The MLA6 coiled-coil, NBS-LRR protein confers AvrMla6-dependent resistance specificity to Blumeria...

The MLA6 coiled-coil, NBS-LRR protein confers AvrMla6-dependent resistance speci®city to Blumeria graminis f. sp.hordei in barley and wheat

Dennis Halterman1,2, Fasong Zhou4, Fusheng Wei2,3, Roger P. Wise1,2,3,* and Paul Schulze-Lefert4,²

1 Corn Insects and Crop Genetics Research, USDA-ARS, Iowa State University, Ames, IA 50011±1020 USA,2 Department of Plant Pathology, Iowa State University, Ames, IA 50011±1020 USA,3 Interdepartmental Genetics Program, Iowa State University, Ames, IA 50011±1020 USA, and4 Sainsbury Laboratory, John Innes Centre, Colney Lane, Norwich NR4 7UH, UK

Received 6 November 2000; accepted 13 December 2000.*For correspondence (fax +515 294 9240; e-mail [email protected]).²Present address: Max-Planck-Institut fuÈ r ZuÈ chtungsforschung, Abteilung Biochemie, Carl-von-Linne-Weg 10, D-50829 KoÈ ln, Germany.

Summary

The barley Mla locus confers multiple resistance speci®cities to the obligate fungal biotroph, Blumeria

(= Erysiphe) graminis f. sp. hordei. Interspersed within the 240 kb Mla complex are three families of

resistance gene homologs (RGHs). Probes from the Mla-RGH1 family were used to identify three classes

of cDNAs. The ®rst class is predicted to encode a full-length CC-NBS-LRR protein and the other two

classes contain alternatively spliced, truncated variants. Utilizing a cosmid that contains a gene

corresponding to the full-length candidate cDNA, two single-cell expression assays were used to

demonstrate complementation of AvrMla6-dependent, resistance speci®city to B. graminis in barley and

wheat. The ®rst of these assays was also used to substantiate previous genetic data that the Mla6 allele

requires the signaling pathway component, Rar1, for function. Computational analysis of MLA6 and the

Rar1-independent, MLA1 protein reveals 91.2% identity and shows that the LRR domain is subject to

diversifying selection. Our ®ndings demonstrate that highly related CC-NBS-LRR proteins encoded by

alleles of the Mla locus can dictate similar powdery mildew resistance phenotypes yet still require

distinct downstream signaling components.

Keywords: CC-NBS-LRR, Rar1-dependent signaling, heterologous resistance speci®city, alternative

splicing.

Introduction

Resistance (R) gene products play an important role in the

recognition of invading pathogens and the activation of

responses that impede pathogen growth (Keen, 1990). The

R-gene mediated response is dependent on the expression

of a complementary pathogen avirulence (Avr) gene. If a

host R gene is paired with an appropriate pathogen Avr

gene, recognition occurs and an incompatible interaction

ensues. This incompatibility results in a rapid signal

cascade, leading to an active defense response. In the

absence of either the R gene or the corresponding Avr

gene, a compatible interaction occurs, and the pathogen is

able to proliferate and cause disease. This genetic rela-

tionship between hosts and pathogens, termed a gene-for-

gene interaction, is involved in resistance to a wide range

of pathogen types including fungi, bacteria, viruses and

nematodes (Baker et al., 1997; Bent, 1996; Flor, 1971; Van

Der Biezen and Jones, 1998).

Resistance genes that function in a gene-for-gene

manner generally belong to one of four general classes

based on amino-acid motifs that are found within the

encoded protein sequence (reviewed by Hammond-Kosack

and Jones, 1997). Members of the largest class encode

cytoplasmic proteins with a nucleotide-binding site (NBS)

and several leucine-rich repeats (LRRs). Sequence diversity

within the LRRs is thought to determine recognition

speci®city for proteins that are otherwise quite similar.

Proteins encoded by the NBS-LRR class of resistance

genes can be further subdivided into those with either a

The Plant Journal (2001) 25(3), 335±348

ã 2001 US Government 335

coiled-coil or Toll-interleukin-1 receptor (TIR) homology

domain at the amino terminus, where they may have a

function in directing certain protein±protein interactions

(Lupas et al., 1991; Whitham et al., 1994).

R genes commonly belong to large, clustered families.

These large arrays of similar sequences allow for recom-

bination events that can lead to the evolution of gene

products with novel recognition speci®cities (Michelmore

and Meyers, 1998). These recombination events may be

accompanied by mutations directed at solvent-exposed

residues within the LRR regions to further modify recog-

nition speci®city. These events can result in the formation

of several closely related alleles that function to recognize

different isolates of the same pathogen containing the

corresponding Avr genes. Despite selection for diver-

gence, many of these race-speci®c resistance genes retain

the requirement for common downstream signaling

components (Aarts et al., 1998; Century et al., 1995;

Parker et al., 1996). The NDR1 and EDS1 genes of

Arabidopsis encode two signaling components that are

required by different subsets of NBS-LRR R genes (Aarts

et al., 1998; Century et al., 1995; Parker et al., 1996).

Although members of these subsets are not necessarily

closely related overall, it has been suggested that NDR1

and EDS1 dependency may be determined by the presence

of coiled-coil or TIR domains, respectively (Aarts et al.,

1998; McDowell et al., 2000).

There are approximately 30 Mla variants in barley that

confer `gene-for-gene' speci®city to the powdery mildew

fungus, Blumeria (=Erysiphe) graminis f. sp. hordei DC.

Merat Em. Marchal (Bgh) (reviewed by Jùrgensen, 1994).

Many of these, including Mla1, Mla6 and Mla13, confer a

rapid defense response phenotype, while others, such as

Mla7, Mla14 and Ml-Ru3 confer a delayed and more

intermediate response (Wei et al., 1999; Wise and

Ellingboe, 1983). Moreover, there are different require-

ments among these variants for the downstream signaling

components, Rar1 and Rar2 (Freialdenhoven et al., 1994;

Jùrgensen, 1988; Jùrgensen, 1996; PeterhaÈnsel et al., 1997;

Torp and Jùrgensen, 1986). In contrast to other resistance

clusters that contain only homologous genes, the Mla

locus contains three distinct families of NBS-LRR resist-

ance gene homologs (RGHs) (Wei et al., 1999). Hence, one

might expect signaling speci®city to be due to structural

differences within the R-gene sequence, much like the

differential requirements for NDR1 and EDS1 in

Arabidopsis.

In this report, we utilized the information derived from

our physical analysis of the Mla locus in cultivar (cv.)

Morex (Wei et al., 1999) to rapidly identify functional cDNA

and genomic copies of the Mla6 allele. Two single-cell

expression assays were employed to demonstrate func-

tionality of the cloned Mla6 allele in barley and wheat. The

®rst of these assays was used to substantiate that Mla6

function is dependent on the Mla-signaling gene, Rar1.

Despite their differences in downstream signaling require-

ments, sequence comparison of Mla6 and the recently

cloned Mla1 allele (Zhou et al., 2001) has revealed that the

two predicted proteins are highly similar, thus providing a

unique framework from which to explore the subtle

features of recognition and signaling speci®city.

Results

Isolation of transcribed RGHs from the Mla6 locus

Previous research resulted in the development of a

physical contig of YAC and BAC clones co-segregating

with and spanning the Mla locus. Sequence analysis of

Mla-spanning BACs from cv. Morex revealed the presence

of three families of NBS-LRR resistance gene homologs

(RGHs). These families were designated RGH1, RGH2 and

RGH3 based on their sequence divergence (Wei et al.,

1999; F. Wei, R. Wing and R. Wise, unpublished results).

Although Morex does not contain a characterized Mla

resistance speci®city, we utilized the information derived

from our physical mapping efforts to identify candidates

for the Mla6 allele present in C. I. (Cereal Introduction)

16151, a Franger-derived, near-isogenic line (Moseman,

1972).

Genomic DNA of C.I. 16151 was used as substrate for

PCR ampli®cation of the LRR regions from the three Mla-

RGH families (Figure 1). These low-copy genomic DNAs

were used individually to hybridize to 400 000 Pfu of an

unampli®ed Lambda-Zap cDNA library constructed from

C.I. 16151 seedlings inoculated with an AvrMla6-contain-

ing isolate of Bgh (see Experimental procedures). No

plaques were identi®ed using the Mla-RGH2a or Mla-

RGH3a probes, however, 29 cDNAs with homology to the

NBS-LRR class of plant disease resistance genes hybrid-

ized to a mixed Mla-RGH1a/RGH1e probe. Thirteen of the

29 cDNAs contained 5¢ untranslated regions (UTRs) up to

400 nt in length. The largest of the cDNAs was used as a

probe to re-screen the same library, which resulted in the

isolation of nine previously unidenti®ed cDNAs, including

two truncated classes with no NBS- or LRR-encoding

domain. In total, this screen revealed the presence of three

classes of transcripts with 5¢ UTRs, containing 13, 2 and 1

members, respectively.

