ISSN 0026�8933, Molecular Biology, 2010, Vol. 44, No. 5, pp. 807–816. © Pleiades Publishing, Inc., 2010.Original Russian Text © A.Yu. Ryazanova, N.V. Molochkov, L.A. Abrosimova, A.V. Alexeevsky, A.S. Karyagina, A.S. Protsenko, P. Friedhoff, T.S. Oretskaya, E.A. Kubareva,2010, published in Molekulyarnaya Biologiya, 2010, Vol. 44, No. 5, pp. 911–921.

807

1 Bacterial restriction–modification (R–M) systemsconsist of at least 2 components: restriction endonu�clease (RE) and DNA methyltransferase (MTase).Gene expression of these proteins can be regulatedwith the MTase participation: the MTase binds in theintergenic region of the R–M system with a sequence

1 The article was translated by the authors.Abbreviations: CD—circular dichroism, HTH—helix–turn–helix, M.Ecl18kI—(cytosine�5)�DNA methyltransferaseEcl18kI, M.HaeIII—(cytosine�5)�DNA methyltransferaseHaeIII, M.HhaI—(cytosine�5)�DNA methyltransferase HhaI,M.NlaX—(cytosine�5)�DNA methyltransferase NlaX,M.SsoII —(cytosine�5)�DNA methyltransferase SsoII,MTase—methyltransferase, NMR—nuclear magnetic reso�nance, PAAG— polyacrylamide gel, R⎯M—restriction⎯modi�fication, RE— restriction endonuclease.

which differs from the methylation site – the so calledregulatory site. Up to date, this type of transcriptionregulation is demonstrated experimentally for 6 R–Msystems: MspI, EcoRII, ScrFI, LlaJI, SsoII, andEcl18kI [1, 2].

The R–M systems SsoII (from Shigella sonnei 47)and Ecl18kI (from Enterobacter cloacae 18k) differfrom the others in the fact that the MTase, besides theautoregulatory function (repression of its own gene),activates the RE gene transcription. These 2 R–M sys�tems are almost identical and can be called SsoII�likesystems. The nucleotide sequences of the RE andMTase genes as well as the intergenic region virtuallymatch. The MTases SsoII (M.SsoII) and Ecl18kI(M.Ecl18kI) recognize in DNA the same sequence

Secondary Structure of SsoII�like (Cytosine�5)�DNA Methyltransferases N�Terminal Region Determined

by Circular Dichroism Spectroscopy1 A. Yu. Ryazanovaa, N. V. Molochkovb, L. A. Abrosimovaa, A. V. Alexeevskya,c, A. S. Karyaginaa,d,

A. S. Protsenkoe, P. Friedhoff f, T. S. Oretskayaa, and E. A. Kubarevaa

a Faculty of Bioengineering and Bioinformatics, Chemistry Department, and A.N. Belozersky Institute of Physico�Chemical Biology, M.V. Lomonosov Moscow State University, Moscow, 119991 Russia

b Institute of Theoretical and Experimental Biophysics, Russian Academy of Sciences, Moscow region Pushchino, 142290 Russia

c Scientific Research Institute for System Studies, Russian Academy of Sciences, Moscow, 117218 Russiad N.F. Gamaleya Institute of Epidemiology and Microbiology, Russian Academy of Medical Sciences,

Moscow, 123098 Russiae G.K. Skryabin Institute of Biochemistry and Physiology of Microorganisms, Russian Academy of Sciences,

Moscow region Pushchino, 142290f Institut für Biochemie, Justus�Liebig�Universität, D�35392 Giessen, Germany;

e�mail: kubareva@belozersky.msu.ruReceived January 28, 2010; Accepted for publication March 16, 2010

Abstract—(Cytosine�5)�DNA methyltransferase SsoII (M.SsoII) has a long N�terminal region (1–71 resi�dues) preceding the sequence with conservative motifs, which are characteristic for all DNA methyltrans�ferases of such kind. The presence of this region provides M.SsoII capability to act as a transcription regulatorin SsoII restriction–modification system. To perform its regulatory function, M.SsoII binds specifically to a15�mer inverted repeat in the promoter region of SsoII restriction–modification system genes. In the presentwork, properties of the protein Δ(72–379)M.Ecl18kI are studied, which is a deletion mutant of the SsoII�likeDNA�methyltransferase M.Ecl18kI and is homologous to M.SsoII N�terminal region. Δ(72–379)M.Ecl18kI capability to bind specifically a DNA duplex containing the regulatory site is demonstrated.However, such a binding takes place only in the presence of high protein excess relative to DNA, which couldindicate an altered structure in the deletion mutant in comparison with the full�length M.SsoII. Circular dichroismspectroscopy demonstrated that Δ(72–379)M.Ecl18kI has a strongly pronounced secondary structure and con�tains 32% α�helices and 20% β�strands. Amino acid sequences alignment of M.SsoII N�terminal region and tran�scription factors of known spatial structure is made. An assumption is made how α�helices and β�strands arearranged in M.SsoII N�terminal region.

DOI: 10.1134/S0026893310050183

Key words: DNA methyltransferase, transcription factor, deletion mutant, DNA–protein interactions, pro�tein secondary structure, circular dichroism.

UDC 577.322.52, 577.152.211

STRUCTURAL–FUNCTIONAL ANALYSIS OF BIOPOLYMERS AND THEIR COMPLEXES

808

MOLECULAR BIOLOGY Vol. 44 No. 5 2010

RYAZANOVA et al.

5'�CCNGG�3'/3'�GGNCC�5' (N = A, C, G, T) andmethylate the C5 atom of the inner cytosine residues[3, 4]. M.SsoII and M.Ecl18kI also bind with a quasi�palindromic sequence 5'�AGGACAAATTGTCCT�3'/3'�TCCTGTTTAACAGGA�5', which was identifiedearlier as the regulatory site [5, 6]. The amino acidsequences of these proteins differ in one residue –Ile56 in M.SsoII, Met56 in M.Ecl18kI.

