Transplant Immunology 24 (2011) 149–156

Contents lists available at ScienceDirect

Transplant Immunology

j ourna l homepage: www.e lsev ie r.com/ locate / t r im

Spontaneous acceptance of mouse kidney allografts is associated with increasedFoxp3 expression and differences in the B and T cell compartments

Chuanmin Wang a,b, Shaun Cordoba a, Min Hu c, Patrick Bertolino a, David G. Bowen a,Alexandra F. Sharland b, Richard D.M. Allen b, Stephen I. Alexander c,Geoffrey W. McCaughan a, G. Alex Bishop a,b,⁎a A.W. Morrow Liver Laboratory, Centenary Institute, Royal Prince Alfred Hospital, Sydney, Australiab Collaborative Transplant Laboratory, Sydney University, Sydney, Australiac Nephrology Department, Children's Hospital Westmead, Sydney, Australia

Abbreviations: GAPDH, glyceraldehyde-3-phosphateMHC, major histocompatibility complex; REJ, rejectitransplant); TGF, transforming growth factor; TOL, toleratransplant).⁎ Corresponding author. Collaborative Transplant Labo

Sydney University, NSW 2006, Australia. Tel.: +61 2 9351E-mail address: Alex.Bishop@sydney.edu.au (G.A. Bi

0966-3274/$ – see front matter © 2010 Elsevier B.V. Aldoi:10.1016/j.trim.2010.12.004

a b s t r a c t

a r t i c l e i n f o

Article history:Received 30 November 2010Received in revised form 20 December 2010Accepted 20 December 2010

Keywords:Graft acceptanceKidney transplantationTransplant tolerance

Spontaneous acceptance of organ allografts can identify novel mechanisms of drug-free transplantationtolerance. Spontaneous acceptance occurs in bothmouse kidney transplants and rat liver transplants howeverthe early immune processes of mouse kidney acceptance have not been studied. Acceptance of C57BL/6 strainkidney allografts in fully MHC-incompatible B10.BR recipients was compared with rejection (REJ) of heartallografts in the same strain combination. Graft infiltrate and antibody deposition were examined byimmunohistochemical staining. Expression of mRNA was measured by quantitative real-time PCR. Apoptosiswas examined by TUNEL staining. The majority of kidney allografts were accepted long-term and inducedtolerance (TOL) of donor-strain skin grafts, showing that acceptance was not due to immune ignorance. Therewas an extensive infiltrate of T cells in the TOL kidney that exceeded the level in REJ hearts but subsequentlydeclined. The main differences were deposition of IgG2a antibody in REJ that was absent in TOL, more B cellsinfiltrating TOL kidneys and a progressive increase in the ratio of CD8 : CD4 cells during rejection. There wasalso significantly greater Foxp3 mRNA expression in TOL. Kidneys from RAG−/− donors were accepted,showing that donor lymphocytes were not necessary for acceptance. Neutralising antibodies to TGF-βadministered from day 0 to day 6 did not prevent TOL. On the basis of cytokine expression and apoptosis therewas no evidence for immune deviation or deletion as mechanisms of acceptance. In accord with the findingsof spontaneous acceptance of liver allografts in rats, themain difference betweenmouse kidney TOL and heartREJ was in the B cell compartment. The major difference to rat liver allograft acceptance was that apoptosis ofinfiltrate did not appear to play a role. Instead, increased Foxp3 expression in TOL kidneys implies thatregulatory T cells might be important.

dehydrogenase; IL, interleukin;on (C57BL6 to B10.BR heartnce (C57BL6 to B10.BR kidney

ratory, Blackburn Building DO6,6131; fax: +61 2 9036 7083.

shop).

l rights reserved.

© 2010 Elsevier B.V. All rights reserved.

1. Introduction

Spontaneous acceptance of transplanted organs in the absence ofany treatment of either donor or recipient occurs in a very fewtransplant models but can give valuable insights into mechanismsthat promote transplant tolerance. Spontaneous acceptance of liverallografts has been investigated in pigs [1], rats [2] andmice [3]. In ratsand mice, several factors contribute to liver acceptance includingdonor leukocytes transferred with the liver [4–7], the large size of the

liver [8] and the liver's unique vasculature [9]. Liver acceptance in therat model is associated with rapid and abortive immune activation ofrecipient T cells [10,11] which then die by apoptosis [12–14]. Thesefindings in rats have been generally supported by a mouse livertransplant model, where extensive activation and exhaustion of graft-reactive CD8 T cells was followed by their inactivation by deletion andanergy [15,16].

Kidney allografts in some mouse models are also spontaneouslyaccepted without requirement for immunosuppression. This was firstreported over 30 years ago for kidneys transplanted between micewith a major histocompatibility complex (MHC) class I disparity[17,18]. This has subsequently been confirmed in several donor/recipient combinations mismatched at both the class I and class II loci[19,20], although it is highly strain-dependent [15]. The immunolog-ical basis for acceptance has not been extensively researched andthere are few reports that examine the underlying mechanism,especially in the early induction period. Examination of murine

150 C. Wang et al. / Transplant Immunology 24 (2011) 149–156

kidney allograft recipients at 60 days after transplant showed thatTGF-β is involved in maintenance of tolerance [20]. By 150 days aftertransplant the main mechanism of maintenance is expression ofindoleamine dioxygenase by “regulatory” dendritic cells [21]. Despitethese findings in established kidney transplant acceptance, theimmediate post-transplant immune events that lead to these out-comes are not known.

