and

subsequently blotted on nitrocellulose (Millipore). The following primary

antibodies were used: rabbit a-b-Catenin (Cell signaling), rabbit a-GFP(Chemicon), mouse a-Active Caspase3 (Cell Signaling), and mouse

a-b-Actin (Sigma). Secondary antibodies (Biorad) were incubated for 2 h

at RT, and signals were revealed by using Millipore ECL kit.

Coimmunoprecipitation was performed on HEK-293T cells trans-

fected with the following plasmids: TOP-Flash luciferase reporter, D90-b-Catenin/GFP, and pCMV-fHipk1. Briefly, 106 HEK-293T were trans-

fected with 2 lg of TOP-Flash plasmid, 4 lg of D90-b-Catenin/GFP with

or without 4 lg of pCMV-fHipk1. Forty-eight hours later, cells were

incubated in lyses buffer (Tris-HCl pH 7.5 20 mM, NaCl 100 mM, EDTA

5 mM, Triton 1%, Glycerol 10%, Na3VO4 1 mM, Na4P2O7 40 mM

supplemented with Protease inhibitor cocktail, Sigma). Then, 50 lL of

Protein-A (Sigma) sepharose beads were incubated with lysate for 1 h

at +4 �C. Lysates were then incubated with mouse a-Flag (2 lg/mL,

Sigma) for 2 h and then 100 lL of Protein A sepharose were added to

the lysates. Lysates were further incubated for 2 h with Protein A beads,

and subsequently, beads were separated by centrifugation. Protein A

beads were subsequently washed 6 times with lyses buffer, and finally,

elution was performed by adding SDS loading buffer directly to beads.

Co-IP samples, inputs, and washes were run on SDS--PAGE and then

blotted on nitrocellulose. Rabbit a-GFP (Abcam) primary antibody was

used to detect D90-b-Catenin-GFP protein. Western blot represents

1 over 3 independent experiments. Total extract from parallel

transfections was used for RT-PCR detection of human p16INK4a

expression as above described.

In Utero ElectroporationThe following plasmids were introduced into progenitor cells of E13.5

(CD1, Charles River) embryos: pCAG-GFP (0.1 lg/lL), Nestin-D90-b-Catenin-GFP (1 lg/lL), pCMV-fHipk1 (1 lg/lL). Plasmids were

mixed with 0.01% Fast green (Sigma), and 1--2 lL of each DNA mix was

injected into the ventricle through a fine glass capillary. Electrodes

(Tweezertrodes, BTX Harvard Apparatus) were placed flanking the

2417Cerebral Cortex October 2012, V 22 N 10

by guest on Decem


Dow

nloaded from


ventricular region of each embryo covered by a drop of PBS and pulsed

4 times at 40 V for 50 ms separated by intervals of 950 ms with a square

wave electroporator (ECM 830, BTX Harvard Apparatus). Then, the

uterine horn was placed back into the abdominal cavity and filled with

warm PBS 13. Accordingly to the experimental plan, brains were

collected 3 days or 40 h after electroporations. BLOCK-it miR RNAi

selected oligos for Hipk1 interference (Mmi-51128; Mmi-51129; Mmi-

51130; Mmi-51131, efficient functioning was tested by transfecting

293T cells) were purchased by Invitrogen, cloned into pcDNA6.2-GW/

miR vector, and electroporated at the concentration of 250 ng/lL each

into E13.5 embryos. Controls were electroporated with pcDNA6.2-GW/

miR LacZ at the concentration of 1 lg/lL. Embryos were collected at

E16.5 and pulsed with EdU 2 h before the sacrifice. Electroporation was

also done at E16.5 (CD1, Charles River). Embryos received pCAG-GFP

(0.1 lg/lL) with or without the Nestin-D90-b-Catenin-GFP (1 lg/lL)plasmids. Electroporation was done as above described, and brains were

collected at P10. Six hours before the sacrifice mice were repeatedly

injected with EdU (100 mg/kg every 2 h). GFP-expressing brains were

fixed in 4% paraformaldehyde and processed for immune fluorescence.

Only embryos showing comparable electroporated patches were

included in our analysis.

StatisticsBar graphs represent the mean value ± standard error of the mean or

the mean value ± standard deviation. Data were analyzed as appropriate

by Student’s t-test or by one-way analysis of variance (ANOVA) using

Graph-Pad Prism version 4. A Significance was accepted when P < 0.05.

Results

b-Catenin Stimulates Cell Proliferation and Inhibits theExpression of Tbr2 in Progenitors of the DevelopingForebrain

We generated embryos expressing the constitutively active

form of b-Catenin by crossing the b-CateninEx3 transgenic

mouse line, which contains 2 loxP sequences upstream and

downstream the third exon of b-Catenin (Harada et al. 1999)

with GfapCre mice. In this new transgenic mouse line,

recombined b-Catenin becomes stabilized and constitutively

active in the nucleus in virtually all RG of E13.5 cerebral cortex

and the hippocampus (Fig. 1A) (Zhuo et al. 2001). GfapCre/

b-CateninEx3 brains collected at P21 and P30 displayed

a significant expansion of the tangential surface of the brain

(Fig. 1B and not shown) and a severe reduction of the cortical

thickness (Fig. 1C and not shown). We further characterized

double transgenic mice at E14.5, that is, 1 day after the activation

of the constitutively active form of b-Catenin; they showed

a significant increase of the cerebral cortex surface (Fig. 1D--F).

At this stage, we also analyzed the effects of b-Cateninstabilization on RG by staining sections for the RG marker RC2

(Hartfuss et al. 2001). In wild-type (WT) mice, RG showed the

classical palisade organization, while they were severely disor-

ganized in GfapCre/b-CateninEx3 brain, displaying distortion of

cytoplasmic bundles at the level of the ventricular zone (VZ)/

SVZ (Fig. 1G,I). We next measured the thickness of the neural

layer (NL) by staining E14.5 sections for TuJ1. NL layer

was significantly reduced in mice overexpressing stabilized

b-Catenin (Fig. 1K,L). In contrast, the thickness of the germinal

layer did not show any alteration (Fig. 1M). The distribution of

pH3+proliferating cells in the germinal layer of double trans-

genic mice was also severely altered. In WT embryos, pH3+

proliferating cells were placed within the ventricular lining

and the SVZ (Carney et al. 2007), while in GfapCre/b-CateninEx3

mice, they were scattered throughout the entire germinal layer

(Fig. 1N--P). These scattered proliferating cells may represent

abventricular mitoses of Tbr2+basal progenitor (BP) cells (Sessa

et al. 2008). However, in GfapCre/b-CateninEx3 mice, the total

number of Tbr2+cells was significantly reduced (Fig. 1Q--S),

confirming previous results that showed a delay of maturation

of BP cells in mice overexpressing the Wnt signaling (Wrobel

et al. 2007;Mutch et al.). To studyproliferatingRGandTbr2+cells

and the contribution of BP cells to the total proliferating pools of

the forebrain, embryos were pulsed with the s-phase tracer EdU.

Proliferating Tbr2+cells accounted for a small fraction of the

brain total proliferating pool (Fig. 1T). Nevertheless, the fraction

of Tbr2+cells, incorporating the EdU tracer, over the total

number Tbr2-expressing cells was similar in both genotypes

(Fig. 1T), suggesting that their limited number derives from

a derangement of their genesis rather than from alterations of

their progression along the cell cycle. Thus, the persistent

activation of the canonical Wnt signaling forces RG to maintain

their cell identity and to reenter the cell cycle, inducing

a tangential expansion of the cortical field. Similar results have

been reported in previously published works (Wrobel et al.

2007; Mutch et al.), however, very few data are available on the

role of b-Catenin at later time points of forebrain maturation.

In order to fill this gap, we overexpressed the stabilized form of

b-Catenin (Nes-D90-b-Catenin-GFP) (Chenn and Walsh 2002,

2003) at the end of neurogenesis by in utero electroporation.