Besides these two, there are three other SsoII�likeR–M systems found in different bacterial strains:Kpn2kI from Klebsiella pneumoniae 2k [7], StyD4Ifrom Salmonella typhi D4 [8], SenPI from Salmonellaenteritidis P1 [9]. The RE and MTase genes are placeddivergently in all the SsoII�like R–M systems, theirnucleotide sequences share 99% similarity, and thecorresponding proteins differ in 1–2 amino acid resi�dues. The only sufficient difference of the SenPI R–Msystem is the deletion of one nucleotide in 3'�terminalregion of the RE gene which leads to the early transla�tion termination. As a result, the protein is inactive [9].The existence of the SsoII�like R–M systems in thedifferent strains is likely to be a result of the plasmidexchange between the genera followed by plasmidrearrangements and mutations.

The MTase interaction with the R–M systemintergenic region has been studied in detail only forM.SsoII. The M.SsoII N�terminal region (residues1–71) was shown to provide the interaction with theregulatory site [10]. A helix–turn–helix (HTH) struc�tural motif, typical for many DNA�binding proteins,was predicted in the N�terminal region [5].

The aim of this work was the determination of thesecondary structure in the N�terminal region of SsoII�like MTases, taking as an example Δ(72–379)M.Ecl18kI—a deletion mutant of M.Ecl18kI.For the purpose of comparison, the structures of the“M.Ecl18kI natural mutants”—M.SsoII andM.NlaX were also characterized, for which purifica�tion protocols were optimized to obtain the amount ofprotein necessary for the structural studies. Here weshow that Δ(72–379)M.Ecl18kI is capable of bindingspecifically the DNA duplex containing the M.SsoIIregulatory site. Using circular dichroism (CD) spec�troscopy, it was found that Δ(72–379)M.Ecl18kI has apronounced secondary structure consisting of α�heli�ces and β�strands. On the basis of the amino acidsequences comparison, an assumption is made thatthe α�helical fragment in the M.SsoII N�terminalregion corresponds to the first three α�helices of C�proteins and contains the HTH motif.

EXPERIMENTAL

Plasmids used in this work were constructed earlier[6, 11]. The proteins were expressed in Escherichia coliM15[pRep4] cells. The recombinant proteins carriedthe N�terminal His tags: MetArgGly�Ser(His)6ThrAspProLeuGluThrCys (M.SsoII), MetArg�GlySer(His)6ThrAspHisArg (M.NlaX) or MetArgGly�

Ser(His)6GlySer (Δ(72–379)M.Ecl18kI). Traditionally,the His tag influence onto the protein structure is con�sidered little, which has been corroborated by theanalysis of the crystallized proteins [12]. Δ(72–379)M.Ecl18kI was purified by affinity chromatogra�phy on Ni�sepharose (GE Healthcare, USA),M.SsoII and M.NlaX were purified by affinity chro�matography on heparin�sepharose followed by Ni�sepharose. Buffer exchange in the protein samples wasperformed by gel�filtration on NAP�10 columns (GEHealthcare, USA).

Oligonucleotides 5'�ACGTTCATAATTGGA�ATCAAAACAGGACAAATTGTCCTAAAACCAAC�ACTTAATTCTGGT�3' (60regF), 5'�ACCAGA�ATTAAGTGTTGTAGGACAATTTGTCCTGTTTT�GATTCCAATTATGAACGT�3' (60regR), 5'�GACTT�ACAGTTGATAGATCAGTACTAATTAGCATTAT�AAAGGATCATACTCATGTACTTG�3' (60octF) and5'�CAAGTACATGAGTATGATCCTTTATAATGCT�AATTAGTACTGATCTATCAACTGTAAGTC�3'(60octR) were purchased in IBA GmbH (Germany).

Oligonucleotides concentrations were measuredspectrophotometrically. Oligonucleotides were 32P�labeled using T4 polynucleotide kinase (10 units (U.);Fermentas, Lithuania) and [γ�32P]ATP in 10 μl50 mM Tris�HCl buffer (pH 7.6) containing 10 mMMgCl2, 5 mM DTT, 0.1 mM spermidine, and 0.1 mMEDTA for 30 min at 37°С. [γ�32P]ATP excess wasremoved by gel�filtration on Illustra MicroSpin G�25columns (GE Healthcare, USA). Radioactivity of32P�labeled preparations was determined by the Cher�enkov method as counts per minute on a Tracor Ana�lytic Delta 300 counter (ThermoQuest/CE Instru�ments, USA).

Solutions of DNA duplexes were prepared by mixingequimolar amounts of the complementary oligonucle�otides. 32P�labeled duplexes with known specificradioactivity were obtained by adding corresponding32P�labeled oligonucleotide to a certain amount ofDNA duplex. The mixture was heated to 90°С andslowly cooled to room temperature for annealing.

Δ(72–379)M.Ecl18kI and M.SsoII complex for�mation with DNA duplexes containing 32P�label in oneof the strands was performed in 10 μl 50 mM Tris�HClbuffer (pH 7.5) containing 100 mM NaCl, 5 mM2�mercaptoethanol, 500 μM S�adenosyl�L�homocys�teine and different amounts of heparin with molecularmass 16 kDa (from 50 ng/μl to 5 μg/μl) for 30 min at37°С. Δ(72⎯379)M.Ecl18kI–DNA complexes andfree DNA duplex were separated by gel electrophoresisin flat 200 × 200 × 1.0 mm polyacrylamide gel (PAAG)containing from 10 to 13% acrylamide and N,N'�bis�acrylamide (acrylamide : N,N'�bis�acrylamide =19 : 1). M.SsoII–DNA complexes and free DNAduplex were separated by gel electrophoresis in flat200 × 200 × 1.5 mm PAAG containing from 7 to 10%acrylamide and N,N’�bis�acrylamide (acrylamide :N,N’�bis�acrylamide = 19 : 1). Electrophoresis wasperformed in TBE�buffer (50 mM Tris�borate

MOLECULAR BIOLOGY Vol. 44 No. 5 2010

SECONDARY STRUCTURE OF M.SsoII N�TERMINAL REGION 809

(pH 8.3), 1 mM EDTA) at 15 mA. Radioactive bandscorresponding to the DNA fragments were detectedusing FLA�3000 (Fujifilm, Japan). In order to visual�ize protein bands, gels were stained with the PageBluesolution (Fermentas, Lithuania).