The mechanisms contributing to kidney allograft acceptance couldinclude deletion, anergy, immune deviation, ignorance or immuneregulation of alloreactive T cells. Immune deviation is characterised bylow levels of Th1 cytokines such as IL-2 and IFN-γ. Immunologicalignorance involves the absence of an immune response and isidentified by the rejection of secondary grafts of donor strain infirst-set tempo. Regulation involves a preponderance of cells thatsuppress potentially alloreactive T cells. A number of cell populationsare capable of immune regulation, the best characterised being CD4+CD25+T cells [22] that express the forkhead box p3 (Foxp3) tran-scription factor [23]. The aim of this study was to characterise theearly immune changes that occurred in spontaneous acceptance ofkidney allografts by comparing it with rejection of heart allografts inthe same strain. The pattern of graft infiltration, expression ofcytokines and Foxp3 in graft and recipient spleen, donor cellmigration and apoptosis of infiltrating cells was compared betweenTOL kidney and REJ heart grafts.

2. Materials and methods

2.1. Organ transplantation

C57BL/6 (H-2b) mice were used as donors and B10.BR (H-2k) wereused as recipients. In some experiments C57BL/6 Rag−/− animalswere used as donors. All were from the Animal Resources Centre,Perth, Western Australia. The Institutional Animal Care EthicsCommittee of Royal Prince Alfred Hospital approved all experiments.The kidney transplant technique was based on the method of Han etal. [24] with modification. Briefly, the donor kidney was removed andthe ureter was dissected close to the bladder. After removal of the leftrecipient kidney, the aorta and vena cava of the donor kidney wereanastomosed end-to-side with the recipient aorta and vena cava with10–0 nylon sutures. The donor ureter end was tied with a 5–0 sutureand implanted into the recipient bladder by pulling the suturethrough the back wall to the front. The ureter was fixed at the ureterimplant site by suturing periureteral tissue to the bladder back wallwith four 10–0 sutures. Excess ureter was cut at the bladder front walland after retraction of the ureter the hole was closed with one 10–0suture. The remaining native kidney was removed at 4 days post-transplantation. Heterotopic heart transplants in mice wereimplanted as an auxiliary graft similar to the procedure describedfor rats [25]. Heart graft function was monitored by daily palpationwhile kidney graft rejection was indicated by significant morbidityand death and confirmed histologically. In some experiments therecipient was treated with a neutralising antibody to transforminggrowth factor β (TGF-β) clone 1D11.16.8 (Bio Express, West Lebanon,NH), 200 μg purified antibody per day i.p. on days 0, 2, 4 and 6.

2.2. Immunohistochemical staining

A three-step indirect immunoperoxidase method was used,similar to previously-describedmethods [26]. Primary rat monoclonalantibodies reactive with the following mouse antigens were used:KT3, T cells (CD3ε); YTS169.4, CD8 cells; F4/80, macrophages; LO-MG1-2, IgG1; LO-MG2a-9, IgG2a; LO-MM-9, IgM (all from Serotec,Oxford UK). Antibodies RA3-6B2, B Cells (B220, CD45R) and GK1.5,CD4 cells were from BD Biosciences (San Diego, CA). Diluent for allantibodies was 5% normal swine serum in PBS. The second- and third-step reagents were rabbit antibody to rat immunoglobulin conjugated

to horseradish peroxidase, 1:50 dilution (Dako, Carpinteria, CA) andgoat antibody to rabbit immunoglobulin conjugated to horse-radish peroxidase, 1:100 dilution (Zymed, South San Francisco, CA)respectively. Frozen sections of 6 μ were air-dried, fixed in acetoneand incubated with primary antibody. After rinsing and washing inPBS, sections were incubated with second antibody in diluent plus20% normal mouse serum then washed in PBS before incubation withthird antibody, washing and colour development with diaminobenzi-dine substrate. After air-drying, the sections were counterstainedwith Mayers haematoxylin and counted with the aid of an eyepiecegraticule as previously described [26].