Architecture of Mla-RGH1 cDNAs

As shown in Figure 2, members of cDNA classes B and C

are severely truncated and contain only 663 nucleotides

(nt) after the start AUG, compared to the 2871 nt open

reading frame of class A. The ®rst 584 nt of the ORFs

contain four nucleotide differences between class A and

classes B and C. One of these mutations, an insertion at

336 Dennis Halterman et al.

ã US Government, The Plant Journal, (2001), 25, 335±348

base 250 in the open reading frame of classes B and C,

causes a frame shift leading to termination of the protein

sequence after only 87 amino acids. Another striking

difference between these classes occurs 584 nt down-

stream of the start AUG, where 79 nt of classes B and C

have no signi®cant similarity to class A cDNAs.

Signi®cant differences between the three classes of

RGH1 cDNAs were also found within the 5¢ UTRs. Aside

from different intron splicing events, the 5¢ UTRs of classes

B and C contain identical nucleotide sequences, but are

different from class A cDNAs in a small region near the 5¢end (see Figure 2). This divergent region in the ®rst cDNA

class is 68 nt in length and contains two 17 nt repeated

sequences separated by 10 bases. In contrast, in classes B

and C, this region is 28 nt shorter and is identical to the

corresponding section of the 5¢ UTR of Mla1 (Zhou et al.,

2001) but shares no similarity to class A cDNAs. In

summary, these data suggest the presence of separate

genes encoding class A and class B/C cDNAs. The

presence of at least two genes is corroborated by the

observation of three or more hybridizing restriction frag-

ments with multiple enzymes on genomic DNA gel blots

(data not shown). The fact that class B and C cDNAs were

isolated implies that the gene encoding them contains a

functional promoter, although premature termination

within the open reading frame and the absence of any

NBS or LRR encoding sequence suggests that the function

of these proteins could be compromised. Therefore, we

focused on determining whether the gene encoding class

A alone is capable of conferring Mla6 speci®city.

Isolation of cosmids containing a candidate Mla6

genomic sequence

The class A RGH1 cDNA co-segregated with Mla6-

mediated resistance using a previously described high-

resolution mapping population (Mahadevappa et al., 1994;

Wei et al., 1999). In order to isolate a genomic clone for

functional testing, we designed a series of unique PCR

primers unique to the class A cDNA sequence and

screened a three-genome-equivalent cosmid library con-

structed from genomic DNA of C.I. 16151. In contrast to

conventional cosmid library screening via colony hybrid-

ization, this procedure targeted cosmid clones speci®cally

containing the class A cDNA sequence as opposed to

potentially cross-hybridizing copies. Seven out of 347

pools containing 3.4 3 106 cosmid clones (10 000 clones/

pool) yielded PCR products that co-migrated with products

ampli®ed from C.I. 16151 genomic DNA. Individual

cosmids puri®ed from these pools ranged between 27

and 39 kb in length. DNA gel-blot analysis of EcoRI, HindIII,

EcoRV and BclI digested cosmids and subsequent hybrid-

ization with the RGH1 class A cDNA probe revealed that

®ve cosmids contained identical restriction site patterns

that are found in the class A cDNA sequence (Figure 1),

whereas the other two cosmids contained related, but not

identical, cross-hybridizing members.

The smallest cosmid (9589±5a; 27 kb) containing only

one hybridizing candidate gene was selected for sequenc-

ing. Sequence analysis of this cosmid revealed a single

NBS-LRR gene with an open reading frame identical to the

class A RGH1 cDNA. Comparison of the genomic and

cDNA sequences predicted the presence of two introns

(992 and 115 nt) within the open reading frame and two

introns (110 and 102 nt) within the 5¢ UTR. However, the

®rst predicted intron (110 nt) was not spliced out of any of

the 5¢ UTRs of class A cDNAs (Figure 2). Cosmid 9589±5a,

containing the genomic copy plus at least 3 kb of upstream

sequence of the Mla6 candidate gene, was then used in a

single-cell transient expression assay for powdery mildew

resistance (Shirasu et al., 1999a; Zhou et al., 2001).

Functional complementation of the Mla6 speci®city in a

three-component transient expression assay

The Mla6-containing line, C.I. 16151, is known to possess

an additional Mla resistance speci®city, designated Mla14

(Giese, 1981; Jùrgensen, 1994). While Mla6 confers rapid

and complete resistance to Bgh, Mla14 is expressed much

later and only moderately suppresses sporulation of the

fungus. Since Mla6 is epistatic to Mla14 and the two

speci®cities co-segregate in coupling (Wei et al., 1999),

Mla14 can only be detected if the infecting Bgh isolate

possesses AvrMla14, but lacks AvrMla6. The powdery

mildew isolate that we have used does indeed contain

AvrMla6 and, hence, the results described below focus on

the complementation of Mla6 speci®city.

The three-component system adapted for our experi-

ments is based on the simultaneous single-cell transient

expression of the reporter GFP, wild-type barley Mlo, and

the Mla6 candidate gene in mlo resistant plants. In this

assay, GFP ¯uorescing, leaf-epidermal cells are rendered

susceptible to Bgh, due to the presence of wild-type Mlo,

whereas neighboring non-transformed cells retain broad-

spectrum mlo resistance (Shirasu et al., 1999a). The mlo

resistance of non-transformed cells makes it possible to

score the infection phenotypes on the few single-cell

transformation events which otherwise would become

masked by spreading fungal hyphae that originates from

neighboring susceptible cells. Particle bombardment is

used to deliver a reporter plasmid (pUGLUM) into leaf

epidermal cells permitting expression of Mlo and GFP

from individual ubiquitin promoters (Zhou et al., 2001).

One set of bombarded leaves was inoculated at high

density with Bgh conidia of isolate A6, which contains

AvrMla6 but not AvrMla1, and is therefore avirulent on

cells expressing a functional Mla6, but virulent on cells

Mla6-mediated speci®city 337


that express Mla1. As a control, a duplicate set of

bombarded leaves was inoculated with Bgh isolate K1,

which does not possess AvrMla6, but contains AvrMla1.

Five days post-inoculation, epidermal cells co-expressing

GFP and Mlo were scored for Bgh infection. Only GFP

¯uorescing cells that had attached fungal conidia were

counted in these experiments because resistance can only

occur after direct contact between conidia and the host cell

Figure 1. Legend on facing page.

Figure 2. Legend on facing page.



(Ellingboe, 1972). Green ¯uorescent cells that supported

growth of fungal hyphae were considered susceptible.

Results of previous experiments using this system have

suggested that fungal growth in approximately 45% of GFP

¯uorescing cells should be considered complete suscep-

tibility (Shirasu et al., 1999b).

The results of the above-described experiments are

presented in Table 1. In leaves that were bombarded

with pUGLUM DNA alone, there was no signi®cant differ-

ence in the percentage of infected, GFP-¯uorescing cells

after inoculation with the A6 or K1 conidia (50.0% and

52.3%, respectively). When cosmid 9589±5a DNA was

included in the bombardment, the percentage of GFP

¯uorescing cells that supported growth of isolate A6 was

signi®cantly reduced to 9.4%. Cells inoculated with conidia

of isolate K1 supported fungal growth 46.5% of the time,

which was not signi®cantly different from that of the

control. In another control experiment, we bombarded the

reporter plasmid pUGLUM together with another cosmid,

p6±49±2-15, which contains Mla1 (Zhou et al., 2001). This

resulted in signi®cantly reduced infection of GFP-marked

cells to the K1 isolate expressing AvrMla1, but did not

reduce susceptibility to Bgh isolate A6 (9.3 and 47.1%,

respectively). The observed Avr gene-dependent, single-

cell resistance indicates that the single candidate gene

encoded within cosmid 9589±5a is Mla6. The gene

encoding cDNA classes B and C, which is not present in

cosmid 9589±5a, has been designated as Mla6-2.

Table 1. Results of the 3-component transient assay in mlo-5 barley leaves inoculated with isolates A6 or K1 of B. graminis f. sp. hordei

Test DNA

A6 (AvrMla6, virMla1) K1 (virMla6, AvrMla1)

no. GFPcells withconidia

no. GFPcells withhyphae

% GFPcells withhyphae

P valuea

(test vs.pUGLUM)




P valuea

(test vs.pUGLUM)

P valueb

(A6 vs. K1)

pUGLUM 52 26 50.0 44 23 52.3 0.9926pUGLUM + 9589-5a 127 12 9.4 <0.0001 129 60 46.5 0.4102 <0.0001pUGLUM + p-49-2-15 51 24 47.1 0.6179 54 5 9.3 <0.0001 <0.0001

aP values were obtained using a random effect model to test for a signi®cant difference between the percentage of cells with hyphalcolonies after bombardment with test DNA in comparison to bombardment with the pUGLUM control. A P value <0.05 indicates that thepercentages are signi®cantly different.bP values were obtained using a random effect model to test for a signi®cant difference between the percentage of cells with hyphalcolonies after inoculation with isolate A6 in comparison to inoculation with isolate K1. A P value <0.05 indicates that the percentages aresigni®cantly different. *Raw numbers indicate the combined results of three independent experiments.