Determination of DNA–protein complexes stoichi�ometry. Gel retardation assay was used with proteins –molecular mass markers for non�denaturing electro�phoresis (Sigma, USA): α�lactalbumin (14200 Da),carbonic anhydrase (29000 Da), ovalbumin (45000 Da),and bovine serum albumin (BSA; monomer – 66000 Da).Experimental procedures and data processing wereperformed according the manufacturer’s recommen�dations. The relative mobility (Rf) was determined forevery protein and DNA–protein complex as a ratio ofthe protein or the complex migration distance to thetracking dye (bromophenol blue) migration distance.Then a plot was made of [100 × × 100)] valuedependence on the gel percentage and the slope of theobtained line was calculated. Then a calibrating graphwas made using the data of the marker proteins—dependence of the negative slope on the molecularmass (in logarithmic coordinates). Using this graph,the molecular mass of the DNA–protein complexeswas estimated.

CD spectra were registered on J�815 CD Spec�trometer (JASCO, Japan). Measurements were per�formed at 20°С in a quartz cuvette with 1 mm opticalpath in 50 mM Na�phosphate buffer (pH 8.0) con�taining 50 mM Na2SO4. The solution volume was200 μl. The protein samples with the following con�centrations were used: 2.2 μM M.SsoII, 2.3 μMM.NlaX, 8.3 μM Δ(72–379)M.Ecl18kI. The second�ary structure was calculated using CONTINLL mod�ule of CDPro program [13].

The protein secondary structure prediction by theamino acid sequence was made using PSIPRED pro�gram [14, 15]. The results of this prediction virtuallymatch with the secondary structure arrangement inthe M.SsoII model [16], built by its sequence similar�ity with the sequences of (cytosine�5)�DNA MTasesHhaI and HaeIII (in the region responsible for meth�ylation) and phage repressors (in the N�terminalregion), for which the 3D structures were determined.

Amino acid sequences comparison was performedusing Clusta1W program [17] followed by manualoptimization.

RESULTS AND DISCUSSION

Ten conservative amino acid motifs can be distin�guished in the primary structure of the (cytosine�5)�DNA MTases, they are arranged in a strictly definedorder along the sequence [18]. More than 300(cytosine�5)�DNA MTases have been characterizedup to date, 67 of which contain a prolonged N�termi�nal region preceding the first conservative motif.According to Pfam (http://pfam.sanger.ac.uk/), the

Rf(log

HTH structural motif (HTH_3, Pfam familyPF01381) is predicted in this region for 18 DNAMTases. However, experimental evidence of the regu�latory function (i.e. capability to regulate the expres�sion of its own gene) exists only for 6 proteins(M.MspI, M.EcoRII, M.ScrFI, M.LlaJI, M.SsoII,and M.Ecl18kI) [1, 2]. We have shown the direct par�ticipation of the M.SsoII N�terminal region in theregulation of the SsoII R–M system genes expression[10]. The presence of the HTH_3 domain is typical formany transcription regulators, including in particularC�proteins—relatively short polypeptides (68–104residues) which control gene expression in many R–Msystems.

The Deletion Mutant Δ(72⎯379)M.Ecl18kI is Capable to Bind the Regulatory Site in DNA

The deletion mutant Δ(72⎯379)M.Ecl18kI wasused in order to study the structural and functionalfeatures of the N�terminal region of the SsoII�likeDNA MTases. It has a low affinity to the 31�bp DNAduplex containing the regulatory site [6] and can notregulate gene expression in the SsoII R–M system(unpublished data). It was shown that complexes ofΔ(72–379)M.Ecl18kI with DNA can be obtainedunder certain conditions (Fig. 1a). A longer, 60�bp,DNA duplex (60reg) containing the regulatory site(underlined) was used for this purpose:

5'�ACGTTCATAATTGGAATCAAAACAGGACAA�ATTGTCCTAAAACCAACACTTAATTCTGGT�3'/

3'�TGCAAGTATTAACCTTAGTTTTGTCCTGTTTA�ACAGGATTTTGGTTGTGAATTAAGACCA�5' 60reg

The complex of Δ(72–379)M.Ecl18kI with thisduplex can be separated from free DNA in a 12%PAAG (Fig. 1a). Only non�specific binding is observedin the absence of heparin or in the presence of its littleamounts. The addition in 2�times and higher molarexcess of heparin over protein resulted in the forma�tion of a specific complex between Δ(72–379)M.Ecl18kI and the regulatory site. No DNA–protein complexes were detected in a control experi�ment with the DNA duplex 60oct which does not con�tain a recognition site (data not shown):

5'�GACTTACAGTTGATAGATCAGTACTAAT�TAGCATTATAAAGGATCATACTCATGTACTTG�3'/

3'�CTGAATGTCAACTATCTAGTCATGATTAATCG�TAATATTTCCTAGTATGAGTACATGAAC�5' 60oct.

Noteworthy, M.SsoII also interacts non�specifi�cally with the 60reg DNA duplex (Fig. 1b). In contrastto Δ(72–379)M.Ecl18kI, M.SsoII forms two specificcomplexes in the presence of heparin.