E16.5 embryos received Nes-D90-b-Catenin-GFP along with

the GFP-expressing plasmid, while control embryos were

injected with the GFP-expressing plasmid alone. Brains were

then collected at P10, and GFP+cells were scored in the SVZ

(Supplementary Fig. 1A,B) and in the cortical plate (Supple-

mentary Fig. 1D,E). The active form of b-Catenin significantly

increased the number of GFP+cells that were retained in the

SVZ (Supplementary Fig. 1C). Since mice were pulsed with the

EdU at the day of the sacrifice, we also established the fraction

of proliferating cells in the SVZ. The number of GFP/EdU

double positive was significantly increased in mice over-

expressing Nes-D90-b-Catenin-GFP plasmids (Supplementary

Fig. 1F,G). Thus, unlike previous published results (Hirabayashi

et al. 2004), our data suggest that the activation of Wnt/

b-Catenin signaling induces RG to proliferate also at late

gestational time points similarly to earlier embryonic stages

(Chenn and Walsh 2002; Wrobel et al. 2007; Mutch et al.).

Confined Expression of the Canonical Wnt Signaling inthe Postnatal SVZ

Given the pivotal role of b-Catenin in regulating cell pro-

liferation during forebrain development (Chenn and Walsh

2002; Wrobel et al. 2007; Mutch et al.), we turned our attention

to the postnatal SVZ. We used the reporter BAT-Gal mice

(Maretto et al. 2003) to trace cells in which the canonical Wnt/

b-Catenin signaling is still active. These mice have multiple

TCF/Lef-binding sites coupled to a minimal promoter that

drives the expression of the LacZ reporter (Maretto et al.

2003). The analysis of P30 BAT-Gal brains showed the presence

of many X-Gal+cells that were placed in the dorsal but not in

the ventrolateral SVZ (Fig. 2A and inset) (Doetsch et al. 1999;

Temple and Alvarez-Buylla 1999). The presence of LacZ

transcripts in the dorsal SVZ was confirmed by in situ

hybridization (Fig. 2B). A subset of LacZ-expressing cells

incorporated the BrdU tracer, suggesting that they belong to

a proliferating SVZ aNPCs (Fig. 2C). In addition, many LacZ+

cells coexpressed Olig2, which labels parenchymal


by guest on Decem


Dow

nloaded from

http://www.cercor.oxfordjournals.org/lookup/suppl/doi:10.1093/cercor/bhr320/-/DC1







oligodendrocyte precursors and type-C aNPCs of the SVZ (Fig.

2D). Some LacZ+cells coexpressed Dcx, which is a marker for

type-A aNPCs (Lois et al. 1996; Hack et al. 2005) (Fig. 2E), while

a relatively high number of them coexpressed GFAP, a marker

of astrocytes in the CNS parenchyma and type-B aNPCs in the

SVZ (Fig. 2F) (Doetsch et al. 1999; Ahn and Joyner 2005;

Tavazoie et al. 2008). LacZ+cells of the most dorsal SVZ were

positive for Id-1 (Fig. 2G), a marker of SVZ-restricted slow

dividing aNPCs (Nam and Benezra 2009). The SVZ, however,

contains also microglia and oligodendrocytes (Menn et al.

2006). Thus, we tested whether some of LacZ+cells might

belong to these lineages by probing sections for Iba-1 or NG2.

However, neither LacZ/Iba-1 nor LacZ/NG2 double positive

cells were detected in the SVZ of BAT-Gal mice (Fig. 2H,I).

Taken together, these results indicate, for the first time, that

the canonical Wnt signaling is confined in adult brains to

a subset of aNPCs of the dorsal SVZ.

The Activation of b-Catenin Signaling in the Adult SVZinhibits Cell Proliferation and Activates the Expression ofp16INK4a

In order to define the contribution of the canonical Wnt

signaling to adult neurogenesis, we took advantage an inducible

Cre allele. NestinCreERT2 transgenic mouse line expresses the

Tamoxifen-dependent Cre recombinase in aNPCs of the SVZ

(Imayoshi et al. 2008). Starting from P30, NestinCreERT2/

b-CateninEx3 mice and their control litters—that is, mice

containing only the NestinCreERT2 allele—were treated with

Tamoxifen for 5 consecutive days. Brains were collected 1 week

after the last Tamoxifen injection. At the day of the sacrifice, we

labeled proliferating cells using EdU. Tamoxifen treatments did

not alter gross morphology but significantly inhibited aNPC

proliferation in the SVZ (Fig. 3A--C). On the other hand, the

number of PSA-NCAM+cells was significantly increased in the

SVZ of NestinCreERT2/b-CateninEx3 mice (Fig. 3D--F), thus

suggesting that the stabilization of b-Catenin in the adult SVZ

inhibits cell proliferation, favoring cell differentiation. Accord-

ingly, also the number of Id-1+slow dividing progenitor cells

was greatly diminished in double transgenic mice (Fig. 3G,H).

A large body of experimental evidence suggests that

b-Catenin signaling, in certain circumstances, might positively

or negatively regulate of the cell cycle--dependent kinase

inhibitor (Cdki) p16INK4a (Saegusa et al. 2006; Delmas et al.

2007). For example, in tumor cells, the b-Catenin--mediated

modulation of p16INK4a forces these cells to differentiate

(Saegusa et al. 2006). To determine whether or not b-Catenin

Figure 1. Wnt/b-Catenin signaling promotes the tangential expansion of the cerebral cortex. Panel (A) provides double staining for Cre and YFP in E13.5 GfapCre/Rosa26YFPforebrain coronal section. Double positive cells were detected in the VZ/SVZ, while YFPþ recombined cells are evident in the outer cortical wall (n 5 3). Comparison between P21cerebral hemispheres of GfapCre/b-CateninEx3 (right in panel B) and WT littermates (left in B, n 5 5 for each group). A significant enlargement of the forebrain is evident in doubletransgenic mice. Panel (C) shows hematoxylin staining of coronal sections from P21 GfapCre/b-CateninEx3 and WT brains (n 5 4 for each group). One coronal section every 300lm of E14.5 GfapCre/b-CateninEx3 and WT brains was used to measure the extension of cortical fields (D--F, n 5 3 for each group). Linear extensions of cortical fields,encompassing the corticostriatal and cortical hem notches, were measured at 3 different levels along the anterior--posterior axes and plotted in panel (F) (arbitrary units ± SD).RG cell cytoarchitecture derangement is evident in E14.5 GfapCre/b-CateninEx3 (H, J) brains when compared with WT (G, I). Arrows in the high magnification of the panel (J)indicate RC2þ cells (n 5 3 for each group). Coronal sections from E14.5 WT (K) and GfapCre/b-CateninEx3 (L) mice were stained for TuJ1 to measure the thickness of the neurallayer (NL) and the germinal niche (VZ/SVZ). One section every 300 lm along the anterior--posterior axes was used for cell counting (n 5 3 for each group). Mean values (arbitraryunits ± standard deviation [SD]) are plotted in panel (M). E14.5 WT (N) and GfapCre/b-CateninEx3 (O) sections were probed for pH3 detection. PH3þ cells were counted in areasof 0.07 mm2 belonging to the VZ/SVZ (see boxed areas). The mean numbers (±SD) of apical and abventricular (arrows in N and O) mitoses are plotted in panel (P). E14.5 WT (Q)and GfapCre/b-CateninEx3 (R) brains received the EdU tracer for 1 h before the sacrifice and were subsequently labeled for Tbr2 and EdU. Cell counts were done withina rectangular areas of 0.07 mm2 belonging to the VZ/SVZ (see boxed area). The mean numbers (±SD) of EdUþ and Tbr2þ cells per section (n 5 3 for each group) are plotted inpanel (S). Fractions of EdU/Tbr2 double positive cells above the total number of EdU or the total number of Tbr2-expressing cells (mean ± SD) are plotted in panel (T). Scale bar100 lm. *P \ 0.05; ***P \ 0.001, t-test.


