The contribution of TRPM8 channels to cold sensing in mammalian neurones

J Physiol 567.2 (2005) pp 415–426 415

The contribution of TRPM8 channels to cold sensingin mammalian neurones

Elvira de la Pena, Annika Malkia, Hugo Cabedo, Carlos Belmonte and Felix Viana

Instituto de Neurociencias de Alicante, Universidad Miguel Hernandez-CSIC, Apartado 18, San Juan de Alicante 03550, Spain

Different classes of ion channels have been implicated in sensing cold temperatures at mammalianthermoreceptor nerve endings. A major candidate is TRPM8, a non-selective cation channel ofthe transient receptor potential family, activated by menthol and low temperatures. Weinvestigated the role of TRPM8 in cold sensing during transient expression in mouse culturedhippocampal neurones, a tissue that lacks endogenous expression of thermosensitive TRPs.In the absence of synaptic input, control hippocampal neurones were not excited by cooling.In contrast, all TRPM8-transfected hippocampal neurones were excited by cooling andmenthol. However, in comparison to cold-sensitive trigeminal sensory neurones, hippocampalneurones exhibited much lower threshold temperatures, requiring temperatures below 27◦Cto fire action potentials. These results directly demonstrate that expression of TRPM8in mammalian neurones induces cold sensing, albeit at lower temperatures than nativeTRPM8-expressing neurones, suggesting the presence of additional modulatory mechanismsin the cold response of sensory neurones.

(Received 14 March 2005; accepted after revision 11 June 2005; first published online 16 June 2005)Corresponding author E. de la Pena: Instituto de Neurociencias de Alicante, Universidad Miguel Hernandez-CSIC,Apartado 18, San Juan de Alicante, 03550 Spain. Email: [email protected]

Peripheral endings of thermal sensory neuronesinnervating the body surface act as cellular sensors fortemperature, transducing the changes in thermal energyinto an electrical signal (Hensel, 1981; Spray, 1986).Following the landmark demonstration of the role ofthe capsaicin-sensitive vanilloid receptor (TRPV1) in thedetection of noxious heat (Caterina et al. 1997), severalother mammalian TRP channels have been implicated intemperature sensing (reviewed by Benham et al. 2003;Jordt et al. 2003). More recent studies have examinedthe cellular and molecular mechanisms involved in thetransduction of cold temperatures by peripheral sensoryendings (reviewed by Patapoutian et al. 2003; Jordt et al.2003; Reid, 2005). An important finding was the cloningof TRPM8, a non-selective, calcium-permeable cationchannel of the transient receptor potential family that isactivated by cooling and menthol (McKemy et al. 2002;Peier et al. 2002). The role of TRPM8 in cold sensing inprimary sensory neurones is supported by several linesof evidence: (i) TRPM8 is expressed selectively in a smallpopulation of primary sensory neurones (McKemy et al.2002; Peier et al. 2002) with specific electrophysiologicalproperties (Viana et al. 2002; Reid et al. 2002); (ii) mostcold-sensitive neurones are also excited by menthol(McKemy et al. 2002; Reid et al. 2002; Viana et al.2002; Nealen et al. 2003; Thut et al. 2003), the specificligand for this channel; and (iii) the same neuronesalso express TRPM8-mRNA transcripts (Nealen et al.

2003). Moreover, many cold-sensitive neurones expressa non-selective cation current (I cold) with biophysicaland pharmacological properties consistent with theproperties of TRPM8-dependent currents in transfectedcells (Okazawa et al. 2002; Reid et al. 2002).

Yet, these findings do not establish an essential orunique role for TRPM8 in cold sensing. Several lines ofevidence point to the presence of additional cold-sensingmechanisms in primary sensory neurones. Firstly, theremarkable temperature sensitivity and high thresholdtemperature of isolated cold-sensitive nerve endings(Brock et al. 2001; Carr et al. 2003) and the temperaturethreshold of the endogenous I cold current in culturedprimary sensory neurones (Reid et al. 2002) do notmatch with the relatively low threshold temperature ofTRPM8-dependent currents in heterologously transfectedcells (<26◦C). These differences in threshold can beinterpreted as evidence for the presence of a cold sensor innerve terminals operating in a higher temperature rangethan TRPM8, but could also be due to modulatory actionsoperating on TRPM8 itself (see Reid, 2005). Secondly,the sole expression of TRPM8 cannot readily explain thebroad range of temperature thresholds observed in thepopulation of sensory afferents responding to cold. Thefact that many cold-sensitive neurones with a low thresholdtemperature lack TRPM8 expression (Nealen et al. 2003;Babes et al. 2004), and the presence of cold-sensitivenociceptors excited only by temperatures below 10–15◦C,

C© The Physiological Society 2005 DOI: 10.1113/jphysiol.2005.086546

416 E. de la Pena and others J Physiol 567.2

provide strong evidence for the presence of alternativecold sensors. A second member of the TRP family, namedTRPA1 (formerly ANKTM1), is activated by much lowertemperatures than TRPM8 and has been suggested to beimportant in the transduction of strong (painful) coolingstimuli (Story et al. 2003). Recently, the involvement ofTRPA1 in cold sensitivity of sensory neurones has beenquestioned (Babes et al. 2004; Jordt et al. 2004).

ENaC, a member of the amiloride-sensitive epithelialsodium channel family, is another molecular candidatefor the excitatory actions of cold temperatures (Askwithet al. 2001). Other TRP-independent ionic mechanisms,such as the closure of background potassium channels,may also participate in cold sensing (Maingret et al. 2000;Reid & Flonta, 2001; Viana et al. 2002; Kang et al. 2005).Data from our group also showed that expression ofslowly inactivating potassium channels in many sensoryneurones acts as a molecular excitability brake, reducingcold sensitivity (Viana et al. 2002; Cabanes et al. 2003).These different cold-sensing mechanisms are not mutuallyexclusive, and their relative contribution to the highsensitivity to cooling, exhibited by the small subset ofprimary sensory neurones that mediate innocuous colddetection, is still unknown.