Complex formation between Δ(72–379)M.Ecl18kI and the 60reg DNA duplex indicatesthat this deletion mutant has a folded structure. At thesame time, the conditions of the protein binding withthe regulatory site differed significantly: the concen�

810

MOLECULAR BIOLOGY Vol. 44 No. 5 2010

RYAZANOVA et al.

tration ratio for Δ(72–379)M.Ecl18kI and DNA is138 : 1, while that for M.SsoII and DNA is 11.7 : 1.Moreover, only one specific complex was formed inthe case of Δ(72–379)M.Ecl18kI, which can corre�spond to a complex containing either one or two pro�tein subunits.

Determination of the Stoichiometry for the M.SsoII–60reg and Δ(72⎯379)M.Ecl18kI–60reg Complexes

The mobility of proteins and DNA–protein com�plexes in a non�denaturing gel depends on the chargeand hydrodynamic radius of the corresponding parti�cles. A set of experiments with gels containing differ�ent concentrations of polyacrylamide allows deter�mining the contribution of the particle size into itsmobility, regardless of its charge [19]. Making anassumption that all particles of interest are globular,one can use a calibrating curve for the marker proteinsto estimate the molecular mass of the DNA–proteincomplexes under investigation. A similar assumptionis made for the molecular mass determination by thegel�filtration technique [20].

The graphs obtained are shown in Fig. 2. The esti�mated molecular masses of the M.SsoII complexeswith 60reg are 79.7 kDa for the complex with thehigher mobility and 120.0 kDa for the complex withthe lower mobility. The calculated molecular mass ofthe complex consisting of one DNA duplex and oneM.SsoII subunit is 81.8 kDa; the calculated molecularmass of the complex consisting of one DNA duplexand two M.SsoII subunits is 126.7 kDa. The dataobtained indicate that the complex with the higher

mobility contains one M.SsoII subunit, while thecomplex with a lower mobility contains two M.SsoIIsubunits. The experimentally obtained values differfrom the calculated less than 6%.

The mass of the free 60reg DNA duplex was deter�mined in a control experiment. It was 36.3 kDa(instead of the calculated 36.9 kDa, with a discrepancyof 2%). This fact illustrates the applicability of thismethod for the molecular mass determination notonly of proteins.

The mass of the specific complex ofΔ(72⎯379)M.Ecl18kI with 60reg was estimated to be59.8 kDa, which corresponds to the complex contain�ing two Δ(72–379)M.Ecl18kI subunits and one DNAduplex 60reg (the calculated mass is 56.7 kDa, the dis�crepancy is 5%). The calculated mass of the complexcontaining only one Δ(72–379)M.Ecl18kI subunit andone DNA duplex 60reg is 46.8 kDa (the discrepancywith the experimental data is 28%). The accuracy ofthe method is not high, especially for distinguishingthe complexes of 46.8 kDa and 56.7 kDa. However, thelargest discrepancy between the calculated mass of amarker protein and its mass determined from the cali�bration graph is 21%. Hence, we conclude that thecomplex under investigation contains two Δ(72–379)M.Ecl18kI subunits.

The interaction of two Δ(72–379)M.Ecl18kI sub�units with one DNA duplex 60reg is in agreement witha model built before [16]. As follows from the above,Δ(72–379)M.Ecl18kI binds to the regulatory site witha significantly lower affinity in comparison with thefull�length M.SsoII (see also [6]). This differencetogether with the absence of the regulatory function in

C 1 2 3 4 5 6 7 801:5 1:1.8 1.9:1 3.8:1 7.5:1 19:1 1:2 1:1 2:1 4.5:1 13:1 22:1

(a) (b)

C 1 2 3 4 5 6 70 1:5

Non�specific DNA�protein

complexes

Specific DNA�protein

complexes

DNA duplex

Fig. 1. a—Equilibrium binding analysis of Δ(72–379)M.Ecl18kI (16.6 μM) with 5'�32P�labeled DNA duplex 60reg (0.12 μM) inthe presence of heparin by retardation assay in 12% PAAG in non�denaturing conditions. Lane C contains free DNA duplex.Lanes 1⎯7 contain 0, 3.1, 9.4, 31.3, 62.5, 125, and 313 μM heparin correspondingly. The ratios of concentrations heparin: Δ(72–379)M.Ecl18kI are given above the lanes. b—Equilibrium binding analysis of M.SsoII (1.4 μM) with 5'�32P�labeled DNA duplex60reg (0.12 μM) in the presence of heparin by retardation assay in 7% PAAG in non�denaturing conditions. Lane C contains freeDNA duplex. Lanes 1–7 contain 0, 0.28, 0.70, 1.4, 2.8, 6.3, 18.7, and 31.3 μM heparin respectively. The ratios of concentrationsheparin : M.SsoII are given above the lanes.

MOLECULAR BIOLOGY Vol. 44 No. 5 2010

SECONDARY STRUCTURE OF M.SsoII N�TERMINAL REGION 811

Δ(72–379)M.Ecl18kI may be due to a partial disrup�tion of the secondary and tertiary structure in the dele�tion mutant, presumably in its N� and C�termini.

Δ(72–379)M.Ecl18kI Secondary Structure

CD spectroscopy was used to characterize the sec�ondary structure of Δ(72–379)M.Ecl18kI. The dataobtained can not substitute an X�ray crystallographicanalysis, however, none of the proteins under investi�gation has been crystallized up to date. The secondarystructure of the full�length M.SsoII and of the(cytosine�5)�DNA MTase NlaX (M.NlaX; a homologueof M.SsoII region responsible for methylation) was alsostudied. M.NlaX can be considered a natural deletion vari�ant of M.SsoII or M.Ecl18kI—Δ(1–72)M.Ecl18kI,since it recognizes in DNA the same methylation site[21] and the amino acid sequences of these proteinsshare 67% of identity (Fig. 3). Besides the spectra ofthe individual proteins, a spectrum was recorded ofM.NlaX and Δ(72–379)M.Ecl18kI equimolar mixture.The processing of this spectrum was performed as for aprotein, the length and the molecular mass of which wouldbe equal to the sum of M.NlaX and Δ(72–379)M.Ecl18kIlengths and molecular masses.