by guest on Decem


Dow

nloaded from


can modulate p16INK4a in aNPCs of the adult SVZ, we

microdissected SVZs from NestinCreERT2/b-CateninEx3 mice

administered with Tamoxifen as above (Fig. 3I). The stabilization

of b-Catenin induced the expression of the target gene Lef1

(Fig. 3J) (Hovanes et al. 2001; Filali et al. 2002) as well as of

p16INK4a (Fig. 3K), suggesting that the activation of ectopic

b-Catenin is operating, and such manipulation induced the

expression of p16INK4a, that in turn orchestrate the opposite

role of b-Catenin functioning in adult germinal niche. In order to

confirm these results, we raised neurospheres cultures (Rey-

nolds and Weiss 1992) from the dorsal SVZ of P30 BAT-Gal mice

(Maretto et al. 2003) to establish if the canonical Wnt signaling is

still working in vitro. X-Gal staining of neurospheres revealed

the presence of LacZ+cells in approximately 40% of them

(Supplementary Fig. 2A). However, upon serial in vitro passages

(ivp), this number greatly diminished, possibly because the

prolonged exposure to high levels of growth factors may

hamper their capacity to express Wnt genes (not shown). Early

generated neurospheres cultures were used for chromatin

immunoprecipitation (ChIP) of b-Catenin targets. By using

a specific antibody for b-Catenin, we demonstrated that the

promoter region of p16INK4a is a direct target of b-Catenin(Supplementary Fig. 2B). In addition, we also demonstrated that

p16INK4a messenger RNA (mRNA) levels were significantly

increased when aNPCs were induced to differentiate by absence

of growth factors (Supplementary Fig. 2C). We also raised

neurospheres cultures form P30 b-Cateninflox/flox SVZs (a

b-Catenin conditional knockout allele) (Brault et al. 2001).

These cultures were infected with lentivirus expressing either

the Cre-IRES-GFP cassette (Borello et al. 2006) or the GFP gene.

Starting from day 8, after lentivirus delivery, the Cre-mediated

recombination of the b-Cateninflox/flox locus abolished the

expression of b-Catenin (Supplementary Fig. 2D). Because

b-Catenin is a component of adherens junctions (Aberle et al.

1996), its depletion deranged cell morphology of targeted aNPCs

and affected their long-term survival. Indeed, 9 days after lentivirus

delivery, we detected a slight activation of Caspase-3 (Supple-

mentary Fig. 2D), and starting from 10 days after viruses, delivery

targeted cells did not adhere to each other (not shown)

(Holowacz et al.). At day 8, a time when infected cells have

already lost b-Catenin expression but the activation of Caspase-3

isundetectable (SupplementaryFig. 2D),weobserveda significant

reduction of p16INK4a expression (Supplementary Fig. 2E).

Because the INK4a locus contains 2 distinct gene variants, the

p16INK4a and the p19Arf, in addition to the short p16INK4a

variant,wemeasured also the expressionof the longp19ArfmRNA

levels that did not show any alteration (Supplementary Fig. 2E).

Thus, we demonstrated that b-Catenin can directly interact with

the promoter region of p16INK4a in vivo and in aNPCs derived

from the adult SVZ.

Figure 2. The canonical Wnt signaling is still active in progenitor cells of the adult dorsal SVZ. X-Gal staining of a 200-lm thick P30 BAT-Gal coronal section (panel A, n 5 4)shows the presence of many cells expressing LacZ at levels in the dorsal, but not in the ventral, SVZ (inset represents lateral SVZ). Radioactive in situ hybridization of P30 BAT-Galcoronal sections confirmed the presence of LacZ-expressing cells (panel B, n 5 3). P30 BAT-Gal received BrdU injections for 9 h at the day of the sacrifice. LacZ/BrdU doublepositive cells are indicated by arrows in panel C (n 5 3). LacZþ cells coexpressing Olig2, are shown in panel (D), while LacZþ cells coexpressing the type-A marker DCX areshown in panel E (n 5 3 for each group). Several LacZþ cells at the ventricular lining are positive for the type-B marker GFAP (arrowheads in panel F, n 5 3) and Id-1(arrowheads in G indicate double positive cells in dorsal SVZ). We did not find any LacZþ cells expressing either the microglial/macrophages marker Iba-1 (panel H, n 5 3) or theoligodendrocytes marker NG2 (panel I, n 5 3). Scale bar 50 lm.


by guest on Decem


Dow

nloaded from












Dynamic Expression of Hipk1 during ForebrainNeurogenesis

The context-dependent role of b-Catenin pathway in pro-

moting cell self-renewal or neuronal differentiation may rely on

the presence of specific molecular interactors (Cavallo et al.

1998). Some of these molecules dictate the outcomes, in term

of cell proliferation and cell differentiation, for the canonical

Wnt/b-Catenin signaling (Sierra et al. 2006; Li and Wang 2008).

Among them, Hipk genes have been recently indicated

as modulators of b-Catenin signaling in the neural plate cells

of Xenopus laevis embryos (Louie et al. 2009) and in stem cells

of the skin (Wei et al. 2007). Hipk1 is expressed in germinal

niches of E9.5, E14.5, E18.5, and P30 brains, as we showed by in

situ hybridization assay (Fig. 4A--E) (Isono et al. 2006).

However, starting from E14.5, also cells of the presumptive

hippocampal plate and cells of the choroid plexus exhibited

detectable levels of Hipk1 (Fig. 4B,C). Thus, the pattern of

expression of Hipk1 overlaps the pattern of expression of the

Wnt signaling (Maretto et al. 2003; Muzio et al. 2005). Hipk1

expression levels are very low during forebrain development

but dramatically raise in germinal niches of the adult brain (Fig.

4D). Indeed, by coupling in situ hybridization for Hipk1 with

immunofluorescence-mediated detection of GFAP, we were

able to detect, in the adult SVZ, a large number of

periventricular GFAP+cells coexpressing at high levels Hipk1

mRNA (Fig. 4E). The expression of Hipk1 levels was also

evaluated by RT-PCR on cortical microdissections of develop-

ing forebrains (E9.5, E11.5, E14.5, E18.5, and P4) and postnatal

SVZs (P10 and P30). Hipk1 mRNA levels were normalized on

the expression of the housekeeping gene b-Actin, and data

from each time point were compared with the normalized

expression of Hipk1 detected at E9.5. During forebrain

development, Hipk1 expression levels were pretty low, if

compared with levels measured in P30 SVZs (Fig. 4F). We also

established that Hipk1 was also expressed in neurospheres

cultures (Fig. 5F), and its expression increased during their

differentiation (Fig. 4G).

CMV-fHipk1 and Nes-D90-b-Catenin-GFPCoelectroporation Reduces RG Cells Proliferation

This temporal gradient of Hipk1 prompted us to investi-

gate whether Hipk1 can regulate b-Catenin functioning in

Figure 3. The stabilization of b-Catenin in adult SVZ progenitors affects cell proliferation and induces p16INK4a expression. P30 NestinCreERT2 (panels A, D, and G) andNestinCreERT2/b�CateninEx3 (panels B, E, H, and I) mice were injected with Tam for 5 days and sacrificed 1 week after the last Tam injection (n 5 3 for each group). Micereceived multiple EdU injections at the day of sacrifice (9 h of cumulative labeling). Cell proliferation was evaluated in the SVZ by staining sections for GFAP and EdU (panels A andD). Cell counts were done in one sections every 300 lm along the anterior--posterior axis, and mean values (±standard deviation [SD]) are plotted in panel (C). Parallel sectionswere probed for PSA-NCAM (panels D and E, arrows indicate the thickness of neuroblast streams), cell counts were done as above, and percentages (±SD) of PSA-CAMþ cellsare plotted in panel (F). Panels (G and H) show adjacent sections stained for Id-1 detection. Coronal sections from P30 NestinCreERT2 and NestinCreERT2/b�CateninEx3 brainstreated with Tam as above were taken in a region spanning from 2 mm from the anterior pole of the brain to 3 mm posterior to the previous cut. SVZs were furthermicrodissected and used for RT-PCR analysis (arrow in panel (I) shows the region of interest in a representative sample, n 5 3 for each group). Expression levels (mean ± SD) ofLef1 and p16INK4a are shown in panels (J and K), respectively. Scale bar 50 and 200 lm for the panel (G). ***P \ 0.001; **P \ 0.01. Scale bar 50 lm.


