The FASEB Journal • Research Communication

Structure and protective efficacy of the Staphylococcusaureus autocleaving protease EpiP

Misty L. Kuhn,*,1 Prachi Prachi,†,1 George Minasov,* Ludmilla Shuvalova,*Jiapeng Ruan,* Ievgeniia Dubrovska,* James Winsor,* Monica Giraldi,†

Massimiliano Biagini,† Sabrina Liberatori,† Silvana Savino,† Fabio Bagnoli,†

Wayne F. Anderson,*,2 and Guido Grandi†,2

*Center for Structural Genomics of Infectious Diseases, Department of Molecular Pharmacology andBiological Chemistry, Northwestern University Feinberg School of Medicine, Chicago, Illinois, USA;and †Novartis Vaccines and Diagnostics, Research Centre, Siena, Italy

ABSTRACT Despite the global medical needs associ-ated with Staphylococcus aureus infections, no licensedvaccines are currently available. We identified andcharacterized a protein annotated as an epiderminleader peptide processing serine protease (EpiP), as anovel S. aureus vaccine candidate. In addition, wedetermined the structure of the recombinant protein(rEpiP) by X-ray crystallography. The crystal structurerevealed that rEpiP was cleaved somewhere betweenresidues 95 and 100, and we found that the cleavageoccurs through an autocatalytic intramolecular mecha-nism. The protein expressed by S. aureus cells alsoappeared to undergo a similar processing event. Todetermine whether the protein acts as a serine protease,we mutated the hypothesized catalytic serine 393 resi-due to alanine, generating rEpiP-S393A. The crystalstructure of this mutant protein showed that the poly-peptide chain was not cleaved and was not interactingstably with the active site. Indeed, rEpiP-S393A wasshown to be impaired in its protease activity. Micevaccinated with rEpiP were protected from S. aureusinfection (34% survival, P�0.0054). Moreover, the pro-tective efficacy generated by rEpiP and rEpiP-S393Awas comparable, implying that the noncleaving mutantcould be used for vaccination purposes.—Kuhn, M. L.,Prachi, P., Minasov, G., Shuvalova, L., Ruan, J.,Dubrovska, I., Winsor, J., Giraldi, M., Biagini, M.,Liberatori, S., Savino, S., Bagnoli, F., Anderson, W. F.,Grandi, G. Structure and protective efficacy of theStaphylococcus aureus autocleaving protease EpiP.FASEB J. 28, 1780–1793 (2014). www.fasebj.org

Key Words: vaccine � epidermin leader peptide processing serineprotease � pathogenesis � lantibiotic � abscess � immunogenicity

Ribosomally synthesized and post-translationallymodified peptides (RiPPs) are a class of natural prod-ucts that exist in all forms of life (1). Many gram-positive bacteria produce RiPPs that have antimicrobialactivity and are called lantibiotics. These lantibiotics areeffective antibacterial agents against other gram-posi-tive bacteria (2, 3) and have been investigated aspossible alternatives for the treatment of bacterialinfections (4, 5). A cascade of proteins is required toboth post-translationally modify the lantibiotic into itsmature form and to protect the producing organismfrom the effects of the lantibiotic via immunity proteins(6). Indeed, producing bacteria protect themselvesfrom the lethal action of its own antimicrobial lantibi-otics by expressing immunity proteins. Generally, thegenes coding for these proteins are found in clusters oneither plasmids or chromosomes (7, 8) and have beenidentified in several bacteria, such as Lactococcus, Bacil-lus, Staphylococcus, Streptococcus, and Enterococcus. Re-cently, in silico screenings have uncovered 49 unidenti-fied clusters from bacteria not known to producelantibiotics (9), which indicates that these clusters aremore common than previously thought. Not all genesin the clusters are conserved, nor are they arrangedin the same order among strains and species (10).Moreover, not all bacteria that have these clusterscan produce active lantibiotic, and if a lantibiotic isproduced, it does not always have antibacterial activ-ity (5, 11).

Most lantibiotic gene clusters have a gene that codesfor a lantibiotic leader peptide protease (10). Epider-min leader peptide processing serine protease (EpiP) is

1 These authors contributed equally to this work.2 Correspondence: G.G., Novartis Vaccines, via Fiorentina

1, 53100, Siena, Italy. E-mail: guido.grandi@novartis.com;W.F.A., Center for Structural Genomics of Infectious Dis-eases, Department of Molecular Pharmacology and BiologicalChemistry, Northwestern University Feinberg School of Med-icine, 303 E Chicago Ave., Chicago, IL 60611, USA. E-mail:wf-anderson@northwestern.edu

doi: 10.1096/fj.13-241737This article includes supplemental data. Please visit http://

www.fasebj.org to obtain this information.

Abbreviations: Agr, accessory gene regulator; EpiP, epider-min leader peptide processing serine protease; LAC, LosAngeles clone; PCR, polymerase chain reaction; PIPE, poly-merase incomplete primer extension; PDB, Protein DataBank; PMF, peptide mass fingerprinting; qRT-PCR, quantita-tive reverse transcription polymerase chain reaction; RiPP,ribosomally synthesized and post-translationally modifiedpeptide; TSB, tryptic soy broth; WT, wild type

1780 0892-6638/14/0028-1780 © FASEB

a subtilisin-like extracellular epidermin leader pepti-dase and is required for proteolytic processing of themature lantibiotic epidermin in Staphylococcus epidermi-dis (6, 12); however, its function in Staphylococcus aureusremains unknown, since there has been debate regard-ing whether S. aureus produces epidermin (13–15) orjust retains the lantibiotic immunity genes for self-protection against other lantibiotics or for increasedvirulence. It has been shown that bacteria that havethese lantibiotic gene clusters, even if they do notproduce the lantibiotic, have increased virulence andresistance (16, 17). Many lantibiotic peptidases arecytoplasmic, but some, like NisP, CylP, and EpiP, resideextracellularly (10). The regulation of expression ofexoproteins, surface proteins, and virulence factors forS. epidermidis and S. aureus are controlled by the acces-sory gene regulator (agr) quorum-sensing system (18).When agr was deleted in S. epidermidis, a decrease inmature epidermin production was seen, which was dueto the decreased ability of EpiP to process the propep-tide of epidermin rather than a decrease in the tran-scription of genes in the lantibiotic cluster (18). There-fore, agr quorum sensing does not interfere with thetranscription of epidermin biosynthetic genes but con-trols the extracellular processing of the N-terminalleader peptide by the EpiP protease.

S. aureus is one of the most common opportunisticpathogens of humans and causes a wide range ofdiseases, from mild skin infections to life-threateningdiseases such as sepsis, pneumonia, endocarditis, andosteomyelitis (19). The burden of staphylococcal dis-ease is increasing due to the ability of S. aureus toacquire resistance to various antibiotics, includingmethicillin and vancomycin (20–22). In fact, methicil-lin-resistant S. aureus (MRSA) has been recognized as amajor cause of infections in healthcare settings andcommunity environments (23, 24). For example, in2005, it was estimated that invasive MRSA infectionsoccurred at a rate of �30/100,000 U.S. citizens andcaused �18,000 patient deaths in the United Statesalone (25). The alarming increase in multiantibioticresistance of S. aureus together with the wide variety andseverity of staphylococcal infections pose a threat topublic health and challenge our ability to control thedisease. In particular, this is due to the lack of medicaltreatment alternatives to antibiotics (26–28). Althoughseveral vaccine candidates have been proposed, andsome of them have been tested in clinical trials usingboth active and passive immunization modalities (29),an effective vaccine is still missing.

Herein we characterized a S. aureus protein anno-tated as an EpiP. The epiP gene contains a peptidase_S8domain that is present in subtilisin-like serine proteasesand is also present in protective antigens of severalother species (30–36). In addition, homologous pro-teins expressed by other bacterial species have beenshown to play important roles during pathogenesis. Inparticular, the Streptococcus pyogenes homologue SpyCEP(also named ScpC) inactivates IL-8 by catalyzing itsC-terminal cleavage (37). As a consequence, SpyCEP

impairs the recruitment of neutrophils at the site ofinfection and subsequent bacterial clearance (38, 39).Given that neutrophils are probably one of the mostimportant elements of the host immune system againstS. aureus infections (40), it will be important to under-stand whether EpiP has similar pathogenic mechanismsto SpyCEP. Unfortunately, there are currently no re-ports describing structural and functional characteriza-tion of the S. aureus EpiP protein. Therefore, wedecided to perform studies aimed at revealing the firstfundamental biochemical and functional properties ofthis novel protein, as well as its potential as a vaccineantigen against S. aureus infection. Herein, we presentthe structure of EpiP, the first structure of a lantibioticprocessing protease, and we show that mice vaccinatedwith it are protected against S. aureus infection.

MATERIALS AND METHODS

Bacterial strains and medium and growth conditions

S. aureus Newman (ST254), Los Angeles clone (LAC; USA300),Mu50 (USA100), and �spa-Newman strains were used for thestudy of the epiP gene and protein expression. The strainsNewman, LAC, and Mu50 were grown overnight in tryptic soybroth (TSB) under agitation at 250 rpm, 37°C, whereas the�spa-Newman strain was grown overnight in TSB growth me-dium supplemented with 10 �g/ml erythromycin.