Figure 1. Selection scheme for complementation of Mla6 speci®city.(a) Genomic DNA of the Mla6-containing line, C.I. 16151, was used as a template to amplify the LRR encoding regions of RGH1a, RGH1e, RGH2a andRGH3a (see Experimental procedures). (b) RGH family speci®c probes were used individually to hybridize 400 000 Pfu of a C.I. 16151 lambda-ZapII cDNAlibrary. Twenty-nine NBS-LRR encoding cDNAs were identi®ed with the RGH1a/RGH1e probe. (c) The Mla6 co-segregating, C.I. 16151 cDNA sequence wasused to design PCR primers to screen super pools of a 3-genome equivalent C.I. 16151 cosmid library. Individual cosmid clones were puri®ed from theidenti®ed pools, ®ngerprinted by restriction digestion, and con®rmed via hybridization to the candidate cDNA. (d) Cosmid 9589±5a was used tocomplement AvrMla6-dependent resistance speci®city via the 3-component single-cell assay.Distances are in centimorgans across the top horizontal line and YACs/BACs in the 400 kb contig are drawn to scale in kilobases below. The Franka YAC isdesignated by a `Fr' pre®x, whereas the Morex BACs are designated by a `Mo' pre®x. An orange ®lled-in circle designates that YAC/BAC was ampli®ed bythe respective end-clone primer set or it hybridized to the ampli®ed product. Horizontal arrowheads designate the T7 side of the BAC vector. Locations ofMorex RGH sequences are designated by vertical rectangles. RGH1 sequences are designated as red, RGH2 as white, and RGH3 as diagonal hash markswithin the rectangle. The number of RGH1 family members shown in this ®gure has been reduced from what is shown in Figure 5 of Wei et al. (1999). Therecent availability of the ®nished sequence of BACs 711N16 and 80H14 (F. Wei, R. Wing and R.P. Wise, unpublished results) has revealed the presence of aBARE-1 retroelement in the intron between the NBS and LRR encoding domains and also a 29 nt deletion in the LRR domain of RGH1bcd. Thiscomplicated the interpretation of RGH1 bcd, originally thought to be three separate RGHs from the low-pass sequence data.

Figure 2. Three classes of candidate Mla6 transcripts.(a) Representation of the 5¢ untranslated regions of the 3 Mla6 cDNA classes. Black arrowheads indicate the position of the 17 nt repeat in class A (Mla6).Classes B and C (Mla6±2) differ only by the presence or absence of introns 1 and 2 and are divergent from Mla6 but identical to Mla1 near the 5¢ end(colored green). All cDNAs encode a small 9 amino acid peptide (uORF) located before the ®rst putative 5¢ UTR intron (designated by red arrowheads). Anidentical peptide is encoded within the 5¢ UTR of Mla1 (Zhou et al., 2001). The 3¢ end of this uORF spans the ®rst intron-splicing site. The presence of thisintron, as in classes A and B, results in the addition of only one amino acid to the uORF because of a stop codon existing very early in the intron. Thegenomic sequence of Mla6 was obtained from cosmid 9589±5a that was shown to be functional in the three-component transient assay.(b) Representation of the open reading frames (including introns) encoded by Mla6 and Mla6±2. The open reading frame of Mla6 contains two introns,992 nt and 115 nt in length. The open reading frame of Mla6±2 is nearly identical to Mla6 mp to 584 nt downstream of the AUG start codon. The fourdivergent bases within this region are designated with arrows. An insertion at base 250 causes a frame-shift leading to an early stop codon in Mla6±2. Theremaining 79 bases have no signi®cant similarity to Mla6.



Mla6 signals through the zinc-binding protein, RAR1

Previously, the function of Mla6-mediated resistance was

shown to be dependent on Rar1, a powdery mildew

resistance-signaling gene (Jùrgensen, 1996; Shirasu et al.,

1999b). To further substantiate that the full-length NBS-

LRR sequence encoded on cosmid 9589±5a encodes Mla6

speci®city, we took advantage of a recently isolated, rar1±

2/mlo-31 double mutant (J. Orme and P. Schulze-Lefert,

unpublished results) to see if Mla6-mediated resistance

was compromised in a rar1 mutant background.

The rar1/mlo double-mutant leaves were co-bombarded

with pUGLUM and cosmid 9589±5a (Mla6). In this experi-

ment, summarized in Table 2, 41% of the GFP-marked

epidermal cells supported growth of Bgh isolate A6

(AvrMla6). In a control experiment, Rar1/mlo leaves were

resistant when bombarded with cosmid 9589±5a. In a

further control we bombarded pUGLUM together with the

Mla1-containing cosmid p6±49±2-15 (Zhou et al., 2001). On

both rar1/mlo double mutant leaves and Rar1/mlo leaves,

we observed the same percentage of GFP expressing cells

supporting the formation of A6 (AvrMla6) powdery mildew

colonies (44%). Thus, we conclude that the AvrMla6-

dependent activity of the NBS-LRR gene in cosmid 9589±

5a is fully compromised in a rar1 mutant background. This

®nding is consistent with our claim that the single NBS-

LRR gene in cosmid 9589±5a is Mla6.

MLA6 belongs to the coiled-coil, NBS-LRR class of

resistance proteins

The deduced protein sequence encoded by the Mla6 open

reading frame contains 956 amino acids with an estimated

molecular mass of 107.8 kDa. An in-frame stop codon

33 nt upstream of the putative start methionine supports

our prediction that the ORF depicted in Figure 2 is the

entire coding region of Mla6. A COILS analysis (Lupas

et al., 1991) of the MLA6 protein sequence revealed with

greater than 95% probability that a coiled-coil region is

located between amino acids 24 and 50, indicating that

MLA6 belongs to the coiled-coil subset of NBS-LRR

resistance proteins. As illustrated in Figure 3, the MLA6

protein contains the ®ve conserved motifs indicative of a

nucleotide-binding site. The kinase-1a (P-loop), kinase-2a,

kinase-3a, and conserved domain 2 motifs are all highly

similar to those of other NBS-LRR resistance proteins

(Grant et al., 1995; Van Der Biezen and Jones, 1998).

However, the conserved NBS domain 3 of MLA6 lacks

the conserved phenylalanine found in other NBS-contain-

ing resistance proteins. The C-terminal region of the

protein contains 11 imperfect leucine-rich repeats with an

average size of 26 amino acids. These LRRs conform to the

consensus motif LxxLxxLxxLxLxx(N/C/T)x(x)L observed in

other cytoplasmic R gene products (Jones and Jones,

1997).

To deduce the conserved amino acids necessary for

function of Mla alleles, the protein sequence of MLA6 was

compared to MLA1, an MLA1 homologue (MLA1±2; Zhou

et al., 2001), and four MLA-RGH1 family members from the

barley cultivar Morex (Figure 1). Although there is a high

level of conservation between all these sequences, it is

apparent that the two proteins with known function, MLA6

and MLA1, are more similar to each other than to any of

the proteins with unknown function. MLA6 and MLA1 are

92.2% similar (91.2% identical) at the amino acid level. The

MLA-RGH1 protein with the highest overall similarity to

these two proteins is MLA-RGH1BCD, which is 87.3%

similar (83.6% identical) to MLA1 and 84.2% similar

(79.9% identical) to MLA6. Fifty-seven amino acids are

conserved between MLA6 and MLA1 that are not con-

served in any of the MLA homologs without known

function. Interestingly, the majority (38) of these residues

are located within the ®rst 160 amino acids.

A comparison of the leucine-rich repeats of these

proteins revealed a number of regions of non-conserved

Table 2. Results of the 3-component transient assay in mlo-5 and rar1-2 / mlo-31 barley leaves inoculated with isolate A6 of B. graminisf. sp. hordei (AvrMla6, virMla1)

Test DNA

mlo-5 leaves rar1-2 / mlo-31 leaves




P valuea

(9589-5a vs.p-49-2-15)




P valuea

(9589-5a vs.p-49-2-15)

P valueb

(Rar1 vs.rar1)

pUGLUM + 9589-5a 72 0 0.0 78 32 41.0 0.0pUGLUM + p-49-2-15 102 45 44.1 0.0 87 38 43.7 0.7287 0.8976

aP values were obtained using a random effect model to test for a signi®cant difference between the percentage of cells with hyphalcolonies after bombardment with Mla6 cosmid 9589-5a in comparison to bombardment with the Mla1 cosmid p-49-2-15. A P value <0.05indicates that the percentages are signi®cantly different.bP values were obtained using a random effect model to test for a signi®cant difference between the percentage of cells with hyphalcolonies in mlo-5 leaves in comparison to mlo-31/rar1-2 leaves. A P value <0.05 indicates that the percentages are signi®cantly different.*Raw numbers indicate the combined results of two independent experiments.



amino acids centered primarily around the putative

solvent exposed residues of the repeats (Figure 3). The

predicted solvent exposed residues in LRR regions of

many R gene products are known to be hypervariable

(Botella et al., 1998; Dixon et al., 1998; Ellis et al., 1999;

McDowell et al., 1998; Meyers et al., 1998; NoeÈ l and

Moores, 1999; Parniske et al., 1997; Thomas et al., 1997).

