http://vet.sagepub.com/Veterinary Pathology Online

http://vet.sagepub.com/content/45/2/131The online version of this article can be found at:

 DOI: 10.1354/vp.45-2-131

2008 45: 131Vet PatholP. J. Dickinson, B. K. Sturges, R. J. Higgins, B. N. Roberts, C. M. Leutenegger, A. W. Bollen and R. A. LeCouteur

Nervous System TumorsVascular Endothelial Growth Factor mRNA Expression and Peritumoral Edema in Canine Primary Central

  

Published by:

http://www.sagepublications.com

On behalf of: 

Pathologists.American College of Veterinary Pathologists, European College of Veterinary Pathologists, & the Japanese College of Veterinary

can be found at:Veterinary Pathology OnlineAdditional services and information for    

  http://vet.sagepub.com/cgi/alertsEmail Alerts:

 

http://vet.sagepub.com/subscriptionsSubscriptions:  

http://www.sagepub.com/journalsReprints.navReprints:  

http://www.sagepub.com/journalsPermissions.navPermissions:  

What is This? 

- Mar 1, 2008Version of Record >>

by guest on October 11, 2013vet.sagepub.comDownloaded from by guest on October 11, 2013vet.sagepub.comDownloaded from by guest on October 11, 2013vet.sagepub.comDownloaded from by guest on October 11, 2013vet.sagepub.comDownloaded from by guest on October 11, 2013vet.sagepub.comDownloaded from by guest on October 11, 2013vet.sagepub.comDownloaded from by guest on October 11, 2013vet.sagepub.comDownloaded from by guest on October 11, 2013vet.sagepub.comDownloaded from by guest on October 11, 2013vet.sagepub.comDownloaded from by guest on October 11, 2013vet.sagepub.comDownloaded from

Vascular Endothelial Growth Factor mRNA Expression andPeritumoral Edema in Canine Primary Central Nervous

System Tumors

P. J. DICKINSON, B. K. STURGES, R. J. HIGGINS, B. N. ROBERTS, C. M. LEUTENEGGER, A. W. BOLLEN, AND

R. A. LECOUTEUR

Departments of Surgical and Radiological Sciences (PJD, BKS, BNR, RAL), Pathology, Microbiologyand Immunology (RJH) and Medicine and Epidemiology (CML), School of Veterinary Medicine,University of California, Davis, Davis, CA; and Department of Pathology, School of Medicine,

University of California, San Francisco, San Francisco, CA (AWB)

Abstract. Vascular endothelial growth factor (VEGF) is an important regulator of tumorangiogenesis and vascular permeability, and has been implicated both in progression of central nervoussystem (CNS) tumors and development of vasogenic peritumoral edema. A retrospective study was doneto characterize the levels of expression of the 3 major canine VEGF isoforms (VEGF120, VEGF164,VEGF188) in a variety of spontaneous canine CNS tumors using quantitative TaqMan reversetranscription real-time polymerase chain reaction. Presence and degree of peritumoral edema also weredetermined in sampled tumors using magnetic resonance imaging (MRI). Increased expression of VEGFrelative to normal cerebral cortex tissue was seen predominantly in high grade astrocytic (grade IV) andoligodendroglial (grade III) tumors, with lower expression in low grade astrocytomas (grade II) andmeningiomas (grade I). All 3 major VEGF isoforms were present; VEGF164 was the predominantisoform, particularly in the tumors with the highest VEGF expression. Peritumoral edema was present inall tumor types; however, a significant association between the extent of peritumoral edema and the levelof VEGF expression was not apparent.

Key words: Canine; central nervous system tumors; edema; reverse transcriptase polymerase chainreaction; vascular endothelial growth factor; VEGF.

Introduction

Vascular endothelial growth factor (VEGF), alsotermed VEGFA and vascular permeability factor,is a member of a family of angiogenesis-relatedgrowth factors. It is a potent endothelial cellmitogen and survival factor, and a strong inducerof vascular permeability, a thousand times morepotent than histamine.17,22 It is an essential factorfor angiogenesis and vasculogenesis during normaldevelopment and is proposed to play a major rolein tumor neovascularization and associated ede-ma.11,28 The VEGF gene consists of 8 exons, and inhumans at least 9 VEGF isoforms are produced byalternative splicing: VEGF121, VEGF145, VEGF148,VEGF162, VEGF165, VEGF165b, VEGF183,VEGF189, VEGF206.2,10,11,48 VEGF121, VEGF165,and VEGF189 are the major isoforms secreted bymost cell types, with VEGF165 being the mostabundant isoform in both normal and transformedcells.10,44 The major VEGF isoforms bind cell-surface heparan sulphate proteoglycans to varying

degrees, with VEGF121 being freely diffusible,approximately half of secreted VEGF165 beingbound, and almost all VEGF189 remaining seques-tered in the extracellular matrix.