The properties of TRPM8 channels have beencharacterized in some detail during expression inmammalian cell lines and oocytes (McKemy et al. 2002;Peier et al. 2002; Andersson et al. 2004; Brauchi et al.2004; Voets et al. 2004; Liu & Qin, 2005). However,these cells lack many of the features of a neurone, likeintrinsic excitability, non-linear membrane properties andcomplex morphology. Many aspects of lipid-mediatedsignalling are also particular to nervous cells. Since thesefactors could affect the functional properties of TRPM8channels (e.g. temperature threshold), studying themin a neuronal environment may provide clues aboutthe differences observed between native cold-sensitivecurrents and TRPM8 channels. The hippocampus, atissue lacking native expression of cold-sensitive TRPs,provides a suitable system to explore the contributionof TRPM8 to cold transduction in a neuronal context.We used hippocampal neurones, genetically modifiedto express TRPM8, and found that all TRPM8(+)hippocampal neurones respond de novo to strong cooling(threshold below 27◦C) in contrast with the high thresholdtemperature (>31◦C) characteristic of many cold-sensitiveneurones of the trigeminal ganglion.

These results support the prevailing vision that assignsan important role to TRPM8 channels in neuronalcold sensing. Yet, they also reveal important functionaldifferences between native cold-sensitive neurones andTRPM8-dependent cold responses, suggesting thatadditional mechanisms contribute to establishing thetemperature threshold and response characteristics ofthermal sensory neurones detecting innocuous cold.

Methods

RNA extraction and RT-PCR

Total RNA was isolated from OF-1 mice hippocampus(embryonic day (E)14.5), trigeminal ganglia (E19) anddorsal root ganglia (2 months postnatal (PN)) withthe RNeasy Mini Kit (QIAGEN) as recommended bythe supplier. Next, 5 µg of total RNA were randomprimed and reverse transcribed to cDNA using the1st Strand cDNA Synthesis Kit for RT-PCR (Roche).Control reactions were performed by omitting thereverse transcriptase. First strand cDNA was PCRamplified with specific primers for mouse TRPM8(trpm8 sense ATGAGCACAACCTGCCCCGCTTC andtrpm8 antisense GTGTCCCATGAGCCTCCACATC,amplified fragments of 563 bp), and TRPA1 (trpa1sense CCCCATTGCTTTCCTTAATCCAG and trpa1antisense CCTGTCTTGGAAAGAGCAATGG, amplifiedfragments of 568 bp). The quality of cDNA synthesis waschecked by amplifying the housekeeping gene β-actin(β-actin sense GAATGGGTCAGAAGGACTCC andβ-actin antisense GCCTGGGTACATGGTGGTACCACC,amplified fragments of 787 bp). Ten per cent of the PCRamplification was submitted to agarose gel electrophoresisand detected with ethidium bromide.

Cloning of TRPM8 in pCINeo/IRES-GFP

The bicistronic vector pcINeo/IRES-GFP was providedby Jan Eggermont (KU, Leuven) and pcDNA3-TRPM8was made available by David Julius (University ofCalifornia, San Francisco). The ORF of TRPM8 wasobtained by digestion with KpnI and NotI, polished withPfu polymerase and cloned into the bicistronic vectorpcINeo/IRES-GFP digested with EcoRI and blunt endedwith the Klenow fragment of the DNA polymerase. Theconstruct was verified by automatic sequencing.

Culture of HEK293 cells and neurones

HEK293 cells were obtained from the ECACC (Salisbury,UK). Cells were cultured in DMEM containing 10%of fetal bovine serum and plated on 2 cm2 wells at400 000 cells well−1. Between 20 and 24 h after plating,the cells were transfected with plasmid DNA usingLipofectamineTM 2000 (Invitrogen); 2 µg DNA and3 µl lipofectamine per well, respectively. Then, 24–48 hpost-transfection, cells were trypsinized and replated onlaminin-coated round coverslips (12 mm diameter) at80 000 cells coverslip−1; 24–48 h post-transfection, greenfluorescent protein (+) (GFP(+)) cells were selectedfor intracellular calcium measurements and electro-physiological recordings.

Pregnant female mice were anaesthetized with etherand killed by decapitation, following EU and institutional

C© The Physiological Society 2005

J Physiol 567.2 Role of TRPM8 channels in cold sensing 417

guidelines. The hippocampus was dissected from thecerebrum of the 14.5-day-old embryos. After mechanicaldissociation with a fire-polished Pasteur pipette, the cellswere plated on ornithine/laminin-coated round coverslipsat 500 000 cells coverslip−1. After 2 days in DMEMsupplemented with 10% FBS, 10% horse serum, 0.2%glucose and penicillin/streptomycin 1000 U ml−1, theculture medium was changed to DMEM supplementedwith B-27, 0.2% glucose and penicillin/streptomycin1000 U ml−1. Then, 2–7 days after plating,neurones were transfected with plasmid DNA andLipofectamineTM 2000 (same quantities as above),and 24–48 h post-transfection, GFP(+) neurones wereselected for intracellular calcium measurements andelectrophysiological recordings. Trigeminal ganglionneurones from neonatal mice were cultured as previouslydescribed (Viana et al. 2001).

Electrophysiology

Cell-attached and whole-cell voltage- or current-clamprecordings were performed simultaneously withtemperature recordings. During current-clamprecordings, the membrane potential was manuallyclamped to an initial value of −60 mV by injection ofsmall DC currents; the same level of polarizing currentwas kept throughout the experiment. The bath solutioncontained (mm): 140 NaCl, 3 KCl, 1.3 MgCl2, 2.4 CaCl2,

Figure 1. Characterization of cold and menthol sensitivity of TRPM8-transfected HEK293 cells using[Ca2+]i imagingA, ratiometric (340 nm/380 nm) [Ca2+]i responses of three individual HEK293 cells during a cooling stimulusin the presence and absence of 100 µM menthol. Only GFP(+) cells (red and green traces) responded witha [Ca2+]i elevation during cooling to 17◦C. In the presence of menthol at 35◦C, [Ca2+]i increased in 79%of the GFP(+) cells. In the remaining cells, the response to cooling was shifted towards higher temperatures.B, effect of menthol (100 µM) on [Ca2+]i elevation and temperature threshold evoked by a staircase of decreasingtemperatures (black trace) in TRM8(+) HEK293 cells. C, temperature–response curve of [Ca2+]i elevation inTRPM8(+) HEK293 cells: data obtained in the same cells in the absence (•, control) and presence (�) of100 µM menthol, respectively (n = 14). [Ca2+]i-values have been normalized to the control response at theminimum temperature (18◦C). Error bars indicate S.E.M. Both data sets have been fitted to the Boltzmannequation: �Ca2+ = �Ca2+

max/(1 + exp((T − T 0.5)/dT )), where T = temperature (◦C) and T0.5 = temperatureat 50% response. For control and menthol, the values were: �Ca2+

max = 1.15 and 1.38; T 0.5 = 21.7 and 32.9◦C;dT = 1.9 and 1.0◦C, respectively.