2.3. Real-time PCR for cytokine mRNA expression

The methods for RNA preparation and cDNA synthesis [26] and forquantitative real-time PCR analysis [27] have been previouslydescribed. Briefly, total RNA was prepared by acid phenol-guanidineextraction and 1 μg was reverse-transcribed using Superscript II(Invitrogen, Carlsbad CA). Aliquots of cDNA were stored at −70 °Cprior to amplification in quantitative PCR. PCR reaction mixturescontained Universal master-mix (Applied Biosystems, Foster City CA),cDNA and gene-specific primers and Taqman probe (Applied Biosys-tems). Primer and probe sequences for cytokines were: IL-2 forward,CAG GAT GCT CAC CTT CAA ATT TT; IL-2 reverse, CGC AGA GGT CCAAGT TCA TCT; IL-2 probe, 6FAM TTG CCC AAG CAG GCC ACA GAA TTGTamra; IL-4 forward, CGGAGATGGATGTGCCAAAC; IL-4 reverse, CGAGCT CAC TCT CTG TGG TGT T; IL-4 probe, 6FAM CCT CAC AGC AAC GAATamra; IFN-γ forward, CAG CAA CAG CAA GGC GAA A; IFN-γ reverse,CTGGAC CTG TGGGTTGTTGAC; IFN-γ probe, 6FAMTCAAAC TTGGCAATA CTC ATG AAT GCA TCC T Tamra; Granzyme B forward, AAG TCATCC CTA TGG TAA AAT GCA T; Granzyme B reverse, CTT ACT CTT CAGCTT TAG CAG CAT GAT; Granzyme B probe, 6FAM CCC ACC CAG ACTATA ATC CTA AGA CAT TCT CCC A Tamra; Foxp3 forward, TTG GCC AGCGCC ATC TT; Foxp3 reverse, TGC CTC CTC CAG AGA GAA GTG; Foxp3probe, 6FAM CAG CTG CTG CTC CAG-minor-groove-binding, non-fluorescent quencher (MGBNFQ); T cell Receptor _ constant region(TRBC) forward, CTA GCA GGA TCT CAT AGA GGA TGGT; TRBC reverse,CAA ACC TGT CAC ACA GAA CAT CAG; TRBC probe, 6FAM CCA CAG TCTGCT CGG C MGBNFQ. Sequences for rat glyceraldehyde-3-phosphatedehydrogenase (GAPDH) primers and probe have been previouslypublished [27] and were completely homologous with the mousegene. Cytokine expression was quantified using a cDNA standard,which consisted of a four-fold serial dilution of a sample with high-level expression. Expression of cytokine cDNA was corrected fordifferences in quality of RNA using GAPDH expression according to theformula: Cytokine expression/GAPDH expression ×103. To ensurereproducibility of results, cDNA synthesis and PCR amplification wasperformed twice for each sample and the results correlated by linearregression analysis. The average of the two resultswas used for furtheranalysis. Foxp3 expression was normalised to the extent of T cellinfiltration by the formula: Foxp3 expression/TRBC expression.

2.4. Flow cytometry

Migration of donor leukocytes to recipient lymphoid tissues wasassayed by single-colour flow cytometry similar to previously-described methods [10]. The recipient spleen was disrupted to forma single-cell suspension and stained to identify cells expressing donorantigen using primary antibody mouse anti-H-2Kb conjugated tobiotin (BD Biosciences). The secondary antibody was streptavidinconjugated to allophycocyanin (Molecular Probes, Eugene, OR). Atotal of 30,000 cells was analysed on a FacsCalibur flow cytometerwith Cellquest software (BD Biosciences, Immunocytometry Systems,Mountain View CA).

151C. Wang et al. / Transplant Immunology 24 (2011) 149–156

2.5. TUNEL assay

Cell apoptosis was detected in-situ by TUNEL staining of frozensections using methods we have previously described [13] and an in-situ cell death detection kit (Roche Diagnostics GmbH, Mannheim,Germany). Frozen sections from the transplanted organ or recipientspleen were fixed and stained according to the manufacturer'sinstructions and the number of apoptotic cells per mm2 was countedusing an eyepiece graticule as previously described [13].

2.6. Statistics

Statistical analyses were performed using GraphPad Prism 5.0(GraphPad Software, La Jolla, CA). Survival curves were compared bythe log-rank (Mantel-Cox) test. Gene expression, and cellularinfiltrate measurements were compared by one or two-way analysisof variance as appropriate, followed by a Bonferroni post-test. Pb0.05was considered statistically significant.

3. Results

3.1. Survival of kidney and heart grafts

In the syngeneic strain combination of B10.BR donor to B10.BRrecipient, heart transplants were accepted with a median survivaltime (MST) of N150 days (Table 1). Syngeneic kidney transplants inthe same combination had a MST of N113 days. Seven of 14 syngeneickidney transplants survived b100 days and showed urinary problemsincluding urine leak, ureteric stenosis and hydronephrosis, whichreflects the difficulty of surgical re-anastomosis of the ureter to thebladder. Heart allografts in the combination of C57BL6 to B10.BR wereall rejected in 10–14 days (p=0.001 compared to syngeneic hearttransplants). In contrast, kidney allografts in the same combinationhad significantly prolonged survival compared to heart allografts(MST N150 days) (p=0.01) and did not differ significantly fromsyngeneic kidney transplants (p=0.45). Six of the seven kidneyallograft recipients that survived N150 days were tested for donor-specific tolerance with skin grafts. Five accepted donor skin forN30 days and two of these were monitored for N100 days withoutrejection while rejecting third-party SJL/J (H-2s) skin in 8–10 days.The skin graft failed in one recipient and the kidney was rejected30 days later.