VEGF is overexpressed at both the mRNA andprotein level in a variety of human brain tumors,including astrocytomas,13,14,29,33,38,39,45,49,54 oligoden-drogliomas,6,7,14,19,45,52 and meningiomas.13,14,21,36,45,49

VEGF expression has been associated with avariety of factors, including necrosis and hypoxia,growth factors such as transforming growth factor(TGF) and fibroblast growth factor (FGF), cyto-kines including IL-1a and IL-6, and oncogenes ortumor suppressor genes such as Ras and TP53.11,28

Most studies have linked the degree of overexpres-sion of VEGF with increasing tumor grade inastrocytomas, oligodendrogliomas, and meningio-mas;5,6,13,14,19,21,29,36,38,50,52,54 however, this has notbeen universally reported.35,45,47

Vasogenic peritumoral edema is a well-docu-mented complication contributing to morbidity

Vet Pathol 45:131–139 (2008)

131

and death in patients with central nervous system(CNS) tumors. The exact mechanisms responsiblefor increased vascular permeability in specifictumors have not been elucidated fully and arelikely to be multifactorial; however, VEGF hasbeen implicated as a contributory agent in tumor-related edema in humans. Peritumoral edema,increased vascular permeability, and presence ofintratumoral cysts have been correlated withincreased VEGF expression in human glio-mas20,26,47,51 and meningiomas.12,16,34,35,37,41 In addi-tion, alleviation of peritumoral edema in high gradegliomas following administration of VEGF-recep-tor-specific tyrosine kinase inhibitors indirectlysuggests an important role for VEGF in edemaformation.1

Five VEGF isoforms have been reported in dogs:VEGF120, VEGF144, VEGF164, VEGF182, andVEGF188. These isoforms have approximately95% homology to the human amino acid sequenceand, similar to most other mammals, lack a singleamino acid residue in the N-terminal regioncompared with human VEGF.15,46 VEGF expres-sion has been demonstrated by means of immuno-histochemistry and polymerase chain reaction(PCR) and in a variety of canine neoplasms,30,42,43,46

including 2 canine grade IV astrocytomas23 and aseries of grade 1 meningiomas.40 Few data existdescribing the relative expression of VEGF iso-forms in canine tissues, although all available datasuggest that VEGF120, VEGF164, and VEGF188 arethe most abundant isoforms, as in other mamma-lian species; VEGF120, VEGF164, and VEGF188

were shown by RT-PCR and sequencing to be themajor isoforms in canine lung carcinoma,46 andsimilar data were reported in canine heart usingRT-PCR, ribonuclease protection assays, andWestern blotting.15 The objectives of this studywere twofold: 1) to evaluate the mRNA expressionof the major VEGF isoforms in a variety ofprimary canine CNS tumors using quantitativereal-time TaqMan polymerase chain reaction andto correlate any mRNA expression with tumor type

and grade, and 2) to determine whether there wasan association between the level of VEGF mRNAexpression in canine CNS tumors and the presenceor severity of peritumoral edema evaluated bymagnetic resonance imaging (MRI).

Materials and Methods

Sample collection

All tumor tissue was obtained from surgical biopsy/resection specimens, necropsy, or from archival paraf-fin-embedded material from clinical cases presented tothe Veterinary Medical Teaching Hospital, University ofCalifornia, Davis. Samples of tumor from necropsy werecollected within 20 minutes of death and snap frozen inliquid nitrogen. Surgical samples were similarly storedfollowing collection. Samples of adjacent tumor tissuewere processed for routine paraffin embedding andhistology whenever fresh tissue was collected in liquidnitrogen. Normal brain samples were collected fromboth necropsy and archival paraffin-embedded material.All tumors were graded by a board certified pathologist(RJH, AWB) essentially according to the internationalWorld Health Organization classification of humantumors of the nervous system.18,24,25 Meningiomas weregraded as either grade I (benign), grade II (atypical), orgrade III (malignant); astrocytomas were graded aseither grade II (diffuse), grade III (anaplastic), or gradeIV (glioblastoma multiforme); oligodendroglial tumorswere graded as either grade II (oligodendroglioma) orgrade III (anaplastic oligodendroglioma). Clinical re-cords were reviewed for evidence of corticosteroidadministration prior to either MRI or acquisition oftumor samples.

Magnetic resonance imaging

MRI was done using either a 0.4T scanner (Resonex5000, Resonex Inc., Sunnyvale, CA) or a 1.5T scanner(General Electric, Sigma, Milwaukee, WI). The imagingsequences were obtained from transverse 5-mm sliceswith an interslice gap of 1 mm generated with T1-weighted (T1W), T2-weighted (T2W), and proton-density weighted (PDW) spin echo pulse sequences.T1-weighted images were also acquired after theintravenous administration of gadolinium-diethylene-triaminepenta-acetic acid (Gd-DTPA; Magnevist, Ber-lex Laboratories, Wayne, NJ) at 0.2 mmol/kg. Peritu-

Table 1. TaqMan PCR primers.

Target Forward Primer Sequence (59R39) Reverse Primer Sequence (59R39)

GAPDH GATGGGCGTGAACCATGAG TCATGAGGCCCTCCACGATRibosomal protein

L13AAAGTTGAATTACCTGGCCTTCCT GGGTGCCCGGAAGTCATAG

Glycosyltransferase GAGATGACCTCTCAACTTTAACTGAAAA CAAGGGAAGCAAGGTTTGCAB-glucuronidase GCTGGATCAGAAACGCAAAGA CTCTCTGTGGTGACTGGTCAGTCATVEGF120 AGATTATGCGGATCAAACCTCATC TCGGCTTGTCACATTTTTCTTGVEGF164 AGATTATGCGGATCAAACCTCATC CCACAGGGATTTTCTTGCCTTVEGF188 AGATTATGCGGATCAAACCTCATC CTCGAACTGATTTTTTTTCTTGCCTT

132 Dickinson, Sturges, Higgins, Roberts, Leutenegger, Bollen, and LeCouteur Vet Pathol 45:2, 2008

moral edema was determined to be present or absentbased on the presence of hyperintensity on T2-weightedimages beyond the tumor boundary. Tumor boundarieswere determined based on T1W, T1W postcontrast,T2W, and PDW images. Edema was graded either asabsent, focal if edema was present on 1 or 2 consecutiveT2W images beyond the tumor margin, or diffuse ifpresent on 3 or more consecutive images beyond thetumor margin.