At the first stage of the work, the buffer solution waschanged to be suitable for the protein secondary struc�ture determination by CD spectroscopy. The mostinformative is 190–220 nm region where the radiationis absorbed by carboxylic groups, Cl–, imida�zole, 2�mercaptoethanol, dithiotreitol, and manyother substances, therefore their presence in the bufferis inadmissible [22, 23]. Moreover, the protein sampleshould not contain glycerol. According to theserequirements, Na�phosphate buffer (pH 8.0) was cho�sen. However, M.NlaX denatured in the 50 mM Na�phosphate buffer without salt, therefore sodium sul�fate was added in the buffer up to 50 mM in order toprovide the necessary ionic strength.

The obtained CD spectra are shown in Fig. 4, and thecalculated protein secondary structure is given in the Table.According to the CD data, α�helices constitute 32% of allthe amino acid residues of Δ(72–379)M.Ecl18kI (i.e.26 residues) and 20% of all the residues of M.NlaX(i.e. 65 residues) – giving in total 91 residues, which is23% of M.SsoII and 22% of the M.NlaX mixture withΔ(72–379)M.Ecl18kI. These calculated values corre�late with the experimental results: α�helices constitute23% of M.SsoII residues and 21% of the residues inthe mixture of M.NlaX with Δ(72–379)M.Ecl18kI.An analogous calculation according to the CD datafor M.NlaX and Δ(72–379)M.Ecl18kI demonstratesthat 28% of M.SsoII residues and 27% of residues inthe M.NlaX mixture with Δ(72–379)M.Ecl18kI belongto β�strands, which matches the results of the directmeasurements. These results confirmed that theM.SsoII N�terminal domain and the deletion mutantΔ(72–379)M.Ecl18kI maintain an approximately sim�ilar secondary structure (within the limits of the exper�

NO3–

,

imental error). One should take into account, how�ever, that the contribution of the N�terminal domainto the full�length protein is small: for example, 10% ofresidues in the N�terminal domain form about 2% ofthe full�length M.SsoII.

100 ×

log(

Rf ×

100

)

180

160

140

120

1007 8 109 11 12 13

(a)

Gel, %

α�lactalbumin

ovalbumin

BSA, monomercarbonic anhydrase

100 ×

log(

Rf ×

100

)

180

160

140

120

1007 8 109 11 12 13

(b)

Gel, %

60reg + M.SsoII

60reg

60reg + 2Δ(72⎯379)M.Ecl18kI

60reg + 2M.SsoIIlo

g 2(�

slop

e)

3.5

2.5

1.5

(c)

60reg + M.SsoII

60reg

60reg + 2Δ(72⎯379)M.Ecl18kI

60reg + 2M.SsoII

4.2 4.4 4.6 4.8 5.0 5.2log MM

α�lactalbumin

ovalbumin

BSA, monomer

carbonic anhydrase

Protein markersSamples

3.0

2.0

1.0

Fig. 2. Molecular mass determination for the complexes ofM.SsoII with 60reg and Δ(72–379)M.Ecl18kI with 60reg.Dependence of the value [100 × × 100)] on thePAAG percentage for the marker proteins (a) and for theDNA–protein complexes under investigation (b). Deter�mination of molecular mass of the DNA–protein com�plexes by the calibration plot (c).

Rf(log

812

MOLECULAR BIOLOGY Vol. 44 No. 5 2010

RYAZANOVA et al.

In addition, the secondary structure was predictedfrom the amino acid sequences using the PSIPRED pro�gram and the results were compared with the secondarystructure of homologous proteins—(cytosine�5)�DNAMTases HhaI (M.HhaI) and HaeIII (M.HaeIII). As

seen in Fig. 3, the arrangement of α�helices and β�strandspredicted for M.SsoII and M.NlaX by PSIPRED pro�gram in general match with the correspondingarrangements in M.HhaI and M.HaeIII, which struc�tures had been determined by X�ray crystallography

Δ

M.SsoIIM.NlaXM.HhaIM.HaeIII

( 1)( 1)( 1)( 1)( 1)

Δ

M.SsoIIM.NlaXM.HhaIM.HaeIII

( –)( 90)( 15)( 13)( 2)

Δ

M.SsoIIM.NlaXM.HhaIM.HaeIII

( –)(177)(103)( 99)( 89)

Δ

M.SsoIIM.NlaXM.HhaIM.HaeIII

( –)(266)(188)(186)(175)

Small domain

Δ

M.SsoIIM.NlaXM.HhaIM.HaeIII

( –)(355)(277)(270)(262)

Small domain

Fig. 3. Comparison of primary and secondary structure of the proteins Δ(72–379)M.Ecl18kI (signed as Δ), M.SsoII, M.NlaX,M.HhaI, and M.HaeIII. The α�helices are black on the grey background; the β�strands are white on the black background. Thenumbering of the amino acid residues in Δ(72–379)M.Ecl18kI, M.SsoII, and M.NlaX includes the N�terminal His tag. The sec�ondary structure of Δ(72–379)M.Ecl18kI, M.SsoII, and M.NlaX is predicted by PSIPRED program, the structure of M.HhaI(PDB code: 1hmy) and M.HaeIII (PDB code: 1dct, chain B) is determined by X�ray crystallography [24, 25]. The position of thesmall domain in the M.HhaI and M.HaeIII structures is marked by asterisks.

[Θ],

deg

· cm

2 /dm

ol

16000140001200010000

8000600040002000

0–2000–4000–6000–8000

–10000–12000

190 200 210 220 230 240λ, nm

M.SsoIIM.NlaXΔ(72⎯379)M.Ecl18kIΔ(72⎯379)M.Ecl18kI + M.NlaX

Fig. 4. CD spectra of M.SsoII, M.NlaX, Δ(72–379)M.Ecl18kI and equimolar mixture of M.NlaX with Δ(72–379)M.Ecl18kI.