3.2. Infiltrate in kidney and heart transplants

Immunohistochemical staining of sections of kidney and heartallograft tissue showed an extensive infiltrate in both kidney andheart allografts. Of interest, there was a greater infiltrate in the kidneythan in the heart early after transplantation, which subsequentlydeclined (Fig. 1). The infiltrate consisted of T cells, B cells andmacrophages. In kidney allografts the infiltratewas diffusely distributed

Table 1Survival of heart or kidney transplants.

Strain combination Organ n Survival

B10.BR → B10.BR Heart 6 54a, N150"" Kidney 14 7b, 8b, 18C57BL/6 → B10.BR Heart 6 10×3, 11"" Kidney 11 7b, 9b 76"" + αTGF-βd " 5 6, 7, N15C57BL/6, Rag−/− → B10.BR " 6 5b, 6b, 8b

a Cessation of heart-beat of unknown cause.b Kidney failure was due to urinary problems including urine leak.c Kidney failure was due to ureteric stenosis or hydronephrosis.d 1D11 antibody to TGF-β was injected i.p. at 200 μg/dose on days 0, 2, 4 and 6.

throughout the interstitial areas with perivascular, periglomerular andkidney capsular foci. In heart allografts there was a concentration ofinfiltrate in the pericardium with only a slight diffuse infiltrate in themyocardium.

Time course analysis showed a rapid diffuse T cell infiltrate on day3 in kidney allografts that was observed earlier than in heart allograftswith significantly more cells in the interstitium of kidney allografts onday 3 (p=0.002) and day 5 (p=0.02) than in the myocardium of theheart (Fig. 1C). For all cell populations studied there was a more rapidinfiltrate of cells into the kidney allografts and usually a denserinterstitial infiltrate in the kidney than in the heart. Anotherdifference in the pattern of infiltrate was that there was a heavyaccumulation of B cells in perivascular areas of the kidney transplantsthat was not observed in heart transplants at any time. There was alsoa difference in the T cell subset ratios in kidney transplant acceptanceand heart rejection, with the CD8:CD4 ratio increasing significantly inheart grafts after day 3 while it remained relatively constant in kidneygrafts (Fig. 1C).

3.3. Intra-graft deposition of immunoglobulin

The deposition of immunoglobulin subclasses IgM, IgG1 and IgG2awas examined in heart and kidney graft sections by immunohisto-chemistry. Therewas an increase in IgMdeposition in both kidney andheart grafts by day 7 after transplantation. There was strongdeposition of IgG2a in heart allografts by day 7 that was localisedwithin the myocardium on elongated structures that were most likelycapillaries. This strong localised deposition of IgG2a was not observedin kidney grafts at any time after transplantation (Fig. 2). IgG1was notdeposited in heart or kidney grafts at any time after transplantation.

3.4. Cytokine expression in kidney and heart transplants

There was a marked increase in intra-graft cytokine mRNAexpression in both kidney transplant acceptance and heart allograftrejection compared to expression in normal (day 0) tissue or insyngeneic grafts (Fig. 3). The pattern of expression did not show acorrelation of the Th1 cytokines IL-2, IFN-γ or granzyme B withrejection, or of the Th2 cytokine IL-4 with acceptance. IL-2 wasexpressed at greater levels in kidney allografts on day 3 (p=0.0004)and day 7 (p=0.006) while there was more IL-4 expression in heartallografts on day 5 (p=0.009) but not at other times. In rejectinghearts the peak of expression of the Th2 cytokine IL-4 on day 5coincided with expression of the Th1 cytokine IFN-γ. There was amore rapid increase of the cytokines IL-2 and IL-4 in kidney graftsthan in hearts.

3.5. Cytokine expression in recipient spleen

The time-course expressionof cytokines in the spleens of recipientsof heart or kidney grafts showed that expression was relatively stable

(days) MST (days) p vs. syngeneic

×5 N150 –c, 35c, 59c, 70c, 76c, N150×7 N113 –

, 12, 14 11 0.001c, 85c, N150×7 N150 0.450×3 N150 0.89, N150×3 N79 0.52

Fig. 1. Immunohistochemical staining of kidney and heart transplants. Rejecting heart allografts (A) or tolerant kidney allografts (B) on day 7 after transplantation stained to identifyinfiltrating T cells with KT3 antibody. (C) Time-course of infiltration of kidney and heart transplants. T cells, B cells, CD4 cells and CD8:CD4 cell ratio was examined in rejecting heartallografts (filled circles); tolerant kidney allografts (filled squares); syngeneic heart allografts (open circles) and syngeneic kidney transplants (open squares).

152 C. Wang et al. / Transplant Immunology 24 (2011) 149–156

(Fig. 4). The level of expression of all cytokineswas similar in spleen ofallograft recipients and did not increase significantly compared to thelevel in spleens of normal or syngeneic graft recipients. In consequence

Fig. 2. Immunohistochemical staining of rejecting heart allograft (A) or tolerant kidney allog

there was little or no difference between heart and kidney graftrecipients in the level of expression at any time point for any cytokinetested.

rafts (B) on day 7 after transplantation showing heavy deposition of IgG2a in rejection.