Canine VEGF sequence

Canine VEGF cDNA sequence data and clones forVEGF isoforms VEGF120, VEGF164, and VEGF188

were kindly provided by Dr. Rolf Jaussi (Institute ofMedical Radiobiology of the University of Zurich andthe Paul Scherrer Institute, Zurich, Switzerland).

TaqMan PCR

Total RNA extraction, cDNA preparation, and real-time TaqMan PCR were done as previously described.9

VEGF PCR primers for canine isoforms VEGF120,VEGF144, and VEGF188 were designed based on caninesequence data described above using Primer Expresssoftware (Applied Biosystems, Foster City, CA) and arelisted and illustrated in Table 1 and Fig. 1. TaqManPCR primers for canine housekeeping genes glyceralde-hydes-3-phosphate dehydrogenase (GAPDH), ribosom-al protein L13A, glycosyltransferase (HPRT1), andglucuronidase beta (GUSB) (Table 1) were designedand validated as previously described.9 PCR productswere designed to be less than 150 base pairs in length,with either one of the primer pairs or internal probeplaced over an exon-exon junction to allow discrimina-tion between cDNA and gDNA. PCR products wereinitially validated by agarose gel electrophoresis. Subse-quently, products from triplicate PCR reactions, gener-ated using control canine pooled tissue cDNA and eachprimer pair, were combined and purified (QIAquickPCR purification kit, QIAGEN Inc., Valencia, CA).Specificity of the PCR product was then confirmed bydirect sequencing using an automated big dye termina-tion sequencing procedure (Davis Sequencing, Davis,CA). Transcript quantitation was done using thecomparative CT method and reported as relativetranscription, or the n-fold difference relative to themean value for individual normal cerebral cortex

samples (n 5 15). Tumor samples that had GAPDHCT values weaker than 3 times the average GAPDH CT

value were considered low-quality cDNA samples andwere discarded.

Statistical analysis

Data were divided into nominal categories of tumortype, and for astrocytomas, they were further dividedinto ordinal categories of grade. Kruskal-Wallis one-way analysis of variance (ANOVA) was used tocompare the variation in expression of VEGF mRNAamong tumor types. When significant differences wereevident, Mann-Whitney tests were used for pairwisecomparisons. A sequentially rejective modification ofBonferroni’s multiple comparison adjustment was usedto confirm significant results. Variation in expression ofspecific VEGF isoforms within tumor groups wasassessed using Friedman two-way ANOVA and Wil-coxon signed rank test for paired data. Peritumoraledema data were divided into ordinal categories ofseverity: 0 5 no edema, 1 5 focal edema, 2 5 diffuseedema. Trends in expression of VEGF isoforms withseverity of peritumoral edema were evaluated using theJonckheere-Terpstra test. Evaluation of VEGF expres-sion with presence or absence of edema was done usingMann-Whitney tests. The effect of presence or absenceof corticosteroid administration on total VEGF expres-sion and presence or absence of edema was assessedusing Mann-Whitney tests. Statistical significance wasdefined as P # .05.

Results

VEGF expression

PCR products from the 3 VEGF primer setswere of the appropriate size based on agarose gelelectrophoresis, and direct sequencing of gel-extracted product resulted in single primer specificsequences corresponding to the 3 major isoforms,VEGF120, VEGF164, and VEGF188. VEGF PCRproduct was amplified from 56 separate samplesfrom 56 dogs; 15 samples of normal cerebralcortex, 9 grade I meningiomas, 1 grade II (atypical)meningioma, 6 grade II astrocytomas, 5 grade IVastrocytomas (glioblastoma multiforme [GBM]), 2grade II oligodendrogliomas, and 18 grade III

Table 1. Continued.

Length (bp) Probe Sequence (59R39)

131 CCCTCAAGATTGTCAGCAATGCCTCCT78 AACACCAACCCATCCCGTGGCC

92 CTTGATTGTTGAAGATCTCATTGACACAGGCA86 TGGTTGGAGAGCTCATCTGGAATTTTGCT123 CAGCATAGCAAATGTGAATGCAGACCAAA118 CAGCATAGCAAATGTGAATGCAGACCAAA123 CAGCATAGCAAATGTGAATGCAGACCAAA

Vet Pathol 45:2, 2008 VEGF Expression in Canine CNS Tumors 133

(anaplastic) oligodendrogliomas (Fig. 2). Threegrade I meningiomas and 1 grade III oligodendro-glioma were of spinal cord origin. Averages ofnormalized values and the standard deviations forboth frozen and paraffin-embedded samples werenot significantly different.Increased expression of VEGF transcripts was

seen most often with high grade gliomas, includingGBMs and oligodendrogliomas. Combined expres-sion of all isoforms was significantly greater inGBMs than grade II astrocytomas (P 5 .026) andsignificantly greater in oligodendrogliomas thanmeningiomas (P 5 .009) or grade II astrocytomas(P 5 .001). There was no significant differencebetween total VEGF expression in GBMs andoligodendrogliomas (P5 .25) (Fig. 2b). Expressionof VEGF isoforms in the single atypical meningi-oma was similar to that in the grade I meningio-mas. Expression of VEGF isoforms in the 2 gradeII oligodendrogliomas were ranked the second andfifth lowest of all oligodendroglial samples as asingle group. All 3 major VEGF isoforms werepresent in tumor samples, and VEGF164 was thepredominant isoform in grade III oligodendrogli-omas (P 5 .016) (Fig. 2a).