Amino-acid variations within these exposed residues of

NBS-LRR proteins are thought to be one of the R-gene

components that determine recognition speci®city (Ellis

et al., 1999). Our results indicate that residues within these

regions are highly variable not only between functional

and non-functional proteins but also between the two

functional proteins, MLA6 and MLA1. Further analysis

indicated that the variability within the LRRs, and more

speci®cally within the solvent exposed residues, is subject

to diversifying selection. In any given region of a gene, a

greater number of non-synonymous (Ka) than synony-

mous (Ks) nucleotide mutations indicates selective diverg-

ence of the region (Ka/Ks > 1; Hughes and Yeager, 1998;

Meyers et al., 1998; Parniske et al., 1997). The Ka/Ks ratio

between the solvent exposed residues of MLA6 and MLA1

is 3.75 (15/4) suggesting selection for divergence at these

residues. Comparatively, the entire LRR region has a Ka/Ks

ratio of 1.64 (36/22) and the region upstream of the LRR has

a ratio of exactly 1.0 (26/26).

Barley MLA6 recognizes Bgh AvrMla6 in wheat

The cloning and characterization of resistance genes is

important in understanding the fundamental basis of

disease resistance, yet ultimately the ability to transfer

race-speci®c resistance genes between plant species will be

important to improve agriculturally important crop varie-

ties. We used a recently described system, similar to the

three-component assay described above, to test whether

Figure 3. Amino acid sequence alignment of Mla6 from C.I. 16151, Mla1 and an Mla1 homologue from C.I. 16137, and four Mla-RGH1 family membersfrom the cv. Morex.Shaded boxes indicate similar residues. Conserved motifs within the NBS region are indicated above the sequence. The stars denote the putative solventexposed residues of the LRR region. The carets indicate residues conserved between MLA6 and MLA1 but not with any other protein. RGH1e and RGH1fgene sequences differ by only one nucleotide, which does not cause and amino acid change. Note the presence of a premature stop codon at position 151of these two classes. A large deletion starting at position 714 of RGH1bcd causes a frame-shift mutation. The homologous frame is shown in thealignment after this deletion.



the Mla6-containing cosmid, 9589±5a, could confer resist-

ance to Bgh in wheat (Schweizer et al., 1999). In this assay, a

GUS reporter plasmid under the control of a ubiquitin

promoter (pUGUS) was used in place of pUGLUM, enabling

easy visualization of fungal haustoria in GUS-positive,

epidermal cells. Mla6 is known to predominantly terminate

fungal growth by preventing differentiation of haustoria

(Boyd et al., 1995; Ellingboe, 1972). Therefore, lack of these

structures would indicate Mla6 activity.

We co-bombarded pUGUS and cosmid 9589±5a (Mla6)

into wheat leaves from cv. Cerco followed by inoculation

with the B. graminis f. sp. tritici (Bgt) isolates JIW2 and

JIW48. Both of these isolates possess most of the currently

known wheat powdery mildew Avr genes, yet are virulent

on Cerco wheat. Co-bombardment of cosmid 9589±5a with

pUGUS did not signi®cantly alter the percentage of

infected cells when compared to bombardment with

pUGUS alone (data not shown). This suggests that either

wheat does not contain the machinery necessary for

proper function of Mla6 or that JIW2 and JIW48 do not

contain a recognized AvrMla6 gene product.

We therefore repeated the experiment using the barley

powdery mildew isolate A6, which possesses a functional

AvrMla6, to inoculate the bombarded wheat leaves.

Although inoculation of Cerco wheat with Bgh isolate A6

represents a non-host interaction, we observed that up to

30% of the infecting conidia were able to form differenti-

ated haustoria (Figure 4). Conidia from Bgh isolate K1 were

not able to form haustoria at a signi®cant level and were

not suitable for use as a negative control. Therefore, the

virulent Bgt isolate JIW48 was used instead.

There was no signi®cant difference between the per-

centage of wheat epidermal cells with Bgt JIW48 haustoria

after co-bombardment of pUGUS with cosmids 9589±5a or

p6±49±2-15 (31 and 30%, respectively; Table 3). Similarly,

the incidence of wheat epidermal cells with Bgh A6

haustoria following delivery of pUGUS alone or together

with cosmid p6±49±2-15 was comparable (20.5% and

22.8%, respectively). In contrast, Bgh isolate A6 consist-

ently established less than half as many haustoria when

wheat cells were transformed with pUGUS and cosmid

9589±5a. Thus, Mla6 is able to function in wheat to confer

speci®city to Bgh expressing AvrMla6.

Discussion

Powdery mildew of barley is becoming a tractable model

for investigating the molecular basis of host±pathogen

interactions among monocots and obligate biotrophic

fungi. Recently, positional cloning efforts have resulted

in the isolation of the Mlo gene modulating broad-

spectrum resistance (BuÈ schges et al., 1997), the Rar1

gene involved in resistance signaling (Shirasu et al.,

1999b), and the Mla1 resistance allele (Zhou et al., 2001).

In this report, we present the identi®cation of the Mla6 (CC-

NBS-LRR-encoding) allele and show that it is able to confer

speci®city to Bgh expressing the AvrMla6 gene in both

barley and wheat.

Little is known about the molecular recognition process

involved in plant fungal interactions. However, it has been

established that, in the case of powdery mildew, Mla-

mediated resistance is expressed only after host and

pathogen have made intimate membrane-to-membrane

contact. Among Mla alleles, resistance speci®cities con-

ferred by Mla6 (and Mla1) are two of the earliest and most

effective at aborting fungal infection attempts prior to

haustorium differentiation (Boyd et al., 1995; Wise and

Ellingboe, 1983). It is for this reason that we were able to

demonstrate that the barley Mla6 gene also functions in

wheat. Introduction of Mla6 into wheat epidermal cells

reduced the incidence of Bgh haustoria by 50%, indicating

that Mla6 retains function and speci®city in this hetero-

logous system.

Figure 4. Compatible and incompatiblewheat/powdery mildew interactions revealedin the three-component transient assay.(a,b) CERCO wheat cells after inoculationwith Bgh isolate A6 (AvrMla6). (c,d) CERCOwheat cells after inoculation with isolate BgtJIW48 (virMla6, virMla1). The GUSexpressing cells (g) in (a) and (c) have beenco-bombarded with the Mla1 cosmid p6±49±2-15. (b) and (d) show GUS expressing cellsafter bombardment with the Mla6 cosmid9589±5a. A statistically signi®cant reductionin haustorial development after bombard-ment with cosmid 9589±5a suggests thatMLA6 is able to recognize Bgh AvrMla6 inwheat. Leaves were stained with X-glucovernight at 37°C to highlight GUS stainingcells (g) and haustorium (h; seeExperimental procedures). The leaves werethen incubated in Coomassie blue to stainthe attached conidia (c).



Historically, intergeneric gene transfer among the

Triticeae has been accomplished through cytogenetic

translocation of chromosome segments. This breeding

technology has been exploited to transfer useful traits into

polyploid wheat, including several resistance genes

(Friebe et al., 1989; Heun and Friebe, 1990; Heun et al.,

1990). The chromosome segment that has been most

widely utilized for this purpose is rye 1RS. This chromo-

some segment contains genes for resistance to leaf, stem

and stripe rust, as well as for powdery mildew (Singh et al.,

1990; Villareal et al., 1991). It is interesting to note that 1RS

from rye is homologous to barley 1HS, the chromosome

arm that contains the majority of Ml loci, including Mla.