Cloning of EpiP wild-type (WT) and mutant genes

epiP was amplified by polymerase chain reaction (PCR) fromthe S. aureus NCTC8325 strain and was cloned in absence ofits putative leader sequence (aa 1–27) as an N-terminal 6X-histidine-tag (His-tag) construct. The His-tagged construct wascloned using oligonucleotides rEpiP forward CTGTACTTC-CAGGGCTCAGAAGAACTATATTACAGTGTTG and reverseAATTAAGTCGCGTTAACTTGCTTTTTGATTTGCTACATTT-AATGCT. The His-tagged PCR product was subcloned into thepET-15b� vector using the polymerase incomplete primer ex-tension (PIPE) technique (41). The Stratagene QuikChangesite-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) wasused to construct the rEpiP-S393A and rEpiP-S393G mutantsaccording to the procedure outlined in the manufacture’stechnical manual. The conditions for the PCR reaction wereinitial denaturation at 95°C for 5 min, followed by 18 cycles ofdenaturation at 95°C for 1 min, annealing at 55°C for 1 min,extension at 68°C for 7 min, and final extension at 68°C for 10min, then cooling to 4°C. A silent mutation for L394 (TTA toCTG) was added to improve the AT-rich region of this gene forPCR. The following primers were used to construct the mutants:rEpiP-S393G, forward GAAGATATATTTATCAAGCTG-GAACTGGCCTGGCCACACCTAAAGTTTCG and reverse CG-AAACTTTAGGTGTGGCCAGGCCAGTTCCAGCTTGATAAA-TATATCTTC; rEpiP-S393A, forward GAAGATATATTTAT-CAAGCTGGAACTGCGCTGGCCACACCTAAAGTTTCG and re-verse CGAAACTTTAGGTGTGGCCAGCGCAGTTCCAGCTTGA-TAAATATATCTTC.

Recombinant protein expression and purification

The ampicillin-resistant rEpiP or mutant His-tagged plasmidswere transformed into kanamycin-resistant BL21 (DE3)Magic cells, grown and expressed in terrific broth (TB), and

1781STAPHYLOCOCCUS AUREUS AUTOCLEAVING PROTEASE EpiP

harvested according to previously described procedures (42,43). Pelleted cells were resuspended in buffer and sonicated,and cleared lysates were loaded onto an immobilized metalion affinity chromatography (IMAC) Ni2�-affinity sepharosecolumn (GE His-trap HP; GE Healthcare, Pittsburgh, PA,USA) as described previously (42). Fractions of protein fromIMAC were pooled and diluted with 10 mM Tris-HCl (pH 8.3)to reduce the salt concentration and then loaded onto a GEHiTrap SP 5-ml column for ion exchange (IEX) chromatog-raphy. The loading buffer was composed of 10 mM Tris-HCl(pH 8.3) and 5 mM �-mercaptoethanol, and the protein waseluted over 30 column volumes with a linear gradient from 0to 1 M NaCl. rEpiP or mutant protein eluted at �0.27 M NaCland was concentrated using Amicon protein concentrators(10,000 MWCO; Millipore, Billerica, MA, USA). Protein con-centration was determined using the absorbance at 280 nmand the extinction coefficient 0.942 M�1 · cm�1. Proteinpurity was determined using SDS-PAGE and was purified tonear homogeneity.

Protein crystallization

The sitting-drop vapor-diffusion method was used for proteincrystallization at 295 K in a 96-well plate format with 1 �l ofprecipitant and 1 �l of enzyme (7 mg/ml for rEpiP and 7.8mg/ml for rEpiP-S393A). The Classics II, PACT, and JCSG�commercial screens from Qiagen (Valencia, CA, USA) wereused for crystallization trials. Several nicely diffracting crystalsgrew after 3–5 d for rEpiP in 0.2 M lithium sulfate, 0.1 MBis-Tris (pH 5.5), and 25% (w/v) PEG 3350; however, only 1crystal was obtained on a fiber after several weeks for therEpiP-S393A in 0.2 M calcium chloride, 0.2 M Tris (pH 8.0),

and 20% (w/v) PEG 6000. No protein crystals were observedeven after 1 yr for the rEpiP-S393G. Single crystals weretransferred to the corresponding mother liquor and flash-frozen in liquid nitrogen for data collection. The rEpiP hadunit cell parameters of a � 85.5 Å, b � 94.7 Å, c � 123 Å, with � 89.98°, � � 90.37°, and � 116.79°, and belonged to theP1 space group. The rEpiP-S393A had unit cell parameters ofa � 71.23 Å, b � 68.47 Å, c � 97.72 Å, with � 90°, � �91.66° and � 90°, and belonged to the P21 space group.

Data collection and refinement

Data were collected at 100 K from single protein crystals atArgonne National Laboratory (Argonne, IL, USA) at theAdvanced Photon Source (APS) on beamline 21-ID-F at aresolution of 2.05 Å and a wavelength of 0.97872 Å for rEpiPand on beamline 21-ID-G at a resolution of 1.95 Å and awavelength of 0.97856 Å for rEpiP-S393A. The diffractionimages for both data sets were indexed, integrated, and scaledwith HKL-3000 (44). The structures of the rEpiP and rEpiP-S393A proteins were solved by molecular replacement usingProtein Data Bank (PDB) codes 1THM and 3QFH, respec-tively, as the search model with Phaser (45). The initial modelfor rEpiP was rebuilt using ARP/wARP (46). Structures wererefined using Refmac (47) and manually corrected usingCoot (48). Both structures were checked and validated usingSfcheck (49) and MolProbity (50). The coordinates weredeposited into PDB using accession codes 3QFH for rEpiPand 3T41 for rEpiP-S393A. Statistics for data collection areshown in Table 1. The PyMOL Molecular Graphics System1.5.0.4 software (Schrodinger LLC, Portland, OR, USA) wasused to create the figures.

TABLE 1. Parameters for crystallography with statistics from data collection, refinement, andvalidation

Parameter or statistic WT S393A

Data collectionSpace group P1 P21Unit cell: a, b, c (Å) 85.5, 94.7, 123.0 71.2, 68.5, 97.7, �, (deg) 90.0, 90.4, 116.8 90.0, 91.7, 90.0Wavelength (Å) 0.97872 0.97856Resolution (Å) 30-2.05 (2.09–2.05) 30-1.95 (1.98–1.95)Observed reflections (n) 219,399 (10,837) 63,885 (3419)Rmerge (%) 4.7 (35.4) 4.5 (47.3)Completeness (%) 97.9 (97.0) 98.0 (97.8)I/�I 15.0 (2.1) 25.5 (3.0)Phasing method MR MR

Refinement and validationRwork/Rfree (%) 16.95/21.60 (24.8/27.2) 16.60/19.48 (22.6/24.5)AMP/GOL 3 Na, EDO, 4 GOL, 38 SO4 6 Ca, 1 ClSolvent molecules 1511 487Bond lengths (Å) 0.011 0.011Bond angles (deg) 1.35 1.38Ramachandran (%)

Most favored regions 88.1 87.3Additionally allowed regions 11.8 12.4Generously allowed regions 0.1 0.3Disallowed regions 0.0 0.0

PDB ID 3QFH 3T41

High-resolution shell statistics are shown in parentheses. Total number of residues in the proteinis 430 from residues 28–457. The 3QFH structure has 8 molecules in the asymmetric unit (chains A–H)and has 6 missing residues between the prodomain and protease domain for chain A, 5 for chain B, 9for chains C and G, and 4 for chains D, E, F, and H. The 3T41 structure has 2 molecules in theasymmetric unit, where 7 residues are missing from chain A and 10 from chain B at the C-terminal endof the protein.

1782 Vol. 28 April 2014 KUHN ET AL.The FASEB Journal � www.fasebj.org

EpiP cleavage mechanism

For the evaluation of the cleavage mechanism of EpiP(whether it was intra- or intermolecular), rEpiP-S393A wasincubated in 50 mM Tris buffer (pH 8) with rEpiP in an�0.25 M ratio of rEpiP to rEpiP-S393A in a final volume of 50�l. Samples were incubated at 37°C for 1, 4, and 24 h andwere analyzed by SDS-PAGE. The protein bands were visual-ized by Coomassie Brilliant Blue.

Mass spectrometry analyses

For intact mass measurement of rEpiP, protein was diluted in0.1% formic acid. The acidified protein solutions were loadedonto a Protein MicroTrap cartridge (from 60 to 100 pmol;Michrom Bioresources, Inc., Auburn, CA, USA), desalted for2 min with 0.1% formic acid at a flow rate of 200 ml/min, andeluted directly into the mass spectrometer using a stepgradient of acetonitrile (55% acetonitrile and 0.1% formicacid). Spectra were acquired in positive mode on a SynaptG2HDMS mass spectrometer (Waters Corp., Milford, MA, USA)equipped with a Z-spray electrospray ionization source. Thequadrupole profile was optimized to ensure the best trans-mission of all ions generated during the ionization process.

For peptide mass fingerprinting (PMF) of rEpiP, spots ofcolloidal Coomassie-stained rEpiP bands were excised fromthe SDS-PAGE gel using a Pasteur pipette and destainedovernight in 200 �l of 50% (v/v) acetonitrile and 50 mMammonium bicarbonate. The spots were then washed with200 �l of acetonitrile. The acetonitrile was discarded, and thespots were allowed to air dry. Modified trypsin (12 �g/ml) in5 mM ammonium bicarbonate was added to each spot, andthe enzymatic digestion was performed for 3 h at 37°C; 0.8 �lof the digestion was directly spotted on a prespotted anchorchip (PAC) target (PAC 96 set for proteomics; Bruker Dal-tonics, Bremen, Germany). The air-dried spots were washedwith 0.6 �l of a solution of 70% (v/v) ethanol and 0.1% (v/v)trifluoroacetic acid (TFA). Peptide mass spectra were re-corded with a matrix-assisted laser desorption ionization-timeof flight (MALDI-TOF) mass spectrometer (UltraFlex; BrukerDaltonics). Ions generated by laser desorption at 337 nm (N2laser) were recorded at an acceleration of 25 kV in thereflector mode. About 200 single spectra were accumulatedfor improving the signal/noise ratio and analyzed by FlexAnalysis 2.4 (Bruker Daltonics). External calibration wasperformed using standard peptides prespotted on the target.Peptide identification was performed using BioTools andSequence Editor 3.0 (Bruker Daltonics).