Information relating to administration of corti-costeroids was available for 38/41 tumors. Corti-costeroids of varying dose and duration wereadministered in 23/38 dogs prior to collection oftumor samples. There was no statistical differencein VEGF transcript levels in treated and untreatedtumor samples when looking at individual tumorgroups. Total VEGF expression with administra-tion of corticosteroids approached significancewhen looking at all tumor groups combined (P 5.055).

Peritumoral edema

MRI was available for 37 dogs from whichtumor samples were analyzed. This included 9meningiomas, 4 grade II astrocytomas, 5 GBMs, 2grade II oligodendrogliomas, and 17 grade IIIoligodendrogliomas. Edema was absent in 2/9meningiomas, 1/4 grade II astrocytoma, 2/2 gradeII oligodendrogliomas, and 5/17 grade III oligo-dendrogliomas; focal in 4/9 meningiomas, 2/4 gradeII astrocytomas, 5/5 GBMs, and 11/17 grade IIIoligodendrogliomas; diffuse in 3/9 meningiomas, 2/4 grade II astrocytomas, and 1/17 grade IIIoligodendrogliomas. No significant association

Fig. 1. Schematic representation of the exon structure and splice variants of canine and human VEGF. Knowncanine splice variants are in bold marked with an asterisk (*). Isoform lengths are numbered as for canine. Thecanine VEGF primers and probes were designed to amplify canine VEGF isoforms 120, 164, and 188 using acommon forward primer (F), a common internal probe (P), and reverse primers containing a common terminus (Rc)located at the end of exon 5 linked to isoform-specific sequence in exon 8 (VEGF120), exon 7 (VEGF164), and exon 6(VEGF188). It is unknown whether additional VEGF isoforms reported in humans are present in dogs. It is possiblethat the VEGF164 primers might also amplify VEGF164b and VEGF147, and the VEGF188 primers might amplifyVEGF182, VEGF162, VEGF145, and VEGF205. Ex 5 exon, UTR 5 untranslated region. Sequence specificity wasconfirmed by direct sequencing.

134 Dickinson, Sturges, Higgins, Roberts, Leutenegger, Bollen, and LeCouteur Vet Pathol 45:2, 2008

was seen between edema scores or presence/absenceof edema and increased expression of VEGF forany tumor group individually, or for all tumorgroups combined.Information relating to administration of corti-

costeroids was available for 35/37 MRI studies.Corticosteroids were administered in 12/37 dogsprior to MRI. There was no statistical associationbetween the presence or absence of edema andcorticosteroid administration.

Discussion

VEGF and its receptors are essential regulatorsof angiogenesis and vascular permeability and arepostulated to play a major role in human tumorangiogenesis, carcinogenesis, invasion, and metas-tasis.48 In the current study, we have demonstratedthe presence of all 3 major VEGF mRNA isoformsin canine meningiomas, astrocytomas, and oligo-dendrogliomas and shown that VEGF mRNA

Fig. 2. Expression of the major canine VEGF mRNA isoforms (a) and total VEGF mRNA isoforms (b) inprimary canine CNS tumors. The highest expression is generally in high grade gliomas, and VEGF164 is thepredominant isoform present. MEN I 5 meningiomas; AST II 5 astrocytoma grade II; GBM 5 glioblastomamultiforme (astrocytoma grade IV); OLIGO III5 oligodendroglioma grade III; 1205VEGF120 isoformmRNA; 1645VEGF164 isoformmRNA; 1885VEGF188 isoformmRNA. The top and bottom edge of the box plots represent theupper and lower quartile, respectively. The line within the box represents the median. The tails extend to the farthestpoint that is within 1.5 interquartile ranges of the quartiles. x-Axis divisions are proportional to sample size.

Vet Pathol 45:2, 2008 VEGF Expression in Canine CNS Tumors 135

expression is highest in high grade gliomas,specifically GBMs and grade III oligodendroglio-mas.Although 9 alternatively spliced human VEGF

isoforms have been described (Fig. 1), 3 isoforms(VEGF121, VEGF165, and VEGF189) predominatein the majority of human tissues and tumors. Inparticular, VEGF165 and to a lesser extentVEGF121 have been shown to be the predominantisoforms expressed in several human tumors,including astrocytomas, oligodendrogliomas, andmeningiomas.3,14,32,36 Individual isoforms have beenshown to have distinct roles in vascular patterningand venous and arterial development; however, theroles of specific isoforms in neoplastic tissuesremain unclear. The findings of the current studysuggest that VEGF164 (canine VEGF isoforms are1 aa residue shorter than their human counterparts)is the predominant mRNA isoform in canine CNStumors, similar to their human tumor counterparts,at least when significant overexpression is present.This predominance also parallels a previous studywhere VEGF164 was found to be the major isoformin the canine heart.15 The TaqMan PCR primersdesigned to amplify VEGF120, VEGF164, andVEGF188 for this study could potentially haveamplified other additional isoforms based onhuman data (Fig. 1). Specifically, the VEGF164