The Lr26 leaf-rust resistance gene, carried on trans-

located rye 1RS, is fully functional in a wheat background

(HanusovaÂ et al., 1996). However, the activity of trans-

located genes can sometimes be suppressed by interact-

ing factors within the wheat genome (Bai and Knott, 1992;

HanusovaÂ et al., 1996; Kema et al., 1995; Kerber and Green,

1980; Ma et al., 1995). For example, a dominant suppressor

in wheat inhibits the phenotypic expression of the Pm8

powdery mildew resistance gene, which was also trans-

located into wheat via rye 1RS. These gene-speci®c

suppressors may represent downstream signaling factors

required for the ultimate expression of the resistance

phenotype, similar to Rar1 from barley (Freialdenhoven

et al., 1994; Jùrgensen, 1996; Shirasu et al., 1999b). Our

initial data, utilizing isolate A6 of Bgh, indicate that the

ability of Mla6 to prevent the formation of haustoria in

wheat was dependent upon recognition of Bgh AvrMla6

(Table 3) and that speci®city was not suppressed by wheat

host factors. The question remains, however, whether

barley Mla6 also confers resistance to Bgt isolates that

express AvrMla6. In the Solanacae, four R genes have

been shown to function in heterologous systems: (1) the

Pto gene of tomato (Rommens et al., 1995; Thilmony et al.,

1995); (2) the N gene of tobacco (Whitham et al., 1996); (3)

the Cf-9 gene of tomato (Hammond-Kosack et al., 1998);

and (4) the Bs2 gene of pepper (Tai et al., 1999). Although it

still remains to be seen whether R genes can provide

resistance outside of their own family, our results demon-

strate that CC-NBS-LRR-encoded resistance speci®city can

be transferred between two different members of the

Triticeae, and that heterologous transfer is not limited

solely to Solanaceous plants.

Expression of Mla-encoded NBS-LRR genes

Only probes speci®c for the RGH1 family were useful in the

identi®cation of expressed transcripts. The cDNAs that we

have isolated appear to correspond to two different genes

based on multiple differences within the 5¢ untranslated

regions, the open reading frames, and the 3¢ end (Figure 2).

The fact that one of the base substitutions within the

truncated coding region of Mla6±2 cDNAs leads to prema-

ture termination of the protein suggests that MLA6±2 may

be non-functional. The predicted MLA6±2 protein shares

some similarity to the truncated products of the N, L6 and

RPP5tr genes in that it lacks an LRR domain (Dinesh-Kumar

et al., 1995; Lawrence et al., 1995; Parker et al., 1997;

Whitham et al., 1994). While the truncated N and L6

transcripts appear to arise from alternative intron splicing

events, the truncated RPP5 transcript (RPP5tr) originates

from an RPP5 gene family member and not from the gene

that determines speci®city (Parker et al., 1997).

Interestingly, the RPP5tr transcript contains a small region

near the 3¢ end that is divergent from the functional RPP5

transcript, which is similar to what we have detected in the

Mla6±2 cDNAs. The role of these truncated proteins in

conferring disease resistance is unclear. While Dinesh-

Kumar and Baker (2000) have suggested a dominant

negative role for the truncated N gene product, alternative

Table 3. Results of the 3-component transient assay in CERCO wheat leaves inoculated with isolates A6 of B. graminis f. sp. hordei andisolate JIW48 of B. graminis f. sp. tritici

Test DNA

Bgh isolate A6 (AvrMla6, virMla1) Bgt isolate JIW48 (virMla6, virMla1)

no. GUScells withconidia

no. GUScells withhaustoria

% GUScells withhaustoria

P valuea

(test vs.pUGUS)

no. GUScells withconidia

no. GUScells withhaustoria

% GUScells withhaustoria

P valuea

(test vs.pUGUS)

P valueb

(A6 vs.JIW48)

pUGUS 195 40 20.5pUGUS + p-49-2-15 280 64 22.8 0.5433 134 41 30.6 0.0903pUGUS + 9589-5a 322 31 9.6 0.0005 92 28 30.4 0.9792 <0.0001

aP values were obtained using a random effect model to test for a signi®cant difference between the percentage of cells with haustoria afterbombardment with cosmid 9589-5a in comparison to bombardment with the Mla1 cosmid p-49-2-15 control. A P value <0.05 indicates thatthe percentages are signi®cantly different.bP values were obtained using a random effect model to test for a signi®cant difference between the percentage of cells with haustoria afterinoculation with isolate A6 in comparison to inoculation with isolate JIW48. A P value <0.05 indicates that the percentages are signi®cantlydifferent. *Raw numbers indicate the combined results of three independent experiments.



transcripts of the L6 gene appear to have no function in

resistance to rust in ¯ax (Ayliffe et al., 1999).

Small upstream open reading frames within the 5¢ UTR

(uORFs) are present in 5±10% of eukaryotic mRNAs and are

thought to control translation or tissue-speci®c expression

of the parent protein within the cell (for reviews see Van

Der Velden and Thomas, 1999; Willis, 1999). A number of

eukaryotic regulatory genes, such as BCL-2 and c-mos,

encode proteins whose over-production could be dele-

terious to cells. Translation of these proteins appears to be

constitutively down-regulated by the presence of small

upstream open reading frames (Harigai et al., 1996; Steel

et al., 1996). Removal of these uORFs from the 5¢ UTRs led

to a ®ve- to sevenfold increase in the expression of fused

reporter genes (Harigai et al., 1996; Steel et al., 1996). The

signi®cance of two 17 nt repeated sequences directly

upstream of the uORF is unclear although each of these

repeats contain a complete TATA box (data not shown),

thus suggesting a possible transcription start site for the

uORF. Interestingly, these repeats are not present in the 5¢UTR of Mla1.

Model for Mla6-mediated resistance

Based on the lack of a signal peptide, we would predict

that Mla6 and Mla1 encode proteins that are likely to be

localized within the cytoplasm. Since both genes act

predominantly prior to haustorium development, the

corresponding Avr products must be released before or

concomitant with the switch from leaf surface growth to

invasive growth. Therefore, recognition of avirulence gene

products is likely to occur within the cytoplasm early in the

infection process. Experimental evidence for a direct

interaction between a leucine-rich R protein/Avr pair has

been observed so far only for the rice NBS-LRD Pi-ta and

the cognate Magnaporthe grisea Avr-Pita (Jia et al., 2000).

Interestingly, transiently expressed Arabidopsis RPS2 co-

immunoprecipitates with the cognate Pseudomonas

AvrRpt2 protein, a 70 kDa plant protein, and an Avr protein

(AvrB), which does not elicit a RPS2-dependent resistance

response (Leister and Katagiri, 2000). One interpretation of

the latter ®nding is that RPS2 recognizes indirectly, via the

70 kDa host protein, the presence of its cognate Avr

product.

The signaling gene, Rar1, is required for resistance

mediated by several Mla alleles and also for other unlinked

powdery mildew resistance loci (Jùrgensen, 1996). Despite

the amino-acid similarity between the MLA6 and MLA1

proteins (91.2%), MLA6 signals in a RAR1-dependent

manner, whereas MLA1 does not (Jùrgensen, 1996;

PeterhaÈnsel et al., 1997; Zhou et al., 2001). This provides

evidence for at least two separate Mla-signaling pathways.

This is comparable to RPP (resistance to Peronospora

parasitica) signaling pathways in Arabidopsis. Resistance

mediated by several RPP genes (RPP2, RPP4, RPP5 and

RPP21) requires a signaling component encoded by EDS1

(Aarts et al., 1998; Parker et al., 1996). However, RPP7 and

RPP8 appear to function independently of EDS1 to confer

resistance (Aarts et al., 1998; McDowell et al., 2000). It has

been suggested that EDS1-dependent signaling is prim-

arily dependent on R protein structure because RPP5 and

other EDS1-dependent R genes encode proteins belonging

to the TIR-NBS-LRR class of resistance proteins while

EDS1-independent R genes like RPP8 encode CC-NBS-LRR

proteins (Aarts et al., 1998; McDowell et al., 2000). In

contrast, the Mla6 and Mla1 alleles provide an example

of two highly sequence-related CC-NBS-LRR proteins,

recognizing Avr genes of the same fungal pathogen that

depend on different downstream signaling components

for their function.

Exploiting similarities among functional Mla alleles

The introduction of novel resistance speci®cities into

cultivated species has traditionally relied on conventional

plant breeding. In contrast to the highly recombinogenic

maize Rp1 rust-resistance locus (Hu et al., 1996; Richter

et al., 1995), combining multiple Mla speci®cities has been

problematic, especially in light of the suppressed recom-

bination at the locus that has been observed between

cultivars (Wei et al., 1999). The ability to isolate R genes

now makes it possible to introduce them directly into the

desired plant via transformation. However, positional

cloning of resistance genes has proven to be a lengthy

process, especially in large-genome cereal crops. The Mla6

and Mla1 alleles are 94.4% identical at the nucleotide

level. This strong similarity is also shared by the Mla13-

candidate allele (F. Wei and R. Wise, unpublished results).

It should be possible therefore to exploit similarities

shared between the functional Mla6 and Mla1 alleles,

which are not conserved among the non-functional Mla1±2

or Morex Mla-RGH1 sequences, to design PCR primers to

amplify homologous genes from other cultivated barley

species or wild relatives. These genes can then be simul-

taneously introduced into a single barley variety, a feat not

previously possible using conventional breeding.