Fig. 3. Time-course of expression of intra-graft cytokines. Expression of IL-2, IL-4, IFN-γ and granzyme-B mRNA was examined in rejecting heart allografts (filled circles); tolerantkidney allografts (filled squares); syngeneic heart allografts (open circles) and syngeneic kidney transplants (open squares).

Fig. 4. Time-course of expression of cytokines in recipient spleen. Expression of IL-2, IL-4, IFN-γ and granzyme-B mRNA was examined in the spleens of recipients of rejecting heartallografts (filled circles); tolerant kidney allografts (filled squares); syngeneic heart allografts (open circles) and syngeneic kidney transplants (open squares).

153C. Wang et al. / Transplant Immunology 24 (2011) 149–156

Fig. 5. Foxp3 mRNA expression. Time course expression of the ratio of Foxp3 to T cell(TRBC) mRNA expression in graft (A) or recipient spleen (B) of tolerant kidney orrejecting heart allograft recipients. *P≤0.05.

154 C. Wang et al. / Transplant Immunology 24 (2011) 149–156

3.6. Foxp3 expression in graft and recipient lymphoid tissues

The time course of expression of the Foxp3 transcription factor wasexamined in the transplanted organ and also in the recipient spleen.The ratio of Foxp3 to TRBC was similar in normal kidneys and hearts.There was a marked increase of the ratio in TOL kidney allografts ondays 7 and 30 (Fig. 5A). In contrast, there was no increase in the ratioof Foxp3 to TRBC in REJ heart grafts at any time after transplantation.The absolute increase in Foxp3 in the kidney allografts compared tothe heart allografts was even greater than the values shown in Fig. 5A,

Fig. 6. Apoptosis of cells in kidney or heart graft recipients. Apoptotic cells wereexamined by TUNEL staining of the graft (A) or recipient spleen (B) of rejecting heartallograft recipients or tolerant kidney allograft recipients.

which had been corrected for the heavier T cell infiltrate in the kidneyallografts (Fig. 1) that was confirmed by TRBC mRNA expression.Examination of Foxp3 expression in the recipient spleen showed nodifference in the ratio of Foxp3 to TRBC at any time after transplantationin recipients of either heart or kidney allografts (Fig. 5B).

3.7. Apoptosis in recipient spleen and graft

Apoptosis of leukocytes in the periarteriolar lymphoid sheath ofthe splenic white pulp and in the grafts themselves was analysed ondays 1 to 7 after transplantation by examination of DNA fragmenta-tion by TUNEL assay. There were very few apoptotic cells in normalheart or kidney tissue, however after transplantation, the numbers ofapoptotic cells increased markedly between days 5 and 7 (Fig. 6A).There was no detectable difference in the number of apoptotic cells ineither heart or kidney grafts. Moderate numbers of apoptotic cellswere observed in periarteriolar sheaths of normal B10.BR spleens(Fig. 6B). There was no significant difference in apoptosis betweenthe spleens of kidney or heart allograft recipients at any time aftertransplantation.

3.8. Donor cell migration to recipient spleen

Donor cell migration to recipient spleen was assayed by immuno-histochemical staining of spleen sections from day 1 to day 7 aftertransplantation using an antibody to H-2Kb that did not cross-reactwith recipient MHC antigen (H-2Kk). This showed that there was littledetectable migration of donor cells to recipient spleen at any timeafter transplantation of either kidney or heart allografts (data notshown). This result was confirmed by flow cytometry analysis, whichshowed no detectable migration of donor cells into the recipientspleen. This analysis confirmed the specificity of the antibody whichreacted with N97% of donor C57BL6 spleen cells but only 0.17±0.02%of cells in normal B10.BR spleen. In B10.BR recipients of C57BL6kidney transplants therewas only 0.15±0.02% of donor cells on day 1,which was not significantly different to background levels.

3.9. No role for donor lymphocytes and recipient TGF-β in kidney acceptance

As donor leucocytes play a central role in spontaneous acceptanceof liver allografts in rat models [4,6,7], we examined the role of donorlymphocytes in kidney allograft acceptance. Kidneys from C57BL6,Rag−/− donors, which lacked T and B cells, were accepted long-termin 3 of 6 recipients (Table 1). The MST in these animals was notsignificantly different to syngeneic kidney transplant recipients,showing that T and B lymphocytes were not necessary for kidneyallograft survival. As TGF-β has been demonstrated to play a role inthe maintenance of tolerance of mouse kidney allografts, its role inestablishment of tolerance was examined. Neutralising antibody toTGF-β injected during the first week after transplantation did notaffect survival of the kidney grafts (Table 1).