primers might also amplify VEGF147 andVEGF164b, and the VEGF188 primers might am-plify VEGF145, VEGF162, VEGF182, and VEGF205.The VEGF120 primers should not amplify anyother published human isoforms. Of these iso-forms, only VEGF182 has been described in dogs;15

however, it is likely that other isoforms are alsopresent and remain to be documented. Isoformsother than VEGF121, VEGF165, and VEGF189 haveonly been described in relatively small amounts inhumans. Agarose gel analysis and sequencing ofcanine products generated with the current primersets revealed single bands with product sequencesconsistent with the expected major VEGF iso-forms, making the presence of significant amountsof most of the potential additional isoformsunlikely.Increased expression of VEGF mRNA in canine

high grade gliomas is not surprising since thepresence of microvascular proliferation, presum-ably driven in part by VEGF, is a histologiccriterion for their classification. Similar findingshave been reported in human studies with highgrade gliomas having greater expression thanmeningiomas,13,14,49 and GBMs and high grade(III) oligodendrogliomas having greater expressionthan low grade astrocytomas and low grade (II)

oligodendrogliomas.5 Some studies, however, re-ported no marked differences in VEGF expressionbetween different tumor types and grades.45 Only 2/20 oligodendrogliomas in this study were lowgrade, and statistical analysis was not possible;however, VEGF mRNA expression for thesesamples were the second and fifth lowest valuesfor the oligodendroglial tumors. Care should betaken when attempting to interpret individualsamples since transcription levels were assessedfor small samples of the whole tumor, and VEGFmRNA expression may vary markedly in differentregions of a tumor depending on intratumoralfactors such as necrosis and hypoxia. As such,significant variation between individual tumors isto be expected, as seen in this study, and overallconclusions should be restricted to describingbroad trends in tumor types and grades as a whole.Although the current study demonstrates increasedVEGF mRNA expression in high grade caninetumors, no specific comments can be made relatingto VEGF protein expression. However, increasedlevels of both VEGF mRNA and protein have beendocumented independently in a variety of humanCNS tumors,6,7,13,14,19,21,29,33,39,45,49,52,54 and somestudies have specifically demonstrated elevatedVEGF protein associated with elevated VEGFmRNA in the same tumor samples.36,38 It istherefore likely that the general patterns seen inVEGF mRNA expression in canine CNS tumorswill be reflected in similar studies quantifyingprotein expression.

The effect of corticosteroid administration onVEGF expression is poorly defined. Corticoste-roids have been shown to decrease VEGF expres-sion, predominantly at the transcriptional level invitro;8 however, in vivo, human tumors withperitumoral edema may express VEGF whetheror not pretreated with corticosteroids.27,47,51 Nosignificant difference was seen within individualtumor groups when comparing levels of VEGFmRNA expression in corticosteroid treated tountreated samples in the current study. However,decreased total VEGF expression with corticoste-roid administration approached significance (P 5.055) when looking at all tumors combined. Dosageand duration of corticosteroid administrationvaried markedly (from less than 24 hours to severalweeks) between individual dogs, and it is possiblethat VEGF mRNA expression could have beendecreased following treatment in certain tumors.However it is unlikely that this had a significanteffect on the broad conclusions made regardingVEGF mRNA expression in the different caninetumors.

136 Dickinson, Sturges, Higgins, Roberts, Leutenegger, Bollen, and LeCouteur Vet Pathol 45:2, 2008

VEGF is known to be a potent factor resulting inincreased vascular permeability and has beenassociated with the presence of peritumoral vaso-genic edema in human CNS tumors. No significantassociation between the level of VEGF mRNAexpression and the degree or presence of peritu-moral edema was seen in this study for any groupof tumors, although MRI data were only availablefor a subset of the tumor samples and overallsample numbers were low. Several human studieshave reported a correlation between VEGF expres-sion and peritumoral edema47 or vascular perme-ability26 in human gliomas, and the decreasededema following treatment with specific inhibitorsof VEGFR tyrosine kinase receptors in humanclinical trials is strong circumstantial evidence for amajor role of VEGF in edemagenesis.1 However, alack of correlation also has been reported.51 A moreconsistent correlation between VEGF expressionand edema has been reported for human meningi-omas,12,16,34,35,37,41 although several other factorshave been implicated, including tumor size andlocation, presence of a cerebral pial blood sup-ply,4,53 other cytokines, vascular obstruction, andintrinsic permeability differences in tumor bloodvessels. None of these additional factors wereassessed in the current study. As discussed above,the exact role of corticosteroid administration onVEGF expression and its subsequent effects onperitumoral edema in vivo are unclear. Althoughthe limited data in the current report must beinterpreted with caution, no significant differenceswere seen between corticosteroid treated anduntreated tumors and the presence or degree ofedema, in either canine meningiomas or gliomas,and it is likely that the presence of peritumoraledema, similar to human tumors, is dependent onmany factors in addition to VEGF expression.Both presence31,33,54 and absence19,50 of a corre-