EpiP expression analysis in S. aureus

The expression of EpiP in S. aureus was evaluated in vitro, byWestern blot and real-time quantitative reverse transcriptionPCR (qRT-PCR). For Western blot analysis, equal amounts oftotal cell proteins from the �spa-Newman strain were sepa-rated on SDS-PAGE and transferred to nitrocellulose mem-branes. S. aureus �spa-Newman strain was grown overnight inTSB (supplemented with 10 �g/ml erythromycin) at 250 rpmat 37°C using aerated Erlenmeyer flasks. The culture wascentrifuged at 4000 rpm at 4°C for 15 min. Cell wall fractionswere prepared by resuspending pellets from 5-ml overnightcultures in 500 �l TSM buffer (50 mM Tris HCl, pH 7.5; 10mM MgCl2; and 0.5 M sucrose). Lysostaphin (50 �l, 5 �g/�lstock; Sigma-Aldrich, St. Louis, MO, USA) was added tosamples and incubated for 1 h at 37°C at 400 rpm in aThermomix (Vorwerk, Wuppertal, Germany). Samples werecentrifuged at 4000 rpm for 15 min at 4°C, and supernatantscontaining the cell wall fraction were used for Western blot

analysis using sera raised against EpiP. The supernatantprotein (extracellular) was prepared by concentrating 10 mlof overnight culture supernatant up to 100� using aVivapore 10/20 solvent absorption concentrator (7500-Dacutoff; Sigma-Aldrich).

To measure expression of the epiP gene, bacterial culturesat exponential and stationary phase were centrifuged at 4000rpm for 15 min at 4°C. Bacterial pellets were resuspended in200 �l TSM buffer and vigorously vortexed. A 10 �l aliquot oflysostaphin (5 �g/�l stock) was added to this suspension andincubated at 37°C for 15 min. After incubation, RNA extrac-tion was performed with the RNeasy Mini kit (Qiagen)according to the manufacturer’s instructions. RNA was quan-tified using a Bioanalyzer (Agilent, Santa Clara, CA, USA). Toremove eukaryotic RNA contamination and to enrich theproportion of bacterial RNA, a MicrobeEnrich kit (Ambion,Austin, TX, USA) was used according to the manufacturer’sinstructions. Total RNA (1 �g) was reversed transcribed with0.5 mM dNTP, 50 ng random hexamers, and 200 U ofSuperscript II reverse transcriptase (Invitrogen, Carlsbad, CA,USA), according to the manufacturer’s recommendations.RNA was denatured and the cDNAs were purified with aQIAquick PCR purification kit (Qiagen). cDNA (1 �l)wasamplified by real-time qRT-PCR on the Stratagene MX3000P(Stratagene) with the SYBR GreenER qPCR universal kit(Invitrogen) and 10 �M of the rEpiP forward CATA-AAGCGCGCTATTATTAG and reverse CTTTATACACAT-CAAGCTCAC primers. Reaction mixtures were denatured for10 min at 94°C, followed by 40 cycles of 30 s at 60°C and 1 minat 72°C, and finished with a dissociation ramp from 55 to95°C. The level of expression of the epiP gene was calculatedby using the cycle threshold (Ct) of the overnight-grownbacteria as the calibrator. epiP expression was normalizedagainst 16s rRNA, for which expression was found to beconstant throughout the S. aureus growth phase.

Enzymatic assays

Samples for testing activity of EpiP toward casein or collagenwere prepared by addition of 1 mg of rEpiP protein to 200 �lof agarose-collagen or agarose-casein suspension (Sigma-Aldrich) that was washed with buffer (50 mM Tris-HCl, pH8.0, and 2 mM CaCl2) in a final volume of 1 ml. Samples wereincubated at 37°C with shaking at 125 rpm overnight andthen centrifuged for 3 min at 13,000 rpm on a tabletopcentrifuge to pellet the unreacted immobilized substrate. Thepellet was washed with 1 ml of buffer and centrifuged again toobtain any additional proteolytic fragments, and 15-�l ali-quots of the supernatant of each sample were used forSDS-PAGE.

Proteolytic activity of the rEpiP protein was tested againstazocoll (dye-impregnated collagen; Sigma-Aldrich) using amodified procedure (51). To begin, 0.25 g of azocoll waswashed twice in 50 ml buffer (50 mM Tris HCl, pH 7.8, and 1mM CaCl2) in a 100-ml beaker and stirred rapidly for 2 h. Theazocoll was filtered using Whatman no. 3 filter paper (What-man, Maidstone, UK) and was resuspended in fresh bufferimmediately before using in the assay. The suspended azocollwas dispensed as 1-ml aliquots into glass test tubes using a5-ml syringe; 0.04 mg of enzyme was added to each reaction,and the tubes were incubated at 37°C with shaking for 24 h.Approximately 4 mg of azocoll was in each 1-ml reaction.After the reaction, samples were centrifuged, the supernatantwas removed, and the absorbance at A550nm was measuredusing a Bio-Tek ELx808 microplate reader equipped withfilters (Bio-Tek Instruments, Inc., Winooski, VT, USA). Thenegative control for the reaction included the azocoll suspen-sion without EpiP enzyme, and the positive control wassubtilisin from Bacillus licheniformis (85968; Sigma-Aldrich).

1783STAPHYLOCOCCUS AUREUS AUTOCLEAVING PROTEASE EpiP

The reactions were performed in triplicate. A unit is definedas the change in A550nm per hour per milliliter of reaction.

Ethics statement

Mice were monitored daily and euthanized at the appearanceof humane endpoints in accordance with the Novartis AnimalWelfare Policies and Italian law. Experimental protocols werereviewed and approved by the Italian National Institute ofHealth, Istituto Superiore di Sanita (ISS), protocol 136/2010-B, for mouse studies.

Immunogenicity assay

EpiP antibody titers present in sera of immunized mice weremeasured by Luminex technology (Luminex 200; LuminexCorp., Austin, TX, USA). The protein was covalently conju-gated to the free carboxyl groups of microspheres usingan N-hydroxysulfosuccinimide-enhanced carbodiimide-medi-ated conjugation chemistry. Antigen-specific antibodies wererevealed by phycoerythrin-labeled secondary antibodies. Theassay readout is a measure of fluorescence intensity expressedas arbitrary relative luminex units (RLU) per milliliter.

Peritonitis model

Immunized animals were challenged on d 24 by intraperito-neal injection of a lethal dose of S. aureus. Mice weremonitored daily for 7 d. TSB cultures of S. aureus werecentrifuged, washed twice, and diluted in PBS before chal-lenge. Further dilutions were needed for the desired inocu-lum, which was experimentally verified by agar plating andcolony counting. Mice were infected with �5 � 108 colony-forming units of the S. aureus Newman strain.

Statistical analysis

Two independent experiments, run under the same con-ditions, were performed to assess protective efficacy ofEpiP in the peritonitis model. Experiments were analyzedusing Fisher’s exact test.

RESULTS

In silico analysis predicted EpiP to be surface locatedand identified a signature of protection

The reverse vaccinology approach was applied to the S.aureus NCTC8325 genome, and several bioinformaticalgorithms were used to select surface-associated andsecreted proteins as described elsewhere (52–54).Among the selected antigens, we focused on the se-quence SAOUHSC_01949, annotated as EpiP. EpiP waspredicted to have an extracellular localization due tothe presence of a leader peptide and the lack of otherknown signals for membrane or cell wall anchoring.EpiP also showed a peptidase_S8 domain organizedwith the catalytic triad Asp, His, and Ser, which is typicalfor the widespread subtilisin-like family of serine pro-teases (ref. 55 and Fig. 1). The analysis of the 177completely annotated S. aureus genomes availablethrough the UniProt Knowledgebase (release 2013_02)revealed that epiP is a dispensable gene, and it is either

well conserved (present in 49 strains with �90% iden-tity) or absent (Supplemental Tables S1 and S2). Theanalysis of the genomic organization showed that epiP isa part of an 8-gene operon (epiABCDPFEG), similar tothe one previously reported for the lantibiotic genes inS. epidermidis (56). Figure 2A reports the epi operonregion view in a representative subset of S. aureusstrains, showing that when epiP is present, the entireoperon organization is also conserved. Among strainswhere epiP was absent, we wanted to investigate whetherthe epi operon was also absent. To this aim, we selectedstrains for which a complete genome set is available, i.e.,with high-quality reviewed annotation. We found thatin most strains (9 of 13) the epi operon was completelyabsent. On the other hand, the remaining 4 strains

Figure 1. EpiP organization and its corresponding 3-dimen-sional structure. Layout of the EpiP protein, including theleader peptide, prodomain, cleavage site, and proteasedomain, is shown. The catalytic triad includes residuesD140, H187, and S393, and the peptidase_S8_lantibiotic-specific protease domain includes residues 133– 426. Toobtain soluble protein, the leader peptide (residues 1–27)was removed and replaced by a polyhistidine tag. Thecleavage site between the prodomain and protease domainis depicted on the bar beneath the structure, and is alsoindicated on the structure with arrows. Residues SEKT arenot always included in the electron density of each chain ofthe rEpiP crystal structure. The coloration of the barrepresenting the primary sequence is equivalent to thecoloration seen in the structure. There is no cell wallanchoring domain predicted in the sequence.

1784 Vol. 28 April 2014 KUHN ET AL.The FASEB Journal � www.fasebj.org

showed a truncated epiG gene in the corresponding epiregion (Fig. 2B).

Bacterial peptidase_S8 proteins have been shown toplay important roles during pathogenesis by cleavingneutrophil chemoattractant factors such as IL-8 andC5a, thus impairing the recruitment of neutrophils atthe site of infection (37, 38, 57). In addition, membersof this family have been identified as protective anti-gens and proposed as vaccine candidates. These in-clude the Streptococcus agalactiae C5a peptidases, the S.pyogenes SpyCEP, the Streptococcus pneumoniae PrtA, andthe Neisseria meningitidis NMB1969 (AspA) (30, 38,57–59). Therefore, we hypothesized that the pepti-dase_S8 domain may represent a signature of protec-tion and that EpiP could be a protective antigen againstS. aureus infection. Hence, we performed a more thor-ough investigation into structural, functional, and im-munogenic properties of this protein.