10 Hepes, 10 glucose, and had a pH of 7.4. Standardpatch-pipettes (3–6 M�) contained (mm): 140 KCl, 10NaCl, 4 Mg-ATP, 0.4 Li-GTP, 10 Hepes (300 mOsmol kg−1,pH 7.3 adjusted with KOH). Current and voltage signalswere recorded with an EPC-8 patch-clamp amplifier(Heka Elektronik, Lambrecht/Pfalz, Germany). Stimulusdelivery and data acquisition were performed usingpClamp 8 software (Axon Instruments, Union City).

To block synaptic transmission, hippocampalrecordings were performed in the presence of a mixture ofblockers for ionotropic glutamate (50 µm APV + 20 µmCNQX) and GABAA (5 µm bicuculline) receptors.

Temperature stimulation

Coverslip pieces with cultured cells were placed in amicrochamber and continuously perfused (2–3 ml min−1)with solutions warmed at 34 ± 1◦C. The temperature wasadjusted with a water-cooled Peltier device placed at theinlet of the chamber and controlled by a feedback device.Cold sensitivity was investigated with a 100 s temperaturedrop to 18 ± 2◦C, as shown in Fig. 1A.

Ca2+ imaging

Neurones were incubated with 5 µm fura-2AM dissolvedin standard extracellular solution and 0.02% Pluronic(both from Molecular Probes Europe, Leiden, The



Netherlands) for 30 min at 37◦C. Fluorescencemeasurements were made with a Zeiss Axioskop FSupright microscope fitted with an OrcaER CCD camera(Hamamatsu). Fura-2 was excited at 340 nm and 380 nmwith a Polychrome IV monochromator (Till Photonics,Grafelfing, Germany) and the emitted fluorescencewas filtered with a 510 nm longpass filter. Calibratedratios were displayed online with Metafluor software(Universal Imaging). The bath temperature was sampledsimultaneously (see below), and threshold temperaturevalues for [Ca2+]i elevation were estimated by linearlyinterpolating the temperature at the midpoint betweenthe last baseline point and the first point at which a risein [Ca2+]i deviated by at least four times the standarddeviation of the baseline.

Reagents

Bicuculline methiodide (BIC) and adenosine-5′-triphosphate (ATP) were purchased fromSigma-Aldrich (Tres Cantos, Spain). dl-2-amino-5-phosphonopentanoic acid (APV) and 6-cyano-7-nitroquinoxaline-2,3-dione disodium (CNQX)were purchased from Tocris Cookson (Bristol, UK), andl-menthol from Scharlau Chemie (Barcelona, Spain).

Data are reported as mean ± standard error of the mean(s.e.m.). Statistical significance (P < 0.05) was assessed byStudent’s t test.

Results

Cold and menthol sensitivity of TRPM8-transfectedHEK293 cells

To investigate the temperature and menthol sensitivityof the TRPM8 protein, we subcloned a full-lengthcDNA of TRPM8 from rat in a bicistronic vectorwith GFP as the reporter molecule, and transientlytransfected it into HEK293 cells. Because TRPM8 iscalcium permeable (McKemy et al. 2002), we usedfura-2 calcium imaging to establish the amplitude and

Figure 2. TRPM8 and TRPA1 mRNAs are notexpressed in mouse hippocampusRNA from hippocampus, trigeminal and dorsal rootganglia was reverse transcribed (+RT) and PCR amplifiedwith specific primers (see Methods). An amplicon forboth TRP channels was obtained from trigeminal gangliaand dorsal root ganglia, but not from hippocampus. Theadequate synthesis of the cDNA was checked byamplifying the housekeeping gene β-actin. The absenceof amplification when the reverse transcriptase is omitted(−RT), rules out the possibility of genomic DNAcontamination.

temperature threshold of the response of single intactcells to cold and menthol applications. During ramp-likereductions in temperature from a holding temperatureof 35◦C, only GFP(+), and hence TRPM8(+), HEK293cells showed an increase in cytoplasmic calcium [Ca2+]i

in response to cooling (Fig. 1A). The mean temperaturethreshold of the response was 24.0 ± 0.3◦C (n = 105).At 35◦C, 100 µm menthol elevated [Ca2+]i in 79% ofTRPM8(+) HEK293 cells. In the remaining 21%, mentholproduced a notable shift in the temperature threshold(mean = 31 ± 1◦C). The effect of menthol on cold-evokedresponse was also examined during stepwise reductions intemperature (Fig. 1B). At mid-amplitude, the positive shiftin the temperature–response curve produced by 100 µmmenthol was 11◦C, while the amplitude of the responseincreased only modestly (Fig. 1C).

Cold and menthol sensitivity of TRPM8-transfectedhippocampal neurones

To assess the specific role of TRPM8 in neuronaltemperature transduction we performed experimentson mouse hippocampal cultures transiently expressingTRPM8. First, we used RT-PCR to verify that the genesof the cold-sensitive TRPs, TRPM8 and TRPA1, werenot expressed in embryonic (E14.5) hippocampal tissue(see Methods). Neither TRPM8 nor TRPA1 mRNAs weredetected in significant amounts in hippocampus (Fig. 2).In contrast, embryonic (E19) trigeminal ganglia and adultdorsal root ganglia expressed both transcripts using thesame RT-PCR conditions.

We then used calcium imaging of TRPM8-transfectedhippocampal neurones to establish the cold and mentholsensitivity induced by de novo expression of TRPM8(Fig. 3A and B). Transfection efficiency was extremelylow (estimated at <1%), but the GFP expression in thebicistronic vector was a reliable marker to unambiguouslyidentify the responding neurones (see Methods). Incontrol solution, all GFP(+), and hence TRPM8(+),hippocampal neurones responded to cooling with anelevation in [Ca2+]i (n = 28) (Fig. 3A). [Ca2+]i responses



to cooling were very infrequent in GFP(−) neurones (seebelow). The average temperature threshold in TRPM8(+)neurones was 30 ± 1◦C (n = 28), and application ofmenthol shifted the threshold response towards highertemperatures without changing the amplitude of theresponse (mean value of 33 ± 1◦C; P < 0.05; n = 11).Application of the cooling stimulus in the presence ofa mixture of synaptic transmission blockers reduced theamplitude of the response, and shifted the threshold ofthe response to lower temperatures (27.8 ± 0.8◦C; n = 11)compared to the threshold in the absence of blockers (seeabove, P = 0.05, unpaired t test). These measures wereperformed in separate groups of neurones, thus precludinga pairwise comparison. The temperature threshold in thepresence of menthol and synaptic transmission blockerswas 32.1 ± 0.1◦C (n = 6). Synaptic blockers had no directeffect on TRPM8 currents in transfected HEK293 cells:the ratio of cold-evoked currents in the presence andabsence of blockers was 0.90 ± 0.09 (n = 3). A summaryof the effects of cold and menthol applications on thepeak [Ca2+]i response in TRPM8(+) HEK293 cells andTRPM8(+) hippocampal neurones, in the absence andpresence of blockers of synaptic transmission, is shown inFig. 3C.