lation between VEGF expression and clinicaloutcome has been reported for individual humanpatients with specific types and grades of CNStumors, and high VEGF expression has beenassociated with poor outcome in canine grade Imeningiomas.40 No attempt was made to correlateprognosis with VEGF mRNA expression in thecurrent study; however, intuitively, the higher levelof expression in high grade gliomas as a group islikely to be associated with a poorer prognosisrelative to the lower expression in lower gradegliomas and meningiomas.VEGF, with its multiple isoforms, each poten-

tially having multiple effects, is one factor in afamily of proteins involved in the highly complexprocesses of angiogenesis, carcinogenesis, and

control of vascular permeability in CNS tumors.We have previously shown that mRNAs for the 2major tyrosine kinase receptors for VEGF(VEGFR-1, VEGFR-2) are overexpressed in manycanine CNS tumors, particularly high gradegliomas.9 The current study further supports amajor role for VEGF in the biology of these tumorsand reinforces the striking similarities betweencanine CNS tumors and their human counterparts.Although the validity and efficacy of VEGFtargeted therapy in neuro-oncology has still to beproven, these data support the further investigationof VEGF expression as a prognostic marker andtherapeutic target in canine primary CNS tumors.

Acknowledgements

This research was supported by the Paul C. andBorghild T. Petersen Foundation and the Center forCompanion Animal Health, University of California,Davis, CA. We are grateful to John Doval for hisassistance with the illustrations.

References

1 Batchelor TT, Sorensen AG, di Tomaso E, ZhangWT, Duda DG, Cohen KS, Kozak KR, Cahill DP,Chen PJ, Zhu M, Ancukiewicz M, Mrugala MM,Plotkin S, Drappatz J, Louis DN, Ivy P, ScaddenDT, Benner T, Loeffler JS, Wen PY, Jain RK:AZD2171, a pan-VEGF receptor tyrosine kinaseinhibitor, normalizes tumor vasculature and allevi-ates edema in glioblastoma patients. Cancer Cell11:83–95, 2007

2 Bates DO, Cui TG, Doughty JM, Winkler M,Sugiono M, Shields JD, Peat D, Gillatt D, HarperSJ: VEGF165b, an inhibitory splice variant ofvascular endothelial growth factor, is down-regulat-ed in renal cell carcinoma. Cancer Res 62:4123–4131,2002

3 Berkman RA, Merrill MJ, Reinhold WC, MonacciWT, Saxena A, Clark WC, Robertson JT, Ali IU,Oldfield EH: Expression of the vascular permeabilityfactor/vascular endothelial growth factor gene incentral nervous system neoplasms. J Clin Invest91:153–159, 1993

4 Bitzer M, Opitz H, Popp J, Morgalla M, Gruber A,Heiss E, Voigt K: Angiogenesis and brain oedema inintracranial meningiomas: influence of vascularendothelial growth factor. Acta Neurochir140:333–340, 1998

5 Chan AS, Leung SY, Wong MP, Yuen ST, CheungN, Fan YW, Chung LP: Expression of vascularendothelial growth factor and its receptors in theanaplastic progression of astrocytoma, oligodendro-glioma, and ependymoma. Am J Surg Pathol22:816–826, 1998

6 Christov C, Adle-Biassette H, Le Guerinel C,Natchev S, Gherardi RK: Immunohistochemicaldetection of vascular endothelial growth factor

Vet Pathol 45:2, 2008 VEGF Expression in Canine CNS Tumors 137

(VEGF) in the vasculature of oligodendrogliomas.Neuropathol Appl Neurobiol 24:29–35, 1998

7 Christov C, Gherardi RK: Vascular endothelialgrowth factor (VEGF) likely contributes to oligo-dendroglioma angiogenesis. Acta Neuropathol(Berl) 97:429–432, 1999

8 Criscuolo GR, Merrill MJ, Oldfield EH: Furthercharacterization of malignant glioma-derived vascu-lar permeability factor. J Neurosurg 69:254–262,1988

9 Dickinson PJ, Roberts BN, Higgins RJ, LeuteneggerCM, Bollen AW, Kass PH, LeCouteur RA: Expres-sion of receptor tyrosine kinases VEGFR-1 (FLT-1),VEGFR-2 (KDR), EGFR-1, PDGFRa and c-Met incanine primary brain tumors. Veterinary and Com-parative Oncology 4:132–140, 2006

10 Ferrara N, Davis-Smyth T: The biology of vascularendothelial growth factor. Endocr Rev 18:4–25, 1997

11 Ferrara N, Gerber HP, LeCouter J: The biology ofVEGF and its receptors. Nat Med 9:669–676, 2003

12 Goldman CK, Bharara S, Palmer CA, Vitek J, TsaiJC, Weiss HL, Gillespie GY: Brain edema inmeningiomas is associated with increased vascularendothelial growth factor expression. Neurosurgery40:1269–1277, 1997

13 Hatva E, Kaipainen A, Mentula P, Jaaskelainen J,Paetau A, Haltia M, Alitalo K: Expression ofendothelial cell-specific receptor tyrosine kinasesand growth factors in human brain tumors.Am J Pathol 146:368–378, 1995

14 Huang H, Held-Feindt J, Buhl R, Mehdorn HM,Mentlein R: Expression of VEGF and its receptorsin different brain tumors. Neurol Res 27:371–377,2005