by guest on Decem


Dow

nloaded from


proliferating SVZ aNPCs. To address this issue, we overex-

pressedHipk1 along with the activated form of b-Catenin in the

developing forebrain, at the time when the Hipk1 physiological

expression levels are low. In utero electroporation of E13.5

forebrains was done by injecting mice with Nes-D90-b-Catenin/GFP, flag-Hipk1 (fHipk1), and a mix of both plasmids. Following

electroporation, embryos were collected at E16.5, and only

forebrains displaying electroporated cells in the lateral cerebral

cortex were included in our analysis. Sections were stained for

GFP and RC2. The number of double positive cells was counted

in the VZs of embryos receiving Nes-D90-b-Catenin-GFP(Fig. 5A), fHipk1 (Fig. 5B), or both plasmids (Fig. 5C). The

overexpression of both Nes-D90-b-Catenin-GFP and fHipk1

significantly reduced the number of GFP cells displaying RG

features (Fig. 5D). Parallel sections were stained for GFP and

TuJ1 to count the number of targeted cells persisting in the

VZ/SVZ and not expressing the neuronal marker TuJ1

(Supplementary Fig. 3A--C). fHipk1, per se, slightly dimin-

ished this number, but only embryos receiving Nes-D90-b-Catenin-GFP and fHipk1 plasmids showed a significant

reduction of these cells (Supplementary Fig. 3D). We next

assessed the role of Hipk1 and b-Catenin on proliferating RG

of the brain. In utero electroporation was done as above, but

brains were collected at E15.5. Double staining for TuJ1 and

GFP allowed the estimation of GFP+cells exiting the cell

cycle—that is, the Q fraction (Takahashi et al. 1996).

Accordingly to previously published report, the fraction of

GFP/TuJ1+

cells was 0.54 ± 0.07 in brains receiving the

pCAG-GFP plasmids (Fig. 5E,I) (Takahashi et al. 1996). This

number was reduced in brains receiving the Nes-D90-b-Catenin-GFP plasmids (Fig. 5F,I), and 1.3-fold increased in

mice receiving both fHipk1 and Nes-D90-b-Catenin-GFPplasmids (Fig. 5H,I). Electroporated embryos were also pulsed

with EdU for 2 h to estimate the proliferating fractions in

each experimental group. The percentage of GFP+

cells

incorporating the EdU tracer was 25.3 ± 0.8% in embryos

receiving pCAG-GFP (Fig. 5J,N). This percentage increased in

mice electroporated with Nes-D90-b-Catenin-GFP (Fig. 5K,N)

butwas significantly reduced in embryos receiving bothplasmids

(Fig. 5M,N). Brains containing large numbers of GFP+cells

(Supplementary Fig. 4A--C) were scored for the presence of

Tunel+cells. However, we did not find any discernable differ-

ences in Tunel staining between each group (Supplementary

Fig. 4A--C). Although the Hipk1 physiological expression levels

are generally low during forebrain development, we further

investigated the effects of Hipk1 inhibition on neurogenesis by

performing its knockdown. E13.5 embryos were electroporated

with short interfering RNAs plasmids targeting Hipk1. The

efficiency of these Hipk1-RNAi vectors was examined by

transfecting 293T cells (Supplementary Fig. 5). E16.5 brains

receiving Hipk1-RNAi, or control plasmids, were injected for 2 h

with the EdU tracer and then sacrificed. The effects of Hipk1-

RNAi on proliferating cells were investigated by probing sections

for GFP and EdU. The fraction of GFP+cells incorporating the

S-phase tracer was 10.5 ± 2 in mice receiving unrelated RNAi

vectors but was doubled in mice receiving Hipk1-RNAi plasmids

(Fig. 5O--Q). Thus, the knockin and the knockdown analyses

suggest that Hipk1 has a repressor activity on proliferating cells

of the forebrain.

Hipk1 Can Directly Interact with b-Catenin

To examine whether Hipk1 might directly interact with

b-Catenin, we performed a coimmunoprecipitation assay

(co-IP). Hek-293T cells were cotransfected with Nes-D90-b-Catenin-GFP, the Top-flash reporter plasmid (Veeman et al.

2003), with or without fHipk1. Two days after transfection,

cells were collected and used for fHipk1 immunoprecipitation

using a specific a-Flag antibody. Immune-precipitated com-

plexes were run on standard SDS--PAGE electroporation and

then probed for D90-b-Catenin-GFP detection. The immune

Figure 4. Hipk1 is confined in proliferating niches of both developing and postnatal brains. Panels (A--D) show radioactive in situ hybridization for Hipk1 at E9.5, E14.5, E18.5, andP30 (n 5 3 for each group). Hipk1 expressing cells are detectable into the VZ of E9.5 forebrain as shown in panel (A). Cells of the VZ/SVZ of both E14.5 and E18.5 brains expressHipk1 as shown in panels (B and C). However, at both time points, neurons of the medial cortical wall and cells of the choroid plexus express Hipk1 at detectable levels(arrowheads in B and C). Cells confined in the P30 SVZ express Hipk1 at robust levels, as shown in panel D (high magnification of the dorsal SVZ is shown in the inset).Immunomediated detection of GFAP coupled with Dig-in situ hybridization for Hipk1 is provided in panel (E) and arrowheads indicate double positive cells in the SVZ. Total mRNAswere extracted from the E9.5 forebrain, E11.5, E14.5, E18.5, and P4 cortices; P10 and P30 S6VZs; and neurospheres cultures. Histogram of panel (F) shows relative expressionlevels of Hipk1. Each data are normalized on the total amount of the housekeeping gene b-Actin, and fold changes (±standard deviation) are calculated respect the meanexpression levels of Hipk1 that is detectable at E9.5. The expression of Hipk1 mRNA was also evaluated in resting and differentiating neurospheres cultures (n 5 3), as shown inhistogram of panel (I). ***P \ 0.001, t-test. Scale bar 100 lm.


by guest on Decem


Dow

nloaded from











precipitation of D90-b-Catenin-GFP was obtained only when

fHipk1 plasmids were included in the plasmids mixes (Fig. 6A,

right panel), while no detectable signals were found when

we omitted fHipk1 (Fig. 6A, left panel). We next performed

a standard Luciferase assay on Hek-293T cells that were

transfected with Nes-D90-b-Catenin-GFP, the Top-flash re-

porter, with or without fHipk1. The cotransfection of Nes-

D90-b-Catenin-GFP and the Top-flash reporter produced high

luciferase levels (Fig. 6B), while the inclusion of fHipk1

plasmids induced a significant reduction of the luciferase

activity (Fig. 6B). Control transfections were done by using the

Top-flash plasmids (Fig. 6B).

Beside the effects as corepressors (Choi et al. 1999), the

Hipk family have been identified among genes that can also

positively regulate the gene transcription. These 2 opposite

effects are largely dependent on promoters of target genes and

on the context in which Hipk genes operate (Rinaldo et al.

2007). We next assessed whether Hipk1 along with b-Catenincan modulate the expression of p16INK4a in SVZ-derived

neurosphere cultures. We nucleofected primary neurosphere

cultures with Nes-D90-b-Catenin-GFP plasmids with or with-

out fHipk1 plasmids. Transfected neural stem cells were then

collected after 48 h to measure the expression levels of

p16INK4a by RT-PCR. Standard RT-PCR analysis revealed that

the presence of both Nes-D90-b-Catenin-GFP and fHipk1

increased the expression levels of p16INK4a (Fig. 6C, upper

panel). Accordingly, RT-PCR analysis confirmed that p16INK4a

was upregulation of in cells receiving Nes-D90-b-Catenin-GFPand fHipk1 plasmids (Fig. 6C, lower panel). However, in these