Experimental procedures

CDNA library screening and sequencing

A cDNA library was constructed in co-operation with D.-W. Choi,at the T.J. Close laboratory (University of California, Riverside,CA, USA) using the Uni-ZAP XR Library kit (Stratagene, La Jolla,CA, USA). The library was constructed from mRNA isolated fromboth uninoculated barley seedlings and seedlings inoculated withB. graminis f. sp. hordei isolate 5874 (AvrMla6). Tissue washarvested at both 20 and 24 h post-inoculation and snap-frozen inliquid nitrogen. The cDNA library was screened using probesderived from the LRR region of previously described resistance



gene homologues RGH1a, RGH1e, RGH2a and RGH3a (Table 4;Wei et al., 1999). RGH1a and RGH1e represent the Mla-RGH1family where all members of this family have greater than 81%nucleic acid similarity. RGH2a and RGH3a are each 100% similarto other members of their respective families due to a largeduplication in the Mla region of the barley genome. DNAsequencing and oligonucleotide synthesis was performed by theIowa State University DNA Sequencing and Synthesis facility.cDNAs were named in accordance with the nomenclature guide-lines for multigene families (Mcintosh et al., 1998; http://wheat.p-w.usda.gov/ggpages/wgc/98/index.html).

Cosmid library construction, screening and sequencing

Cosmid library construction was done in co-operation with Cell &Molecular Technologies, Inc. (Phillipsburg, NJ, USA). High-molecular weight genomic DNA from C.I. 16151 was partiallydigested with Sau3A, size selected for fragments ranging between50 and 75 kb, and ligated into the BamHI site of digested cosmidSuperCos-1 (Stratagene). Ligated cosmids were then electro-porated into the XL-1 Blue strain of E. coli. The library wasampli®ed in semi-solid medium and aliquoted into 347 poolscontaining between 7500 and 10 000 clones each. An aliquot(0.5 ml; ~5 3 106 clones) of each bacterial pool was placed in aPCR reaction with Mla6 cDNA primers. Pools from which theappropriately sized PCR product could be ampli®ed were dilutedand plated onto solid media. Individual cosmids were identi®edby colony hybridization using the Mla6 cDNA as a probe. Aplasmid library of partially digested 9589±5a DNA was con-structed in pGEM-7Zf(+) (Promega, Madison, WI, USA) and 384templates were sequenced.

Fungal isolates

B. graminis f. sp. hordei isolates 5874 (AvrMla1, AvrMla6,virMla13), A6 (virMla1, AvrMla6) and K1 (AvrMla1, virMla6)were propagated on H. vulgare cv. Manchuria, Golden Promise,and Ingrid, respectively, at 18°C (16 h light/8 h darkness).

High-resolution genetic mapping

High-resolution mapping between the two near-isogenic lines C.I.16151 and C.I. 16155 has been described previously (DeScenzoet al., 1994; Mahadevappa et al., 1994). The Franger (C.I. 16151)and Rupee (C.I. 16155) derived lines contain the Mla6 and theMla13 resistance speci®cities, respectively. Starting from 3600gametes (1800 F2 seed), a total of 286 recombinant barley lineswere identi®ed to be recombinant between and homozygous atthe Hor1 and Hor2 loci at a resolution of 0.028 cM

Barley DNA was isolated from frozen tissue using a modi®edCTAB extraction. These DNA extractions, as well as DNA gel blotanalyses, were conducted as described previously (Wise andSchnable, 1994). cDNA sequences were screened for RFLPs bySouthern hybridization with parental DNA digested with anumber of restriction enzymes to reveal which restrictionendonuclease revealed a polymorphism. RFLPs were exhibitedas differences between the two parental lines and were mappedby Southern hybridization on the 88 individual recombinant linesthat contain recombination breakpoints in the Xmwg036±Xmwg068 interval.

Single-cell transient assay

Biolistic bombardment of leaves was carried out according toShirasu et al. (1999a) using a particle in¯ow gun (Vain et al., 1993).Detached leaves of 7-day-old barley or wheat seedlings wereplaced onto 1% Phytoagar (Gibco) plates supplemented with 10%sucrose (w/v) and allowed to recover for 1 h at room temperature.Three barley leaves and four wheat leaves were used per plate.Gold particles (BioRad) were coated with plasmid and/or cosmidDNA at a plasmid: cosmid molar ratio of 2 : 3. The leaves werethen incubated at room temperature for 4 h and transferred to 1%Phytoagar prior to fungal inoculation. The inoculated leaves wereincubated at 15°C (16 h light/8 h darkness) for 5 days (barley) or66 h (wheat).

Barley cells expressing GFP were visualized 5 days after fungalinoculation using a microscope with an excitation ®lter of 450±490 nm, bypass ®lter 515±565 nm (Leica, GFP plus). Wheat leaveswere vacuum-in®ltrated twice with a GUS-staining solution(containing 0.1 M Na2HPO4/NaH2PO4 pH 7.0, 10 mM Na-EDTA,5 mM potassium hexacyanoferrat (II) and potassium hexacyano-

Table 4. RGH-speci®c primer pairs utilized for C.I. 16151 cDNA and cosmid library screen

Primerdesignation

Primer sequences(5¢ ® 3¢)

Fragmentsize (bp)

Sequencedesignation(origin)

Region ofRGH ORF

Annealingtemperature

39F13 GGTTACCATCCTCTTTCGTCACC 582 RGH1a LRR 5639B95 GGAGGCTCGTTGTGTCTCTGAATAC (Morex)38F19 TGGTTCCAACTGGTGTGTTGC 426 RGH1e LRR 5438B27 CCCCAATGATTTCCACGTCC (Morex)38IF50 GCTCTCTCACTGTTCGTATGGACC 198 RGH2a LRR 5438IB62 AGCAGCTACCAGGCTGTATTGC (Morex)80H14BF30 TGCTTTACCTCAAGTTGGCTGC 212 RGH3a LRR 5680H14BB35 CGAAGGTGTGTGATTTCGATGC (Morex)9-1 AAGCATGGGATAGCTCAC 1433 Mla6 cDNA NBS-LRR 5853Rev3 CCCAAGATTACATCGTGAC (CI 16151)3UTRF GCACGAGGTCATTCCAGAGATATG 1616 Mla6 cDNA 5¢ UTR- 5853Rev4 GAAAGAGAGTATTCTCCGC (CI 16151) NBS



ferrat (III), 1 mg ml-1 5-bromo-4-chloro-3-indoxyl-b-D-glucuronicacid, cyclohexylammonium salt (X-Gluc), 0.1% (v/v) Triton X-100,20% (v/v) methanol) and incubated at 37°C overnight. The leaveswere rinsed brie¯y with water and then immersed in Coomassieblue stain (0.3% w/v Coomassie blue, 7.5% w/v TCA, 30% v/vmethanol) for 5 min and rinsed again before visualization using alight microscope as described previously (Schweizer et al., 1999).

Acknowledgements

The authors thank Drs Thomas Baum and Adam Bogdanove forcritical review of the manuscript. Special thanks goes to Dong-Woog Choi of the Close laboratory (University of California,Riverside, CA, USA) for assistance in preparation of the C.I. 16151cDNA library. This research was supported in part by USDA-NRI/CGP grant 98±35300±6169 and facilitated by the North AmericanBarley Genome Mapping Project. Research in the P.S.-L. labora-tory was supported by a GATSBY foundation grant. Jointcontribution of the Corn Insects & Crop Genetics Research Unit,USDA-Agricultural Research Service and the Iowa Agriculture andHome Economics Experiment Station. This is Journal Paper No. J-19010 of the Iowa Agricultural and Home Economics ExperimentStation, Ames, IA, Project no. 3368, and supported by Hatch Actand State of Iowa funds.

References

Aarts, N., Metz, M., Holub, E., Staskawicz, B.J., Daniels, M.J. andParker, J.E. (1998) Different requirements for eds1 and NDR1 bydisease resistance genes de®ne at least two R gene-mediatedsignaling pathways in Arabidopsis. Proc. Natl Acad. Sci. USA,95, 10306±10311.

Ayliffe, M.A., Frost, D.V., Finnegan, E.J., Lawrence, G.J.,Anderson, P.A. and Ellis, J.G. (1999) Analysis of alternativetranscripts of the ¯ax L6 rust resistance gene. Plant J. 17, 287±292.

Bai, D. and Knott, D.R. (1992) Suppression of rust resistance inbread wheat (Triticum aestivum L.) by D-genomechromosomes. Genome, 35, 276±282.

Baker, B., Zambryski, P., Staskawicz, B. and Dinesh-Kumar, S.P.(1997) Signaling in plant±microbe interactions. Science, 276,726±733.