4. Discussion

In the completely MHC-mismatched strain combination of C57BL6donor to B10.BR recipient, heart allografts were rapidly rejected whilekidney allografts were accepted without requiring immunosuppres-sion and promoted specific tolerance of donor strain skin grafts.Acceptance of kidney grafts was associated with extensive immuneactivation, a dense interstitial infiltrate of T cells and monocytes, aperivascular infiltrate of B cells and a marked increase in cytokineexpression within the graft. There was also an extensive infiltratewithin the rejected heart grafts and a corresponding marked increasein cytokines within the graft. Themain difference between rejection ofhearts and acceptance of kidneys was that immune activationappeared earlier in the TOL kidney grafts and was associated with a

155C. Wang et al. / Transplant Immunology 24 (2011) 149–156

heavier perivascular B cell infiltrate. This was accompanied by anincrease in Foxp3 expression in the transplanted kidneys. In the REJheart allografts there was a greater CD8:CD4 ratio as rejectionprogressed, greater intra-graft expression of the cytokines IL-4 andIFN-γ later in rejection and the deposition of IgG2a subclass antibodiesin the graft that were not observed in TOL kidneys.

Although there have been several studies examining the mainte-nance phase of mouse kidney transplant tolerance [20,21] this is thefirst to characterise the immune response to the kidney immediatelyafter transplantation and to contrast it with rejection of a heart in thesame strain combination. TGF-β appears to be important in the earlymaintenance phase of kidney transplantation from day 30 to 150 [20],while indoleamine dioxygenase is responsible for maintenance oftolerance after day 150 [21]. Our findings show that TGF-β is unlikelyto play a role in the establishment of transplant tolerance as treatmentof mice for the first six days with a dose of antibody to TGF-β whichwas double that required to neutralise regulatory cells in vivo [28], didnot abrogate tolerance.

The mechanism of spontaneous acceptance of mouse kidney graftsappears to be different to the spontaneous acceptance observed withmouse or rat liver allografts. Rat liver allograft acceptance has beenshown to depend on donor leukocytes that are transferred within theliver [4]. These migrate to recipient lymphoid tissues within hours oftransplantation [10,29] and their presence there is associated with aparadoxical marked increase of IL-2 and IFN-γ in recipient lymphoidtissues of tolerant rat liver allograft recipients that is not observed inrejection [10,11]. Donor leukocytes, injected at the time of transplan-tation, can also convert kidney rejection to tolerance in a rat model[11] and there are several studies showing that T or B lymphocytes areinvolved [8,30,31]. In contrast, the results here show that donorlymphocytes did not appear to play a role in kidney acceptance asgrafts from Rag−/−donors were not rejected, although this does notdiscount the possible involvement of donor leukocytes of myeloidlineages. Other differences between rat liver and mouse kidneytransplant acceptance are that there was no detectable migration ofdonor leukocytes into the recipient lymphoid tissues and notolerance-associated increase of IL-2 and IFN-γ in mouse kidneyacceptance.

A study in a mouse strain combination in which liver transplantswere accepted but kidney and heart transplants were rejectedshowed that mouse liver transplant acceptance led to more rapidand extensive activation of alloreactive CD8 T cells than rejection ofheart or kidney grafts [15]. These findings correspond closely with therat liver transplant model and also with our findings for spontaneousacceptance of mouse kidney allografts. In all models of spontaneousacceptance there was a more rapid increase in inflammation withinthe accepted grafts. In addition, there was a greater B cell infiltrate intolerant grafts which contrasted with the production of graft-specificantibodies in rejection observed in both the mouse kidney and ratliver models [26]. This accumulation of B cells in tolerant grafts couldbe due to their requirement for T cell help in the form of cytokines,particularly IFN-γ and IL-4 [32]. Expression of IFN-γ and IL-4 in heartsincreased markedly on day 5 and could have provided the signal formaturation of B cells and their migration to the bone marrow wherethey become long-lived plasma cells secreting immunoglobulin [33].In TOL kidney transplants B cell accumulation might therefore be dueto the absence of sufficient T cell help. There was also an increase inthe CD8:CD4 ratio in both the mouse and rat [34] models of rejectionthat was not seen in tolerance.

The main difference between our findings for kidney allograftacceptance and the published findings of liver allograft acceptance isthat we were unable to demonstrate a role for apoptosis of infiltratingleucocytes in acceptance. In contrast, early immune activation in livertransplant tolerance is followed by marked apoptosis of graft-reactivecells in both rats [12–14] and mice [15,16]. The potential mechanismsof transplant tolerance include T cell deletion, ignorance, anergy,

immune deviation, or suppression and liver allografts in rodentsappear to induce tolerance by deletion [35]. The evidence for deletionis that apoptosis of recipient activated T cells is associated withacceptance [12,16]. This apoptosis of alloreactive T cells limits therejection response and results in reduced cytotoxic T cell activityassociated with tolerance [16]. Leukocyte apoptosis did not appear toplay a role in mouse kidney graft acceptance as the levels of apoptosisin the graft infiltrate or recipient spleen were the same in toleranceand rejection.