experimental conditions, the simple overexpression ofNes-D90-

Figure 5. fHipk1 and Nes-D90-bCatenin-GFP mediated the premature exit of exit from cell cycle of cortical progenitor cells. E13.5 forebrains were electroporated with Nes-D90-bCatenin-GFP (A, n 5 5), fHipk1 (B, n 5 4), or with both plasmids (C, n 5 6), then brains were collected at E16.5 and labeled for RC2 and GFP. By confocal sectioning, wecounted double positive cells in the VZ of each experimental group, and mean numbers (±standard deviation [SD]) of RC2/GFP cells per section are plotted in panel (D). E13.5embryos were further electroporated with pCAG-GFP (E, J, n 5 3), Nes-D90-bCatenin-GFP (F, K, n 5 3), fHipk1 (G, L, n 5 3) or with Nes-D90-bCatenin-GFP and fHipk1plasmids (H, M, n 5 3), brains were then collected at E15.5, and fractions of differentiating cells in each electroporated area were calculated by staining sections for TuJ1 andGFP (E--H) to calculate. Mean values (±SD) are plotted in panel (I). Electroporated embryos received the EdU tracer for 1 h at the day of the sacrifice. Sections were doublelabeled for EdU and GFP (J--M). Percentages (±SD) of double positive cells were calculated in each electroporated area and plotted in panel (N). E13.5 embryos wereelectroporated with control RNAi plasmids (panel O, n 5 3) or Hipk1-RNAi plasmids (panel P, n 5 3) along with pCAG-GFP plasmids. Mice were pulsed with EdU for 2 h at E16.5and then sacrificed. Percentages (±SD) of GFP/EdU double positive cells above the total number of SVZ-restricted GFPþ cells are shown in panel (Q). *P \ 0.05, **P \ 0.01,and ***P \ 0.001. For panels (D, I, and N), we used ANOVA pretest, followed by t-test. Scale bar 50 lm.


by guest on Decem


Dow

nloaded from


b-Catenin-GFP failed to increase p16INK4a levels, possible

because neurospheres were maintained in the presence of high

concentration of FGF2 that, per se, is capable to inhibit

b-Catenin signaling (Israsena et al. 2004). However, the addition

of fHipk1 forced the upregulation of p16INK4a, suggesting that

Hipk1 is a limiting factor for p16INK4a expression in aNPCs.

SVZ Restricted b-Catenin Loss of Function Affects theExpression of Hipk1

A large number of genes implicated in the control of Wnt/

b-Catenin signaling are often regulated by b-Catenin through

positive or negative feedback loops (Kazanskaya et al. 2004;

Logan and Nusse 2004; Chamorro et al. 2005; Khan et al. 2007),

we asked whether Hipk1 expression might be modulated by

the b-Catenin. We firstly induced the b-Catenin depletion by

crossing b-Cateninflox/flox mice (Brault et al. 2001) with

GlastCreERT2 transgenic mice (Mori et al. 2006). Cells express-

ing Glast, Gfap, and Nestin are presumably high hierarchical

aNPCs of the adult SVZ that are capable to self-renew in vitro

and to generate multipotent neurosphere cultures (Ninkovic

et al. 2007; Beckervordersandforth et al.). Adult GlastCreERT2/

b-Cateninflox/flox and their controls—that is, GlastCreERT2

/

b-Cateninflox/+—were fed with Tamoxifen and sacrificed

4 weeks after Tamoxifen treatment. Efficiency of recombina-

tion was tested by including the Rosa26YFP allele. Virtually, all

cell or the periventricular lining expressed robust yellow

fluorescent protein (YFP) levels (not shown). Robust Hipk1

expression levels were detected in controls (Supplementary

Fig. 6A) but significantly reduced in conditional KO mice

(Supplementary Fig. 6B). Accordingly, neurospheres deprived

of b-Catenin significantly lowered Hipk1 expression levels

(Supplementary Fig. 5C). We also examined Hipk1 in brains

overexpressing the stabilized form of b-Catenin. Nestin-

CreERT2/b-CateninEx3 mice administered with Tamoxifen for

5 consecutive days were collected 1 week after the last Tam

injection and probed forHipk1 detection. In parallel, the SVZ of

some of themwasmicrodissected for RT-PCR analysis. However,

the stabilization of b-Catenin produced a slight, but not

significant, increase of Hipk1 levels as measured by RT-PCR

(Supplementary Fig. 6D--F). Thus, the inactivation of the

b-Catenin signaling inhibited Hipk1 expression, while the

upregulation of this molecule did not.

Discussion

In the forebrain, early ectopic activation of the canonical Wnt

signaling fosters RG to proliferate thus promoting an excessive

tangential expansion of the cortical field (Chenn and Walsh

2002, 2003). By contrary, later time point activation of Wnt

signaling—via stabilization of the active form of b-Catenin—fosters RG to differentiate (Hirabayashi et al. 2004). This latter

effect is due to the positive regulation of the proneural gene

Ngn1 expression (Hirabayashi et al. 2004). By studying cell

proliferation of GfapCre/b-CateninEx3 brains, we found that the

persistent activation of Wnt signaling promotes RG proliferation

also at later time points of forebrain development. RG pro-

liferation increased in E13.5 embryos once the expression of

the activated form of b-Catenin was transgenically induced.

Consistently with this finding, the electroporation of Nes-D90-b-Catenin-GFP plasmid at E16.5 induces targeted RG to pro-

liferate and to inhibit the expression of TuJ1 and Tbr2.

Figure 6. Hipk1 can directly interact with b-Catenin. Co-IP experiments were performed on 1 3 106 Hek293T cells transfected with TOP-Flash (2 lg), Nes-D90-bCatenin-GFP (4lg) plasmids, with or without fHipk1 (4 lg) plasmids (n 5 3 independent experiments). Cells were collected after 48 h, and total extracts were immunoprecipitated with a a-Flagantibody. D90-bCatenin/GFP chimeric protein was detected by using specific a a-GFP antibody, and data form a representative experiment are plotted in panel (A). Hek293T (5 3105) cells were transfected with TOP-Flash (0.5 lg), prlTK (0.1 lg), Nes-D90-bCatenin-GFP (0.5 lg), and increasing concentrations of fHipk1 (0.1, 0.5, 0.7, 1, and 2 lg). Controlexperiments were done by transfecting cells with Fop-Flash (0.5 lg), prlTK (0.1 lg), Nes-D90-bCatenin-GFP (0.5 lg), and fHipk1 (2 lg) plasmids. Cell lysates were prepared 24h after transfection and were analyzed for luciferase activity. The mean luciferase activities (±standard deviation [SD]) of 3 independent experiments, each performed intriplicate, are plotted in panel (B). Neural precursor cells (3 3 105) derived from dissociated primary neurospheres cultures (n 5 3) were nucleofected with Nes-D90-bCatenin-GFP (1 lg) and fHipk1 (1 and 2 lg). Cells were lysated after 24 h, and RNA extracts were used to detected p16INK4a by standard RT-PCR (upper panel C). Upper lanes representp16INK4a amplicons (166 bp), while the housekeeping gene H3(190 bp) is shown in lower lanes. Total mRNAs were also used to detect p16INK4a by RT-PCR analysis. Each datawere normalized on the expression of the housekeeping gene H3, and percentages (±SD) are plotted on histogram in C. *P \ 0.05, **P \ 0.01, ***P \ 0.001, t-test.


by guest on Decem


Dow

nloaded from








Interestingly, we also observed a severe alteration of RG

morphology in our transgenicmice consistingwith the presence

of a significant high number of abventricular mitoses in the VZ/

SVZ. At this stage, we can only speculate that the active form of

b-Catenin might have directly influenced the positioning of

pH3+mitoses by regulating nuclear interkinesis.

It is well known that Wnts are expressed by aNPCs residing

within neurogenic niches (Lie et al. 2005; Adachi et al. 2007).

However, their role is still partially unclear. As a matter of fact,

the presence of a stabilized form of b-Catenin increases

proliferation of Mash1 expressing aNPCs placed in both the

ventral and the dorsal SVZ (Adachi et al. 2007). On the other

hand, Wnt signaling induces differentiation of aNPCs residing

within the dentate gyrus of the hippocampus (Lie et al. 2005)

by activating the expression of NeuroD1 (Kuwabara et al.

2009). We found that Wnt signaling is activated only in the

aNPCs residing within the dorsal SVZ by using BAT-Gal

reporter mice. As such, BAT-Gal--expressing cells of the dorsal

SVZ incorporate the S-phase tracer BrdU and a large part of

them express molecular markers of SVZ-restricted aNPCs.