Structure of EpiP

Subtilisin-like serine proteases typically cleave them-selves into 2 domains: an N-terminal prodomain and aC-terminal protease domain, which contains catalyticresidues that are used to cleave specific substrates. We

have determined the 3-dimensional structure of the rEpiPfrom S. aureus in its cleaved form with the prodomainnoncovalently interacting with the protease domain(Figs. 1 and 3). The prodomain is composed of 4 �strands flanked by 2 helices, and the protease domainhas a fold that is characteristic of a subtilisin-likeprotease. The electrostatic surface interactions betweenthese 2 domains are tight and complementary (Fig. 4),and attempts to clone these domains individually or tochromatographically separate them when they wereproduced from the full-length construct were unsuc-cessful. There are 8 molecules in the asymmetric unitfor this structure, and all of the molecules are cleavedsomewhere between residues 95 and 100 (TSEKTI; Fig.1). The electron density surrounding this cleavage siteis only present for residues CSTCxxxxxTI in chain A,CSTCIxxxxTI in chain B, CxxxxxxxxxI in chains C andG, and CSTCITxxxxI in chains D–F and H, where xindicates lack of density for that particular residue. Dueto the lack of and inconsistent electron density forresidues in this region, it is not obvious what thecleavage specificity is from the structure alone.

We were curious whether EpiP cleaved itself into the2 separate domains or whether there was anotherprotein involved in processing the prodomain, so we

Figure 2. Schematic representation of the genomic organization of the epi region in S. aureus strains. A) S. aureus strains whereepiP is present. B) Corresponding region in strains carrying a truncated epiG gene. Open reading frames are represented asarrows showing the direction of transcription, with the size reflecting the relative length of the genes and the different colorsreflecting the gene family.

1785STAPHYLOCOCCUS AUREUS AUTOCLEAVING PROTEASE EpiP

mutated the conserved serine residue at position 393 toalanine (S393A) and determined the structure of themutant protein. rEpiP-S393A crystallized in a differentspace group than rEpiP, and it contained 2 moleculesin the asymmetric unit compared with 8 (Table 1). Thestructure of rEpiP-S393A showed that the protein re-mained fully intact, which indicates that this serineresidue is indeed involved in the self-cleavage mecha-nism for EpiP. In the rEpiP structure, the polypeptidechain that links the prodomain and protease domainacts like a rubber band and snaps once it is cleaved toexpose the active site of the protease domain (Fig. 5).In the rEpiP-S393A mutant structure, however, thispolypeptide chain hovers above the active site and doesnot interact with it directly (Figs. 5 and 6). Bothmolecules in the asymmetric unit of rEpiP-S393A havedisordered regions of this polypeptide chain, whichinclude 102–106 for one molecule and 100–106 foranother molecule (Table 1).

In rEpiP, the active site contains the C terminusof a neighboring molecule of the asymmetric unit(Fig. 6). The placement of this polypeptide chain in the

active site is in the reverse direction of what would beexpected for an actual substrate. This is because theC-terminal carboxyl group of S457 on the chain of theneighboring molecule does not mimic the properconformation of this group (see structural comparisonof rEpiP with 2TEC in Fig. 6). However, the active siteof EpiP has a high affinity for a carboxyl group becauseit pulls the C-terminal tail of a neighboring moleculeinto its active site. The S393 residue of the catalytic triadof rEpiP interacts with the O side chain and an oxygenatom of the terminal carboxyl group of residue S457from a neighboring molecule. Other active site inter-actions with the neighboring molecule include N290with an oxygen atom of the terminal carboxyl group ofS457 in a different manner than the S393 interactionsand the carbonyl group of A390 with the nitrogen atomof S457. The catalytic H187 residue of rEpiP has onenitrogen atom that interacts with O of S393 andanother nitrogen that interacts with the oxygen atomsof the catalytic D140 residue (Fig. 6). rEpiP-S393A doesnot generate this type of interaction between neighbor-

Figure 3. Active site comparison of WT andS393A mutant EpiP. Ball-and-stick models ofthe catalytic triad (D140, H187, and S393) andselected residues from the active site are pre-sented. To indicate the high quality of therefinement and the final models, Fo-Fc omitmaps (green) contoured at the 3� level for theWT (A) and mutant (B) proteins are shown. Inthe active site of the WT protein, S457 of the Cterminus of a neighboring WT protein mole-cule is bound in the active site. In the mutantprotein, a water molecule resides in the samelocation as one of the oxygen atoms of theC-terminal carboxyl group of S457. Hydrogenbonds are shown by black dashes, nitrogenatoms are shown in blue, oxygen atoms in red,carbon atoms in yellow, and water in cyan.

Figure 4. Complementary electrostatic charge interactions ofthe surfaces of the prodomain and protease domain in rEpiPprotein. A) Prodomain as an electrostatic surface and theprotease domain as a ribbon diagram. B) Prodomain asribbon diagram and protease domain is an electrostaticsurface. Arrows indicate corresponding interactions of the 2domains in each panel. Electrostatic surfaces are shown in redfor negative charge, blue for positive charge, and white forneutral charge.

Figure 5. Surface representations of the rEpiP and rEpiP-S393A proteins. A, B) WT protein. C, D) S393A mutant. A,C) Side view of the protein. B, D) Top view of the protein.Coloration of the surface diagrams is the same as in Fig. 1.Polypeptide chain that links the prodomain and proteasedomains is shown in light blue.

1786 Vol. 28 April 2014 KUHN ET AL.The FASEB Journal � www.fasebj.org

ing molecules of the asymmetric unit. In fact, theC-terminal end of the molecule is disordered, and thelast residue with electron density is either A452 orQ454.

The prodomain of rEpiP contains 2 cysteine residues(C90 and C93) that reside directly upstream of thepolypeptide cleavage site between the 2 domains of theprotein. In the rEpiP structure, the presence of adisulfide bond between C90 and C93 of the prodomainvaries among chains in the asymmetric unit. In chains Eand F a disulfide bond exists between these 2 residuesbut is absent in chains A, B, D, G, and H. Althoughchain H does not have a disulfide bond, these 2 cysteineresidues face each other and their electron density isconnected. There is no electron density for residue C90in chain C, and thus lacks a disulfide bond. In therEpiP-S393A, however, these 2 cysteine residues formdisulfide bonds and are present in both chains of theasymmetric unit. It is not clear what the role of thesecysteine residues is in EpiP, but they are only conservedin the lantibiotic protease from S. epidermidis and S.aureus.

Cleavage mechanism of the polypeptide extensionbetween the prodomain and protease domain of EpiP

EpiP deprived of its putative leader sequence (aa 1–27)was expressed in, and purified from, Escherichia coli-soluble extracts. rEpiP appeared as 3 bands migratingwith apparent molecular weights of � 50, 39, and 8 kDaby SDS-PAGE (Fig. 7A). PMF of the 3 bands separatedby SDS-PAGE identified peptides specific for the 3fragments (Fig. 7B). More specifically, peptides cover-ing both the N and C terminus of the protein wereidentified in the upper 50-kDa band, while coverage ofthe 39-kDa fragment spanned amino acids startingfrom threonine 88 to the end of the C terminus, and inthe 8-kDa fragment, identified peptides mapping in thefirst 74 aa residues of rEpiP.

The theoretical mass of rEpiP is 49744.27 Da (aa1–446), but by intact mass spectrometry we observed anexperimental mass of 39694.48 Da (aa 88–446; 30 ppmtolerance; Fig. 7C) for the most abundant species in thesample starting with amino acid threonine at position88. This observation fits well with the pattern obtainedby SDS-PAGE in which the first peptide identified byPMF in the band migrating at 39 kDa begins withthreonine 88. Altogether, these data indicate that rEpiPis composed of 3 polypeptides resulting from thecleavage of the protein between amino acids lysine 87and threonine 88, corresponding to residues 98 and 99of the WT protein.

We next investigated whether cleavage of EpiP couldbe due to autoproteolysis, as reported for other extra-cellular bacterial proteases (58). To address this point,we generated a rEpiP protein in which the serine atposition 393 of the predicted catalytic triad was substi-tuted with alanine (rEpiP-S393A). The purified mutantprotein was then subjected to SDS-PAGE analysis toinvestigate whether the mutation impaired the cleavagepattern observed with rEpiP. As shown in Fig. 8, therEpiP-S393A appeared as a single band with an electro-phoretic mobility comparable to that of the noncleavedprotein band of rEpiP.

The combination of SDS-PAGE analysis and the 3Dstructure of the rEpiP-S393A mutant shows that thefull-length protein remains intact in the absence of thisserine residue. To understand whether the cleavage ofEpiP occurs through an inter- or an intramolecularmechanism, we tested whether rEpiP could cleave theprodomain of rEpiP-S393A. rEpiP and rEpiP-S393Awere mixed in a 0.25 M ratio, incubated for varyinglengths of time, and then analyzed using SDS-PAGE.During this experiment, we observed no increase inintensity of the protease domain of the protein bySDS-PAGE (Fig. 8), indicating that rEpiP does notcleave rEpiP-S393A. We also tested the effect of varying

Figure 6. Comparison of active sites of rEpiP and rEpiP-S393A proteins with a thermitase-eglin-c complex. A) Overlay of rEpiPand a thermitase-eglin-c complex (PDB ID: 2TEC). B) Overlay of the rEpiP-S393A and thermitase-eglin-c complex. rEpiP isshown in blue, rEpiP-S393A in green, and the thermitase-eglin-c complex in pink. The C terminus of a neighboring moleculein the rEpiP active site is shown in cyan. C) Ball-and-stick representation of the superposition of the active sites of thethermitase-eglin-c complex and rEpiP. Nitrogen atoms are shown in blue, oxygen atoms in red, carbon atoms for the thermitasein yellow and for rEpiP (chain A) in cyan, the thermitase-eglin-c complex in green, and the C-terminal portion of chain H ofrEpiP in gray. Despite the fact that peptide chains for thermitase-eglin-c complex and rEpiP chain H run in the oppositedirection, carbonyl oxygen atoms are pointed in the same direction. The position of one of the C-terminal oxygens of rEpiPchain H matches the position of the carbonyl oxygen of the thermitase-eglin-c complex, which is bound in the oxyanion hole.There are almost no differences in the active sites of rEpiP and rEpiP-S393A, so the mutant is not shown here. In the crystalstructure of rEpiP, the active site of the protein contains the C terminus of a neighboring molecule as follows: in the active siteof A–H is the C terminus of chains H, D, F, G, B, A, E, and C, respectively.