Bent, A.F. (1996) Plant disease resistance: function meetsstructure. Plant Cell, 8, 1757±1771.

Botella, M.A., Parker, J.E., Frost, L.N., Bitter-Eddy, P.D., Beyon,J.L., Daniels, M.J., Holub, E.B. and Jones, J.D.G. (1998) Threegenes of the Arabidopsis RPP1 complex resistance locusrecognize distinct Peronospora parasitica avirulencedeterminants. Plant Cell, 10, 1847±1860.

Boyd, L.A., Smith, P.H., Foster, E.M. and Brown, J.K.M. (1995) Theeffects of allelic variation at the Mla resistance locus in barleyon the early development of Erysiphe graminis f.sp. hordei andhost responses. Plant J. 7, 959±968.

BuÈ schges, R., Hollricher, K., Panstruga, R. et al. (1997) The barleyMlo gene: a novel control element of plant pathogen resistance.Cell, 88, 695±705.

Century, K.S., Holub, E.B. and Staskawicz, B.J. (1995) NDR1, alocus of Arabidopsis thaliana that is required for diseaseresistance to both a bacterial and a fungal pathogen. Proc.Natl Acad. Sci. USA, 92, 6597±6601.

DeScenzo, R.A., Wise, R.P. and Mahadevappa, M. (1994) Highresolution mapping of the Hor1/Mla/Hor2 region onchromosome 5S in barley. Mol. Pl. Micr. Inter. 7, 657±666.

Dinesh-Kumar, S.P., Whitham, S., Choi, D., Hehl, R., Corr, C. andBaker, B. (1995) Transposon tagging of tobacco mosaic virusresistance gene N: its possible role in the TMV-N-mediatedsignal transduction pathway. Proc. Natl Acad. Sci. USA, 92,4175±4180.

Dinesh-Kumar, S.P. and Baker, B.J. (2000) Alternatively spliced Nresistance gene transcripts: their possible role in tobaccomosaic virus resistance. Proc. Natl Acad. Sci. USA, 97, 1908±1913.

Dixon, M.S., Hatzixanthis, K., Jones, D.A., Harrison, K. and Jones,J.D.G. (1998) The tomato Cf-5 disease resistance gene and sixhomologs show pronounced allelic variation in leucine-richrepeat copy number. Plant Cell, 10, 1915±1925.

Ellingboe, A.H. (1972) Genetics and physiology of primaryinfection by Erysiphe graminis. Phytopathology, 62, 401±406.

Ellis, J.G., Lawrence, G.J., Luck, J.E. and Dodds, P.N. (1999) Theidenti®cation of regions in alleles of the ¯ax rust resistancegene L that determine differences in gene-for-gene speci®city.Plant Cell, 11, 495±506.

Flor, H.H. (1971) Current status of the gene-for-gene concept.Annu. Rev. Phytopathol. 9, 275±296.

Freialdenhoven, A., Scherang, B., Hollricher, K., Collinge, D.B.,Thordal-Christensen, H. and Schulze-Lefert, P. (1994) Nar-1 andNar-2, two loci required for Mla-12 speci®ed race-speci®cresistance to powdery mildew in barley. Plant Cell, 6, 983±994.

Friebe, B., Heun, M. and Bushuk, W. (1989) Cytologicalcharacterization, powdery mildew resistance and storageprotein composition of tetraploid and hexaploid 1BL/1RSwheat-rye translocation lines. Theor. Appl. Genet. 78, 425±432.

Giese, H. (1981) Powdery mildew resistance genes in the Ml-a andMl-k regions on barley chromosome 5. Hereditas, 95, 51±62.

Grant, M.R., Godiard, L., Straube, E., Ash®eld, T., Lewald, J.,Sattler, A., Innes, R.W. and Dangl, J.L. (1995) Structure of theArabidopsis RPM1 gene enabling dual speci®city diseaseresistance. Science, 269, 843±846.

Hammond-Kosack, K.E. and Jones, J.D.G. (1997) Plant diseaseresistance genes. Annu. Rev. Plant Phys. Plant Mol. Biol. 48,575±607.

Hammond-Kosack, K.E., Tang, S., Harrison, K. and Jones, J.D.G.(1998) The tomato Cf-9 disease resistance gene functions intobacco and potato to confer responsiveness to the fungalavirulence gene product Avr9. Plant Cell, 10, 1251±1266.

HanusovaÂ , R., Hsam, S.L.K., Bartos, P. and Zeller, F.J. (1996)Supression of powdey mildew resistance Pm8 in Triticumaestivum L. (common wheat) cultivars carrying wheat-ryetranslocation T1BL/1RS. Heredity, 77, 383±387.

Harigai, M., Masayoshi, M., Miyashita, T., Hanada, M. and Reed,J.C. (1996) A cis-aciting element in the BCL-2 gene controlsexpression through translational mechanisms. Oncogene, 12,1369±1374.

Heun, M. and Friebe, B. (1990) Introgression of powdery mildewresistance from rye to wheat. Phytopathology, 80, 242±245.

Heun, M., Friebe, B. and Bushuk, W. (1990) Chromosomal locationof the powdery mildew resistance gene of Amigo wheat.Phytopathology, 80, 1129±1133.

Hughes, A.L. and Yeager, M. (1998) Natural selection at majorhistocompatibility complex loci of vertebrates. Annu. Rev.Genet. 32, 415±435.

Hu, B., Richter, T.E., Hulbert, S.H. and Pryor, T. (1996) Diseaselesion mimicry caused by mutations in the rust resistance generp1. Plant Cell, 8, 1367±1376.

Jia, Y., McAdams, S.A., Bryan, G.T., Hershey, H.P. and Valent, B.(2000) Direct interaction of resistance gene and avirulence geneproducts confers rice blast resistance. EMBO J. 19, 4004±4014.



Jones, D.A. and Jones, J.D.G. (1997) The role of leucine-richrepeat proteins in plant defenses. Adv. Botan. Res. 24, 89±167.

Jùrgensen, J.H. (1988) Genetic analysis of barley mutants withmodi®cations of powdery mildew resistance gene Mla-12.Genome, 30, 129±132.

Jùrgensen, J.H. (1994) Genetics of powdery mildew resistance inbarley. Crit. Rev. Plant Sci. 13, 97±119.

Jùrgensen, J.H. (1996) Effect of three suppressors on theexpression of powdery mildew resistance genes in barley.Genome, 39, 492±498.

Keen, N.T. (1990) Gene-for-gene complementarity in plant±pathogen interactions. Annu. Rev. Genet. 24, 447±463.

Kema, G.H.J., Lange, W. and van Silfhout, C.H. (1995) Differentialsuppression of stripe rust resistance in synthetic wheathexaploids derived from Triticum turgidim subsp. dicoccoidesand Aegilops squarrosa. Phytopathology, 85, 425±429.

Kerber, E.R. and Green, G.J. (1980) Supression of stem rustresistance in the hexaploid wheat cv. Canthatch bychromosome 7DL. Can. J. Bot. 58, 1347±1350.

Lawrence, G.J., Finnegan, E.J., Ayliffe, M.A. and Ellis, J.G. (1995)The L6 gene for ¯ax rust resistance is related to the Arabidopsisbacterial resistance gene RPS2 and the tobacco viral resistancegene N. Plant Cell, 7, 1195±1206.

Leister, R.T. and Katagiri, F. (2000) A. resistance gene product ofthe nucleotide binding site ± leucine rich repeats class can forma complex with bacterial avirulence proteins in vivo. Plant J. 22,345±354.

Lupas, A., Van Dyke, M. and Stock, J. (1991) Predicting coiledcoils from protein structures. Science, 252, 1162±1164.

Ma, H., Singh, R.P. and Mujeeb-Kazi, A. (1995) Supression/expression of resistance to stripe rust in synthetic hexaploidwheat (Triticum turgidum x t. tauschii). Euphytica, 83, 87±93.

Mahadevappa, M., DeScenzo, R.A. and Wise, R.P. (1994)Recombination of alleles conferring speci®c resistance topowdery mildew at the Mla locus in barley. Genome, 37, 460±468.

McDowell, J.M., Dhandaydham, M., Long, T.A., Aarts, M.G.M.,Goff, S., Holub, E.B. and Dangl, J.L. (1998) Intragenicrecombination and diversifying selection contribute to theevolution of downy mildew resistance at the RPP8 locus ofArabidopsis. Plant Cell, 10, 1861±1874.

McDowell, J.M., Cuzick, A., Can, C., Beynon, J., Dangl, J.L. andHolub, E.B. (2000) Downy mildew (Peronospora parasitica)resistance genes in Arabidopsis vary in funcitonal requirementsfor NDR1, EDS1, NPR1, and salicylic acid accumulation. Plant J.22, 523±529.