Therefore, in contrast to the rat and mouse liver transplanttolerance models, T cell deletion does not appear to play a role. Also, Tcell ignorance is not the mechanism of mouse kidney transplantacceptance as our results show that kidney transplantation inducedsubsequent skin transplant tolerance which is not compatible withignorance. Furthermore, there was no evidence for immune deviation,as there was no clear association between Th1 cytokines such as IFN-γand IL-2 and rejection. These findings narrow the range of potentialmechanisms for mouse kidney allograft tolerance to T cell anergy orsuppression. The increased proportion of Foxp3 in tolerant kidneys isevidence that regulatory T cells might play a role in acceptance. Theratio of Foxp3 to T cell transcripts was significantly higher on day 7 inkidneys compared to hearts, suggesting that there is an earlyaccumulation of regulatory T cells expressing Foxp3. The mechanismby which these cells accumulate and their potential role in kidneytransplant acceptance requires further examination.

In conclusion, this study is the first to detail the early responsesthat occur in acceptance of kidney allografts compared with rejectionof heart allografts in the same recipient mouse strain. Comparison ofmouse kidney allograft tolerance with heart rejection shows thatacceptance is associated with a rapid and extensive immuneinfiltration and marked increases in intra-graft Th1 and Th2 cytokineexpression that were difficult to distinguish from rejection. Therewere, however, differences in the pattern of infiltration, cytokineexpression and antibody deposition. The finding that kidney accep-tance was associated with the accumulation of Foxp3 transcripts inthe graft suggests that regulatory T cells might be involved inacceptance. Unlike spontaneous acceptance of liver allografts in miceor rats, kidney acceptance is not associated with apoptosis and deathof graft infiltrating cells. These findings thus support the conclusionsthat early accumulation of regulatory T cells rather than deletion ofalloreactive T cells, is responsible for kidney acceptance.

Acknowledgments

This work was supported by the National Health and MedicalResearch Council of Australia and by the Microsearch Foundation ofAustralia.

References

[1] Calne RY, Sells RA, Pena JR, Davis DR, Millard PR, Herbertson BM, et al. Induction ofimmunological tolerance by porcine liver allografts. Nature 1969;223:472–6.

[2] Kamada N. The immunology of experimental liver transplantation in the rat.Immunology 1985;55:369–89.

[3] Lu L, Rudert WA, Qian S, McCaslin D, Fu F, Rao AS, et al. Growth of donor-deriveddendritic cells from the bone marrow of murine liver allograft recipients inresponse to granulocyte/macrophage colony-stimulating factor. J Exp Med1995;182:379–87.

[4] Sun J, McCaughan GW, Gallagher ND, Sheil AGR, Bishop GA. Deletion ofspontaneous rat liver allograft acceptance by donor irradiation. Transplantation1995;60:233–6.

[5] Sriwatanawongsa V, Davies HfS, Calne RY. The essential roles of parenchymaltissues and passenger leukocytes in the tolerance induced by liver grafting in rats.Nat Med 1995;1:428–32.

[6] Tu YZ, Arima T, Flye MW. Rejection of spontaneously accepted rat liver allograftswith recipient interleukin-2 treatment or donor irradiation. Transplantation1997;63:177–81.

[7] Shimizu Y, Goto S, Lord R, Vari F, EdwardsSmith C, Chiba S, et al. Restoration oftolerance to rat hepatic allografts by spleen-derived passenger leukocytes. TransplInt 1996;9:593–5.

156 C. Wang et al. / Transplant Immunology 24 (2011) 149–156

[8] Sun J, Sheil AGR, Wang C, Wang L, Rokahr KL, Sharland AF, et al. Tolerance to ratliver allografts IV. Acceptance depends on the quantity of donor tissue and ondonor leukocytes. Transplantation 1996;62:1725–30.

[9] Bowen DG, ZenM, Holz L, Davis T, McCaughan GW, Bertolino P. The site of primaryT cell activation is a determinant of the balance between intrahepatic toleranceand immunity. J Clin Invest 2004;114:701–12.

[10] Bishop GA, Sun J, DeCruz DJ, Rokahr KL, Sedgwick JD, Sheil AGR, et al. Tolerance torat liver allografts. III. Donor cell migration and tolerance-associated cytokineproduction in peripheral lymphoid tissues. J Immunol 1996;156:4925–31.

[11] Yan Y, Shastry S, Richards C, Wang C, Bowen DG, Sharland AF, et al. Posttransplantadministration of donor leukocytes induces long-term acceptance of kidney orliver transplants by an activation-associated immune mechanism. J Immunol2001;166:5258–64.

[12] Sharland AF, Shastry S, Wang C, Rokahr KL, Sun J, Sheil AGR, et al. Kinetics ofintragraft cytokine expression, cellular infiltration and cell death in rejection ofrenal allografts compared with acceptance of liver allografts in a rat model. Earlyactivation and apoptosis is associated with liver graft acceptance. Transplantation1998;65:1370–7.

[13] Sharland AF, Yan Y, Wang C, Bowen DG, Sun J, Sheil AGR, et al. Evidence thatapoptosis of activated T cells occurs in spontaneous tolerance of liver allograftsand is blocked by manipulations which break tolerance. Transplantation 1999;68:1736–45.