1787STAPHYLOCOCCUS AUREUS AUTOCLEAVING PROTEASE EpiP

concentrations of rEpiP in the presence of constantconcentrations of rEpiP-S393A for up to 24 h and didnot observe a decrease in the intensity of the full-length(mutant) band (data not shown). Given that rEpiP didnot cleave rEpiP-S393A during extended periods oftime or increased concentrations of rEpiP, these datasuggest that the cleavage event of EpiP occurs throughan intramolecular autocatalytic mechanism.

Enzymatic activity of the recombinant EpiP

Although EpiP is annotated as being responsible forproteolytically processing mature epidermin in S. epi-dermidis, this lantibiotic is not produced in S. aureus(14). Thus, it is not clear what the function of thisprotease is in S. aureus. To investigate a potentialfunctional role of this protein that is alternative toepidermin cleavage, we subjected rEpiP to in vitroproteolytic assays. The S1 pocket of EpiP is relativelyshallow and hydrophobic and resembles that of anelastase-like serine protease. Based on this information,we tailored the enzymatic assays to investigate whether

the enzyme had activity toward an elastase-like proteasesubstrate in addition to its own intramolecular cleavage.

We determined that the rEpiP protein was able tocleave both casein and collagen, indicating that theenzyme is capable of proteolytically processing sub-strates other than itself. First, we tested EpiP activitytoward casein or collagen that was immobilized ontoagarose beads and visualized the cleavage products viaSDS-PAGE. Some of the proteolytic fragments of caseinwere large enough to be seen on the gel, but collagenwas not (data not shown). At this point, it was not clearwhether collagen was being proteolyzed into smallerfragments than what we could visualize on SDS-PAGE,or whether it was not a substrate. To address thisquestion, we used a colorimetric assay to determinewhether EpiP could cleave azocoll, a dye-impregnatedcollagen, with subtilisin from B. licheniformis as a posi-tive control. Compared with subtilisin, the activity ofthe rEpiP enzyme toward azocoll was 2.4-fold lower(0.31 compared with 0.73 U/mg); however, it was ofthe same order of magnitude as subtilisin. The subtili-sin enzyme began cleaving the collagen more quickly

Figure 7. Recombinant EpiP is composed of 3 polypeptide fragments. Analysis of recombinant EpiP purified from E. coli extractsthrough SDS-PAGE, and mass spectrometry. A) In SDS-PAGE stained with Coomassie, the proteins migrated with 3 species(bands 1–3). Molecular mass of the bands from top to bottom is comparable with the size of the mature protein ( 50 kDa), theprotease domain ( 39 kDa), and the prodomain ( 8 kDa), respectively. B) Peptides identified by PMF in bands i–iii in panelA are indicated on the sequence of rEpiP: red indicates peptides identified in band i, green indicates peptides from band ii, andblue indicates peptides from band iii. C) Experimental mass observed by intact mass measurement of the rEpiP fits with bandii in panel A. Sequence starts with threonine 88 of rEpiP, indicating that the cleavage site of the protein occurred between lysine87 and threonine 88, corresponding to residues 98 and 99, respectively, of EpiP. Asterisk indicates loss of H2O.

1788 Vol. 28 April 2014 KUHN ET AL.The FASEB Journal � www.fasebj.org

than EpiP, so the activity reported for subtilisin after 24h may be artificially lower than expected. It is not clearwhether the decrease in activity of rEpiP compared withsubtilisin is due to the presence of the prodomain ofrEpiP or whether the enzyme is just less active thansubtilisin. Based on the structure of the rEpiP, it is likelythat this prodomain does not need to be removed forcatalysis to occur. One reason is that once the polypeptidechain that links the prodomain and protease domains iscleaved, the structure becomes more open and exposesthe active site. Another reason is that we were not able toseparate the 2 domains of the protein; therefore EpiP isconstantly in the presence of its prodomain. Since theenzyme is active, the presence of its prodomain does notseem to be inhibitory for EpiP compared with other typesof subtilisin-like proteases that must have their prodo-mains removed before they become active.

A comparison of the sequences of EpiP from S.epidermidis and S. aureus within 4 Å of the conservedcatalytic triad residues indicates that 72% are identicaland the remaining residues have similar characteristics,with the exception of K185 and G186 of S. aureus (L192and N193 for S. epidermidis, respectively). Based on thehigh sequence identity and similarity of the residues inthe active sites of EpiP from S. aureus and S. epidermidis,we cannot rule out the possibility that EpiP from S.aureus may indeed cleave epidermin produced by S.epidermidis. However, further experiments will be nec-essary to confirm this hypothesis.

EpiP is expressed and processed in S. aureus cells

To assess the expression of the epiP gene, real-timeqRT-PCR was performed on RNA isolated from bacteriagrown in TSB, which is the same medium used toprepare challenge inocula for infection experiments inthe animal model. Under these conditions, the genewas found to be expressed and increased gene expres-sion was observed in exponential compared with sta-tionary growth phase (Supplemental Fig. S1). More-over, we also looked for the epiP gene expression indifferent S. aureus strains (i.e., Newman, LAC, andMu50) by qRT-PCR with RNA isolated from bacteriagrown to exponential phase in TSB. Under the condi-tion tested, the epiP gene was expressed in Newman andLAC strains but not in Mu50. Furthermore, LACshowed �2-fold increased gene expression as com-pared with Newman (Fig. 9A).

The S. aureus EpiP lacks a known localization signal(Fig. 1), and it may either be released in the extracel-lular milieu or be anchored to the cell wall through anunknown mechanism, as reported for EpiP of S. epider-midis (6, 8, 60, 61). To experimentally verify its local-

Figure 9. EpiP expression and processing in S. aureus. A) epiPgene was expressed in the Newman and LAC strains, whereasno expression was detected in the Mu50 strain, as expected.Furthermore, LAC showed �2 fold increased gene expres-sion as compared with the Newman strain. B) Analysis ofculture supernatant, cell wall fraction and protoplast of S.aureus strain Newman by Western blot using an EpiP mouseantiserum. The 3 polypeptides (noncleaved, protease do-main, and prodomain) of the purified recombinant proteinwere recognized by the serum; however, the predominantbands that were recognized by the serum had a molecularmass compatible with the full-length protein and that of theprodomain of EpiP. In the supernatant preparation, a faintband with a molecular mass congruous with the noncleavedprotein was visible as well an immunoreactive band with a sizesimilar to the prodomain. An additional band was visiblewhich does not correspond to any of the 3 polypeptides ofEpiP. No immunoreactivity was detected in the lane wherethe cell wall preparation was loaded. A major immunoreactiveband was present in the protoplast preparation comparableto the molecular mass of the noncleaved protein. Otherminor protein species were also detected that appearedsimilar to the ones observed in the lower molecular massrange of the culture supernatant preparation.

Figure 8. EpiP cleavage is dependent on serine residue 393 andoccurs through an autocatalytic intramolecular mechanism.Analysis of the autoproteolytic activity of the recombinant puri-fied EpiP and its mutant derivative by a time course coincuba-tion of the 2 proteins in a 0.25 M ratio. The 2 recombinantproteins (rEpiP and rEpiP-S393A) were used as molecular masscontrols (lanes 1 and 2). No decrease in the intensity of thenoncleaved EpiP-S393A was observed throughout the 24 hincubation time, which indicates that EpiP uses an intramolec-ular autocleavage to remove the prodomain.

1789STAPHYLOCOCCUS AUREUS AUTOCLEAVING PROTEASE EpiP

ization, we isolated the cell wall fraction and the culturesupernatant, as well as protoplasts of S. aureus cells, andanalyzed them by immunoblot using an EpiP mouseantiserum. For this experiment, we decided to use theS. aureus strain Newman deficient for SpA (SEJ2; ref.62). This strain was selected to reduce the nonspecificstaining in Western blot analyses due to the binding ofIgGs mediated by SpA (62, 63). The anti-EpiP serumidentified several immunoreactive bands, includingone at �50 kDa and another at 8 kDa. These bandsappear to have molecular mass comparable to thenoncleaved EpiP and the prodomain, respectively. Fur-thermore, this indicates that the serum mainly detectsthe prodomain of EpiP (Fig. 9B). Lack of detection ofthe protease domain (the 39-kDa band in Fig. 9B) maybe due to poor recognition by the serum that we haveused in the immunoblot. Indeed, with the purifiedrecombinant protein, the protease domain also appearsas a faint band as compared with the noncleavedprotein and the prodomain. At this point, the identityof the 17-kDa immunoreactive band is not clear. Noimmunoreactive bands were detected in the cell wallfraction, suggesting that the protein was mainly re-leased into the extracellular milieu. Interestingly, dif-ferent patterns were observed in the supernatant andprotoplast preparations. In particular, a band migratingat a molecular mass comparable to that of the non-cleaved form was more abundant in the cytoplasm,while the prodomain appeared more prevalent in thesupernatant. This suggests that the protein was pro-duced in its noncleaved form and then was processedduring or after its release into the extracellular milieu.

EpiP vaccination protects mice against lethal S. aureusinfection

Given that EpiP appears to be secreted, it might beexposed to the immune system during infection. There-fore, we asked whether EpiP immunization could con-fer protection against staphylococcal infection in amurine peritonitis model (64). Five-week-old CD1 micewere immunized intraperitoneally with a prime boosterinjection of 20 �g purified recombinant EpiP adsorbedto aluminum hydroxide adjuvant (alum; 2 mg/ml) witha 14 d interval. Control mice received equal amounts ofPBS and alum adjuvant. Animals were bled immediatelybefore the first immunization and 23 d thereafter, andsera were examined for IgG antibodies directed againstrEpiP. Vaccination generated significant IgG titersagainst the protein (geometric mean � se[scap]m:1319�644). Mice were challenged intraperitoneally ond 24 with a lethal injection of a bacterial suspension ofS. aureus Newman. After the challenge, survival wasmonitored for 7 d. EpiP vaccination significantly pro-tected mice from the lethal challenge (2 independentexperiments for a total of 32 mice/group), with greatersurvival rate at d 7 after challenge as compared with thecontrol group (Table 2).

At this point, we asked whether the noncleavingrEpiP-S393A was as efficacious as the rEpiP in eliciting

protection against S. aureus infection. Protective effi-cacy of the 2 proteins was compared in the peritonitismodel against lethal challenge with strain Newman. Nosignificant difference was observed between the groupsof mice immunized with the 2 proteins (Table 2).