We noticed that 16% of the neurones in controlcultures (n = 109) and 7% of GFP(−) hippocampalneurones from transfected coverslips (n = 54) also showed[Ca2+]i responses to cooling in the absence of synaptictransmission blockers (data not shown). However, these

Figure 3. Characterization of cold and menthol sensitivity of TRPM8-transfected hippocampalneurones using [Ca2+]i imagingA, simultaneous recording of [Ca2+]i (upper trace) and bath temperature (lower trace) in two hippocampalneurones, stimulated with 30 mM KCl, cooling and 100 µM menthol. B, optical field showing the fura-2 fluorescenceexcited at 380 nm (upper image) and the GFP fluorescence excited at 470 nm (lower image). The [Ca2+]i responsesof neurones labelled 1 and 2 are shown in A. Note that only the GFP(+) neurone responds to cooling andmenthol. Calibration bar equals 20 µm. C, summary of [Ca2+]i responses in TRPM8(+) HEK293 cells and TRPM8(+)hippocampal neurones to 30 mM KCl (K+), cooling to 20◦C, 100 µM menthol at 33◦C, and the simultaneousapplication of cooling and menthol. Responses in hippocampal neurones were determined in control solution andin the presence of a mixture of synaptic transmission blockers (50 µM APV, 20 µM CNQX and 5 µM bicuculline).The amplitudes of responses in the presence of blockers were significantly smaller (P < 0.01, unpaired t test). Errorbars indicate S.E.M.

[Ca2+]i responses were infrequent and significantly smallerthan in GFP(+) neurones (249 ± 31 nm (n = 28) versus77 ± 11 nm (n = 18); P < 0.01). Furthermore, responsesin untransfected cells were not potentiated by menthol,but were completely eliminated by application of synapticblockers. We attributed the responses in control culturesto synaptically mediated changes in network excitabilityduring transient cooling, that were independent of TRPM8expression. For this reason, all electrophysiologicalexperiments were conducted in the presence of blockersof synaptic transmission.

Next, we used whole-cell patch-clamp recordings tocharacterize membrane responses induced by temperaturechanges and menthol application in control (i.e.untransfected) and TRPM8(+) hippocampal neurones.Recorded cells were characterized electrophysiologically toestablish their firing phenotype during injection of currentpulses. All of the cells were able to fire action potentials inresponse to depolarizing pulses (Fig. 4C).

In untransfected hippocampal neurones, coolingincreased the input resistance to an average of 178 ± 11%of the initial value (n = 7) (Fig. 4A and B). In TRPM8(+)neurones, the increase in input resistance during coolingwas very similar, yielding an average value of 161 ± 12% ofthe initial resistance (n = 17, P > 0.3). These effects werereversible upon rewarming (Fig. 4A).

The results of cooling on membrane potential weremarkedly different in untransfected versus TRPM8(+)neurones. In untransfected cells, half of the cells



hyperpolarized (mean = −6.3 ± 1.9 mV) and halfdepolarized (mean = 6.5 ± 2.5 mV) during cooling(n = 8). However, depolarizations were modest and inno case did they reach firing threshold. All effects onmembrane potential were reversible upon re-warming(Figs 4A and 5A).

In contrast, cooling to 20◦C produced a cleardepolarization in 14 out of 17 TRPM8(+) hippocampalneurones tested, averaging 19 ± 3 mV. Typically, thedepolarization followed the change in temperature closely(Fig. 5A). Two neurones hyperpolarized by −3 mVand −13 mV, respectively, and the remaining one wasunaffected. In 4 out of 17 neurones, the ramp-likedepolarization was sufficient to trigger action potentials,with a mean temperature threshold of 23 ± 2◦C.Furthermore, menthol, applied at 20◦C, produced a rapidand robust depolarization in all neurones tested, averaging43 ± 3 mV (n = 17) (Fig. 5A). The menthol-induceddepolarization was paralleled by a marked reduction ininput resistance, decreasing to a mean value of 37 ± 5%of the initial value (n = 17). The depolarization bymenthol resulted in a transient barrage of action potentials(13/17) that inactivated in a depolarized plateau (Fig. 5A).

Figure 4. Control hippocampal neurones are not excited by coolingA, simultaneous recording of membrane potential (upper trace) and bath temperature (lower trace) during acooling ramp to 15◦C in an untransfected hippocampal neurone. The entire recording was obtained in thepresence of a mixture of synaptic transmission blockers (5 µM bicuculine, 50 µM APV and 20 µM CNQX). Membraneinput resistance was monitored with repetitive injection of a 240 ms−25 pA current pulse every 5 s. Note thatcoapplication of 100 µM menthol had no further depolarizing effect on the membrane potential. B, superimposedvoltage responses to the −25 pA pulse at 35◦C and at 20◦C. C, firing properties of the same neurone at 35◦C.

The average firing rate during the first second of thementhol-induced response was 6 ± 1 spikes s−1 (n = 13).These results clearly indicate that expression of TRPM8confers cold- and menthol sensitivity to hippocampalneurones.