Similarly to the results shown by Li and Wang (2008), we found

that Wnt signaling significantly reduced the number of

proliferating aNPCs in the SVZ: a 2-fold increase of type-A

neuroblasts was measured in NestinCreERT2/b-CateninEx3 mice.

Finally, we observed that the active form of b-Catenin induces

the expression of the p16INK4a in aNPCs of the SVZ (Lukas

et al. 1995). Reduced expression level of p16INK4a was

observed upon inactivation of the expression of b-Catenin in

SVZ-derived neurosphere cultures derived from b-Cateninflox/

flox mice. This was attributed to the capability of b-Catenin to

engage the promoter region of the mouse p16INK4a (Saegusa

et al. 2006). While technical hurdles (i.e., retroviral vector-

based cell tracing vs. inducible transgenes) might explain the

different results we obtained from Adachi et al. (2007), it is

reasonable to think that the activation of the Wnt signaling in

different SVZ cell populations might lead to different pheno-

types. Future studies must address the relative contribution of

Wnts in each specific cell population belonging to the SVZ.

The opposite effects produced by b-Catenin signaling in

aNPCs may be due to signals capable of positively or negatively

regulate b-Catenin target genes. Among such proteins those

coded by Hipk genes—Hipk1, Hipk2, Hipk3, and Hipk4—

have been shown to be reliable modulators of the b-Cateninsignaling (Rinaldo et al. 2007). Hipk1 can regulate the

transcription of Wnt/b-Catenin targets during X. levis gastru-

lation (Louie et al. 2009). Hipk2 interacting with b-Cateninand repressing b-Catenin/Lef1 target genes impairs self-

renewal of skin stem cells (Wei et al. 2007): This suppressive

effect does not require the phosphorylation of b-Catenincritical residues (Wei et al. 2007). The constitutive inactivation

of Hipk1 and Hipk2 induces early exencephaly, which is

characterized by an exaggerate overgrowth of forebrain/

midbrain neural tissue (Isono et al. 2006). While the expression

pattern of Hipk1 has been deeply investigated in early embryos

(Isono et al. 2006), still few data are available at later time

points during forebrain maturation. We found that Hipk1 is

expressed within developing and adult neurogenic germinal

niches: Its expression levels are generally low during forebrain

development but significantly increased in aNPCs of the adult

SVZ, when Wnts induced aNPCs differentiation. We also found

that overexpression of Hipk1 during embryonic develop-

ment—when Hipk1 expression levels are low—slightly aff-

ected RG proliferation. However, the coelectroporation of

Hipk1 with the constitutive active form of b-Cateninsignificantly reduced the number of proliferating cells and

a significant number of RG receiving both constructs differen-

tiated into TuJ1+cells. While excluding that our findings could

be due to the exaggerated rate of cells death induced by

overexpression of Hipk1 (D’Orazi et al. 2002; Doxakis et al.

2004), we finally demonstrated that Hipk1 was able to

physically interact with b-Catenin and that Hipk1 is able to

regulate the b-Catenin--mediated expression of the reporter

plasmid TOP-Flash.

Since we demonstrated that b-Catenin is capable to engage

the promoter region of the mouse p16INK4a and that Hipk

genes are able to physically interact with b-Catenin, we finally

explore the possibility that Hipk1-b-Catenin interaction

regulates p16INK4a expression. In neurosphere cultures, the

overexpression of b-Catenin slightly modulated the expression

of p16INK4a. However, increased expression of p16INK4a was

obtained in the presence of both Hipk1 and the active form of

b-Catenin. Our data, showing that Hipk1might cooperate with

the canonical Wnt signaling in the adult SVZ, parallel the above-

mentioned previous results obtained showing that Hipk2 and

b-Catenin act jointly as cell cycle repressors in skin stem cells

(Wei et al. 2007). However, we cannot exclude that Hipk genes

can interact with other molecules to regulate the cell cycle as

Hipk2 can interact with Axin to stimulate the expression of

P53 (Rui et al. 2004).

In conclusion, our data further reiterate the strong in-

volvement of the Wnt signaling pathway in the regulation and

orchestration of the cell cycle in embryonic and adult neural

progenitors.

Supplementary Material

Supplementary material can be found at: http://www.cercor.

oxfordjournals.org/

Funding

BMW Italy group and Italian Association for Multiple Sclerosis

(Fism/Aism) grant number ‘‘Stem cells 2008.’’

Notes

We deeply thank Dr Furlan and Dr P. Brown for their helpful

discussions and support. We thank Dr Hiroyoshi Ariga for providing

the Hipk1 expressing construct, Dr Stefano Piccolo for providing BAT-

Gal transgenic mice, Dr R. Kageyama for providing NestinCreERT2

transgenic mice, Dr C. Walsh for providing the Nestin-D90-b-Catenin-GFP construct, and Dr U. Borello for the Cre-ires-GFP construct. This

work is dedicated to the memory of Dr G. Corte. Conflict of Interest :

None declared.

References

Aberle H, Schwartz H, Kemler R. 1996. Cadherin-catenin complex:

protein interactions and their implications for cadherin function.

J Cell Biochem. 61:514--523.

Adachi K, Mirzadeh Z, Sakaguchi M, Yamashita T, Nikolcheva T,

Gotoh Y, Peltz G, Gong L, Kawase T, Alvarez-Buylla A, et al. 2007.

Beta-catenin signaling promotes proliferation of progenitor cells in

the adult mouse subventricular zone. Stem Cells (Dayton, Ohio).

25:2827--2836.

Ahn S, Joyner AL. 2005. In vivo analysis of quiescent adult neural stem

cells responding to sonic hedgehog. Nature. 437:894--897.


by guest on Decem


Dow

nloaded from


http://www.cercor.oxfordjournals.org/

http://www.cercor.oxfordjournals.org/


BackmanM,MachonO,Mygland L, van den Bout CJ, ZhongW, TaketoMM,

Krauss S. 2005. Effects of canonical Wnt signaling on dorso-ventral

specification of the mouse telencephalon. Dev Biol. 279:155--168.

Beckervordersandforth R, Tripathi P, Ninkovic J, Bayam E, Lepier A,

Stempfhuber B, Kirchhoff F, Hirrlinger J, Haslinger A, Lie DC, et al.

2010. In vivo fate mapping and expression analysis reveals

molecular hallmarks of prospectively isolated adult neural stem

cells. Cell Stem Cell. 7:744--758.

Borello U, Berarducci B, Murphy P, Bajard L, Buffa V, Piccolo S,

Buckingham M, Cossu G. 2006. The Wnt/beta-catenin pathway

regulates Gli-mediated Myf5 expression during somitogenesis.

Development (Cambridge, England). 133:3723--3732.

Bovolenta P, Esteve P, Ruiz JM, Cisneros E, Lopez-Rios J. 2008. Beyond

Wnt inhibition: new functions of secreted frizzled-related proteins

in development and disease. J Cell Sci. 121:737--746.

Brault V, Moore R, Kutsch S, Ishibashi M, Rowitch DH, McMahon AP,

Sommer L, Boussadia O, Kemler R. 2001. Inactivation of the beta-

catenin gene by Wnt1-Cre-mediated deletion results in dramatic

brain malformation and failure of craniofacial development. De-

velopment (Cambridge, England). 128:1253--1264.

Brill MS, Ninkovic J, Winpenny E, Hodge RD, Ozen I, Yang R, Lepier A,

Gascon S, Erdelyi F, Szabo G, et al. 2009. Adult generation of

glutamatergic olfactory bulb interneurons. Nat Neurosci. 12:

1524--1533.

Carney RS, Bystron I, Lopez-Bendito G, Molnar Z. 2007. Comparative

analysis of extra-ventricular mitoses at early stages of cortical

development in rat and human. Brain Struct Funct. 212:37--54.

Cavallo RA, Cox RT, Moline MM, Roose J, Polevoy GA, Clevers H,

Peifer M, Bejsovec A. 1998. Drosophila Tcf and Groucho interact to

repress Wingless signalling activity. Nature. 395:604--608.