DISCUSSION

Based on bioinformatics antigen prediction (reversevaccinology) and sequence homology, we identified theS. aureus EpiP as a novel vaccine candidate.

Like other extracellular bacterial proteases, EpiP hasan N-terminal leader peptide involved in translocationacross the cell membrane; however, it does not containa known cell wall anchoring motif. Indeed, our dataindicate that the protein is released into the extracel-lular milieu. Furthermore, we found that the recombi-nant purified protein undergoes an autocatalytic intra-molecular cleavage, which separates an N-terminalpropeptide from the rest of the molecule. The proteinexpressed by staphylococcal cells appears to be similarlyprocessed. Most likely the autocatalytic intramolecularcleavage occurs after protein translocation beyond thecell membrane. Indeed, while most of the EpiP in theprotoplast preparation is present with a molecularweight compatible with the full-length protein in theextracellular fraction the most abundant reactive bandappears to be the propeptide. The biological meaningof these observations requires further investigation.

It is puzzling as to why S. aureus retains EpiP, since itdoes not produce epidermin and lacks several of thegenes for lantibiotic production. Daly et al. (13) deter-mined that retention of lantibiotic immunity genes in S.aureus was not sufficient to protect it from the bacteri-cidal effects of other lantibiotics, as previously hypoth-esized. Additional studies have shown that S. aureus alsodoes not produce a bacteriocin (bsa) but rather aphenol-soluble modulin (PSM) with the same molecu-lar weight as the previously identified bsa (13, 14). Inaddition to its intramolecular cleavage between resi-dues Lys98 and Thr99 to remove its prodomain, wefound that rEpiP is capable of cleaving both collagenand casein and may have an alternative functional role.

TABLE 2. Protective efficacy of EpiP vaccination in theperitonitis model

TreatmentSurvived/total

animals % PE P

Alum 2/32 6 – –EpiP 11/32 34 30 0.0054EpiP-S393A 10/31 32 28 0.0093

A lethal dose of S. aureus Newman strain was used to challengeCD1 mice (n�32/group, 2 separate experiments), and survival rateswere followed for 1 wk. Mice were vaccinated intraperitoneally andchallenged with the S. aureus strain Newman. Statistical analysis wasperformed by 1-tailed Fisher’s exact test; comparisons are vs. alumtreatment. Protective efficacy (PE) � 1 � (DV/DC), where DV is deadvaccinated (%), and DC is dead control (%).

1790 Vol. 28 April 2014 KUHN ET AL.The FASEB Journal � www.fasebj.org

The site of autoproteolysis does not necessarily repre-sent the preferred cleavage specificity or the sites ofcleavage in collagen because it is potentially a localconcentration effect. Thus, a more thorough analysis ofits proteolytic activity will be necessary to elucidate its invivo function in S. aureus.

EpiP from S. aureus is structurally similar to othersubtilisin-like serine proteases, including several thatare involved in a variety of bacterial infections. Some ofthe structures in PDB that are similar include one fromBacillus lentus (PDB ID: 1GCI; ref. 65), Tk-subtilisinfrom Thermosococcus kodakaensis (PDB ID: 3AFG, 2Z2Z;ref. 66, 67), the A subunit of AB5 toxin in E. coli (PDBID: 2IY9; ref. 68), the cytobactin from Cyanothece PCC7425 (PDB ID: 3ZXY; ref. 69), AprV2 (PDB ID: 3LPC;ref. 70), and PCSK9 (PDB ID: 2W2N, 2QTW, 2P4E;refs. 71–73). The inability to separate the domains isnot unique, and the structures of other prodomains arequite similar to the prodomain of EpiP. Other exam-ples of proteases that retain interactions with theirprodomain have been described in the literature (66,67, 72, 74, 75), although the way in which the 2domains interact can vary (e.g., be inhibitory or havecomplementary charge interactions). The structure ofEpiP is unique because it is the first structure of alantibiotic peptide processing protease.

As predicted, mice vaccinated with EpiP were pro-tected from staphylococcal lethal infection. However,our analysis shows that epiP is not fully conserved;therefore, in order to develop a broadly protectivevaccine, EpiP must be combined with other antigens.Given that the protein was released extracellularly,protection might be associated with EpiP antibodiesblocking the function of the protein. This advocates infavor of a role of EpiP in invasive infection, as has beenshown for some of its homologs. The function of the S.pyogenes homologue SpyCEP in impairing the recruit-ment of neutrophils at the site of infection (38, 39) isparticularly intriguing in this regard. Given the promi-nent role of neutrophils against S. aureus infections, weare now investigating whether EpiP has a similar func-tion.

Protective efficacy of rEpiP and rEpiP-S393A wasfound to be comparable. In addition, a comparison ofthe crystal structure of rEpiP and rEpiP-S393A showsthat the mutation does not alter the protein conforma-tion, thus providing an explanation for the protectiveequivalence of the 2 proteins. The mutant rEpiP-S393Amay be better suited for vaccine development, becauseit consists of a single polypeptide, while the WT maypresent some issues, particularly in terms of productcharacterization. Therefore, these observations high-light the importance of structural biology in antigendesign.

The authors thank Dr. Elisabetta Sabini for her tirelessefforts and organization to enable a productive collaborationbetween our groups. Use of the Advanced Photon Source, anOffice of Science User Facility operated for the U.S. Depart-ment of Energy (DOE) Office of Science by Argonne Na-tional Laboratory (Argonne, IL, USA), was supported by the

U.S. DOE under contract DE-AC02-06CH11357. Use of theLS-CAT Sector 21 was supported by the Michigan EconomicDevelopment Corporation and Michigan Technology Tri-Corridor (grant 085P100817). This project has been fundedin whole or in part with federal funds from the U.S. NationalInstitute of Allergy and Infectious Diseases, U.S. NationalInstitutes of Health, U.S. Department of Health and HumanServices, under contracts HHSN272200700058C andHHSN272201200026C. The authors are grateful to Dr. Ravi P.N Mishra, Dr. Luigi Fiaschi, and Dr. Fabiana Falugi for theircontribution in antigen identification and cloning and RNAextraction and real-time PCR experiments.

REFERENCES

1. Arnison, P. G., Bibb, M. J., Bierbaum, G., Bowers, A. A., Bugni,T. S., Bulaj, G., Camarero, J. A., Campopiano, D. J., Challis,G. L., Clardy, J., Cotter, P. D., Craik, D. J., Dawson, M.,Dittmann, E., Donadio, S., Dorrestein, P. C., Entian, K. D.,Fischbach, M. A., Garavelli, J. S., Goransson, U., Gruber, C. W.,Haft, D. H., Hemscheidt, T. K., Hertweck, C., Hill, C., Horswill,A. R., Jaspars, M., Kelly, W. L., Klinman, J. P., Kuipers, O. P.,Link, A. J., Liu, W., Marahiel, M. A., Mitchell, D. A., Moll, G. N.,Moore, B. S., Muller, R., Nair, S. K., Nes, I. F., Norris, G. E.,Olivera, B. M., Onaka, H., Patchett, M. L., Piel, J., Reaney, M. J.,Rebuffat, S., Ross, R. P., Sahl, H. G., Schmidt, E. W., Selsted,M. E., Severinov, K., Shen, B., Sivonen, K., Smith, L., Stein, T.,Sussmuth, R. D., Tagg, J. R., Tang, G. L., Truman, A. W.,Vederas, J. C., Walsh, C. T., Walton, J. D., Wenzel, S. C., Willey,J. M., and van der Donk, W. A. (2013) Ribosomally synthesizedand post-translationally modified peptide natural products:overview and recommendations for a universal nomenclature.Nat. Prod. Rep. 30, 108–160

2. Schnell, N., Entian, K. D., Schneider, U., Gotz, F., Zahner, H.,Kellner, R., and Jung, G. (1988) Prepeptide sequence of epider-min, a ribosomally synthesized antibiotic with four sulphide-rings. Nature 333, 276–278

3. Willey, J. M., and van der Donk, W. A. (2007) Lantibiotics:peptides of diverse structure and function. Annu. Rev. Microbiol.61, 477–501

4. Cotter, P. D., Hill, C., and Ross, R. P. (2005) Bacteriocins:developing innate immunity for food. Nat. Rev. Microbiol. 3,777–788

5. Smith, L., and Hillman, J. (2008) Therapeutic potential of typeA (I) lantibiotics, a group of cationic peptide antibiotics. Curr.Opin. Microbiol. 11, 401–408

6. Schnell, N., Engelke, G., Augustin, J., Rosenstein, R., Unger-mann, V., Gotz, F., and Entian, K. D. (1992) Analysis of genesinvolved in the biosynthesis of lantibiotic epidermin. Eur. J.Biochem. 204, 57–68

7. Kuipers, O. P., Rollema, H. S., de Vos, W. M., and Siezen, R. J.(1993) Biosynthesis and secretion of a precursor of nisin Z byLactococcus lactis, directed by the leader peptide of the homol-ogous lantibiotic subtilin from Bacillus subtilis. FEBS Lett. 330,23–27

8. Augustin, J., Rosenstein, R., Wieland, B., Schneider, U., Schnell,N., Engelke, G., Entian, K. D., and Gotz, F. (1992) Geneticanalysis of epidermin biosynthetic genes and epidermin-nega-tive mutants of Staphylococcus epidermidis. Eur. J. Biochem. 204,1149–1154

9. Marsh, A. J., O’Sullivan, O., Ross, R. P., Cotter, P. D., and Hill,C. (2010) In silico analysis highlights the frequency and diversityof type 1 lantibiotic gene clusters in genome sequenced bacte-ria. BMC Genomics 11, 679

10. Siezen, R. J., Kuipers, O. P., and de Vos, W. M. (1996)Comparison of lantibiotic gene clusters and encoded proteins.Antonie van Leeuwenhoek 69, 171–184

11. Bierbaum, G., and Sahl, H. G. (2009) Lantibiotics: mode ofaction, biosynthesis and bioengineering. Curr. Pharm. Biotechnol.10, 2–18