The excitatory actions of artificial TRPM8 expressionwere corroborated during whole-cell voltage-clamprecordings. In TRPM8(+) hippocampal neurones, voltageclamped at a holding potential of −60 mV, coolingproduced a detectable inward current in 6 outof 11 cells studied (mean amplitude −51 ± 21 pA;current density −4.0 ± 1.3 pA pF−1) (Fig. 5B and C).In all cases, currents were slowly rising, approachingsaturation values as the final temperature neared. In theremaining five neurones, a small outward current wasrecorded (mean amplitude 11 ± 3 pA; 0.6 ± 0.2 pA pF−1).In all TRPM8(+) neurones investigated (n = 11),menthol, applied at 20◦C, produced a large-amplitudeinward current (mean −478 ± 52 pA; current density−32.1 ± 4.1 pA pF−1) (Fig. 5B and D). For comparison,we also measured cold- and menthol-activated currentsin cold-sensitive neonatal trigeminal neurones underidentical recording conditions. In 16 of 22 cold-sensitive



neonatal trigeminal neurones, a net inward current wasdetected during cooling (mean amplitude = −81 ± 16 pA;density −8.7 ± 2 pA pF−1), significantly larger thanwhat was observed in the hippocampal neurones(P < 0.005; Fig. 5C). In the remaining six neurones,a small outward current (mean = 11 ± 2 pA; currentdensity 1.2 ± 0.2 pA pF−1) was recorded. Applicationof menthol was tested at 20◦C and produced asignificant inward current in all trigeminal neuronesinvestigated. However, the amplitude (and density) ofthe menthol-sensitive current was significantly smallerin trigeminal neurones (mean amplitude = 152 ± 64 pA;current density = 13.8 ± 5.1 pA pF−1) compared withTRPM8(+) hippocampal neurones (P < 0.01) (Fig. 5D).These results show that trigeminal neurones have largerI cold currents at 20◦C than transfected hippocampalneurones, despite an apparently higher level of expressionof functional TRPM8 channels in the latter class ofneurones.

Figure 5. TRPM8 expression induces novel cold and menthol sensitivity in hippocampusA, simultaneous recording of membrane potential (upper trace) and bath temperature (lower trace) duringcooling ramps in a TRPM8-GFP (+) hippocampal neurone. The GFP fluorescence image is shown in the inset(calibration bar = 10 µm). The application of menthol (100 µM) is marked by the horizontal solid bars. Membraneinput resistance was monitored with repetitive injection of a 240 ms −25 pA current pulse every 5 s. The entirerecording was obtained in a mixture of GABAA and ionotropic glutamate receptor blockers (see Methods). Verticalarrows mark the temperature-threshold for firing. B, simultaneous recording of membrane current (upper trace)(V hold = −60 mV) and bath temperature (lower trace) during a cooling step in the same hippocampal neurone. Notethe small inward current induced by cold, and the large reversible inward current induced by 100 µM menthol.C, average cold-evoked current (Icold) in TRPM8(+) hippocampal neurones and cold-sensitive trigeminal neuro-nes recorded at 20◦C. D, average menthol-evoked current (Imenthol) in TRPM8(+) hippocampal neurones andcold-sensitive trigeminal neurones recorded at 20◦C. Error bars indicate S.E.M.; ∗P < 0.05 (Student’s t test); ∗∗P <

0.01 (Student’s t test).

Trigeminal ganglion neurones have markedly highersensitivity to cooling

Most cold-sensitive trigeminal neurones are also excitedby menthol, suggesting there is endogenous expressionof TRPM8 in these cells (McKemy et al. 2002; Vianaet al. 2002). However, many are also excited by minimalreductions in temperature, 7–8◦C above the temperatureactivation threshold reported for TRPM8 channelsexpressed heterologously (McKemy et al. 2002; Peieret al. 2002; Andersson et al. 2004) (see above). Thus,we decided to compare temperature thresholds betweenmouse trigeminal sensory neurones and TRPM8(+)hippocampal neurones recorded in the cell-attachedconfiguration under identical conditions. This recordingconfiguration should minimize alterations in theintracellular milieu produced by whole-cell dialysis thatcould alter the temperature threshold and the robustnessof the neuronal response to cooling. Cold-sensitive



neurones in the trigeminal ganglion were identifiedwith fluorimetric [Ca2+]i-imaging techniques (Fig. 6D) asreported previously (Viana et al. 2002).

Control hippocampal neurones, recorded incell-attached mode, were not excited by cooling(n = 2) (not shown). In contrast, all TRPM8(+)hippocampal neurones fired action potentials inresponse to cooling (Fig. 6A). The mean temperaturethreshold of TRPM8(+) hippocampal neurones was23 ± 1◦C (range 18–28; n = 20). A cumulative histogramof temperature thresholds is shown in Fig. 6C. Incomparison, cold-sensitive trigeminal ganglion neuroneswere clearly more sensitive to cooling than TRPM8(+)hippocampal neurones (Fig. 6B), with a mean temperaturethreshold of 29 ± 1◦C (n = 31) and a broad thresholddistribution ranging from 34◦C to 17◦C. The difference inmean temperature thresholds between both populationswas highly significant (P < 0.001). The presence ofsynaptic transmission blockers had no effect on themean temperature threshold of trigeminal ganglionneurones (32 ± 2◦C in control versus 30 ± 1◦C withblockers; n = 4; P > 0.3). The cumulative histogram oftemperature thresholds shows that about 75% of the

Figure 6. Trigeminal ganglion neurones exhibit significantly higher threshold temperatures thanTRPM8(+) hippocampal neuronesTRPM8(+) hippocampal neurones (A) and cold-sensitive trigeminal ganglion neurones (B) were recorded in thecell-attached mode of the patch-clamp technique (upper trace) during cooling ramps (lower trace), in the pre-sence of synaptic transmission blockers. The arrows mark the temperature threshold for firing of action potentials.C, cumulative distribution of active neurones as a function of bath temperature. TRPM8(+) hippocampal neuronesare plotted as blue circles and the cold-sensitive trigeminal ganglion neurones as red triangles. D, cold-sensitivetrigeminal neurones were identified by their reversible [Ca2+]i elevations during cooling. The [Ca2+]i tracecorresponds to the same neurone as in B, before electrophysiological recordings. The insets show pseudocolorimages of the same trigeminal neurone (arrowhead) at 35◦C and 28◦C, and after rewarming to 35◦C. Thecalibration bar equals 10 µm.

trigeminal ganglion neurones reached firing threshold attemperatures higher than the most sensitive hippocampalneurone (Fig. 6C).

The differences in temperature threshold betweenhippocampal and trigeminal neurones observed incell-attached mode were confirmed during whole-cellrecordings. The mean threshold of the cold-evokedcurrent (I cold) in TRPM8(+) hippocampal neuroneswas 26.3 ± 1.4◦C (n = 6). In trigeminal neurones withphenotypical properties characteristic of low-thresholdthermoreceptors, and presumably TRPM8(+) (e.g.menthol sensitivity and or sharp calcium elevations uponcooling), the mean threshold of I cold was 31.7 ± 0.9◦C(n = 7). These mean values were statistically different(P < 0.05).

Modest effect of 4-AP on thermosensitivityof TRPM8(+) hippocampal neurones

Recently, we demonstrated that expression of ahighly 4-aminopyridine (4-AP)-sensitive voltage-gatedK+ current (IKD) in many sensory neurones modulatestheir temperature threshold to cooling (Viana et al. 2002).