[14] Fujiki M, Esquivel CO, Martinez OM, Strober S, Uemoto S, Krams SM. Inducedtolerance to rat liver allografts involves the apoptosis of intragraft T cells and thegeneration of CD4(+)CD25(+)FoxP3(+) T regulatory cells. Liver Transplant2010;16:147–54.

[15] Steger U, Denecke C, Sawitzki B, Karim M, Jones ND, Wood KJ. Exhaustivedifferentiation of alloreactive CD8(+) T cells: Critical for determination of graftacceptance or rejection. Transplantation 2008;85:1339–47.

[16] Qian S, Lu L, Fu F, Li Y, Li W, Starzl TE, et al. Apoptosis within spontaneouslyaccepted mouse liver allografts. Evidence for deletion of cytotoxic T cells andimplications for tolerance induction. J Immunol 1997;158:4654–61.

[17] Skoskiewicz M, Chase C, Winn HJ, Russell PS. Kidney transplants between mice ofgraded immunogenetic diversity. Transplant Proc 1973;5:721–5.

[18] Russell PS, Chase CM, Colvin RB, Plate JM. Kidney transplants in mice. An analysisof the immune status of mice bearing long-term, H-2 incompatible transplants.J Exp Med 1978;147:1449–68.

[19] Inoue K, Niesen N, Albini B, Milgrom F. Studies on immunological-toleranceinduced in mice by kidney allografts. Int Arch Allergy Imm 1991;96:358–61.

[20] Bickerstaff AA, Wang JJ, Pelletier RP, Orosz CG. Murine renal allografts:Spontaneous acceptance is associated with regulated T cell-mediated immunity.J Immunol 2001;167:4821–7.

[21] Cook CH, Bickerstaff AA, Wang JJ, Nadasdy T, Della Pelle P, Colvin RB, et al.Spontaneous renal allograft acceptance associated with "Regulatory" dendriticcells and IDO. J Immunol 2008;180:3103–12.

[22] Hall BM, Pearce NW, Gurley KE, Dorsch SE. Specific unresponsiveness in rats withprolonged cardiac allograft survival after treatment with cyclosporine III. Furthercharacterisation of the CD4+ suppressor cell and its mechanisms of action. J ExpMed 1990;171:141–57.

[23] Hori S, Nomura T, Sakaguchi S. Control of regulatory T cell development by thetranscription factor Foxp3. Science 2003;299:1057–61.

[24] Han WR, Murray-Segal LJ, Mottram PL. Modified technique for kidney transplan-tation in mice. Microsurgery 1999;19:272–4.

[25] Ono K, Lindsey ES. Improved technique of heart transplantation in rats. J ThoracCardiov Surg 1969;57:225–9.

[26] Sun J, McCaughan GW, Matsumoto Y, Sheil AGR, Gallagher ND, Bishop GA.Tolerance to rat liver allografts 1. Differences between tolerance and rejection aremore marked in the B cell compared with the T cell or cytokine response.Transplantation 1994;57:1349–57.

[27] Yin J, Shackel NA, Zekry A, McGuinness PH, Richards C, Van der Putten K, et al. RealTime RT-PCR for measurement of cytokine and growth factor mRNA expressionwith fluorogenic probes or SYBR Green I. Immunol Cell Biol 2001;79:213–21.

[28] Chen YH, Inobe J, Kuchroo VK, Baron JL, Janeway CA, Weiner HL. Oral tolerance inmyelin basic protein T-cell receptor transgenic mice - Suppression of autoimmuneencephalomyelitis and dose-dependent induction of regulatory cells. Proc NatlAcad Sci USA 1996;93:388–91.

[29] Demetris AJ. Early events in liver allograft rejection. Am J Pathol 1991;138:609–18.[30] Yan Y, Van der Putten K, Bowen DG, Painter DM, Kohar J, Sharland AF, et al.

Postoperative administration of donor B cells induces long-term rat kidneyallograft acceptance: Lack of association with Th2 cytokine expression in long-term accepted grafts. Transplantation 2002;73:1123–30.

[31] Tsui TY, Deiwick A, Ko S, Schlitt HJ. Specific immunosuppression by postoperativeinfusion of allogeneic spleen cells: requirement of donor major histocompatibilitycomplex expression and graft-versus-host reactivity. Transplantation 2000;69:25–30.

[32] Snapper CM, Paul WE. Interferon-gamma and B cell stimulatory factor-1reciprocally regulate Ig isotype production. Science 1987;236:944–7.

[33] Manz RA, Thiel A, Radbruch A. Lifetime of plasma cells in the bone marrow. Nature1997;388:133–4.

[34] Knechtle SJ, Wolfe JA, Burchette J, Sanfilippo F, Bollinger RR. Infiltrating cellphenotypes and patterns associated with hepatic allograft rejection or acceptance.Transplantation 1987;43:169–72.

[35] Bishop GA, McCaughan GW. Immune activation is required for the induction ofliver allograft tolerance: implications for immunosuppressive therapy. LiverTransplant 2001;7:161–72.