12. Geissler, S., Gotz, F., and Kupke, T. (1996) Serine protease EpiPfrom Staphylococcus epidermidis catalyzes the processing of theepidermin precursor peptide. J. Bacteriol. 178, 284–288

1791STAPHYLOCOCCUS AUREUS AUTOCLEAVING PROTEASE EpiP

13. Daly, K. M., Upton, M., Sandiford, S. K., Draper, L. A.,Wescombe, P. A., Jack, R. W., O’Connor, P. M., Rossney, A.,Gotz, F., Hill, C., Cotter, P. D., Ross, R. P., and Tagg, J. R. (2010)Production of the Bsa lantibiotic by community-acquired Staph-ylococcus aureus strains. J. Bacteriol. 192, 1131–1142

14. Joo, H. S., Cheung, G. Y., and Otto, M. (2011) Antimicrobialactivity of community-associated methicillin-resistant Staphylococ-cus aureus is caused by phenol-soluble modulin derivatives. J.Biol. Chem. 286, 8933–8940

15. Otto, M., and Gotz, F. (2001) ABC transporters of staphylococci.Res. Microbiol. 152, 351–356

16. Moore, P. C., and Lindsay, J. A. (2001) Genetic variation amonghospital isolates of methicillin-sensitive Staphylococcus aureus:evidence for horizontal transfer of virulence genes. J. Clin.Microbiol. 39, 2760–2767

17. Highlander, S. K., Hulten, K. G., Qin, X., Jiang, H., Yerrapra-gada, S., Mason, E. O., Jr., Shang, Y., Williams, T. M., Fortunov,R. M., Liu, Y., Igboeli, O., Petrosino, J., Tirumalai, M., Uzman,A., Fox, G. E., Cardenas, A. M., Muzny, D. M., Hemphill, L.,Ding, Y., Dugan, S., Blyth, P. R., Buhay, C. J., Dinh, H. H.,Hawes, A. C., Holder, M., Kovar, C. L., Lee, S. L., Liu, W.,Nazareth, L. V., Wang, Q., Zhou, J., Kaplan, S. L., and Wein-stock, G. M. (2007) Subtle genetic changes enhance virulence ofmethicillin resistant and sensitive Staphylococcus aureus. BMCMicrobiol. 7, 99

18. Kies, S., Vuong, C., Hille, M., Peschel, A., Meyer, C., Gotz, F.,and Otto, M. (2003) Control of antimicrobial peptide synthesisby the agr quorum sensing system in Staphylococcus epidermidis:activity of the lantibiotic epidermin is regulated at the level ofprecursor peptide processing. Peptides 24, 329–338

19. Lowy, F. D. (1998) Staphylococcus aureus infections. N. Engl. J.Med. 339, 520–532

20. Smith, T. L., and Jarvis, W. R. (1999) Antimicrobial resistance inStaphylococcus aureus. Microbes Infect. 1, 795–805

21. Rybak, M. J., and Akins, R. L. (2001) Emergence of methicil-lin-resistant Staphylococcus aureus with intermediate glycopeptideresistance: clinical significance and treatment options. Drugs 61,1–7

22. Webb, G. F., Horn, M. A., D’Agata, E. M., Moellering, R. C., Jr.,and Ruan, S. (2010) Competition of hospital-acquired andcommunity-acquired methicillin-resistant Staphylococcus aureusstrains in hospitals. J. Biol. Dynamics 4, 115–129

23. Anonymous. (1989) Methicillin-resistant Staphylococcus aureus.N. Engl. J. Med. 321, 1342–1345

24. Yamamoto, T., Nishiyama, A., Takano, T., Yabe, S., Higuchi, W.,Razvina, O., and Shi, D. (2010) Community-acquired methicil-lin-resistant Staphylococcus aureus: community transmission,pathogenesis, and drug resistance. J. Infect. Chemo. 16, 225–254

25. Klevens, R. M., Morrison, M. A., Nadle, J., Petit, S., Gershman,K., Ray, S., Harrison, L. H., Lynfield, R., Dumyati, G., Townes,J. M., Craig, A. S., Zell, E. R., Fosheim, G. E., McDougal, L. K.,Carey, R. B., and Fridkin, S. K. (2007) Invasive methicillin-resistant Staphylococcus aureus infections in the United States.JAMA 298, 1763–1771

26. Maskalyk, J. (2002) Antimicrobial resistance takes anotherstep forward. CMAJ 167, 375

27. Shorr, A. F. (2007) Epidemiology and economic impact ofmeticillin-resistant Staphylococcus aureus: review and analysis ofthe literature. Pharmacoeconomics 25, 751–768

28. Kuklin, N. A., Clark, D. J., Secore, S., Cook, J., Cope, L. D.,McNeely, T., Noble, L., Brown, M. J., Zorman, J. K., Wang,X. M., Pancari, G., Fan, H., Isett, K., Burgess, B., Bryan, J.,Brownlow, M., George, H., Meinz, M., Liddell, M. E., Kelly, R.,Schultz, L., Montgomery, D., Onishi, J., Losada, M., Martin, M.,Ebert, T., Tan, C. Y., Schofield, T. L., Nagy, E., Meineke, A.,Joyce, J. G., Kurtz, M. B., Caulfield, M. J., Jansen, K. U.,McClements, W., and Anderson, A. S. (2006) A novel Staphylo-coccus aureus vaccine: iron surface determinant B induces rapidantibody responses in rhesus macaques and specific increasedsurvival in a murine S. aureus sepsis model. Infect. Immun. 74,2215–2223

29. Patti, J. M. (2011) Will we ever see the approval of a Staphylococ-cus aureus vaccine? Exp. Rev. Anti-infective Therap. 9, 845–846

30. Rodriguez-Ortega, M. J., Norais, N., Bensi, G., Liberatori, S.,Capo, S., Mora, M., Scarselli, M., Doro, F., Ferrari, G., Garaguso,I., Maggi, T., Neumann, A., Covre, A., Telford, J. L., and Grandi,G. (2006) Characterization and identification of vaccine candi-

date proteins through analysis of the group A Streptococcussurface proteome. Nat. Biotechnol. 24, 191–197

31. Turner, C. E., Kurupati, P., Wiles, S., Edwards, R. J., andSriskandan, S. (2009) Impact of immunization against SpyCEPduring invasive disease with two streptococcal species: Streptococ-cus pyogenes and Streptococcus equi. Vaccine 27, 4923–4929

32. Cleary, P. P., Matsuka, Y. V., Huynh, T., Lam, H., and Olmsted,S. B. (2004) Immunization with C5a peptidase from eithergroup A or B streptococci enhances clearance of group Astreptococci from intranasally infected mice. Vaccine 22, 4332–4341

33. Cheng, Q., Debol, S., Lam, H., Eby, R., Edwards, L., Matsuka, Y.,Olmsted, S. B., and Cleary, P. P. (2002) Immunization with C5apeptidase or peptidase-type III polysaccharide conjugate vac-cines enhances clearance of group B streptococci from lungs ofinfected mice. Infect. Immun. 70, 6409–6415

34. Ji, Y., Carlson, B., Kondagunta, A., and Cleary, P. P. (1997)Intranasal immunization with C5a peptidase prevents nasopha-ryngeal colonization of mice by the group A Streptococcus. Infect.Immun. 65, 2080–2087

35. Santillan, D. A., Andracki, M. E., and Hunter, S. K. (2008)Protective immunization in mice against group B streptococciusing encapsulated C5a peptidase. Am. J. Obstetrics Gynecol. 198,114.e1–114.e6

36. Bethe, G., Nau, R., Wellmer, A., Hakenbeck, R., Reinert, R. R.,Heinz, H. P., and Zysk, G. (2001) The cell wall-associated serineprotease PrtA: a highly conserved virulence factor of Streptococcuspneumoniae. FEMS Microbiol. Lett. 205, 99–104

37. Edwards, R. J., Taylor, G. W., Ferguson, M., Murray, S., Rendell,N., Wrigley, A., Bai, Z., Boyle, J., Finney, S. J., Jones, A., Russell,H. H., Turner, C., Cohen, J., Faulkner, L., and Sriskandan, S.(2005) Specific C-terminal cleavage and inactivation of interleu-kin-8 by invasive disease isolates of Streptococcus pyogenes. J. Infect.Dis. 192, 783–790

38. Zinkernagel, A. S., Timmer, A. M., Pence, M. A., Locke, J. B.,Buchanan, J. T., Turner, C. E., Mishalian, I., Sriskandan, S.,Hanski, E., and Nizet, V. (2008) The IL-8 protease SpyCEP/ScpC of group A streptococcus promotes resistance to neutro-phil killing. Cell Host Microbe 4, 170–178

39. Hidalgo-Grass, C., Dan-Goor, M., Maly, A., Eran, Y., Kwinn,L. A., Nizet, V., Ravins, M., Jaffe, J., Peyser, A., Moses, A. E., andHanski, E. (2004) Effect of a bacterial pheromone peptide onhost chemokine degradation in group A streptococcal necrotis-ing soft-tissue infections. Lancet 363, 696–703

40. Andrews, T., and Sullivan, K. E. (2003) Infections in patientswith inherited defects in phagocytic function. Clin. Microbiol.Rev. 16, 597–621

41. Klock, H. E., and Lesley, S. A. (2009) The Polymerase Incom-plete Primer Extension (PIPE) method applied to high-throughput cloning and site-directed mutagenesis. Methods Mol.Biol. 498, 91–103

42. Millard, C. S., Stols, L., Quartey, P., Kim, Y., Dementieva, I., andDonnelly, M. I. (2003) A less laborious approach to the high-throughput production of recombinant proteins in Escherichiacoli using 2-liter plastic bottles. Protein Expr. Purif. 29, 311–320

43. Kuhn, M. L., Majorek, K. A., Minor, W., and Anderson, W. F.(2013) Broad-substrate screen as a tool to identify substrates forbacterial Gcn5-related N-acetyltransferases with unknown sub-strate specificity. Protein Sci. 22, 222–230