In six hippocampal neurones we employed the sameprotocol used previously to uncover IKD in trigeminalganglion (see Viana et al. 2002). None of the cells testedshowed a current with the kinetic or pharmacologicalfeatures characteristic of IKD: three cells had a fast,transient K+ current (IA) that was not blocked by 100 µm4-AP, and the other three cells lacked transient K+

currents in the subthreshold voltage range. Consistentwith this result, 100 µm 4-AP had only minor effects onthe temperature threshold of TRPM8(+) hippocampalneurones. Thus, the mean temperature thresholdincreased in the presence of 4-AP, but the shift was modest,averaging 1.4 ± 0.4◦C (P < 0.05; n = 7) (not shown).

Discussion

Temperature sensing and regulation is critical for animalsurvival and adaptation to variable habitats. In this study,using lipid-driven delivery of TRPM8 cDNA, we wereable to achieve the artificial activation of hippocampalneurones by cooling stimuli and menthol. However,in marked contrast with the sensitivity to moderatecooling characteristic of cutaneous cold thermoreceptors,TRPM8(+) hippocampal neurones were only excitedby strong cooling stimuli (temperatures below 27◦C),although they were readily excited by menthol, a specificchemical agonist of TRPM8 channels.

Effects of TRPM8(+) transfection on cold andmenthol sensitivity in the hippocampus

All TRPM8-transfected hippocampal neurones wereexcited by cooling and menthol. These results confirmedthe sensitivity of the channels to both agonists reportedpreviously. Results from several groups, characterizingmammalian TRPM8 channels in oocytes and trans-fected cell lines, coincide in a temperature activationthreshold of approximately 26◦C (McKemy et al. 2002;Peier et al. 2002; Story et al. 2003; Andersson et al. 2004).This relatively low temperature for activation is entirelyconsistent with the cold-evoked firing threshold measuredin TRPM8(+) hippocampal neurones in this study: allwere excited by temperatures below 27◦C. These resultssuggest that the temperature-dependent gating of trans-fected, homomeric TRPM8 channels is very similar in thediverse expression systems used. Thus, one has to lookelsewhere to explain the fine sensitivity of mammaliancold thermoreceptors to temperature, characterized byspontaneous activity at normal skin temperature (34◦C)and temperature-dependent modulation in their dischargerate in response to minimal reductions in temperature(Hensel, 1981; Carr et al. 2003).

In TRPM8-transfected hippocampal cultures, responsesto menthol were clearly enhanced in the absence of synaptic

transmission blockers. In addition to gating effects onTRPM8 channels, menthol has been shown to act directlyon presynaptic Ca2+ stores, increasing the frequency ofminiature EPSCs (mEPSCs) (Tsuzuki et al. 2004). Becausehippocampal neurones branch extensively in the culture,even forming synapses on their own somas (autapsis),neurones excited by menthol could reinforce their activityvia recurrent synaptic interactions.

Differences in cold sensitivity between sensoryneurones and TRPM8-transfected cells

As is the case for cold thermoreceptors in vivo, manycold sensory neurones in culture have temperature firingthresholds that are well above the temperature activationthreshold of TRPM8 currents measured in transfectedcells (Viana et al. 2002; Reid et al. 2002; Thut et al.2003). Yet, many of the same sensory neurones expressTRPM8 channels. What causes this marked differencein temperature threshold between native I cold currentsand heterologously expressed TRPM8 channels? Is itdue to changes in the gating behaviour of TRPM8or to expression of other thermosensitive channels insensory neurones? We excluded a lower density of TRPM8channels in transfected hippocampal neurones versussensory neurones as a plausible explanation to accountfor this difference, because all hippocampal cells showedvery robust responses to menthol, the specific chemicalagonist of TRPM8 channels.

Two recent studies (Voets et al. 2004; Brauchi et al.2004) elucidated the issue of TRPM8 gating by coldtemperatures. Both studies showed that activation ofTRPM8 is not governed by a single temperature threshold,but strongly depends on transmembrane voltage: atdepolarized potentials, TRPM8 channels are activated athigher temperatures than at more negative potentials.Furthermore, the cooling agent menthol mimics coldresponses by shifting the voltage dependence of TRPM8activation (Voets et al. 2004). Thus, a large difference inresting membrane potential could change the apparentthreshold of TRPM8 activation. This is relevant for coldthermoreceptors in vivo since they fire spontaneously(Hensel, 1981): the cyclical depolarizations during theaction potential could act as a positive feedbackmechanism for TRPM8 activation. In this way, TRPM8channels could play a role in the pacemaking of coldthermoreceptors. In this study, however, cold-sensitivesensory neurones and hippocampal neurones werequiescent, and temperature thresholds were determinedfrom the same initial membrane potential.

Endogenous lipids have been shown to be potentmodulators of various TRP channels, including TRPV1(Zygmunt et al. 1999; Chuang et al. 2001), the first thermo-sensitive TRP discovered, and TRPV4 (Watanabe et al.



2003). In heterologous systems, TRPM8 activity is stronglyregulated by phosphatidylinositol 4,5-biphosphate (PIP2)(Liu & Qin, 2005). Another recent study showedthat TRPM8 activation is inhibited by blockers ofphospholipase C (Bandell et al. 2004). Thus, lipidsignalling may influence TRPM8 activation, somethingyet to be proven in a physiological context. By analogyto other TRPs, the gating properties of TRPM8 channelscould be influenced by phosphorylation (Premkumar& Ahern, 2000; Vellani et al. 2001; Numazaki et al.2002). Such modulatory mechanisms may explain thetemperature threshold discrepancy between the endo-genous cold-induced currents in sensory neurones (I cold),and the current activated by cold in recombinant systemsexpressing TRPM8 (both neuronal and non-neuronal).These hypothetical modulators would have to be expressedselectively in sensory neurones in order to explain theirhigher sensitivity to mild cooling stimuli.

Additional putative modulatory mechanisms of TRPM8include the interaction with other cellular proteins. Giventhat TRPV1 and TRPV3 can associate when coexpressedin HEK293 cells (Smith et al. 2002), it is possible thatnative TRPM8 may form hetero-oligomers with other TRPchannels. Alternatively, in sensory neurones, TRPM8 mayinteract with scaffolding proteins that are not expressedin hippocampal neurones. In many sensory transductionsystems, cooperation between proteins assembled in acomplex is essential for proper function. A clear exampleis the Drosophila phototransduction cascade (Montell,1998).