MOLECULAR BIOLOGY Vol. 44 No. 5 2010

SECONDARY STRUCTURE OF M.SsoII N�TERMINAL REGION 813

[24, 25]. Only the region of the small domain (residues194–275 in M.HhaI, 183–275 in M.HaeIII) is anexception, where the sequence similarity is low sincethe small domain determines the specific DNAsequence recognition while the recognition sites ofM.HhaI and M.HaeIII differ from that of M.SsoIIand M.NlaX.

According to the CD results, Δ(72–379)M.Ecl18kI has a pronounced secondary struc�ture. The protein contains 32% α�helices which is sig�nificantly lower than the predicted value. Moreover,Δ(72–379)M.Ecl18kI contains 20% β�strands whichwere not predicted by PSIPRED program.

The CD analysis for M.NlaX and M.SsoII showedthat the percentage of α�helices and β�strands in thesestructures differed significantly from the secondarystructure predicted by the sequences: the percentageof α�helices was lower than the predicted one, and thatof β�strands is higher. The results of PSIPRED predic�tion agreed with the secondary structure arrangementin M.HhaI and M.HaeIII, excepting the smalldomain. One can assume that α�helices in the smalldomains of M.SsoII and M.NlaX predicted byPSIPRED, which lack analogues in the structures ofM.HhaI or M.HaeIII, indeed do not exist. Consider�ing this, the discrepancy between experimental andcalculated data decreased to 8% for both proteins. Thediscrepancy between the prediction and the CD resultsregarding the β�strands can also be explained by anerror of the prediction in the region of the smalldomain. Indeed, there are 5 β�strands in the smalldomain of M.HhaI (PDB code: 1hmy). It is possiblethat there are several β�strands in the small domains ofM.SsoII and M.NlaX not predicted by PSIPRED. Inthis case, the discrepancy between the predicted andthe experimental data can decrease to 5–10%.

Comparison of Amino acid Sequences of the N�terminal Region of SsoII�like DNA MTases

and of the Transcription Factors

In order to understand how the α�helices and β�strands are arranged in Δ(72–379)M.Ecl18kI, anamino acid sequences alignment was made for thetranscription factors of the HTH_3 family in the Pfamdatabase, for which the structure had been determinedby X�ray crystallography or nuclear magnetic reso�nance (NMR) spectroscopy (Fig. 5). All these pro�teins contain 4–5 α�helices, the second and the thirdforming the HTH motif. This motif is typical for manytranscription factors and DNA binding enzymes. It isdefined traditionally as a segment of 20 residues con�sisting of 2 almost perpendicular α�helices connectedby a β�turn of 4 residues [26]. This region between theα�helices can be longer in some cases [27].

It is seen from Fig. 5 that the highest similarity ofM.SsoII sequence with the HTH_3 family transcrip�tion factors is found in the region of the first 3 α�heli�ces, two of which form an HTH motif—the elementwhich provides the functioning of these proteins,while the third one is necessary for the structure stabi�lization. The position of the HTH motif predicted inM.SsoII structure matches with its position in theother proteins, in spite of the 3 residues insertion in theβ�turn region in the aligned M.SsoII and Δ(72–379)M.Ecl18kI sequences. The same insertion ispresent in the POU domain, which has a fold similarto that of the HTH_3 domains [27]. The total lengthof the first 3 α�helices is 27 residues, or 33% of thetotal Δ(72–379)M.Ecl18kI length, which matches withthe percentage of α�helices detected in this protein byCD spectroscopy. The CD spectroscopy showed alsothat 20% of Δ(72–379)M.Ecl18kI residues belong to β�strands, which is about 16 residues. According to theSCOP database (http://scop.mrc�lmb.cam.ac.uk/scop/), the presence of β�strands is not typical for theHTH_3 domains, which structure had been deter�

Secondary structure of M.SsoII, M.NlaX, Δ(72–379)M.Ecl18kI and equimolar mixture of M.NlaX with Δ(72–379)M.Ecl18kI,determined by CD* and predicted by PSIPRED**

Sample α�Helices, % β�Strands, % Disordered regions, %

Δ(72–379)M.Ecl18kI, 8.3 µM 32 (46) 20 (0) 48 (54)

M.NlaX, 2.3 µM 20 (34) 29 (13) 51 (53)

M.NlaX + Δ(72–379)M.Ecl18kI, 2.0 µM 21 (37) 28 (10) 51 (53)

M.SsoII, 2.2 µM 23 (36) 28 (12) 49 (52)

Notes: * The standard deviation given by CONTINLL was 5–8%. ** The secondary structure predicted by amino acid sequence usingPSIPRED program is given in brackets.

814

MOLECULAR BIOLOGY Vol. 44 No. 5 2010

RYAZANOVA et al.

mined by X�ray crystallography or NMR spectros�copy.

Thus, one can assume on the basis of the CD datathat, in contrast to many other members of theHTH_3 family, only three α�helices of Δ(72–379)M.Ecl18kI are stable in solution while its C�termi�nal region forms a β�layer of 2 or more α�strands viainteraction with the His tag. The absence in Δ(72–379)M.Ecl18kI of an analogue of the fifth α�helix,observed in the HTH_3 family members, is corrobo�rated by the presence of 3 Pro residues in the corre�sponding region. Pro residues are known to be presentmainly in a disordered structure [28].

Analogously to the hydroxypropylphosphonic acidepoxidase structure (PDB code: 2bnm) [29], onecould assume that the disordered region in the full�length M.SsoII, which contains these Pro residues andthe six following residues is a linker which provides theN�terminal region with a certain mobility relative tothe M.SsoII region responsible for methylation. Oneshould also take into account that most of the struc�tures of the HTH_3 family were obtained by X�raycrystallography; and protein conformation in a crystalis obviously more stable than in solution. As a rule, inthe structures of HTH_3 family isolated domainsobtained by NMR spectroscopy, the N� and C�termi�nal segments of a domain have different conforma�tions in different models, which indicates their mobil�ity in solution. In the most of these structures, four α�helices remain stable. However, only three α�helicesare stable in the POU domain structures obtained byNMR spectroscopy (PDB codes: 1pog, 1ocp), andthey contain the HTH motif [30, 31].