44. Minor, W., Cymborowski, M., Otwinowski, Z., and Chruszcz, M.(2006) HKL-3000: the integration of data reduction and struc-ture solution–from diffraction images to an initial model in min-utes. Acta Crystallogr. D Biol. Crystallogr. 62, 859–866

45. McCoy, A. J., Grosse-Kunstleve, R. W., Adams, P. D., Winn,M. D., Storoni, L. C., and Read, R. J. (2007) Phaser crystallo-graphic software. J. Appl. Crystallogr. 40, 658–674

46. Perrakis, A., Morris, R., and Lamzin, V. S. (1999) Automatedprotein model building combined with iterative structure re-finement. Nat. Struct. Biol. 6, 458–463

47. Murshudov, G. N., Vagin, A. A., and Dodson, E. J. (1997)Refinement of macromolecular structures by the maximum-likelihood method. Acta Crystallogr. D Biol. Crystallogr. 53, 240–255

48. Emsley, P., Lohkamp, B., Scott, W. G., and Cowtan, K. (2010)Features and development of Coot. Acta Crystallogr. D Biol.Crystallogr. 66, 486–501

1792 Vol. 28 April 2014 KUHN ET AL.The FASEB Journal � www.fasebj.org

49. Vaguine, A. A., Richelle, J., and Wodak, S. J. (1999) SFCHECK:a unified set of procedures for evaluating the quality of macro-molecular structure-factor data and their agreement with theatomic model. Acta Crystallogr. D Biol. Crystallogr. 55, 191–205

50. Chen, V. B., Arendall, W. B., 3rd, Headd, J. J., Keedy, D. A.,Immormino, R. M., Kapral, G. J., Murray, L. W., Richardson,J. S., and Richardson, D. C. (2010) MolProbity: all-atom struc-ture validation for macromolecular crystallography. Acta Crystal-logr. D Biol. Crystallogr. 66, 12–21

51. Chavira, R., Jr., Burnett, T. J., and Hageman, J. H. (1984)Assaying proteinases with azocoll. Anal. Biochem. 136, 446–450

52. Bagnoli, F., Baudner, B., Mishra, R. P., Bartolini, E., Fiaschi, L.,Mariotti, P., Nardi-Dei, V., Boucher, P., and Rappuoli, R. (2011)Designing the next generation of vaccines for global pub-lic health. OMICS 15, 545–566

53. Rappuoli, R. (2001) Reverse vaccinology, a genome-based ap-proach to vaccine development. Vaccine 19, 2688–2691

54. Palumbo, E., Fiaschi, L., Brunelli, B., Marchi, S., Savino, S., andPizza, M. (2012) Antigen identification starting from the ge-nome: a “reverse vaccinology” approach applied to MenB.Methods Mol. Biol. 799, 361–403

55. Rawlings, N. D., and Barrett, A. J. (1994) Families of ser-ine peptidases. Methods Enzymol. 244, 19–61

56. Ten Broeke-Smits, N. J., Pronk, T. E., Jongerius, I., Bruning, O.,Wittink, F. R., Breit, T. M., van Strijp, J. A., Fluit, A. C., and Boel,C. H. (2010) Operon structure of Staphylococcus aureus. NucleicAcids Res. 38, 3263–3274

57. Hidalgo-Grass, C., Mishalian, I., Dan-Goor, M., Belotserkovsky,I., Eran, Y., Nizet, V., Peled, A., and Hanski, E. (2006) Astreptococcal protease that degrades CXC chemokines andimpairs bacterial clearance from infected tissues. EMBO J. 25,4628–4637

58. Zingaretti, C., Falugi, F., Nardi-Dei, V., Pietrocola, G., Mariani,M., Liberatori, S., Gallotta, M., Tontini, M., Tani, C., Speziale,P., Grandi, G., and Margarit, I. (2010) Streptococcus pyogenesSpyCEP: a chemokine-inactivating protease with unique struc-tural and biochemical features. FASEB J. 24, 2839–2848

59. Turner, D. P., Wooldridge, K. G., and Ala’Aldeen, D. A. (2002)Autotransported serine protease A of Neisseria meningitidis: animmunogenic, surface-exposed outer membrane, and se-creted protein. Infect. Immun. 70, 4447–4461

60. Van der Meer, J. R., Polman, J., Beerthuyzen, M. M., Siezen,R. J., Kuipers, O. P., and De Vos, W. M. (1993) Characterizationof the Lactococcus lactis nisin A operon genes nisP, encoding asubtilisin-like serine protease involved in precursor processing,and nisR, encoding a regulatory protein involved in nisin bio-synthesis. J. Bacteriol. 175, 2578–2588

61. Engelke, G., Gutowski-Eckel, Z., Kiesau, P., Siegers, K., Hammel-mann, M., and Entian, K. D. (1994) Regulation of nisin biosyn-thesis and immunity in Lactococcus lactis 6F3. Appl. Environ.Microbiol. 60, 814–825

62. Stranger-Jones, Y. K., Bae, T., and Schneewind, O. (2006)Vaccine assembly from surface proteins of Staphylococcus au-reus. Proc. Natl. Acad. Sci. U. S. A. 103, 16942–16947

63. Atkins, K. L., Burman, J. D., Chamberlain, E. S., Cooper, J. E.,Poutrel, B., Bagby, S., Jenkins, A. T., Feil, E. J., and van denElsen, J. M. (2008) S. aureus IgG-binding proteins SpA and Sbi:host specificity and mechanisms of immune complex formation.Mol. Immunol. 45, 1600–1611

64. Mishra, R. P., Mariotti, P., Fiaschi, L., Nosari, S., Maccari, S.,Liberatori, S., Fontana, M. R., Pezzicoli, A., De Falco, M. G.,Falugi, F., Altindis, E., Serruto, D., Grandi, G., and Bagnoli, F.

(2012) Staphylococcus aureus FhuD2 is involved in the early phaseof staphylococcal dissemination and generates protective immu-nity in mice. J. Infect. Dis. 206, 1041–1049

65. Kuhn, P., Knapp, M., Soltis, S. M., Ganshaw, G., Thoene, M., andBott, R. (1998) The 0.78 A structure of a serine protease: Bacilluslentus subtilisin. Biochemistry 37, 13446–13452

66. Tanaka, S., Matsumura, H., Koga, Y., Takano, K., and Kanaya, S.(2007) Four new crystal structures of Tk-subtilisin in unautopro-cessed, autoprocessed and mature forms: insight into structuralchanges during maturation. J. Mol. Biol. 372, 1055–1069

67. Foophow, T., Tanaka, S., Angkawidjaja, C., Koga, Y., Takano, K.,and Kanaya, S. (2010) Crystal structure of a subtilisin homo-logue, Tk-SP, from Thermococcus kodakaraensis: requirement of aC-terminal beta-jelly roll domain for hyperstability. J. Mol. Biol.400, 865–877

68. Paton, A. W., Beddoe, T., Thorpe, C. M., Whisstock, J. C., Wilce,M. C., Rossjohn, J., Talbot, U. M., and Paton, J. C. (2006) AB5subtilase cytotoxin inactivates the endoplasmic reticulum chap-erone BiP. Nature 443, 548–552

69. Houssen, W. E., Koehnke, J., Zollman, D., Vendome, J., Raab,A., Smith, M. C., Naismith, J. H., and Jaspars, M. (2012) Thediscovery of new cyanobactins from Cyanothece PCC 7425defines a new signature for processing of patellamides. Chembi-ochem 13, 2683–2689

70. Kennan, R. M., Wong, W., Dhungyel, O. P., Han, X., Wong, D.,Parker, D., Rosado, C. J., Law, R. H., McGowan, S., Reeve, S. B.,Levina, V., Powers, G. A., Pike, R. N., Bottomley, S. P., Smith,A. I., Marsh, I., Whittington, R. J., Whisstock, J. C., Porter, C. J.,and Rood, J. I. (2010) The subtilisin-like protease AprV2 isrequired for virulence and uses a novel disulphide-tetheredexosite to bind substrates. PLoS Pathogens 6, e1001210

71. Bottomley, M. J., Cirillo, A., Orsatti, L., Ruggeri, L., Fisher, T. S.,Santoro, J. C., Cummings, R. T., Cubbon, R. M., Lo Surdo, P.,Calzetta, A., Noto, A., Baysarowich, J., Mattu, M., Talamo, F., DeFrancesco, R., Sparrow, C. P., Sitlani, A., and Carfi, A. (2009)Structural and biochemical characterization of the wild typePCSK9-EGF(AB) complex and natural familial hypercholester-olemia mutants. J. Biol. Chem. 284, 1313–1323

72. Hampton, E. N., Knuth, M. W., Li, J., Harris, J. L., Lesley, S. A.,and Spraggon, G. (2007) The self-inhibited structure of full-length PCSK9 at 1.9 A reveals structural homology with resistinwithin the C-terminal domain. Proc. Natl. Acad. Sci. U. S. A. 104,14604–14609

73. Cunningham, D., Danley, D. E., Geoghegan, K. F., Griffor,M. C., Hawkins, J. L., Subashi, T. A., Varghese, A. H., Ammirati,M. J., Culp, J. S., Hoth, L. R., Mansour, M. N., McGrath, K. M.,Seddon, A. P., Shenolikar, S., Stutzman-Engwall, K. J., Warren,L. C., Xia, D., and Qiu, X. (2007) Structural and biophysicalstudies of PCSK9 and its mutants linked to familial hypercho-lesterolemia. Nat. Struct. Mol. Biol. 14, 413–419

74. Comellas-Bigler, M., Maskos, K., Huber, R., Oyama, H., Oda, K.,and Bode, W. (2004) 1.2 A crystal structure of the serinecarboxyl proteinase pro-kumamolisin; structure of an intactpro-subtilase. Structure 12, 1313–1323

75. Jain, S. C., Shinde, U., Li, Y., Inouye, M., and Berman, H. M.(1998) The crystal structure of an autoprocessed Ser221Cys-subtilisin E-propeptide complex at 2.0 A resolution. J. Mol. Biol.284, 137–144

Received for publication September 18, 2013.Accepted for publication January 2, 2014.

1793STAPHYLOCOCCUS AUREUS AUTOCLEAVING PROTEASE EpiP