Yet another possibility, based on genomic structure, isthat TRPM8 may be expressed in several alternative splicedforms. Therefore, the strong temperature sensitivity oftrigeminal neurones might be due to expression of aparticular splice variant. However, the form we used forthe hippocampal neurone transfection was the same thatwas isolated during an expression cloning strategy using atrigeminal ganglion cDNA library (McKemy et al. 2002),suggesting that this is likely to be the principal isoform intrigeminal ganglion.

Finally, cold sensitivity in sensory neurones maydepend on the expression of particular sets of ionchannels with variable temperature dependence, whosecombination confers to the neurones a particulartemperature threshold for discharge. A similar view hasbeen put forward to explain the differential sensoryresponsiveness of individual neurones in C. elegans tonociceptive stimuli (Tobin et al. 2002). We showedpreviously that cold-sensitive trigeminal neurones arehighly excitable, requiring less inward current to reachfiring threshold compared to other trigeminal neurones,and express reduced levels of low-threshold voltage-gatedK+ channels (Viana et al. 2002) that normally act as cellularbrakes to excitability. The recent description of markedthermosensitivity of TREK-2 and TRAAK potassium

channels (Kang et al. 2005), both present in sensoryneurones, offers another potential mechanisms for coldsensing by thermoreceptors.

Studies of mutated TRP proteins (Greka et al.2003; Prescott & Julius, 2003) and phenotypic analysesof knockout animals (Caterina et al. 2000; Freichelet al. 2001; Hoenderop et al. 2003; Tracey et al.2003; Moqrich et al. 2005) have contributed greatly toour understanding of the functional roles of variousTRP channels. Similar data for mammalian TRPM8channels are eagerly awaited. Using a complementaryapproach, our results directly demonstrate that expressionof TRPM8 in temperature-insensitive neurones conferscold sensitivity to them. However, which additionalmechanisms, other than already known cold-sensitive TRPchannels, govern temperature-dependent modulation ofneuronal excitability, still remain to be determined.

References

Andersson DA, Chase HW & Bevan S (2004). TRPM8activation by menthol, icilin, and cold is differentiallymodulated by intracellular pH. J Neurosci 24, 5364–5369.

Askwith CC, Benson CJ, Welsh MJ & Snyder PM (2001).DEG/ENaC ion channels involved in sensory transductionare modulated by cold temperature. Proc Natl Acad Sci U S A98, 6459–6463.

Babes A, Zorzon D & Reid G (2004). Two populations ofcold-sensitive neurons in rat dorsal root ganglia and theirmodulation by nerve growth factor. Eur J Neurosci 20,2276–2282.

Bandell M, Story GM, Hwang SW, Viswanath V, Eid SR, PetrusMJ, Earley TJ & Patapoutian A (2004). Noxious cold ionchannel TRPA1 is activated by pungent compounds andbradykinin. Neuron 41, 849–857.

Benham CD, Gunthorpe MJ & Davis JB (2003). TRPVchannels as temperature sensors. Cell Calcium 33, 479–487.

Brauchi S, Orio P & Latorre R (2004). Clues to understandingcold sensation: thermodynamics and electrophysiologicalanalysis of the cold receptor TRPM8. Proc Natl Acad SciU S A 101, 15494–15499.

Brock J, Pianova S & Belmonte C (2001). Differences betweennerve terminal impulses of polymodal nociceptors and coldsensory receptors of the guinea-pig cornea. J Physiol 533,493–501.

Cabanes C, Viana F & Belmonte C (2003). Differentialthermosensitivity of sensory neurons in the guinea pigtrigeminal ganglion. J Neurophysiol 90, 2219–2231.

Carr RW, Pianova S, Fernandez J, Fallon JB, Belmonte C &Brock JA (2003). Effects of heating and cooling on nerveterminal impulses recorded from cold-sensitive receptors inthe guinea-pig cornea. J Gen Physiol 121, 427–439.

Caterina MJ, Leffler A, Malmberg AB, Martin WJ, Trafton J,Petersen-Zeitz KR, Koltzenburg M, Basbaum AI & Julius D(2000). Impaired nociception and pain sensation in micelacking the capsaicin receptor. Science 288, 306–313.



Caterina MJ, Schumacher MA, Tominaga M, Rosen TA, LevineJD & Julius D (1997). The capsaicin receptor: a heat-activated ion channel in the pain pathway. Nature 389,816–824.

Chuang HH, Prescott ED, Kong H, Shields S, Jordt SE,Basbaum AI, Chao MV & Julius D (2001). Bradykinin andnerve growth factor release the capsaicin receptor fromPtdIns (4,5),P2-mediated inhibition. Nature 411,957–962.

Freichel M, Suh SH, Pfeifer A, Schweig U, Trost C, WeissgerberP, Biel M, Philipp S, Freise D, Droogmans G, Hofmann F,Flockerzi V & Nilius B (2001). Lack of an endothelialstore-operated Ca2+ current impairs agonist-dependentvasorelaxation in TRP4−/− mice. Nat Cell Biol 3,121–127.

Greka A, Navarro B, Oancea E, Duggan A & Clapham DE(2003). TRPC5 is a regulator of hippocampal neurite lengthand growth cone morphology. Nat Neurosci 6, 837–845.

Hensel H (1981). Cutaneous thermoreceptors. InThermoreception and Temperature Regulation, ed. Hensel H,pp. 33–61. Academic Press, London.

Hoenderop JG, van Leeuwen JP, van der Eerden BC, KerstenFF, van der Kemp AW, Merillat AM, Waarsing JH, RossierBC, Vallon V, Hummler E & Bindels RJ (2003). Renal Ca2+wasting, hyperabsorption, and reduced bone thickness inmice lacking TRPV5. J Clin Invest 112, 1906–1914.

Jordt SE, Bautista DM, Chuang HH, McKemy DD, ZygmuntPM, Hogestatt ED, Meng ID & Julius D (2004). Mustard oilsand cannabinoids excite sensory nerve fibres through theTRP channel ANKTM1. Nature 427, 260–265.

Jordt SE, McKemy DD & Julius D (2003). Lessons from peppersand peppermint: the molecular logic of thermosensation.Curr Opin Neurobiol 13, 487–492.

Kang D, Choe C & Kim D (2005). Thermosensitivity of thetwo-pore domain K+ channels TREK-2 and TRAAK.J Physiol 564, 103–116.

Liu BY & Qin F (2005). Functional control of cold- andmenthol-sensitive TRPM8 ion channels byphosphatidylinositol 4,5-bisphosphate. J Neurosci 25,1674–1681.