The β�strands in Δ(72–379)M.Ecl18kI structureare arranged most probably between the third α�helixand the disordered region and also in the His tag.There is a protein with a similar secondary structureamong the transcription regulators containing the

HTH motif—Cro protein of phage λ (PDB code:6cro) [32]. It contains 3 α�helices and 3 β�strands; thefirst β�strand of 3 residues preceds the α�helices whilethe second and the third β�strands, both 6 residues inlength, are placed after the α�helices. One couldassume approximately the same β�strands arrange�ment in Δ(72–379)M.Ecl18kI.

It is worth mentioning that in the HTH_3 familythere are both rather small C�proteins containing only5 α�helices and large proteins where the HTH motif isincluded in one of several domains. M.SsoII also hassuch a multidomain structure.

Thus, it is shown in the present work that the dele�tion mutant Δ(72–379)M.Ecl18kI under certain con�ditions is capable of forming specific complexes withthe DNA duplex containing the regulatory site. Thisindicates that Δ(72–379)M.Ecl18kI is structured invitro. As shown by CD spectroscopy, it has a pro�nounced secondary structure seemingly similar to thestructure of M.SsoII N�terminal region, at least in thearea of the 3�helix bundle. The secondary structure ofΔ(72–379)M.Ecl18kI determined by CD includes aβ�layer, which is not typical for most of the membersof the same family. A possible explanation of the CDresults is that the β�layer can be formed by the C�ter�minal segment of Δ(72–379)M.Ecl18kI together withthe His tag. The question whether the secondary struc�ture of the deletion mutant matches completely that offull�length M.SsoII N�terminal region requires fur�ther investigation.

ACKNOWLEDGMENTS

The authors are grateful to N.V. Lavrova andA.S. Ershova (Gamaleya Institute of Epidemiologyand Microbiology, Russian Academy of Medical Sci�ences) for plasmids sequencing, to M.V. Zakharovaand A.S. Solonin (Skryabin Institute of Biochemistry

β

СПСM.SsoIIC.AhdIC.BclIP22 C2SinR434 C1434 Crol C1CylR2EDF�1TrRegEcorLHppE

(1y7y)(2b5a)(1adr)(1b0n)(1per)(3cro)

(1lmb)(1utx)(1x57)(1y9q)(1axz)(1zz6)

Fig. 5. Comparison of amino acid sequences of M.SsoII N�terminal region with the sequences of the transcription regulators,structure of which is determined by X�ray crystallography or NMR (the corresponding PDB codes are given in brackets). Theα�helices are in bold; the amino acid residues conservative for 70% and more are on the grey background. The HTH motif posi�tion in the M.SsoII primary structure is marked by asterisks. A putative arrangement of β�strands in the structure of M.SsoII N�terminalregion is marked with letters “β”.

MOLECULAR BIOLOGY Vol. 44 No. 5 2010

SECONDARY STRUCTURE OF M.SsoII N�TERMINAL REGION 815

and Physiology of Microorganisms, Russian Academyof Sciences) for placing Δ(72–379)M.Ecl18kI plasmidat our disposal, to E.M. Ryazanova (Institute of Agri�cultural Biotechnology, Russian Academy of Agricul�tural Sciences) for the protein expression, and toB.S. Mel’nik (Institute of Protein, Russian Academyof Sciences) for consultations during preparation ofthe publication.

The work was supported by Russian Foundation forBasic Research (grant no. 10�04�01578) and by theRFBR�DFG program “International Research Train�ing Groups” (grant nos. 08�04�91973, 08�04�91975,and GRK 1384).

REFERENCES

1. Nagornykh M.O. Bogdanova E.S., Protsenko A.S.,Zakharova M.V., Severinov K.V. 2008. Regulation ofgene expression in a type II restriction�modificationsystem. Russ. J. Genet. 44, 523–532.

2. Protsenko A., Zakharova M., Nagornykh M., Solonin A.,Severinov K. 2009. Transcription regulation of restric�tion�modification system Ecl18kI. Nucleic Acids Res.37, 5322–5330.

3. Nikolskaya I.I., Lopatina N.G., Suchkov S.V., Debov S.S.1985. Site specificity of DNA methylases from Shigella son�nei 47 cells. Biokhimiya. 50, 1694–1700.

4. Denjmukhametov M.M., Brevnov M.G., Zakharova M.V.,Repyk A.V., Solonin A.S., Petrauskene O.V., Gromova E.S.1998. The Ecl18kI restriction�modification system:cloning, expression, properties of the purified enzymes.FEBS Lett. 433, 233–236.

5. Vorob’eva O.V., Vasil’ev S.A., Karyagina A.S.,Oretskaya T.S., Kubareva E.A. 2000. Analysis of DNA�protein contacts in a complex between methyltrans�ferase SsoII and a promoter region of the SsoII restric�tion�modification genes. Mol. Biol. 34, 921–926.

6. Fedotova E.A., Protsenko A.S., Zakharova M.V.,Lavrova N.V., Alekseevskii A.V., Oretskaya T.S., Kary�agina A.S., Solonin A.S., Kubareva E.A. 2009. SsoII�like DNA methyltransferase Ecl18kI: Interactionbetween regulatory and methylating functions.Biokhimiya. 74, 108–116.

7. Zakharova M.V., Beletskaya I.V., Denjmukhametov M.M.,Yurkova T.V., Semenova L.M., Shlyapnikov M.G.,Solonin A. S. 2002. Characterization of pECL18 andpKPN2: A proposed pathway for the evolution of two plas�mids that carry identical genes for a Type II restriction�modification system. Mol. Genet. Genomics. 267, 171–178.