15 Jingjing L, Srinivasan B, Bian X, Downey HF,Roque RS: Vascular endothelial growth factor isincreased following coronary artery occlusion in thedog heart. Mol Cell Biochem 214:23–30, 2000

16 Kalkanis SN, Carroll RS, Zhang J, Zamani AA,Black PM: Correlation of vascular endothelialgrowth factor messenger RNA expression withperitumoral vasogenic cerebral edema in meningio-mas. J Neurosurg 85:1095–1101, 1996

17 Keck PJ, Hauser SD, Krivi G, Sanzo K, Warren T,Feder J, Connolly DT: Vascular permeability factor,an endothelial cell mitogen related to PDGF. Science246:1309–1312, 1989

18 Kleihues P, Louis DN, Scheithauer BW, Rorke LB,Reifenberger G, Burger PC, Cavenee WK: TheWHO classification of tumors of the nervous system.J Neuropathol Exp Neurol 61:215–225; discussion226–229, 2002

19 Korshunov A, Golanov A: The prognostic signifi-cance of vascular endothelial growth factor (VEGFC-1) immunoexpression in oligodendroglioma. Ananalysis of 91 cases. J Neurooncol 48:13–19, 2000

20 Lafuente JV, Adan B, Alkiza K, Garibi JM, RossiM, Cruz-Sanchez FF: Expression of vascular endo-thelial growth factor (VEGF) and platelet-derived

growth factor receptor-beta (PDGFR-beta) in hu-man gliomas. J Mol Neurosci 13:177–185, 1999

21 Lamszus K, Lengler U, Schmidt NO, Stavrou D,Ergun S, Westphal M: Vascular endothelial growthfactor, hepatocyte growth factor/scatter factor, basicfibroblast growth factor, and placenta growth factorin human meningiomas and their relation toangiogenesis and malignancy. Neurosurgery 46:938–947; discussion 947–938, 2000

22 Leung DW, Cachianes G, Kuang WJ, Goeddel DV,Ferrara N: Vascular endothelial growth factor is asecreted angiogenic mitogen. Science 246:1306–1309,1989

23 Lipsitz D, Higgins RJ, Kortz GD, Dickinson PJ,Bollen AW, LeCouteur RA: Glioblastoma multi-forme: clinical findings, magnetic resonance imagingand pathology in 5 dogs. Vet Pathol 40:659–669,2003

24 Louis DN, Ohgaki H, Wiestler OD, Cavenee WK:WHO classification of tumors of the central nervoussystem, 4th ed, WHO Press, Geneva, Switzerland,2007

25 Louis DN, Ohgaki H, Wiestler OD, Cavenee WK,Burger PC, Jouvet A, Scheithauer BW, Kleihues P:The 2007 WHO Classification of Tumours of theCentral Nervous System. Acta Neuropathol (Berl)114:97–109, 2007

26 Machein MR, Kullmer J, Fiebich BL, Plate KH,Warnke PC: Vascular endothelial growth factorexpression, vascular volume, and, capillary perme-ability in human brain tumors. Neurosurgery44:732–740; discussion 740–731, 1999

27 Machein MR, Kullmer J, Ronicke V, Machein U,Krieg M, Damert A, Breier G, Risau W, Plate KH:Differential downregulation of vascular endothelialgrowth factor by dexamethasone in normoxic andhypoxic rat glioma cells. Neuropathol Appl Neuro-biol 25:104–112, 1999

28 Machein MR, Plate KH: VEGF in brain tumors.J Neurooncol 50:109–120, 2000

29 Maia AC Jr, Malheiros SM, da Rocha AJ, da SilvaCJ, Gabbai AA, Ferraz FA, Stavale JN: MRcerebral blood volume maps correlated with vascularendothelial growth factor expression and tumor gradein nonenhancing gliomas. AJNR Am J Neuroradiol26:777–783, 2005

30 Maiolino P, De Vico G, Restucci B: Expression ofvascular endothelial growth factor in basal celltumours and in squamous cell carcinomas of canineskin. J Comp Pathol 123:141–145, 2000

31 Maiuri F, Del Basso De Caro ML, Iaconetta G,Peca C, Esposito M, de Divitiis E: Prognostic andsurvival-related factors in patients with well-differ-entiated oligodendrogliomas. Zentralbl Neurochir67:204–209, 2006

32 Munaut C, Boniver J, Foidart JM, Deprez M:Macrophage migration inhibitory factor (MIF)expression in human glioblastomas correlates withvascular endothelial growth factor (VEGF) expres-sion. Neuropathol Appl Neurobiol 28:452–460, 2002

138 Dickinson, Sturges, Higgins, Roberts, Leutenegger, Bollen, and LeCouteur Vet Pathol 45:2, 2008

33 Nam DH, Park K, Suh YL, Kim JH: Expression ofVEGF and brain specific angiogenesis inhibitor-1 inglioblastoma: prognostic significance. Oncol Rep11:863–869, 2004

34 Otsuka S, Tamiya T, Ono Y, Michiue H, KurozumiK, Daido S, Kambara H, Date I, Ohmoto T: Therelationship between peritumoral brain edema andthe expression of vascular endothelial growth factorand its receptors in intracranial meningiomas.J Neurooncol 70:349–357, 2004