Maingret F, Lauritzen I, Patel AJ, Heurteaux C, Reyes R, LesageF, Lazdunski M & Honore E (2000). TREK-1 is aheat-activated background K+ channel. EMBO J 19,2483–2491.

McKemy DD, Neuhausser WM & Julius D (2002).Identification of a cold receptor reveals a general role forTRP channels in thermosensation. Nature 416, 52–58.

Montell C (1998). TRP trapped in fly signaling web. Curr OpinNeurobiol 8, 389–397.

Moqrich A, Hwang SW, Earley TJ, Petrus MJ, Murray AN,Spencer KS, Andahazy M, Story GM & Patapoutian A (2005).Impaired thermosensation in mice lacking TRPV3, a heatand camphor sensor in the skin. Science 307, 1468–1472.

Nealen ML, Gold MS, Thut PD & Caterina MJ (2003). TRPM8mRNA is expressed in a subset of cold-responsive trigeminalneurons from rat. J Neurophysiol 90, 515–520.

Numazaki M, Tominaga T, Toyooka H & Tominaga M (2002).Direct phosphorylation of capsaicin receptor VR1 by proteinkinase Cepsilon and identification of two target serineresidues. J Biol Chem 277, 13375–13378.

Okazawa M, Takao K, Hori A, Shiraki T, Matsumura K &Kobayashi S (2002). Ionic basis of cold receptors acting asthermostats. J Neurosci 22, 3994–4001.

Patapoutian A, Peier AM, Story GM & Viswanath V (2003).ThermoTRP channels and beyond: mechanisms oftemperature sensation. Nat Rev Neurosci 4, 529–539.

Peier AM, Moqrich A, Hergarden AC, Reeve AJ, Andersson DA,Story GM, Earley TJ, Dragoni I, McIntyre P, Bevan S &Patapoutian A (2002). A TRP channel that senses coldstimuli and menthol. Cell 108, 705–715.

Premkumar LS & Ahern GP (2000). Induction of vanilloidreceptor channel activity by protein kinase C. Nature 408,985–990.

Prescott ED & Julius D (2003). A modular PIP2 binding site asa determinant of capsaicin receptor sensitivity. Science 300,1284–1288.

Reid G (2005). ThermoTRP channels and cold sensing: whatare they really up to? Pflugers ArchDOI: 10.1007/s00424-005-1437-2.

Reid G, Babes A & Pluteanu F (2002). A cold- andmenthol-activated current in rat dorsal root ganglionneurones: properties and role in cold transduction. J Physiol545, 595–614.

Reid G & Flonta M (2001). Cold transduction by inhibition of abackground potassium conductance in rat primary sensoryneurones. Neurosci Lett 297, 171–174.

Smith GD, Gunthorpe MJ, Kelsell RE, Hayes PD, Reilly P, FacerP, Wright JE, Jerman JC, Walhin JP, Ooi L, Egerton J, CharlesKJ, Smart D, Randall AD, Anand P & Davis JB (2002).TRPV3 is a temperature-sensitive vanilloid receptor-likeprotein. Nature 418, 186–190.

Spray DC (1986). Cutaneous temperature receptors. Annu RevPhysiol 48, 625–638.

Story GM, Peier AM, Reeve AJ, Eid SR, Mosbacher J, HricikTR, Earley TJ, Hergarden AC, Andersson DA, Hwang SW,McIntyre P, Jegla T, Bevan S & Patapoutian A (2003).ANKTM1, a TRP-like channel expressed in nociceptiveneurons, is activated by cold temperatures. Cell 112,819–829.

Thut PD, Wrigley D & Gold MS (2003). Cold transduction inrat trigeminal ganglia neurons in vitro. Neuroscience 119,1071–1083.

Tobin D, Madsen D, Kahn-Kirby A, Peckol E, Moulder G,Barstead R, Maricq A & Bargmann C (2002). Combinatorialexpression of TRPV channel proteins defines their sensoryfunctions and subcellular localization in C. elegans neurons.Neuron 35, 307–318.

Tracey WD Jr, Wilson RI, Laurent G & Benzer S (2003).painless, a Drosophila gene essential for nociception. Cell113, 261–273.

Tsuzuki K, Xing H, Ling J & Gu JG (2004). Menthol-inducedCa2+ release from presynaptic Ca2+ stores potentiatessensory synaptic transmission. J Neurosci 24, 762–771.

Vellani V, Mapplebeck S, Moriondo A, Davis JB &McNaughton PA (2001). Protein kinase C activationpotentiates gating of the vanilloid receptor VR1 by capsaicin,protons, heat and anandamide. J Physiol 534, 813–825.

Viana F, de la Pena E & Belmonte C (2002). Specificity of coldthermotransduction is determined by differential ionicchannel expression. Nat Neurosci 5, 254–260.



Viana F, de la Pena E, Pecson B, Schmidt RF & Belmonte C(2001). Swelling-activated calcium signalling in culturedmouse primary sensory neurons. Eur J Neurosci 13,722–734.

Voets T, Droogmans G, Wissenbach U, Janssens A, Flockerzi V& Nilius B (2004). The principle of temperature-dependentgating in cold- and heat-sensitive TRP channels. Nature 430,748–754.

Watanabe H, Vriens J, Prenen J, Droogmans G, Voets T &Nilius B (2003). Anandamide and arachidonic acid useepoxyeicosatrienoic acids to activate TRPV4 channels.Nature 424, 434–438.

Zygmunt PM, Petersson J & Andersson D (1999). A., Chuang,H., Sorgard, M., Di, M., V, Julius, D. & Hogestatt, E. D.Vanilloid receptors on sensory nerves mediate thevasodilator action of anandamide. Nature 400, 452–457.

Acknowledgements

We thank R. Velasco, E. Quintero and A. Perez for technicalassistance and S. Ingham for illustrations. We also acknowledgeM. Dominguez, R. Gallego, P. Gomez, E. Nasi and M.Valdeolmillos for critical comments. D. Julius providedthe rat TRPM8 cDNA in pcDNA3 and J. Eggermont thepcINeo/IRES-GFP bicistronic vector. This work was supportedby funds from the Spanish Ministry of Science and Education,SAF2001-1641 and SAF2004-01011 to F.V, BFI2002-03788 toC.B., project GV04A-652 from the Generaliltat Valenciana toE.P and a fellowship from the Spanish Ministry of Foreign Affairs(MAE-AECI) to A.M.


The contribution of TRPM8 channels to cold sensing in mammalian neurones

Documents

Transcript of The contribution of TRPM8 channels to cold sensing in mammalian neurones