Centonze D, Muzio L, Rossi S, Cavasinni F, De Chiara V, Bergami A,

Musella A, D’Amelio M, Cavallucci V, Martorana A, et al. 2009.

Inflammation triggers synaptic alteration and degeneration in

experimental autoimmune encephalomyelitis. J Neurosci. 29:

3442--3452.

Centonze D, Muzio L, Rossi S, Furlan R, Bernardi G, Martino G. 2009.

The link between inflammation, synaptic transmission and neuro-

degeneration in multiple sclerosis. Cell Death Differ. 17:1083--1091.

Chamorro MN, Schwartz DR, Vonica A, Brivanlou AH, Cho KR,

Varmus HE. 2005. FGF-20 and DKK1 are transcriptional targets of

beta-catenin and FGF-20 is implicated in cancer and development.

EMBO J. 24:73--84.

Chenn A, Walsh CA. 2002. Regulation of cerebral cortical size by control

of cell cycle exit in neural precursors. Science. 297:365--369.

Chenn A, Walsh CA. 2003. Increased neuronal production, enlarged

forebrains and cytoarchitectural distortions in beta-catenin over-

expressing transgenic mice. Cereb Cortex. 13:599--606.

Choi CY, Kim YH, Kwon HJ, Kim Y. 1999. The homeodomain protein

NK-3 recruits Groucho and a histone deacetylase complex to

repress transcription. J Biol Chem. 274:33194--33197.

Cook D, Fry MJ, Hughes K, Sumathipala R, Woodgett JR, Dale TC. 1996.

Wingless inactivates glycogen synthase kinase-3 via an intracellular

signalling pathway which involves a protein kinase C. EMBO J.

15:4526--4536.

Daniels DL, Weis WI. 2005. Beta-catenin directly displaces Groucho/

TLE repressors from Tcf/Lef in Wnt-mediated transcription

activation. Nat Struct Mol Biol. 12:364--371.

Delmas V, Beermann F, Martinozzi S, Carreira S, Ackermann J,

Kumasaka M, Denat L, Goodall J, Luciani F, Viros A, et al. 2007.

Beta-catenin induces immortalization of melanocytes by suppress-

ing p16INK4a expression and cooperates with N-Ras in melanoma

development. Genes Dev. 21:2923--2935.

DickinsonME, Krumlauf R, McMahon AP. 1994. Evidence for a mitogenic

effect of Wnt-1 in the developing mammalian central nervous

system. Development (Cambridge, England). 120:1453--1471.

Doetsch F, Alvarez-Buylla A. 1996. Network of tangential pathways

for neuronal migration in adult mammalian brain. Proc Natl Acad Sci

U S A. 93:14895--14900.

Doetsch F, Caille I, Lim DA, Garcia-Verdugo JM, Alvarez-Buylla A. 1999.

Subventricular zone astrocytes are neural stem cells in the adult

mammalian brain. Cell. 97:703--716.

D’Orazi G, Cecchinelli B, Bruno T, Manni I, Higashimoto Y, Saito S,

Gostissa M, Coen S, Marchetti A, Del Sal G, et al. 2002.

Homeodomain-interacting protein kinase-2 phosphorylates p53 at

Ser 46 and mediates apoptosis. Nat Cell Biol. 4:11--19.

Doxakis E, Huang EJ, Davies AM. 2004. Homeodomain-interacting

protein kinase-2 regulates apoptosis in developing sensory and

sympathetic neurons. Curr Biol. 14:1761--1765.

Filali M, Cheng N, Abbott D, Leontiev V, Engelhardt JF. 2002. Wnt-3A/

beta-catenin signaling induces transcription from the LEF-1 pro-

moter. J Biol Chem. 277:33398--33410.

Galceran J, Miyashita-Lin EM, Devaney E, Rubenstein JL, Grosschedl R.

2000. Hippocampus development and generation of dentate gyrus

granule cells is regulated by LEF1. Development (Cambridge,

England). 127:469--482.

Gotz M, Huttner WB. 2005. The cell biology of neurogenesis. Nat Rev

Mol Cell Biol. 6:777--788.

Guillemot F. 2007. Cell fate specification in the mammalian telenceph-

alon. Prog Neurobiol. 83:37--52.

Hack MA, Saghatelyan A, de Chevigny A, Pfeifer A, Ashery-Padan R,

Lledo PM, Gotz M. 2005. Neuronal fate determinants of adult

olfactory bulb neurogenesis. Nat Neurosci. 8:865--872.

Harada N, Tamai Y, Ishikawa T, Sauer B, Takaku K, Oshima M,

Taketo MM. 1999. Intestinal polyposis in mice with a dominant

stable mutation of the beta-catenin gene. EMBO J. 18:5931--5942.

Hartfuss E, Galli R, Heins N, Gotz M. 2001. Characterization of CNS

precursor subtypes and radial glia. Dev Biol. 229:15--30.

Haydar TF, Ang E, Jr, Rakic P. 2003. Mitotic spindle rotation and mode of

cell division in the developing telencephalon. Proc Natl Acad Sci U S

A. 100:2890--2895.

Hirabayashi Y, Itoh Y, Tabata H, Nakajima K, Akiyama T, Masuyama N,

Gotoh Y. 2004. The Wnt/beta-catenin pathway directs neuronal

differentiation of cortical neural precursor cells. Development

(Cambridge, England). 131:2791--2801.

Holowacz T, Huelsken J, Dufort D, van der Kooy D. 2011. Neural stem

cells are increased after loss of beta-catenin, but neural progenitors

undergo cell death. Eur J Neurosci.

Hovanes K, Li TW, Munguia JE, Truong T, Milovanovic T, Lawrence

Marsh J, Holcombe RF, Waterman ML. 2001. Beta-catenin-sensitive

isoforms of lymphoid enhancer factor-1 are selectively expressed in

colon cancer. Nat Genet. 28:53--57.

Imayoshi I, Sakamoto M, Ohtsuka T, Takao K, Miyakawa T,

Yamaguchi M, Mori K, Ikeda T, Itohara S, Kageyama R. 2008. Roles

of continuous neurogenesis in the structural and functional

integrity of the adult forebrain. Nat Neurosci. 11:1153--1161.

Isono K, Nemoto K, Li Y, Takada Y, Suzuki R, Katsuki M, Nakagawara A,

Koseki H. 2006. Overlapping roles for homeodomain-interacting

protein kinases hipk1 and hipk2 in the mediation of cell growth in

response to morphogenetic and genotoxic signals. Mol Cell Biol.

26:2758--2771.

Israsena N, Hu M, Fu W, Kan L, Kessler JA. 2004. The presence of FGF2

signaling determines whether beta-catenin exerts effects on

proliferation or neuronal differentiation of neural stem cells. Dev

Biol. 268:220--231.

Kazanskaya O, Glinka A, del Barco Barrantes I, Stannek P, Niehrs C,

Wu W. 2004. R-Spondin2 is a secreted activator of Wnt/beta-catenin

signaling and is required for Xenopus myogenesis. Dev Cell.

7:525--534.

Khan Z, Vijayakumar S, de la Torre TV, Rotolo S, Bafico A. 2007. Analysis

of endogenous LRP6 function reveals a novel feedback mechanism

by which Wnt negatively regulates its receptor. Mol Cell Biol.

27:7291--7301.

Kuwabara T, Hsieh J, Muotri A, Yeo G, Warashina M, Lie DC, Moore L,

Nakashima K, Asashima M, Gage FH. 2009. Wnt-mediated activation

of NeuroD1 and retro-elements during adult neurogenesis. Nat

Neurosci. 12:1097--1105.

Lee SM, Tole S, Grove E, McMahon AP. 2000. A local Wnt-3a signal

is required for development of the mammalian hippocampus.

Development (Cambridge, England). 127:457--467.

Li J, Wang CY. 2008. TBL1-TBLR1 and beta-catenin recruit each other to

Wnt target-gene promoter for transcription activation and onco-

genesis. Nat Cell Biol. 10:160--169.


by guest on Decem


Dow

nloaded from


Lie DC, Colamarino SA, Song HJ, Desire L, Mira H, Consiglio A, Lein ES,

Jessberger S, Lansford H, Dearie AR, et al. 2005. Wnt signalling

regulates adult hippocampal neurogenesis. Nature. 437:1370--1375.