35 Paek SH, Kim CY, Kim YY, Park IA, Kim MS,Kim DG, Jung HW: Correlation of clinical andbiological parameters with peritumoral edema inmeningioma. J Neurooncol 60:235–245, 2002

36 Pistolesi S, Boldrini L, Gisfredi S, De Ieso K,Camacci T, Caniglia M, Lupi G, Leocata P, BasoloF, Pingitore R, Parenti G, Fontanini G: Angiogen-esis in intracranial meningiomas: immunohistochem-ical and molecular study. Neuropathol Appl Neu-robiol 30:118–125, 2004

37 Pistolesi S, Fontanini G, Camacci T, De Ieso K,Boldrini L, Lupi G, Padolecchia R, Pingitore R,Parenti G: Meningioma-associated brain oedema:the role of angiogenic factors and pial blood supply.J Neurooncol 60:159–164, 2002

38 Plate KH, Breier G, Weich HA, Mennel HD, RisauW: Vascular endothelial growth factor and gliomaangiogenesis: coordinate induction of VEGF recep-tors, distribution of VEGF protein and possible invivo regulatory mechanisms. Int J Cancer59:520–529, 1994

39 Plate KH, Breier G, Weich HA, Risau W: Vascularendothelial growth factor is a potential tumourangiogenesis factor in human gliomas in vivo.Nature 359:845–848, 1992

40 Platt SR, Scase TJ, Adams V, Wieczorek L, Miller J,Adamo F, Long S: Vascular endothelial growthfactor expression in canine intracranial meningiomasand association with patient survival. J Vet InternMed 20:663–668, 2006

41 Provias J, Claffey K, delAguila L, Lau N, FeldkampM, Guha A: Meningiomas: role of vascular endo-thelial growth factor/vascular permeability factor inangiogenesis and peritumoral edema. Neurosurgery40:1016–1026, 1997

42 Restucci B, Maiolino P, Paciello O, Martano M, DeVico G, Papparella S: Evaluation of angiogenesis incanine seminomas by quantitative immunohisto-chemistry. J Comp Pathol 128:252–259, 2003

43 Restucci B, Papparella S, Maiolino P, De Vico G:Expression of vascular endothelial growth factor incanine mammary tumors. Vet Pathol 39:488–493,2002

44 Robinson CJ, Stringer SE: The splice variants ofvascular endothelial growth factor (VEGF) and theirreceptors. J Cell Sci 114:853–865, 2001

45 Samoto K, Ikezaki K, Ono M, Shono T, Kohno K,Kuwano M, Fukui M: Expression of vascularendothelial growth factor and its possible relationwith neovascularization in human brain tumors.Cancer Res 55:1189–1193, 1995

46 Scheidegger P, Weiglhofer W, Suarez S, Kaser-HotzB, Steiner R, Ballmer-Hofer K, Jaussi R: Vascularendothelial growth factor (VEGF) and its receptorsin tumor-bearing dogs. Biol Chem 380:1449–1454,1999

47 Strugar JG, Criscuolo GR, Rothbart D, HarringtonWN: Vascular endothelial growth/permeability fac-tor expression in human glioma specimens: correla-tion with vasogenic brain edema and tumor-associ-ated cysts. J Neurosurg 83:682–689, 1995

48 Takahashi H, Shibuya M: The vascular endothelialgrowth factor (VEGF)/VEGF receptor system andits role under physiological and pathological condi-tions. Clin Sci (Lond) 109:227–241, 2005

49 Takano S, Yoshii Y, Kondo S, Suzuki H, Maruno T,Shirai S, Nose T: Concentration of vascular endo-thelial growth factor in the serum and tumor tissueof brain tumor patients. Cancer Res 56:2185–2190,1996

50 Vaquero J, Zurita M, Coca S, Oya S, Morales C:Prognostic significance of clinical and angiogenesis-related factors in low-grade oligodendrogliomas.Surg Neurol 54:229–234; discussion 234, 2000

51 Vaquero J, Zurita M, Morales C, Cincu R, Oya S:Expression of vascular permeability factor in glio-blastoma specimens: correlation with tumor vascularendothelial surface and peritumoral edema.J Neurooncol 49:49–55, 2000

52 Varlet P, Guillamo JS, Nataf F, Koziak M, BeuvonF, Daumas-Duport C: Vascular endothelial growthfactor expression in oligodendrogliomas: a correla-tive study with Sainte-Anne malignancy grade,growth fraction and patient survival. NeuropatholAppl Neurobiol 26:379–389, 2000

53 Yoshioka H, Hama S, Taniguchi E, Sugiyama K,Arita K, Kurisu K: Peritumoral brain edemaassociated with meningioma: influence of vascularendothelial growth factor expression and vascularblood supply. Cancer 85:936–944, 1999

54 Zhou YH, Tan F, Hess KR, Yung WK: Theexpression of PAX6, PTEN, vascular endothelialgrowth factor, and epidermal growth factor receptorin gliomas: relationship to tumor grade and survival.Clin Cancer Res 9:3369–3375, 2003

Request reprints from Dr. P. J. Dickinson, Department of Surgical and Radiological Sciences, Tupper Hall, Schoolof Veterinary Medicine, University of California, Davis, Davis, CA 95616 (USA). E-mail: pjdickinson@ucdavis.edu.

Vet Pathol 45:2, 2008 VEGF Expression in Canine CNS Tumors 139