Mcintosh, R.A., Hart, G.E., Devos, K.M., Gale, M.D. and Rogers,W.J. (1998) Guidelines for nomenclature of biochemical/molecular loci in wheat and related species. Proceedings ofthe 9th International Wheat Genetics Symposium, Vol. 5,Catalogue of Gene Symxbols for Wheat. Saskatchewan:University Extension Press, University of Saskatchewan, pp.2±11.

Meyers, B.C., Shen, K.A., Rohani, B.S., Gaut, B.S. andMichelmore, R.W. (1998) Receptor-like genes in the majorresistance locus of lettuce are subject to divergent selection.Plant Cell, 10, 1833±1846.

Michelmore, R.W. and Meyers, B.C. (1998) Clusters of resistancegenes in plants evolve by divergent selection and a birth-and-death process. Genome Res. 8, 1113±1130.

Moseman, J.G. (1972) Isogenic barley lines for reaction toErysiphe graminisi f. sp. hordei. Crop Sci. 12, 681±682.

NoeÈ l, L., Moores, T.L., van der Biezen, E.A., Parniske, M., Daniels,M.J., Parker, J.E. and Jones, J.D.G. (1999) Pronounced

intraspeci®c haplotype divergence at the RPP5 complexdisease resistance locus of Arabidopsis. Plant Cell, 11, 2099±2111.

Parker, J.E., Holub, E.B., Frost, L.N., Falk, A., Gunn, N.D. andDaniels, M.J. (1996) Characterization of eds1, a mutation inArabidopsis suppressing resistance to Peronospora parasiticaspeci®ed by several different RPP genes. Plant Cell, 8, 2033±2046.

Parker, J.E., Coleman, M.J., SzaboÂ , V., Frost, L.N., Schmidt, R.,Van Der Biezen, E.A., Moores, T., Dean, C., Daniels, M.J. andJones, J.D.G. (1997) The Arabidopsis downy mildew resistancegene RPP5 shares similarity to the Toll and Interleukin-1receptors with N and L6. Plant Cell, 9, 879±894.

Parniske, M., Hammond-Kossack, K.E., Golstein, C., Thomas,C.M., Jones, D.A., Harrison, K., Wulff, B.B.H. and Jones, J.D.G.(1997) Novel disease resistance speci®cities result fromsequence exchange between tandemly repeated genes at theCf-4/9 locus of tomato. Cell, 9, 821±832.

PeterhaÈnsel, C., Freialdenhoven, A., Kurth, J., Kolsch, R. andSchulze-Lefert, P. (1997) Interaction analyses of genes requiredfor resistance responses to powdery mildew in barley revealdistinct pathways leading to leaf cell death. Plant Cell, 9, 1397±1409.

Richter, T.E., Pryor, A.J., Bennetzen, J.L. and Hulbert, S.H. (1995)New rust speci®cities associated with recombination at the Rp1complex in maize. Genetics, 141, 373±381.

Rommens, C.M.T., Salmeron, J.M., Oldroyd, G.E.D. andStaskawicz, B.J. (1995) Intergenic transfer and functionalexpression of the tomato disease resistance gene Pto. PlantCell, 7, 1573±1544.

Schweizer, P., Pokorny, J., Abderhalden, O. and Dudler, R. (1999)A transient assay system for the functional assessment ofdefense-related genes in wheat. Mol. Plant-Microbe Interact. 12,647±654.

Shirasu, K., Nielsen, K., Piffanelli, P., Oliver, R. and Schulze-Lefert,P. (1999a) Cell-autonomous complementation of mlo resistanceusing a biolistic transient expression system. Plant J. 17, 293±299.

Shirasu, K., Lahaye, T., Tan, M., Zhou, F., Azevedo, C. andSchulze-Lefert, P. (1999b) A novel class of eukaryotic zinc-binding proteins is required for disease resistance signaling inbarley and development in C. elegans. Cell, 99, 355±366.

Singh, N.K., Shepherd, K.W. and McIntosh, R.A. (1990) Linkagemapping of genes for resistance to leaf, stem and stripe rustsand w-secalins on the short arm of rye chromosome 1R. Theor.Appl. Genet. 80, 609±616.

Steel, L.F., Telly, D.L., Leonard, J., Rice, B.A., Monks, B. andSawicki, J.A. (1996) Elements in the murinec-mos messengerRNA 5¢-untranslated region repress translation of down-streamcoding sequences. Cell Growth Diff. 7, 1415±1424.

Tai, T.H., Dahlbeck, D., Clark, E.T., Gajiwala, P., Whalen, M.C.,Stall, R.E. and Staskawicz, B.J. (1999) Expression of the Bs2pepper gene confers resistance to bacterial spot disease intomato. Proc. Natl Acad. Sci. USA, 96, 14153±14158.

Thilmony, R.L., Chen, Z., Bressan, R.A. and Martin, G.B. (1995)Expression of the tomato Pto gene in tobacco enhancesresistance to Pseudomonas syringae pv. tabaci expressing.Avr Pto. Plant Cell, 7, 1529±1536.

Thomas, C.M., Jones, D.A., Parniske, M., Harrison, K., Balin-Urti,P.J. and Jones, J.D.G. (1997) Characterization of the tomato Cf-4 gene for resistance to Cladisporium fulvum identi®essequences which determine recognition speci®city in Cf-4 andCf-9. Plant Cell, 9, 1±17.

Torp, J. and Jùrgensen, J.H. (1986) Modi®cation of barley



powdery mildew resistance gene Mla12 by induced mutation.Can. J. Genet. Cytol. 28, 725±731.

Vain, P., Murillo, J., Rathus, C., Nemes, C. and Finer, J.J. (1993)Development of the particle in¯ow gun. Plant Cell Tissue OrganCulture, 33, 237±246.

Van Der Biezen, E.A. and Jones, J.D.G. (1998) Plant disease-resistance proteins and the gene-for-gene concept. TrendsBiochem. Sci. 23, 454±456.

Van Der Velden, A.W. and Thomas, A.A.M. (1999) The role of the5¢ untranslated region of an mRNA in translation regulationduring development. Int. J. Biochem. Cell Biol. 31, 87±106.

Villareal, R.L., Mujeeb-Kazi, A., Rajaram, A. and Del-Toro, E.(1991) The effects of chromosome 1B/1R translocation on theyield potential of certain spring wheats (Triticum aestivum L.).Plant Breed. 106, 77±81.

Wei, F., Gobelman-Werner, K., Morroll, S.M., Kurth, J., Mao, L.,Wing, R., Leister, D., Schulze-Lefert, P. and Wise, R.P. (1999)The Mla (powdery mildew) resistance cluster is associated withthree NBS-LRR gene families and suppressed recombinationwithin a 240-kb DNA interval on chromosome 5S (1HS) ofbarley. Genetics, 153, 1929±1948.

Whitham, S., Dinesh-Kumar, S.P., Choi, D., Hehl, R., Coor, C. and

Baker, B. (1994) The product of the tobacco mosiac virusresistance gene N. Similarity to Toll and the Interleukin-1receptor. Cell, 78, 1101±1115.

Whitham, S., McCormick, S. and Baker, B. (1996) The N gene oftobacco confers resistance to tobacco mosaic virus intransgenic tomato. Proc. Natl Acad. Sci. USA, 93, 8776±8781.

Willis, A.E. (1999) Translational control of growth factor andproto-oncogene expression. Int. J. Biochem. Cell Biol. 31, 73±86.

Wise, R.P. and Ellingboe, A.H. (1983) Infection kinetics of Erysiphegraminis f. sp. hordei on barley with different alleles at the Ml-alocus. Phytopathology, 73, 1220±1222.

Wise, R.P. and Schnable, P.S. (1994) Mapping complementarygenes in maize. Positioning the rf1 and rf2 nuclear-fertilityrestorer loci of Texas (T) -cytoplasm relative to RFLP andmorphological markers. Theor. Appl. Genet. 88, 785±795.

Zhou, F., Kurth, J., Wei, F., Elliott, C., ValeÁ , G., Yahiaoui, N., Keller,B., Somerville, S., Wise, R. and Schulze-Lefert, P. (2001) Cell-autonomous expression of barley Mla1 confers race-speci®cresistance to the powdery mildew fungus via a Rar1independent signaling pathway. Plant Cell, 13, in press.

EMBL accession numbers: Mla6 class A, B and C cDNAs (AJ302292, AJ302294 and AJ302295, respectively), Mla6 genomic

(AJ302293) and Mla-RGH1 family members from cv. Morex (AJ302296, AJ302297, AJ302298, AJ302299).



The MLA6 coiled-coil, NBS-LRR protein confers AvrMla6-dependent resistance specificity to Blumeria...

Documents

Transcript of The MLA6 coiled-coil, NBS-LRR protein confers AvrMla6-dependent resistance specificity to Blumeria...