Logan CY, Nusse R. 2004. The Wnt signaling pathway in development

and disease. Annu Rev Cell Dev Biol. 20:781--810.

Lois C, Garcia-Verdugo JM, Alvarez-Buylla A. 1996. Chain migration of

neuronal precursors. Science. 271:978--981.

Louie SH, Yang XY, Conrad WH, Muster J, Angers S, Moon RT,

Cheyette BN. 2009. Modulation of the beta-catenin signaling pathway

by the dishevelled-associated protein Hipk1. PLoS One. 4:e4310.

Lukas J, Parry D, Aagaard L, Mann DJ, Bartkova J, Strauss M, Peters G,

Bartek J. 1995. Retinoblastoma-protein-dependent cell-cycle in-

hibition by the tumour suppressor p16. Nature. 375:503--506.

Mallamaci A, Muzio L, Chan CH, Parnavelas J, Boncinelli E. 2000. Area

identity shifts in the early cerebral cortex of Emx2-/- mutant mice.

Nat Neurosci. 3:679--686.

MaoB,WuW, DavidsonG,Marhold J, Li M, Mechler BM, Delius H, HoppeD,

StannekP,WalterC, et al. 2002.KremenproteinsareDickkopf receptors

that regulate Wnt/beta-catenin signalling. Nature. 417:664--667.

Maretto S, Cordenonsi M, Dupont S, Braghetta P, Broccoli V, Hassan AB,

Volpin D, Bressan GM, Piccolo S. 2003. Mapping Wnt/beta-catenin

signaling during mouse development and in colorectal tumors. Proc

Natl Acad Sci U S A. 100:3299--3304.

Menn B, Garcia-Verdugo JM, Yaschine C, Gonzalez-Perez O, Rowitch D,

Alvarez-Buylla A. 2006. Origin of oligodendrocytes in the subven-

tricular zone of the adult brain. J Neurosci. 26:7907--7918.

Mori T, Tanaka K, Buffo A, Wurst W, Kuhn R, Gotz M. 2006. Inducible

gene deletion in astroglia and radial glia—a valuable tool for

functional and lineage analysis. Glia. 54:21--34.

Mutch CA, Schulte JD, Olson E, Chenn A. 2010. Beta-catenin signaling

negatively regulates intermediate progenitor population numbers in

the developing cortex. PLoS One. 5:e12376.

Muzio L, Cavasinni F, Marinaro C, Bergamaschi A, Bergami A, Porcheri C,

Cerri F, Dina G, Quattrini A, Comi G, et al. 2009. Cxcl10 enhances

blood cells migration in the sub-ventricular zone of mice affected by

experimental autoimmune encephalomyelitis. Mol Cell Neurosci.

43:268--280.

Muzio L, DiBenedetto B, Stoykova A, Boncinelli E, Gruss P, Mallamaci A.

2002. Conversion of cerebral cortex into basal ganglia in Emx2(-/-)

Pax6(Sey/Sey) double-mutant mice. Nat Neurosci. 5:737--745.

Muzio L, Soria JM, Pannese M, Piccolo S, Mallamaci A. 2005. A mutually

stimulating loop involving emx2 and canonical wnt signalling

specifically promotes expansion of occipital cortex and hippocam-

pus. Cereb Cortex. 15:2021--2028.

Nam HS, Benezra R. 2009. High levels of Id1 expression define B1 type

adult neural stem cells. Cell Stem Cell. 5:515--526.

Ninkovic J, Mori T, Gotz M. 2007. Distinct modes of neuron addition in

adult mouse neurogenesis. J Neurosci. 27:10906--10911.

Pluchino S, Muzio L, Imitola J, Deleidi M, Alfaro-Cervello C, Salani G,

Porcheri C, Brambilla E, Cavasinni F, Bergamaschi A, et al. 2008.

Persistent inflammation alters the function of the endogenous brain

stem cell compartment. Brain. 131:2564--2578.

Reynolds BA, Weiss S. 1992. Generation of neurons and astrocytes from

isolated cells of the adult mammalian central nervous system.

Science. 255:1707--1710.

Rinaldo C, Prodosmo A, Siepi F, Soddu S. 2007. HIPK2: a multitalented

partner for transcription factors in DNA damage response and

development. Biochem Cell Biol. 85:411--418.

Rui Y, Xu Z, Lin S, Li Q, Rui H, Luo W, Zhou HM, Cheung PY, Wu Z,

Ye Z, et al. 2004. Axin stimulates p53 functions by activation of

HIPK2 kinase through multimeric complex formation. EMBO J.

23:4583--4594.

Saegusa M, Hashimura M, Kuwata T, Hamano M, Okayasu I. 2006.

Induction of p16INK4A mediated by beta-catenin in a TCF4-

independent manner: implications for alterations in p16INK4A

and pRb expression during trans-differentiation of endometrial

carcinoma cells. Int J Cancer. 119:2294--2303.

Semenov MV, Tamai K, Brott BK, Kuhl M, Sokol S, He X. 2001. Head

inducer Dickkopf-1 is a ligand for Wnt coreceptor LRP6. Curr Biol.

11:951--961.

Sessa A, Mao CA, Hadjantonakis AK, Klein WH, Broccoli V. 2008. Tbr2

directs conversion of radial glia into basal precursors and guides

neuronal amplification by indirect neurogenesis in the developing

neocortex. Neuron. 60:56--69.

Sierra J, Yoshida T, Joazeiro CA, Jones KA. 2006. The APC tumor

suppressor counteracts beta-catenin activation and H3K4 methyl-

ation at Wnt target genes. Genes Dev. 20:586--600.

Subramanian L, Remedios R, Shetty A, Tole S. 2009. Signals from the

edges: the cortical hem and antihem in telencephalic development.

Semin Cell Dev Biol. 20:712--718.

Takahashi T, Nowakowski RS, Caviness VS, Jr. 1996. The leaving or Q

fraction of the murine cerebral proliferative epithelium: a general

model of neocortical neuronogenesis. J Neurosci. 16:6183--6196.

Tavazoie M, Van der Veken L, Silva-Vargas V, Louissaint M, Colonna L,

Zaidi B, Garcia-Verdugo JM, Doetsch F. 2008. A specialized vascular

niche for adult neural stem cells. Cell Stem Cell. 3:279--288.

Temple S, Alvarez-Buylla A. 1999. Stem cells in the adult mammalian

central nervous system. Curr Opin Neurobiol. 9:135--141.

Veeman MT, Slusarski DC, Kaykas A, Louie SH, Moon RT. 2003.

Zebrafish prickle, a modulator of noncanonical Wnt/Fz signaling,

regulates gastrulation movements. Curr Biol. 13:680--685.

Wei G, Ku S, Ma GK, Saito S, Tang AA, Zhang J, Mao JH, Appella E,

Balmain A, Huang EJ. 2007. HIPK2 represses beta-catenin-mediated

transcription, epidermal stem cell expansion, and skin tumorigen-

esis. Proc Natl Acad Sci U S A. 104:13040--13045.

Willert K, Nusse R. 1998. Beta-catenin: a key mediator of Wnt signaling.

Curr Opin Genet Dev. 8:95--102.

Wrobel CN, Mutch CA, Swaminathan S, Taketo MM, Chenn A. 2007.

Persistent expression of stabilized beta-catenin delays maturation of

radial glial cells into intermediate progenitors. Dev Biol. 309:

285--297.

Zhuo L, Theis M, Alvarez-Maya I, Brenner M, Willecke K, Messing A.

2001. hGFAP-cre transgenic mice for manipulation of glial and

neuronal function in vivo. Genesis. 31:85--94.


by guest on Decem


Dow

nloaded from


Wnt Signaling Has Opposing Roles in the Developing and the Adult Brain That Are Modulated by Hipk1

Documents

Transcript of Wnt Signaling Has Opposing Roles in the Developing and the Adult Brain That Are Modulated by Hipk1