8. Miyahara M., Ishiwata N., Yoshida Y. 1997. StyD4Irestriction�modification system of Salmonella typhi D4:Cloning and sequence analysis. Biol. Pharm. Bull. 20,201�203.

9. Ibáñez M., Alvarez I., Rodríguez�Peña J.M., Rotger R.1997. A ColE1�type plasmid from Salmonella enteritidisencodes a DNA cytosine methyltransferase. Gene. 196,145–158.

10. Karyagina A., Shilov I., Tashlitskii V., Khodoun M.,Vasil’ev S., Lau P.C., Nikolskaya I. 1997. Specific bind�ing of SsoII DNA methyltransferase to its promoterregion provides the regulation of SsoII restriction�

modification gene expression. Nucleic Acids Res. 25,2114–2120.

11. Karyagina A.S., Lunin V.G., Levtchenko I.Ya.,Labbé D., Brousseau R., Lau P.C., Nikolskaya I.I.1995. The SsoII and NlaX DNA methyltransferases:Overproduction and functional analysis. Gene. 157,93–96.

12. Carson M., Johnson D.H., McDonald H., Brouillette C.,Delucas L.J. 2007. His�tag impact on structure. ActaCrystallogr. D. Biol. Crystallogr. 63, 295–301.

13. Sreerama N., Woody R.W. 2000. Estimation of proteinsecondary structure from circular dichroism spectra:comparison of CONTIN, SELCON, and CDSSTRmethods with an expanded reference set. Anal. Bio�chem. 287, 252–260.

14. Jones D. T. 1999. Protein secondary structure predic�tion based on position�specific scoring matrices. J. Mol.Biol. 292, 195–202.

15. Bryson K., McGuffin L.J., Marsden R.L., Ward J.J.,Sodhi J.S., Jones D. T. 2005. Protein structure predic�tion servers at University College London. NucleicAcids Res. 33, W36–W38.

16. Karyagina A.S., Alexeevski A.V., Golovin A.V., Spirin S.A.,Vorob’eva O.V., Kubareva E.A. 2003. Computer mod�eling of complexes of (C5�cytosine)�DNA methyl�transferase SsoII with target and regulatory DNAs. Bio�physics. 48, S45–S55.

17. Thompson J.D., Gibson T.J., Higgins D.G. 2002. Mul�tiple sequence alignment using ClustalW and ClustalX.Curr. Protoc. Bioinform. Chapter 2:Unit 2.3.

18. Kumar S., Cheng X., Klimasauskas S., Mi S., Posfai J.,Roberts R.J., Wilson G.G. 1994. The DNA (cytosine�5)methyltransferases. Nucleic Acids Res. 22, 1–10.

19. Bading H. 1988. Determination of the molecularweight of DNA�bound protein(s) responsible for gelelectrophoretic mobility shift of linear DNA fragmentsexamplified with purified viral myb protein. NucleicAcids Res. 16, 5241–5248.

20. Osterman L.A. 1985. Khromatografiya belkov inukleinovykh kislot (Chromatograpgy of Proteins andNucleic Acids). Moscow: Nauka.

21. Kubareva E.A., Walter J., Karyagina A.S., Vorob’eva O.V.,Lau P.C., Trautner T. 2002. Determination of methyla�tion site of DNA�methyltransferase NlaX by a hybridmethod. Biotechniques. 33, 526–531.

22. Martin S.R., Schilstra M.J. 2008. Circular dichroismand its application to the study of biomolecules. Meth.Cell Biol. 84, 263–293.

23. Kelly S.M., Jess T.J., Price N. C. 2005. How to studyproteins by circular dichroism. Biochim. Biophys. Acta.1751, 119–139.

24. Cheng X., Kumar S., Posfai J., Pflugrath J.W., Roberts R.J.1993. Crystal structure of the HhaI DNA methyltrans�ferase complexed with S�adenosyl�L�methionine. Cell.74, 299–307.

25. Reinisch K.M., Chen L., Verdine G.L., Lipscomb W.N.The crystal structure of HaeIII methyltransferase con�valently complexed to DNA: an extrahelical cytosineand rearranged base pairing. Cell. 82, 143–153.

26. Brennan R.G., Matthews B.W. 1989. The helix�turn�helix DNA binding motif. J. Biol. Chem. 264, 1903–1906.

816

MOLECULAR BIOLOGY Vol. 44 No. 5 2010

RYAZANOVA et al.

27. Luscombe N.M., Austin S.E., Berman H.M., Thorn�ton J.M. 2000. An overview of the structures of protein�DNA complexes. Genome Biol. 1, reviews001.

28. Finkelstein A.V., Ptitsyn O.B. Fizika belka (ProteinPhysics), Moscow: KDU.

29. McLuskey K., Cameron S., Hammerschmidt F.,Hunter W.N. 2005. Structure and reactivity of hydrox�ypropylphosphonic acid epoxidase in fosfomycin bio�synthesis by a cation� and flavin�dependent mecha�nism. Proc. Natl. Acad. Sci. USA. 102, 14221–14226.

30. Cox M., van Tilborg P.J., de Laat W., Boelens R., vanLeeuwen H.C., van der Vliet P.C., Kaptein R. 1995.

Solution structure of the Oct�1 POU homeodomaindetermined by NMR and restrained molecular dynam�ics. J. Biomol. NMR. 6, 23–32.

31. Morita E.H., Shirakawa M., Hayashi F., Imagawa M.,Kyogoku Y. 1995. Structure of the Oct�3 POU�home�odomain in solution, as determined by triple resonanceheteronuclear multidimensional NMR spectroscopy.Protein Sci. 4, 729–739.

32. Albright R.A., Matthews B.W. 1998. Crystal structureof lambda�Cro bound to a consensus operator at 3.0 Åresolution. J. Mol. Biol. 280, 137–151.